DOCSLIB.ORG

Is Intestinal Oxidative Stress Involved in Patients with Compensated Liver Cirrhosis?

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Is Intestinal Oxidative Stress Involved in Patients with Compensated Liver Cirrhosis? 402 Pijls KE, et al. , 2016; 15 (3): 402-409 ORIGINAL ARTICLE May-June, Vol. 15 No. 3, 2016: 402-409 The Official Journal of the Mexican Association of Hepatology, the Latin-American Association for Study of the Liver and the Canadian Association for the Study of the Liver Is intestinal oxidative stress involved in patients with compensated liver cirrhosis? Kirsten E. Pijls,*,*** Daisy M.A.E. Jonkers,*,*** Montserrat Elizalde,*,*** Marie-Jose Drittij-Reijnders,**,*** Guido R. Haenen,**,*** Aalt Bast**,*** Ad A.M. Masclee,*,*** Ger H. Koek*,*** * Division Gastroenterology-Hepatology, Department of Internal Medicine, Maastricht University Medical Center, the Netherlands. ** Department of Toxicology, Maastricht University Medical Center, the Netherlands. *** School for Nutrition, Toxicology and Metabolism (NUTRIM), Maastricht University Medical Center, the Netherlands. ABSTRACT Background. Liver cirrhosis is associated with intestinal epithelial barrier dysfunction, which may be affected by oxidative stress. Studies in cirrhotic rats provided evidence for intestinal oxidative stress, but studies in cirrhotic patients are scarce. We have shown intestinal barrier dysfunction in patients with compensated cirrhosis. Aim. The present study aimed to investigate whether oxidative stress occurs in the intestinal mucosa of compensated cirrhotic patients and may contribute to barrier dysfunction. Material and methods. Oxidative stress was studied in duodenal and sigmoid biopsies from 15 cirrhotic patients and 22 controls by analyzing transcription of genes involved in glutathione and uric acid metabolism using quantitative real-time polymerase chain reaction. Protein levels of glutathione and glutathione disulphide were measured and the glutathione/glutathione disulphide ratio was calculated as mar- ker of oxidative stress. In addition, intestinal myeloperoxidase and fecal calprotectin were determined. Results. Gene transcription of glutathione synthetase and glutathione reductase were significantly different in duodenal and sigmoid biopsies of cirrhotic patients vs. controls, but no alterations were found for other genes nor for glutathione, glutathione disulphide, glutathione/glutathione disulphide ratio and intestinal myeloperoxidase and fecal calprotectin concentrations. Conclusion. This study did not find indications for oxi- dative stress and low-grade inflammation in the small and large intestine of stable compensated cirrhotic patients. Although these preliminary findings need further validation, we found intestinal oxidative stress not to be a major mechanism contributing to epithelial barrier dysfunction in patients with compensated cirrhosis. Key words. Intestine. Epithelial barrier. Glutathione. Inflammation. INTRODUCTION bacteria and bacterial products such as endotoxin into the systemic circulation,8 and thereby contribute to the devel- Cirrhosis is the end stage of chronic liver diseases and opment of cirrhotic complications, such as spontaneous is associated with a high morbidity and mortality. Increas- bacterial peritonitis.9 Epithelial barrier function is regulat- ing evidence indicates that the gastrointestinal (GI) tract ed by intercellular tight junctions (TJ) and adherens junc- plays a role in the development of liver cirrhosis and its tions (AJ). Recently, Assimakopoulos, et al.10 and Du complications. Cirrhosis has been associated with both Plessis, et al.,11 found alterations in the expression of TJ structural and functional alterations in the GI tract, such as proteins in duodenal biopsies of compensated and decom- edema of lamina propria,1 distended intercellular spaces,2 pensated cirrhotic patients. impaired motility,3 changes in microbiota composition4 Oxidative stress is a potential mechanism underlying and dysfunction of the epithelial barrier. Several studies intestinal epithelial barrier dysfunction as it can induce di- have shown an increased intestinal permeability in patients rect epithelial cell damage and disrupt TJ and/or AJ func- with liver cirrhosis.5-7 This may facilitate translocation of tion and structure.12-15 Possible factors causing oxidative Manuscript received: June 05, 2015. Manuscript accepted: August 28, 2015. DOI:10.5604/16652681.1198816. Is intestinal oxidative stress involved in patients with compensated