Inactivation of Glutathione Peroxidase Activity Contributes to UV-Induced Squamous Cell Carcinoma Formation

Research Article

Jennifer Walshe,1 Magdalena M. Serewko-Auret,1 Ngari Teakle,1 Sarina Cameron,1 Kelly Minto,1 Louise Smith,1 Philip C. Burcham,5 Terry Russell,1 Geoffrey Strutton,2 Anthony Griffin,3 Fong-Fong Chu,6 Stephen Esworthy,6 Vivienne Reeve,7 and Nicholas A. Saunders1,4

1Epithelial Pathobiology Group, Cancer Biology Programme, Diamantina Institute for Cancer, Immunology and Metabolic Medicine, University of Queensland, 2Department of Pathology, and 3Transplant Surgery Unit, Princess Alexandra Hospital; 4School of Biomedical Sciences, University of Queensland, Brisbane, Queensland, Australia; 5Pharmacology and Anaesthesiology Unit, School of Medicine and Pharmacology, University of Western Australia, QEII Medical Centre, Nedlands, Western Australia, Australia; 6City of Hope, Duarte, California; and 7Faculty of Veterinary Sciences, Sydney University, Sydney, New South Wales, Australia

Abstract SCC (intraepidermal carcinoma; ref. 3) and a late-stage SCC (3). Cutaneous squamous cell carcinomas (CSCC) are a common In that study, we reported that the most significant and early malignancy of keratinocytes that arise in sites of the skin observable alteration in gene expression was a 10- to 40-fold exposed to excessive UV radiation. In the present study, we induction in the mRNA for glutathione peroxidase 2 (GPX2; ref. 3). showthat human SCC cell lines, preneoplastic solar keratoses This profound and early induction of GPX2 mRNA in SCCs (SK), and CSCC are associated with perturbations in glutathi- suggested that GPX, and by extrapolation aberrant peroxide one peroxidase (GPX) activity and peroxide levels. Specifically, metabolism, may be involved in the early events that contribute to the development of SCC in vivo. we found that two of three SKs and four of five CSCCs, in vivo, were associated with decreased GPX activity and all SKs and The GPXs (GPX1, GPX2, GPX3, and GPX4) are a family of CSCCs were associated with an elevated peroxide burden. peroxidases that use reduced glutathione (GSH) as an electron Given the association of decreased GPX activity with CSCC, donor and catalyze the biotransformation of various organic and we examined the basis for the GPX deficiency in the CSCCs. inorganic peroxides (4). GPX1, GPX2, GPX3, and GPX4 are all Our data indicated that GPX was inactivated by a post- selenocysteine-containing proteins (4). GPX1 is a ubiquitous translational mechanism and that GPX could be inactivated intracellular GPX and is the most predominant of the GPX by increases in intracellular peroxide levels. We next tested isoforms (4). GPX1 can catalyze the removal of inorganic peroxides whether the decreased peroxidase activity coupled with an and lipid peroxides (4). GPX2 is reported to be localized elevated peroxidative burden might contribute to CSCC predominantly to the epithelia of the gastrointestinal tract (5) À/À À/À formation in vivo. This was tested in Gpx1 and Gpx2 and has similar substrate specificities to that of GPX1 (4). GPX3 is a mice exposed to solar-simulated UV radiation. These studies secreted form of GPX and is able to reduce lipid hydroperoxides showed that Gpx2 deficiency predisposed mice to UV-induced (6, 7). GPX4 is an intracellular peroxidase that preferentially CSCC formation. These results suggest that inactivation of catalyses the peroxidation of phospholipid hydroperoxides (8, 9). GPX2 in human skin may be an early event in UV-induced SCC When cells are exposed to stressful or damaging stimuli, they formation. [Cancer Res 2007;67(10):4751–8] generate reactive oxygen species (ROS) in response to the stress signals (10–12). Although ROS are inherently reactive and Introduction damaging, the cells have a suite of cytoprotective enzymes, including GPXs, superoxide dismutases, and catalase, to convert Cutaneous squamous cell carcinoma (CSCC) is a common and ROS into harmless products (4). Defects in these antioxidant sometimes fatal malignancy arising from transformed keratino- enzymes, which can reduce ROS levels and the subsequent cytes of the epidermis. Although excessive exposure to UVA/UVB accumulation of ROS, including peroxides, may contribute to irradiation is considered to be the main etiologic factor in the cancer formation by facilitating macromolecular damage, such as development of CSCC, there is mounting evidence that infection DNA lesions, or stimulating proliferation (13, 14). In this regard, with human papillomavirus subtypes as well as immunoincompe- GPX enzymes would be considered to be tumor preventive. tence may also contribute to CSCC development (e.g., see refs. 1, 2). However, the ability of the GPX enzymes to reduce intracellular In spite of our knowledge of the main causative factors associated peroxides would also suggest that it could act as a procarcinogen with CSCC development, as well as a growing knowledge of the by inhibiting the ability of a cell to undergo peroxide-stimulated molecular defects associated with CSCCs, we still have little apoptosis in response to stressful stimuli (15–17). This is not understanding of how the etiologic factors initiate the transforming unprecedented because GPX1 (16) and GPX2 (17) have both been events in keratinocytes. In an attempt to understand the molecular reported to inhibit stress-induced apoptosis. This potential basis for the initiation of CSCC, we did a gene array study procarcinogenic activity could explain the enhanced skin tumor comparing normal keratinocytes with cells derived from an early incidence in transgenic mice that overexpress Gpx1 (18). Although this apparent paradox (procarcinogen versus tumor preventive) remains unresolved, there are a large number of reports to suggest Requests for reprints: Nicholas A. Saunders, Diamantina Institute for Cancer, Immunology and Metabolic Medicine, University of Queensland, Princess Alexandra that the main function of GPX is that of an antioxidant and tumor Hospital, Ipswich Road, Building 1, R Wing, 4th Floor, Brisbane, Queensland 4102, preventative. For example, (a) Gpx1/Gpx2 double knockout (DKO) Australia. Phone: 61-7-3240-5894; E-mail: [email protected]. I2007 American Association for Cancer Research. mice have an enhanced rate of inflammation-induced intestinal doi:10.1158/0008-5472.CAN-06-4192 cancer (5); (b) human lung and breast cancers frequently contain a www.aacrjournals.org 4751 Cancer Res 2007; 67: (10).May 15, 2007