liver cirrhosis? , 2016; 15 (3): 402-409 403 damage in the intestine of patients with cirrhosis include odenoscopy and/or sigmoidoscopy after an overnight fast ingested alcohol,16 changes in intestinal microbiota,4,17,18 without prior bowel cleansing. Mucosal biopsies were intestinal inflammation11,19 and disturbed microcirculation obtained from standardized locations: the second seg- of the intestinal mucosa secondary to portal hyperten- ment of the duodenum and the sigmoid approximately 20 sion.1,20,21 In addition, systemic inflammation and oxida- cm from the anal sphincter, respectively. Biopsies for tive stress as well as oxidative stress inducers produced in gene transcription and protein expression were snap fro- the liver, may be transferred to the intestine via blood and zen in liquid nitrogen and stored at -80 °C until further bile.15,22 These factors together with a decreased antioxi- analyses. Biopsies for histological evaluation of haema- dant status in cirrhotic patients23 may promote intestinal toxylin and eosin (H&E) stained sections by one experi- oxidative damage. enced pathologist, were fixed in 4% formaldehyde and Few studies in rats with carbon tetrachloride (CCl4)- embedded in paraffin. induced cirrhosis have provided evidence for oxidative In addition, subjects collected a fresh fecal sample in a stress in both the small and large intestine, by e.g. in- sterile container. Aliquots were stored within 12 h after creased xanthine oxidase (XO) activity, increased malond- defecation at -80 °C until further analysis. ialdehyde (MDA) levels, and alterations in antioxidant The study has been approved by the Medical Ethics status, such as low levels of reduced glutathione (GSH) Committee of Maastricht University Medical Center and high levels of glutathione disulphide (GSSG).13,24-26 (MUMC), conducted according to the revised version of So far, one recently published study has assessed mucosal the Declaration of Helsinki (October 2008, Seoul) and proliferation, apoptosis and oxidative stress in duodenal registered at the US National Library of Medicine (http:// biopsies of patients with cirrhosis and found a significantly www.clinicaltrials.gov, NTC01081236). All subjects (pa- increased intestinal lipid peroxidation (i.e. lipid tients and healthy volunteers) gave their written informed hydroperoxides) as well as increased plasma endotoxin consent before participation. concentrations.27 In a previous study we have investigated the intestinal Transcription of epithelial barrier function in patients with compensated oxidative stress-related genes liver cirrhosis in order to find out whether an increased intestinal permeability may be a risk factor for the pro- Transcription of genes involved in glutathione (GSH) gression towards decompensated cirrhosis and observed and uric acid metabolism, i.e. glutamate-cysteine ligase, cat- an increased small intestinal permeability in a subgroup of alytic subunit (GCLC), glutamate-cysteine ligase, modifier patients with alcohol-related cirrhosis and an increased subunit (GCLM), glutathione synthetase (GS), glutathione large intestinal permeability in the whole group of com- peroxidases (GPX1, GPX2 and GPX3), glutathione reduct- pensated cirrhotic patients.28 ase (GR), and xanthine dehydrogenase (XDH), in mucosal We hypothesized that intestinal oxidative stress is in- biopsies were determined by qRT-PCR. Total RNA was volved in the epithelial barrier dysfunction of patients with isolated from the frozen biopsies using TRIzol reagent compensated liver cirrhosis. Aim of the present study was (Invitrogen, Carlsbad, USA) and purified with the RNe- therefore to investigate the occurrence of oxidative stress asy Mini Kit (Qiagen, Venlo, the Netherlands). The con- not only in the mucosa of the small, but also of the large in- centration of purified RNA was measured with the testine in patients with compensated cirrhosis and to com- NanoDrop. Finally, 500 ng total RNA was used as a pare data with those obtained in healthy controls. template for the cDNA reaction, which was synthesized using the iScriptcDNA Synthesis Kit (Bio-Rad, MATERIAL AND METHODS Veenendaal, the Netherlands). The cDNA was diluted to a concentration of 4 ng/μL. Each reaction contained 5 μL Patients and study design cDNA template solution, 12.5 μL iQ SYBR Green Supermix (Bio-Rad), 1 μL forward and reverse primers A subgroup of compensated cirrhotic patients (i.e. (10 μM) and 5.5 μL sterile water. Primer sequences have without clinically evident complications, including as- been listed in table 1. Housekeeping genes included cites, variceal hemorrhage, hepatic encephalopathy and/ were 18S rRNA and glyceraldehyde-3-phosphate dehy- or jaundice) and a control group of healthy volunteers drogenase (GAPDH). Reactions were run on the My IQ participating in a prior prospective case-control study on Single Color RT-PCR Detection System (Bio-Rad). intestinal permeability were available for analyses of in- PCR conditions used were 3 min at 95 °C, followed by testinal oxidative stress. The design and clinical details 40 amplification cycles of 10 sec at 95 °C and 45 sec at of the study have been described elsewhere.28 Briefly, 15 60 °C. Data were expressed as normalized expression
Load more

Recommended publications
  • MPO) in Inflammatory Communication
    antioxidants Review The Enzymatic and Non-Enzymatic Function of Myeloperoxidase (MPO) in Inflammatory Communication Yulia Kargapolova * , Simon Geißen, Ruiyuan Zheng, Stephan Baldus, Holger Winkels * and Matti Adam Department III of Internal Medicine, Heart Center, Faculty of Medicine and University Hospital of Cologne, 50937 North Rhine-Westphalia, Germany; [email protected] (S.G.); [email protected] (R.Z.); [email protected] (S.B.); [email protected] (M.A.) * Correspondence: [email protected] (Y.K.); [email protected] (H.W.) Abstract: Myeloperoxidase is a signature enzyme of polymorphonuclear neutrophils in mice and humans. Being a component of circulating white blood cells, myeloperoxidase plays multiple roles in various organs and tissues and facilitates their crosstalk. Here, we describe the current knowledge on the tissue- and lineage-specific expression of myeloperoxidase, its well-studied enzymatic activity and incoherently understood non-enzymatic role in various cell types and tissues. Further, we elaborate on Myeloperoxidase (MPO) in the complex context of cardiovascular disease, innate and autoimmune response, development and progression of cancer and neurodegenerative diseases. Keywords: myeloperoxidase; oxidative burst; NETs; cellular internalization; immune response; cancer; neurodegeneration Citation: Kargapolova, Y.; Geißen, S.; Zheng, R.; Baldus, S.; Winkels, H.; Adam, M. The Enzymatic and Non-Enzymatic Function of 1. Introduction. MPO Conservation Across Species, Maturation in Myeloid Progenitors, Myeloperoxidase (MPO) in and its Role in Immune Responses Inflammatory Communication. Myeloperoxidase (MPO) is a lysosomal protein and part of the organism’s host-defense Antioxidants 2021, 10, 562. https:// system. MPOs’ pivotal function is considered to be its enzymatic activity in response to doi.org/10.3390/antiox10040562 invading pathogenic agents.
    [Show full text]
  • In Thyroid Cancer
    Metere et al. Cancer Cell Int (2018) 18:7 https://doi.org/10.1186/s12935-018-0504-4 Cancer Cell International PRIMARY RESEARCH Open Access A possible role for selenoprotein glutathione peroxidase (GPx1) and thioredoxin reductases (TrxR1) in thyroid cancer: our experience in thyroid surgery Alessio Metere1* , Francesca Frezzotti1, Claire Elizabeth Graves2, Massimo Vergine1, Alessandro De Luca1, Donatella Pietraforte3 and Laura Giacomelli1 Abstract Background: Oxidative stress is responsible for some alterations in the chemical structure and, consequently, in the function of proteins, lipids, and DNA. Recent studies have linked oxidative stress to cancers, particularly thyroid cancer, but the mechanisms remain unclear. Here, we further characterize the role of oxidative stress in thyroid cancer by analyzing the expression of two selenium antioxidant molecules, glutathione peroxidase (GPx1) and thioredoxin reductase (TrxR1) in thyroid cancer cells. Methods: Samples of both healthy thyroid tissue and thyroid tumor were taken for analysis after total thyroidectomy. The expression of GPx1 and TrxR1 was revealed by Western blot analysis and quantifed by densitometric analy- ses, while the evaluation of free radicals was performed by Electron Paramagnetic Resonance (EPR)-spin trapping technique. Results: Our results show a decrease in the expression of GPx1 and TrxR1 ( 45.7 and 43.2% respectively, p < 0.01) in the thyroid cancer cells compared to the healthy cells. In addition, the EPR− technique− shows an increase of free radicals in tumor tissue, signifcantly higher than that found in healthy thyroid tissue ( 116.3%, p < 0.01). + Conclusions: Our fndings underscore the relationship between thyroid cancer and oxidative stress, showing the imbalance of the oxidant/antioxidant system in thyroid cancer tissue.