Materials and Methods Tissue culture. Normal human keratinocytes (HEKs) were isolated and cultured from neonatal foreskins following circumcision as described (23– 25). The maintenance and culture of the epidermal SCC cell line Colo-16 and the tongue-derived SCC cell line SCC25 have also been described previously (26, 27). Due to a deficiency of selenium in the culture medium, the SCC25 and Colo-16 cells were grown in medium supplemented with 50 nmol/L sodium selenite (28). In some instances, cells were treated with A A tert-butylhydroperoxide (700 mol/L final concentration), H2O2 (500 mol/L final concentration), the catalase inhibitor aminotriazole (5 mmol/L final concentration; ref. 29), the peroxidase mimetic ebselen (100 Amol/L final concentration; ref. 30), and the antioxidant DL-a-tocopherol (vitamin E; 1 mmol/L final concentration; ref. 22). RNA isolation and real-time PCR. Total RNA was isolated using Trizol reagent (27) and single-strand cDNA was synthesized (3). Real-time PCR used Platinum SYBR Green qPCR SuperMix UDG (Invitrogen), reactions were amplified on a Rotor-Gene real-time PCR machine, and the data were analyzed using the Rotor-Gene (version 6) software (Corbett). The following primers were used: GPX1, ACGATGTTGCCTGGAACTTT (forward) and TCGATGTCAATGGTCTGGAA (reverse); GPX2, TAAGTGGGCT- CAGGCCTCTCT ( forward) and GGTCATAGAAGGACTTGGCAATG (reverse); GPX3, ACAGGAAGAGCTTGCACCAT (forward) and CTCCTGGTTCCTGTTTTCCA (reverse); GPX4, CAGTGAGGCAAGACC- GAAGT (forward) and CTGCTTCCCGAAGTGGTTAC (reverse); and Actin, GGACCTGACTGACTACCTCA (forward) and AGCTTCTCCTTAATGTCACG (reverse). PCR amplifications were done under the following conditions: denaturation at 94jC for 5 s, annealing at 55jC for 10 s, and extension at 72jC for 15 s. Tissue collection. In the mouse studies, epidermal sheets were isolated À À À À from wild-type (WT) or Gpx1 / /Gpx2 / DKO mice (5) as described (23–25). For human tumor studies, resected tumors were taken from patients (with consent) and the classification of the lesions [i.e., solar Figure 1. GPX1 and GPX2 expression is increased in SCCs in vitro and in vivo. keratoses (SK) or SCC] was made by the staff pathologist. The epithelial A P C RNA was isolated from ( ) proliferating ( ) or confluent ( ) HEKs, Colo-16, sheets were removed (23, 27), and GPX activity assays (Bioxytech GPx-340, or SCC25 cells or from (B) normal epidermis (skin, one patient), preneoplastic SKs (three patients), or neoplastic SCCs (seven patients). Quantitative real-time Oxis International), Western blots, and real-time PCR were done. PCR was done for the expression of GPX1, GPX2, GPX3, and GPX4 isoforms. Antibody production and Western blotting. Isoform-specific rabbit All samples are normalized for actin expression. Columns, mean of triplicate polyclonal antibodies against the COOH-terminal peptides of human GPX1 bars, determinations for each sample; SE. Western blot analysis of GPX1 (IEPDIEALLSQG) and human GPX2 (CDIKRLLKVAI) were generated. or GPX2 protein expression in (C) confluent cultures of HEK, Colo-16, or SCC25 cells or (D) in vivo in foreskin, SKs, or SCC. Expression levels Peptides were synthesized and coupled to keyhole limpet hemocyanin visualized by chemiluminescence. The expression level for a-tubulin is shown (Auspep). Rabbit polyclonal antisera were then generated (Institute of to allow for loading inequalities in (A) and by amido black staining in (B). Medical and Veterinary Sciences, Adelaide, South Australia, Australia) and The numbers in (D) correspond to the same numbered samples in Figs. 2 and 3. tested for cross-reactivity against purified GPX1 and GPX2 peptide (data not shown). Antisera were frozen down in aliquots and used in Western blots as crude antisera at a 1:1,000 dilution. For Western blotting, 20 to 40 Agof protein samples were fractionated by SDS-PAGE on a 12% acrylamide gel. Pro198Leu polymorphism that is associated with reduced GPX For tissue samples, epithelial/tumor sheets were isolated following dispase activity (19, 20); (c) peroxide levels are increased following acute digestion (23, 27). The samples were then placed directly into 200 AL exposure to damaging levels of UV irradiation and tumor reducing buffer [7% glycerol, 0.5 mmol/L EDTA, 1 mmol/L phenyl- promoters; (d) peroxides are generated as intermediates during methylsulfonyl fluoride, 2% SDS, 10 mmol/L DTT, 60 mmol/L Tris-HCl (final pH 6.8)] and boiled for 5 min before freezing at À80jC. For tissue the metabolism of known carcinogens; (e) peroxides are precursors culture cells, the cells were trypsinized and placed directly into reducing to adducts of proteins, lipids, and DNA (21); (f ) the production of buffer, boiled for 5 min, and frozen at À80jC. Immunodetection protocols the highly reactive hydroxyl radical following UV exposure is a have been described previously (31, 32), and normalization for loading direct consequence of increased peroxide levels (22); (g) certain equivalence is provided by immunodetection of a-tubulin levels (T9026; organic peroxides (e.g., benzoyl peroxide and tert-butylhydroper- 1:3,000; Sigma-Aldrich) or amido black staining. oxide) are known tumor promoters (14); and (h) peroxides inhibit Peroxidase activity and peroxide level measurement. The GPX the EGFrec phosphatase resulting in constitutive EGFrec phosphor- activity assay measures GPX1 and GPX2 activity. Briefly, epithelial sheets ylation and activation of this pro-proliferative signaling pathway or cells were homogenized in sample buffer [50 mmol/L Tris (pH 7.5), Â (13). These data would support the hypothesis that GPX enzymes 5 mmol/L EDTA, 1 mmol/L mercaptoethanol] and spun at 2,000 g for 10 j À j are tumor protective. However, data implicating disturbed peroxide min (4 C). The supernatant was then collected and frozen at 80 C until used in the GPX assay. The GPX assay measures NADPH disappearance in metabolism with human cancers have not been reported to date. the presence of glutathione reductase and GSH using tert-butylhydroper- In the present study, we examine the regulation and expression oxide as substrate (BioxyTech). In experiments testing the ability of of GPX isoforms in human skin and examine whether inactivation peroxides to inactivate GPX, we used an in vitro reconstitution assay of GPX activity may be a contributory factor in the development of comprising purified RBC GPX (G4013; Sigma-Aldrich) at a final concentra- UV-induced CSCC. tion of 50 milliunits/mL in the GPX assay buffer. To this was added