    [Show full text]
  • Lncrna-MEG3 Functions As Ferroptotic Promoter to Mediate OGD Combined High Glucose-Induced Death of Rat Brain Microvascular Endothelial Cells Via the P53-GPX4 Axis
    LncRNA-MEG3 functions as ferroptotic promoter to mediate OGD combined high glucose-induced death of rat brain microvascular endothelial cells via the p53-GPX4 axis Cheng Chen Xiangya Hospital Central South University Yan Huang Xiangya Hospital Central South University Pingping Xia Xiangya Hospital Central South University Fan Zhang Xiangya Hospital Central South University Longyan Li Xiangya Hospital Central South University E Wang Xiangya Hospital Central South University Qulian Guo Xiangya Hospital Central South University Zhi Ye ( [email protected] ) Xiangya Hospital Central South University https://orcid.org/0000-0002-7678-0926 Research article Keywords: lncRNA-MEG3, p53, ferroptosis, ischemia, GPX4, OGD, hyperglycemia, Posted Date: May 18th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-28622/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/21 Abstract Background Individuals with diabetes are exposed to a higher risk of perioperative stroke than non- diabetics mainly due to persistent hyperglycemia. lncRNA-MEG3 (long non-coding RNA maternally expressed gene 3) has been considered as an important mediator in regulating ischemic stroke. However, the functional and regulatory roles of lncRNA-MEG3 in diabetic brain ischemic injury remain unclear. Results In this study, RBMVECs (the rat brain microvascular endothelial cells) were exposed to 6 h of OGD (oxygen and glucose deprivation), and subsequent reperfusion via incubating cells with glucose of various high concentrations for 24 h to imitate in vitro diabetic brain ischemic injury. It was shown that the marker events of ferroptosis and increased lncRNA-MEG3 expression occurred after the injury induced by OGD combined with hyperglycemic treatment.
    [Show full text]
  • A Machine Learning Tool for Predicting Protein Function Anna
    The Woolf Classifier Building Pipeline: A Machine Learning Tool for Predicting Protein Function Anna Farrell-Sherman Submitted in Partial Fulfillment of the Prerequisite for Honors in Computer Science under the advisement of Eni Mustafaraj and Vanja Klepac-Ceraj May 2019 © 2019 Anna Farrell-Sherman Abstract Proteins are the machinery that allow cells to grow, reproduce, communicate, and create multicellular organisms. For all of their importance, scientists still have a hard time understanding the function of a protein based on its sequence alone. For my honors thesis in computer science, I created a machine learning tool that can predict the function of a protein based solely on its amino acid sequence. My tool gives scientists a structure in which to build a � Nearest Neighbor or random forest classifier to distinguish between proteins that can and cannot perform a given function. Using default Min-Max scaling, and the Matthews Correlation Coefficient for accuracy assessment, the Woolf Pipeline is built with simplified choices to guide users to success. i Acknowledgments There are so many people who made this thesis possible. First, thank you to my wonderful advisors, Eni and Vanja, who never gave up on me, and always pushed me to try my hardest. Thank you also to the other members of my committee, Sohie Lee, Shikha Singh, and Rosanna Hertz for supporting me through this process. To Kevin, Sophie R, Sophie E, and my sister Phoebe, thank you for reading my drafts, and advising me when the going got tough. To all my wonderful friends, who were always there with encouraging words, warm hugs, and many congratulations, I cannot thank you enough.