Cancer Res 2007; 67: (10).May 15, 2007 4752 www.aacrjournals.org

770 Amol/L tert-butylhydroperoxide for differing times and the GPX activity was subsequently measured. A similar set of experiments was also conducted using HEK extracts as the GPX donor. Intracellular peroxide levels in cultured keratinocytes or the SCC cell lines Colo-16 and SCC25 were estimated using either dihydrorhodamine 123 or 5,6-chloromethyl-2¶,7¶-dichlorodihydrofluorescein diacetate, acetyl ester

(CM-H2DCFDA; Molecular Probes) using a FACSCalibur (Becton Dickinson). Total peroxide levels in normal or tumor epithelial tissue were estimated by measuring horseradish peroxidase–mediated oxidation of phenol red in tissue samples as described (33). KO mouse strains and UV induction protocol. We have previously À À À À generated Gpx1 / and Gpx2 / mice (C57Bl/6J and 129S background; ref. 5). The mice were housed under gold lighting (GEC F40GO tubes) that does not emit UVB radiation. The solar-simulated UV (SSUV) radiation source and protocol have been described (34). For the first week, mice received a daily dose of 0.5 Â minimal erythemal daily dose (MEdD), and for the next 19 weeks, 1.0 Â MEdD daily. At this time, the daily SSUV dose was increased weekly to a final dose in weeks 23 to 27 of 2.5 Â MEdD. Tumor promotion was then accelerated by the topical application of 0.1 mL 0.01% (v/v) croton oil (Sigma-Aldrich)/acetone solution twice weekly for 10 weeks. Tumors began to appear at weeks 35 to 36, and the croton oil applications were discontinued. Each mouse was examined for tumor appearance, and tumors of diameter greater than f1 mm were mapped and counted weekly. At the end of the study, pieces of tumor were collected routinely for histopathologic analysis. Significance of the differences between the genotypes was assayed by the Mantel-Haenszel log-rank assay for tumor incidence and by the balanced ANOVA assay and the Kruskal-Wallis test for tumor multiplicity (34).