    [Show full text]
  • SUPPLEMENTARY DATA Supplementary Figure 1. The
    SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary
    [Show full text]
  • Thiol Peroxidases Mediate Specific Genome-Wide Regulation of Gene Expression in Response to Hydrogen Peroxide
    Thiol peroxidases mediate specific genome-wide regulation of gene expression in response to hydrogen peroxide Dmitri E. Fomenkoa,1,2, Ahmet Koca,1, Natalia Agishevaa, Michael Jacobsena,b, Alaattin Kayaa,c, Mikalai Malinouskia,c, Julian C. Rutherfordd, Kam-Leung Siue, Dong-Yan Jine, Dennis R. Winged, and Vadim N. Gladysheva,c,2 aDepartment of Biochemistry, University of Nebraska, Lincoln, NE 68588-0664; bDepartment of Life Sciences, Wayne State College, Wayne, NE 68787; dDepartment of Medicine, University of Utah Health Sciences Center, Salt Lake City, UT 84132; eDepartment of Biochemistry, University of Hong Kong, Hong Kong, China; and cDivision of Genetics, Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115 Edited by Joan Selverstone Valentine, University of California, Los Angeles, CA, and approved December 22, 2010 (received for review July 21, 2010) Hydrogen peroxide is thought to regulate cellular processes by and could withstand significant oxidative stress. It responded to direct oxidation of numerous cellular proteins, whereas antioxi- several redox stimuli by robust transcriptional reprogramming. dants, most notably thiol peroxidases, are thought to reduce However, it was unable to transcriptionally respond to hydrogen peroxides and inhibit H2O2 response. However, thiol peroxidases peroxide. The data suggested that thiol peroxidases transfer have also been implicated in activation of transcription factors oxidative signals from peroxides to target proteins, thus activating and signaling. It remains unclear if these enzymes stimulate or various transcriptional programs. This study revealed a previously inhibit redox regulation and whether this regulation is widespread undescribed function of these proteins, in addition to their roles or limited to a few cellular components.
    [Show full text]
  • Micrornas As New Regulators of Neutrophil Extracellular Trap Formation
    International Journal of Molecular Sciences Review MicroRNAs as New Regulators of Neutrophil Extracellular Trap Formation Sonia Águila † , Ascensión M. de los Reyes-García †, María P. Fernández-Pérez, Laura Reguilón-Gallego, Laura Zapata-Martínez, Inmaculada Ruiz-Lorente, Vicente Vicente , Rocío González-Conejero *,‡ and Constantino Martínez *,‡ Department of Hematology and Medical Oncology, Morales Meseguer University Hospital, Centro Regional de Hemodonación, Universidad de Murcia, IMIB, C/Ronda de Garay S/N, 30003 Murcia, Spain; [email protected] (S.Á.); [email protected] (A.M.d.l.R.-G.); [email protected] (M.P.F.-P.); [email protected] (L.R.-G.); [email protected] (L.Z.-M.); [email protected] (I.R.-L.); [email protected] (V.V.) * Correspondence: [email protected] (R.G.-C.); [email protected] (C.M.); Tel.: +34-968341990 (R.G.-C. & C.M.); Fax: +34-968261914 (R.G.-C. & C.M.) † These authors contributed equally to this work. ‡ These authors shared senior authorship. Abstract: Neutrophil extracellular traps (NETs) are formed after neutrophils expelled their chromatin content in order to primarily capture and eliminate pathogens. However, given their characteristics due in part to DNA and different granular proteins, NETs may induce a procoagulant response linking inflammation and thrombosis. Unraveling NET formation molecular mechanisms as well Citation: Águila, S.; de los as the intracellular elements that regulate them is relevant not only for basic knowledge but also Reyes-García, A.M.; Fernández-Pérez, to design diagnostic and therapeutic tools that may prevent their deleterious effects observed in M.P.; Reguilón-Gallego, L.; several inflammatory pathologies (e.g., cardiovascular and autoimmune diseases, cancer).
    [Show full text]
  • Role of Oxidative Stress and Nrf2/KEAP1 Signaling in Colorectal Cancer: Mechanisms and Therapeutic Perspectives with Phytochemicals
    antioxidants Review Role of Oxidative Stress and Nrf2/KEAP1 Signaling in Colorectal Cancer: Mechanisms and Therapeutic Perspectives with Phytochemicals Da-Young Lee, Moon-Young Song and Eun-Hee Kim * College of Pharmacy and Institute of Pharmaceutical Sciences, CHA University, Seongnam 13488, Korea; [email protected] (D.-Y.L.); [email protected] (M.-Y.S.) * Correspondence: [email protected]; Tel.: +82-31-881-7179 Abstract: Colorectal cancer still has a high incidence and mortality rate, according to a report from the American Cancer Society. Colorectal cancer has a high prevalence in patients with inflammatory bowel disease. Oxidative stress, including reactive oxygen species (ROS) and lipid peroxidation, has been known to cause inflammatory diseases and malignant disorders. In particular, the nuclear factor erythroid 2-related factor 2 (Nrf2)/Kelch-like ECH-related protein 1 (KEAP1) pathway is well known to protect cells from oxidative stress and inflammation. Nrf2 was first found in the homolog of the hematopoietic transcription factor p45 NF-E2, and the transcription factor Nrf2 is a member of the Cap ‘N’ Collar family. KEAP1 is well known as a negative regulator that rapidly degrades Nrf2 through the proteasome system. A range of evidence has shown that consumption of phytochemicals has a preventive or inhibitory effect on cancer progression or proliferation, depending on the stage of colorectal cancer. Therefore, the discovery of phytochemicals regulating the Nrf2/KEAP1 axis and Citation: Lee, D.-Y.; Song, M.-Y.; verification of their efficacy have attracted scientific attention. In this review, we summarize the role Kim, E.-H. Role of Oxidative Stress of oxidative stress and the Nrf2/KEAP1 signaling pathway in colorectal cancer, and the possible and Nrf2/KEAP1 Signaling in utility of phytochemicals with respect to the regulation of the Nrf2/KEAP1 axis in colorectal cancer.