Figure 3. Peroxide levels are increased in SCC cells. A, HEKs, SCC25, or Colo-16 cells were incubated with CM-H2DCFDA for 15 min and then trypsinized. Cells were then analyzed by fluorescence-activated cell sorting (FACS) and peroxide levels were estimated. Blank, fluorescence of nonstained cells. Columns, mean of three independent experiments; bars, SE. *, P < 0.05, significantly different to HEK. B, tissue peroxide levels in normal skin, and SCC were measured as described (33). C, plot of tissue peroxidase activity (X axis) versus tissue peroxide levels (Y axis) for the epidermal and SCC samples shown in Figs. 2B and 3B. Note that the patient sample numbers for SCC are the same samples used in Figs. 1D and 2.

Results GPX2 mRNA is selectively induced in SCCs in vitro and in vivo. Analysis of mRNA expression levels for GPX1, GPX2, GPX3, and GPX4 by real-time PCR using RNA derived from proliferative or nonproliferative/differentiated cultures of HEKs, SCC25, or Colo-16 cells indicated that only GPX2 was consistently and significantly increased in the SCC cell lines (Fig. 1A). This elevation was independent of whether the cells were proliferative/undifferentiat- ed or nonproliferative and differentiated. GPX1 mRNA expression was slightly elevated in the Colo-16 cells, whereas GPX3 mRNA expression was elevated in the SCC25 cells and confluent HEKs but not in the Colo-16 cells (Fig. 1A). GPX4 mRNA was modestly Figure 2. GPX activity is reduced in vitro and in vivo. Cellular extracts elevated in the Colo-16 cells and, to a lesser extent, in the SCC25 were prepared from (A) confluent HEKs, Colo-16, or SCC25 cells or from the cells (Fig. 1A). We next determined whether our in vitro findings epithelial component of (B) normal skin, SKs, or SCCs. GPX activity was then estimated using tert-butylhydroperoxide as substrate. A, columns, mean of could be validated in patient lesions. We took three precancerous quadruplicate determinations for three independent experiments; bars, SE. SKs and seven CSCCs from patients and found that, in all three SKs B, columns, mean of triplicate determinations for each sample; bars, SE. *, and in six of seven SCCs, there was a significant and selective P < 0.05, significantly different to HEK or normal. Dashed line, mean value for normal epidermis. Note the patient numbers for SK and SCC are the same increase in GPX2 mRNA (Fig. 1B). A modest increase in GPX1 and patient samples as in Figs. 1D and 3. GPX4 mRNA was also evident in most lesions (Fig. 1B). These data www.aacrjournals.org 4753 Cancer Res 2007; 67: (10).May 15, 2007

Downloaded from cancerres.aacrjournals.org on September 23, 2021. © 2007 American Association for Cancer Research. Cancer Research indicate that the GPX2 mRNA is expressed in keratinocytes and We next examined whether the changes in mRNA and protein that its expression is inducible. These data also show that expression, observed in vitro and in vivo, were reflected by preneoplastic and neoplastic skin lesions are associated with alterations in GPX activity. Figure 2A shows that the GPX activity in altered expression of GPX isoforms. SCC25 and Colo-16 cells was significantly reduced (approximately GPX activity is reduced in SCCs in vitro and in vivo. To 75% and 50%, respectively) relative to the HEK control. Similarly, examine GPX protein expression levels, we focused on GPX1 and we found that two of three SKs and four of five SCCs had GPX2 because earlier studies have shown that GPX3 is a secreted significantly reduced GPX activity compared with normal epider- isoform (6) and GPX4 has a very restricted substrate preference mis (Fig. 2B). Conversely, one of three and one of five SKs and SCCs (8, 9). For these reasons, GPX3 and GPX4 are unlikely to contribute to had elevated GPX activity, respectively (Fig. 2B). These data the intracellular peroxidase activity of HEKs and SCC cells. Western indicate that, although GPX1 and GPX2 mRNA and protein are blot analysis of GPX1 and GPX2 expression in HEKs and SCC cell frequently induced in SCCs, this is not reflected in a corresponding lines indicated that both GPX1 and GPX2 protein were present increase in GPX activity. Indeed, CSCC patients 1, 3, and 5, in which and that there was a modest increase in GPX1 expression in the GPX1 and GPX2 protein was most profoundly induced, had the cancer cell lines compared with normal keratinocytes (Fig. 1C). The most reduced GPX activity. Similarly, the GPX activity in two of induction of protein expression in the cell lines was clearly not as three SKs is significantly less than in normal epidermis, yet the great as for the mRNA induction, which suggests that GPX1 and protein level remains similar. These data, plus the expression/ GPX2 may be subject to complex transcriptional, posttranscrip- activity data for the CSCCs, clearly show that GPX activity does not tional, translational, and/or post-translational processing. In patient correlate with protein expression levels. It could be argued that the SCCs, the levels of protein expression more closely reflected the low levels of GPX1 and GPX2 protein expression in the epidermis mRNA expression profiles. GPX1 was not noticeably induced in or SKs indicate that they do not contribute to the GPX activity preneoplastic SKs but was profoundly elevated in SCCs compared measured in the normal epidermis. However, we have found that with foreskin samples (Fig. 1D). Similarly, GPX2 protein expression GPX activity in WT mouse epidermis is 426 F 41 milliunits/mg À À À À was low in skin and SKs but was elevated in three of four SCCs protein, whereas in Gpx1 / Â Gpx2 / DKO mice (5) the activity (Fig. 1D). Because the assays used only the epithelial component of is reduced to 23 F 40 milliunits/mg protein. These data the tumors, we can exclude the effects of any underlying inter- convincingly show that the combined activity of GPX1 and GPX2 stitium. It should be noted that the SCC and SK sample numbering is likely to account for almost all the GPX activity observed in the in Figs. 2, 3, and 4 relates to the same patient sample throughout. epidermis and that the inactivation of GPX is due to a profound

Figure 4. GPX2 deficiency predisposes mice to UV-induced SCC formation. WT (+/+; n = 16), Gpx1À/À (n = 13), and Gpx2À/À (n = 14) mice were subjected to SSUV protocol as described in Materials and Methods. Tumor incidence rates (A) or tumor multiplicity (B) was plotted as a function of time. *, P < 0.05, significantly different from WT mice. Statistical differences in tumor incidence between WT and Gpx mice were assessed by a Mantel-Haenszel test. Statistical differences in tumor multiplicity between WT and Gpx mice were assessed by the balanced ANOVA and Kruskal-Wallis test. C, gross appearance of tumors on the back of a mouse at the termination of the study. D, histologic section of a tumor at the end of the study. H&E stained. Magnification, Â12.

Cancer Res 2007; 67: (10).May 15, 2007 4754 www.aacrjournals.org

Figure 5. GPX enzyme activity is peroxide sensitive. A, HEKs were treated with 500 Amol/L H2O2, 700 Amol/L tert-butylhydroperoxide (TBH), or 5 mmol/L aminotriazole (AT)for3h.B, Colo-16 cells were left untreated (control) or were treated with 100 Amol/L ebselen or 1 mmol/L DL-a-tocopherol (Vit. E) for 48 h. GPX activity was then estimated. Columns, mean of triplicate samples from at least two experiments; bars, SE. *, P < 0.05, activities that are significantly different from the control group. A and B, numbers above the columns, relative peroxide level (percentage of control) for each condition as estimated by FACS determination of dihydrorhodamine 123 fluorescence. C, HEK extract was used as a source of endogenous GPX activity. To this 780 Amol/L tert-butylhydroperoxide was added for the times shown and then the GPX activity was measured. Columns, mean of triplicate determinations from two experiments; bars, SE. D, purified RBC GPX was used as source of GPX activity in a reconstitution assay in the presence of 780 Amol/L tert-butylhydroperoxide for the times shown. Columns, mean of triplicate determinations from two experiments; bars, SE.