    [Show full text]
  • The C718T Polymorphism in the 3″-Untranslated
    Hypertension Research (2012) 35, 507–512 & 2012 The Japanese Society of Hypertension All rights reserved 0916-9636/12 www.nature.com/hr ORIGINAL ARTICLE The C718T polymorphism in the 3¢-untranslated region of glutathione peroxidase-4 gene is a predictor of cerebral stroke in patients with essential hypertension Alexey V Polonikov1, Ekaterina K Vialykh2, Mikhail I Churnosov3, Thomas Illig4, Maxim B Freidin5, Oksana V Vasil¢eva1, Olga Yu Bushueva1, Valentina N Ryzhaeva1, Irina V Bulgakova1 and Maria A Solodilova1 In the present study we have investigated the association of three single nucleotide polymorphisms in glutathione peroxidase (GPx) genes GPX1 rs1050450 (P198L), GPX3 rs2070593 (G930A) and GPX4 rs713041 (T718C) with the risk of cerebral stroke (CS) in patients with essential hypertension (EH). A total of 667 unrelated EH patients of Russian origin, including 306 hypertensives (the EH–CS group) who suffered from CS and 361 people (the EH–CS group) who did not have cerebrovascular accidents, were enrolled in the study. The variant allele 718C of the GPX4 gene was found to be significantly associated with an increased risk of CS in hypertensive patients (odds ratio (OR) 1.53, 95% confidence interval (CI) 1.23–1.90, Padj¼0.0003). The prevalence of the 718TC and 718CC genotypes of the GPX4 gene was higher in the EH–CS group than the EH-alone group (OR¼2.12, 95%CI 1.42–3.16, Padj¼0.0018). The association of the variant GPX4 genotypes with the increased risk of CS in hypertensives remained statistically significant after adjusting for confounding variables such as sex, body mass index (BMI), blood pressure and antihypertensive medication use (OR¼2.18, 95%CI 1.46–3.27, P¼0.0015).
    [Show full text]
  • Programmed Cell-Death by Ferroptosis: Antioxidants As Mitigators
    International Journal of Molecular Sciences Review Programmed Cell-Death by Ferroptosis: Antioxidants as Mitigators Naroa Kajarabille 1 and Gladys O. Latunde-Dada 2,* 1 Nutrition and Obesity Group, Department of Nutrition and Food Sciences, University of the Basque Country (UPV/EHU), 01006 Vitoria, Spain; [email protected] 2 King’s College London, Department of Nutritional Sciences, Faculty of Life Sciences and Medicine, Franklin-Wilkins Building, 150 Stamford Street, London SE1 9NH, UK * Correspondence: [email protected] Received: 9 September 2019; Accepted: 2 October 2019; Published: 8 October 2019 Abstract: Iron, the fourth most abundant element in the Earth’s crust, is vital in living organisms because of its diverse ligand-binding and electron-transfer properties. This ability of iron in the redox cycle as a ferrous ion enables it to react with H2O2, in the Fenton reaction, to produce a hydroxyl radical ( OH)—one of the reactive oxygen species (ROS) that cause deleterious oxidative damage • to DNA, proteins, and membrane lipids. Ferroptosis is a non-apoptotic regulated cell death that is dependent on iron and reactive oxygen species (ROS) and is characterized by lipid peroxidation. It is triggered when the endogenous antioxidant status of the cell is compromised, leading to lipid ROS accumulation that is toxic and damaging to the membrane structure. Consequently, oxidative stress and the antioxidant levels of the cells are important modulators of lipid peroxidation that induce this novel form of cell death. Remedies capable of averting iron-dependent lipid peroxidation, therefore, are lipophilic antioxidants, including vitamin E, ferrostatin-1 (Fer-1), liproxstatin-1 (Lip-1) and possibly potent bioactive polyphenols.