decrease in the specific activity of the GPX1 or GPX2 isoforms. a significant increase in progressive average tumor multiplicity in À À Thus, we show (a) that SCCs in vitro and in vivo possess the Gpx2 / mice (P < 0.0001) compared with WT control. In significantly less GPX activity than their nontransformed counter- contrast, this analysis showed no significant difference (P = 0.16) À À parts, (b) that the reduction of GPX activity is not due to reduced between WT and Gpx1 / mice. Analysis of the time from the start GPX protein expression and, (c) that peroxidase activity is subject of the trial to the time when the tumors reach 1 cm in diameter to post-translational regulation. showed there was no significant difference in the growth rates of À À Reduced GPX activity is associated with elevated peroxide tumors between the WT (48.1 F 10 weeks) and Gpx1 / (51.7 F À À levels. We determined whether GPX deficiency would result in 14.6 weeks) and Gpx2 / mice (52.4 F 9.5 weeks). These data pathologic increases in the total intracellular peroxide burden in unequivocally show that Gpx2 deficiency predisposes mice to SCCs. Formal examination of this question indicated that the UV-induced SCC formation. reduced GPX activity observed in SCC cell lines was associated Intracellular peroxides regulate GPX activity. If GPX with elevated peroxide levels compared with normal HEKs deficiency is a causative event in UV-induced SCC formation, then (Fig. 3A). Moreover, when we examined the peroxide levels in it becomes important to understand the mechanism underlying SCCs, we found that all the lesions were associated with increased GPX inactivation in SCCs. Previous reports have shown that the peroxide levels (Fig. 3B). If one compares the same SCC patient exposure of keratinocytes to exogenously added peroxides can sample number between the figures, it becomes very clear that GPX result in a reduction in GPX activity (29). If true, this would suggest activity is inversely related to peroxide burden (Fig. 3C). Thus, that the reduction in GPX activity we see in the majority of SCCs reduced peroxidase activity is associated with an increased in vitro and in vivo may be a direct result of the elevation in peroxidative burden in the patient lesions. intracellular peroxide levels. To test whether this was plausible, GPX2 deficiency predisposes mice to UV-induced SCC we incubated HEKs with agents that are known to increase formation. To determine whether GPX deficiency could be a peroxide levels (i.e., H2O2, tert-butylhydroperoxide, and amino- causative factor in UV-induced SCC formation, we examined the triazole; Fig. 5A). These experiments were designed to test whether ability of chronic low-dose UVA and UVB exposure to induce SCC the elevation of peroxide levels in a normal keratinocyte could lead À À À À in WT mice or Gpx1 / or Gpx2 / mice (Fig. 4A–D). We selected to the inhibition of GPX activity and thus leave cells vulnerable to low-dose UVA and UVB irradiation protocols similar to those oxidative damage. All of these treatments resulted in elevated implicated in CSCC formation in humans (i.e., SSUV irradiation; peroxide levels (Fig. 5A). Neither H2O2 nor aminotriazole caused a ref. 34). Analysis of tumor incidence by the Mantel-Haenszel test reduction in GPX activity. However, the organic peroxide tert- showed a highly significant increase in the tumor incidence in butylhydroperoxide produced a profound reduction in GPX activity À À the Gpx2 / mice (P < 0.001; n = 14) compared with the WT (Fig. 5A). In a further set of experiments, we treated the GPX- control mice (n = 16; Fig. 4A). In contrast, there was no significant deficient Colo-16 cell line with the peroxidase mimetic ebselen or À À difference (P > 0.05) in tumor incidence between Gpx1 / the antioxidant vitamin E (Fig. 5B). We found that treatment of mice (n = 13) and WT control mice (Fig. 4A). Similarly, balanced Colo-16 cells with ebselen or vitamin E resulted in a reduction ANOVA and the Kruskal-Wallis test for tumor multiplicity revealed in peroxide levels that was accompanied by an increase in GPX www.aacrjournals.org 4755 Cancer Res 2007; 67: (10).May 15, 2007

Downloaded from cancerres.aacrjournals.org on September 23, 2021. © 2007 American Association for Cancer Research. Cancer Research activity (Fig. 5B). These data clearly show (a) that GPX activity can implicated in the formation of CSCCs. These defects commonly be modulated directly/indirectly by conditions that alter peroxide target regulatory molecules involved in the p16-cyclin D-RB-E2F levels, (b) that the reduced GPX activity observed in SCC cells can axis (26, 35–37), the EGFrec-ras-extracellular signal-regulated kinase be reversed by reducing the peroxidative/oxidative burden of the pathway (3, 35, 38), the p53-DNA repair pathways (39, 40), or cell, (c) that the elevated peroxidative burden observed in the SCC telomerase activity (35). The present study now provides the first cells could contribute to the reduction in GPX activity observed direct evidence that disruptions to peroxide and ROS metabolism in the SCCs in vitro or in vivo, and (d) that GPX1/GPX2 may be are direct contributors to UV-induced SCC. Such a conclusion is subjected to redox-sensitive post-translational regulation. entirely consistent with earlier studies, which showed that elevated We next examined whether the ability of organic peroxides to peroxide levels and peroxide-derived reactive intermediates were reduce GPX activity was a direct or indirect effect of tert- associated with UV-induced skin cancers (14, 21) and that butylhydroperoxide addition. Figure 5C shows that the addition antioxidants, such as vitamin E, can inhibit UV-induced CSCC of tert-butylhydroperoxide to HEK extracts did not result in GPX formation (41, 42). Although UV irradiation is known to induce inactivation (Fig. 5C). However, if the HEK extracts were elevations in ROS and the ROS-dependent 7,8-dihydroxyguanine preincubated with tert-butylhydroperoxide for 60 min, there was DNA adduct in skin and CSCC, there is growing acceptance that a significant reduction in GPX activity (Fig. 5C). These data are this is predominantly due to the UVA wavelength component of UV consistent with peroxide-mediated inactivation being mediated by irradiation (35, 43–45). This suggests that the contribution of GPX2 an indirect mechanism. Peroxides are chemically unstable, and so deficiency to UV-induced CSCC may be restricted to the effects of we examined whether the indirect inhibition of GPX activity could UVA wavelengths. This would also suggest that, although the GPX2 be due to the nonenzymatic degradation of tert-butylhydroper- enzyme affords protection from UVA damage, it may not be oxide to a reactive intermediate. To test this, we repeated the protective against UVB-induced effects (43) on CSCC formation. experiments in Fig. 5C using purified GPX1 protein rather than a Interestingly, UVA and UVB are known to modulate local and HEK extract. These experiments gave similar results (Fig. 5D)to systemic immune function (41, 45). Thus, the predisposition of those obtained using the HEK extracts. These data clearly show Gpx2-deficient mice to UV-induced carcinoma formation may be that GPX activity can be inactivated indirectly by organic peroxides attributable to defects in the keratinocytes as well as other cell and that this inhibition can result from the nonenzymatic types. This certainly is the case with inflammation-induced degradation of organic peroxide. intestinal carcinomas in Gpx1/Gpx2-deficient mice (5). The finding that the GPX2 enzyme plays a specific role in protecting the epidermis from UV-induced CSCC formation raises Discussion the obvious question of what is the function of GPX2 in the GPX deficiency and UV-induced CSCC formation. The epidermis. The weight of evidence would suggest that differences present study has shown that human CSCCs are associated with between GPX isoform functions are likely to be dictated by frequent reductions in GPX activity combined with a concomitant differences in substrate specificity or subcellular location of the elevation in intracellular peroxide levels. In addition, our data enzyme. GPX1 is localized to the cytosol and mitochondria, indicate that GPX2 inactivation acts as a predisposing factor for whereas GPX2 is restricted to the cytosol (4, 15), suggesting that UV-induced CSCC formation in vivo. These data indicate that GPX2 differences in subcellular localization are not responsible for the inactivation should join a growing list of genetic and biological GPX2-specific functions. In contrast, there is no data relating to the defects affecting important regulatory pathways that have been identification of endogenous substrates for GPX2 or GPX1. We do

Figure 6. Proposed role for peroxides in regulating GPX activity and peroxide toxicity. In normal keratinocytes (top), stressors lead to an accumulation of peroxides that can be removed by the GPX enzymes. This transient elevation in peroxides can also trigger a positive feedback loop in which elevated peroxides induce GPX2 transcription. If the accumulation of peroxides is too great, this can trigger apoptosis. Chronic exposure to stressors/carcinogens or metabolic defects can lead to a chronic accumulation of peroxides that can induce GPX2 transcription. If this accumulation of peroxides occurs against a background of defective apoptotic control, then the accumulation of peroxides may overwhelm the ability of the cells to detoxify peroxides and the peroxides may then be converted to reactive intermediates that can inactivate the GPX enzymes. Such inactivation would then lead to a chronic state of GPX deficiency and increasing peroxide-mediated damage.

Cancer Res 2007; 67: (10).May 15, 2007 4756 www.aacrjournals.org

know they are both capable of transforming H2O2 or model organic reducing environment in which the oxidation and irreversible peroxide substrates, but the identification of the physiologically or inhibition of newly synthesized (not preexisting irreversibly pathologically relevant substrates for GPX2 is unknown. Clearly, the inhibited) GPX1 or GPX2 would be prevented. This would seem identification of such substrates will give important insights into to be the case, in vitro and in vivo, because if the inhibition of the the role of GPX2 as a tumor protective enzyme in skin. GPX activity were reversible, then it would be reversed under Mechanism of post-translational inactivation of GPX. the reducing conditions used in the assay. This implies that the Because GPX inactivation is associated with CSCC formation, it inactivation of GPX activity observed in the SCC cells is most likely is of considerable interest to identify how the GPX enzymes are to be irreversible in nature and that the only way to recover activity inactivated in CSCC. In this regard, we know that GPX inactivity is is for newly synthesized GPX protein to be made in a reducing not due to mutations in the GPX2/GPX1 transcripts (data not environment (i.e., in the presence of antioxidants). shown) nor to selenium deficiency (all cells cultured in Se2+- Taken together, our data support a model (Fig. 6) in which containing medium). We also showed that GPX transcription and normal keratinocytes are able to maintain intracellular peroxide translation is disrupted in SKs and CSCCs but does not contribute levels via GPX. However, if peroxides are elevated, in response to to the inactivation of GPX activity in SKs and CSCCs. In contrast, stressors, the elevated peroxides then induce GPX2 mRNA (data the inactivation of GPX activity observed in CSCCs and SCC cell not shown) or, if sufficiently high, stimulate apoptosis. In this way, lines clearly involves a post-translational mechanism and is likely the cells are protected from peroxide-mediated macromolecular to be oxidation/peroxidation dependent. For example, it has been damage. However, if the stress stimuli occur in a cell with defective previously reported that GPX activity in keratinocytes can be apoptotic responses (e.g., p53 mutation), then the elevated peroxide reduced by exogenous organic peroxides but not by inorganic levels could lead to the inactivation of GPX activity and the further peroxides (29). Moreover, cysteine-containing and selenocysteine- elevation in damaging reactive intermediates. In this way, it can be containing enzymes are generally considered to be vulnerable to seen that an overwhelming carcinogenic insult may lead to a cycle electrophilic attack (46, 47). Our data extend these earlier of events in which the protective enzymes may be chronically observations by showing that elevations in organic peroxide levels ‘‘inactivated’’ by an overwhelming peroxidative burden. This would can decrease GPX activity and, conversely, that reduction of suggest that defects in apoptosis (e.g., p53 mutation) are an early intracellular peroxide levels can increase endogenous GPX activity. event in keratinocyte transformation followed by disruption to This reversibility would allow for prophylactic pharmacologic peroxide metabolism in preneoplastic lesions (e.g., SKs). This latter interventions in high-risk patient groups (e.g., immunosuppressed event would make cells vulnerable to peroxidative/oxidative patients) to try and prevent CSCC formation. In this regard, the damage and subsequent genetic and epigenetic damage. Such a earlier reports that vitamin E can inhibit UV-induced SCC sequence of events is observed in nontumorigenic p53-deficient formation are entirely consistent with the results of the present HaCaT cells, which can be fully transformed following exposure to study and also support the thesis that an increased peroxidative oxidative stress (49). burden may contribute to UV-induced SCC formation (41, 42). Of particular relevance to the in vivo situation is the observation that the reduced GPX activity in vivo can be reversed by agents that Acknowledgments reduce the oxidative/peroxidative burden. We believe this revers- Received 11/14/2006; revised 2/21/2007; accepted 3/1/2007. Grant support: Principal Research Fellowship awarded by the Garnett Passe and ibility is likely to be at the level of nascent protein synthesis for the Rodney Williams Memorial Foundation (N.A. Saunders) and Australian National following reasons. GPXs have been reported to exist in three forms: Health and Medical Research Council grants 301075 and 455929. (a) a reduced active form, (b) a reversibly inactive form, or (c)an The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance irreversibly inactive oxidized form (48). Therefore, the incubation with 18 U.S.C. Section 1734 solely to indicate this fact. of the cancer cells with ebselen or vitamin E would provide a We thank all the tissue donors who made this work possible.