    [Show full text]
  • Myeloperoxidase-Mediated Platelet Release Reaction
    Myeloperoxidase-Mediated Platelet Release Reaction Robert A. Clark J Clin Invest. 1979;63(2):177-183. https://doi.org/10.1172/JCI109287. Research Article The ability of the neutrophil myeloperoxidase-hydrogen peroxide-halide system to induce the release of human platelet constituents was examined. Both lytic and nonlytic effects on platelets were assessed by comparison of the simultaneously measured release of a dense-granule marker, [3H]serotonin, and a cytoplasmic marker, [14C]adenine. Incubation of platelets with H2O2 alone (20 μM H2O2 for 10 min) resulted in a small, although significant, release of both serotonin and adenine, suggesting some platelet lysis. Substantial release of these markers was observed only with increased H2O2 concentrations (>0.1 mM) or prolonged incubation (1-2 h). Serotonin release by H2O2 was markedly enhanced by the addition of myeloperoxidase and a halide. Under these conditions, there was a predominance of release of serotonin (50%) vs. adenine (13%), suggesting, in part, a nonlytic mechanism. Serotonin release by the complete peroxidase system was rapid, reaching maximal levels in 2-5 min, and was active at H2O2 concentrations as low as 10 μM. It was blocked by agents which inhibit peroxidase (azide, cyanide), 2+ degrade H2O2 (catalase), chelate Mg (EDTA, but not EGTA), or inhibit platelet metabolic activity (dinitrophenol, deoxyglucose). These results suggest that the myeloperoxidase system initiates the release of platelet constituents primarily by a nonlytic process analogous to the platelet release reaction. Because components of the peroxidase system (myeloperoxidase, H2O2) are secreted by activated neutrophils, the reactions described here […] Find the latest version: https://jci.me/109287/pdf Myeloperoxidase-Mediated Platelet Release Reaction ROBERT A.
    [Show full text]
  • MK+10-025-Mouse-Model-For-Inflammatory-Bowel-Diseases
    Intellectual Property (Non-confidential) NATIONAL MEDICAL CENTER AND BECKMAN RESEARCH INSTITUTE Mouse Model for Inflammatory Bowel Diseases DESCRIPTION This is a transgenic double-knockout (DKO) mouse (Gpx1 and Gpx2). Both GPX1 and GPX2 belong to a selenium-dependent glutathione peroxidase (GPXs) family, which are enzymes that are efficient in the reduction of hydroperoxides. Gpx1 is expressed ubiquitously, and Gpx2 is highly expressed in the epithelium of the gastrointestinal (GI) tract. Gpx1/2-DKO mice have early-onset spontaneous ileocolitis beginning around weaning. These mice are an excellent model for human inflammatory bowel diseases (IBD) because they share similar disease etiology, which includes that the disease severity is highly influenced by genetic background, gut microflora, diet, and higher cancer risk in the distal GI tract. Unlike most mouse IBD models which have disrupted genes playing an important role in regulation of adaptive immunity, these Gpx1/2-DKO mice have intact immunity- which resembles human IBD. KEY ASPECTS • Homozygous disruption of both the endogenous Gpx1 and Gpx2 genes. • Disease characteristics include ileitis, colitis, hypothermia, growth retardation, runting, perianal ulceration, diarrhea, wasting syndrome,, IBD histopathology, tumors/cancer in the ileum or colon PUBLISHED DATA • Esworthy RS, Binder SW, Doroshow JH, and Chu FF, Microflora trigger colitis in mice deficient in selenium-dependent glutathione peroxidase and induce Gpx2 gene expression. Biol. Chem. 384: 597- 607, 2003 • Lee D-H, Esworthy RS, Chu, C, Pfeifer GP, and Chu, F-F. Mutation accumulation in the intestine and colon of mice deficient in two intracellular glutathione peroxidases. Cancer Res. 66: 9845-9851, 2006 • Hahn MA, Hahn T, Lee DH, Esworthy RS, Kim B, Riggs AD, Chu F-F, and Pfeifer GP.
    [Show full text]