References 8. Maiorino M, Chu FF, Ursin F, Davies KJA, Doroshow 15. Chu FF, Esworthy RS, Doroshow JH. Role of Se- JH, Esworthy RS. Phospholipid hydroperoxide glutathi- dependent glutathione peroxidases in gastrointestinal 1. Meyer T, Arndt R, Nindl I, Ulrich C, Christophers E, one peroxidase is the 18-kDa selenoprotein expressed in inflammation and cancer. Free Radic Biol Med 2004;36: Stockfleth E. Association of human papillomavirus human tumor cell lines. J Biol Chem 1991;266:7728–32. 1481–95. infections with cutaneous tumors in immunosuppressed 9. Maiorino M, Scapin M, Ursini F, Biasolo M, Bosello V, 16. Gouaze V, Andrieu-Abadie N, Cuvillier O, et al. patients. Transpl Int 2003;16:146–53. Flohe L. Distinct promoters determine alternative Glutathione peroxidase-1 protects from CD95-induced 2. Stockfleth E, Nindl I, Sterry W, Ulich C, Schmook T, transcription of gpx-4 into phospholipid-hydroperoxide apoptosis. J Biol Chem 2002;277:42867–74. Meyer T. Human papillomaviruses in transplant-associ- glutathione peroxidase variants. J Biol Chem 2003;278: 17. Yan W, Chen X. GPX2, a direct target of p63, inhibits ated skin cancers. J Invest Dermatol 2004;30:604–9. 34286–90. oxidative stress-induced apoptosis in a p53-dependent 3. Serewko MM, Popa C, Dahler AL, et al. Alterations in 10. Benhar M, Engelberg D, Levitzki A. ROS, stress- manner. J Biol Chem 2006;281:7856–62. gene expression and activity during squamous cell activated kinases and stress signaling in cancer. EMBO 18. Lu YP, Lou YR, Yen P, et al. Enhanced skin carcinoma development. Cancer Res 2002;62:3759–65. Rep 2002;3:420–5. carcinogenesis in transgenic mice with high expression 4. Arthur JR. The glutathione peroxidases. Cell Mol Life 11. Finkel T, Holbrook NJ. Oxidants, oxidative stress and of glutathione peroxidase or both glutathione peroxi- Sci 2000;57:1825–35. the biology of ageing. Nature 2000;408:239–47. dase and superoxide dismutase. Cancer Res 1997;57: 5. Chu FF, Esworthy RS, Chu PG, et al. Bacteria-induced 12. Hussain SP, Hofseth LJ, Harris CC. Radical causes of 1468–74. intestinal cancer in mice with disrupted Gpx1 and Gpx2 cancer. Nat Rev Cancer 2003;3:276–85. 19. Ratnasinghe D, Tangrea JA, Andersen MR, et al. genes. Cancer Res 2004;64:962–8. 13. Peus D, Vasa RA, Meves A, et al. H2O2 is an important Glutathione peroxidase codon 198 polymorphism 6. Bier C, Voetsch B, Jin RC, Handy DE, Loscalzo J. mediator of UVB-induced EGF-receptor phosphoryla- variant increases lung cancer risk. Cancer Res Determinants of human plasma glutathione peroxidase tion in cultured keratinocytes. J Invest Dermatol 1998; 2000;60:6381–3. (GPx-3) expression. J Biol Chem 2004;279:26839–45. 110:966–71. 20. Ravn-Haren G, Olsen A, Tjonneland A, et al. 7. Esworthy RS, Chu FF, Geiger P, Girotti AW, Doroshow 14. Hanausek M, Walaszek Z, Viaje A, et al. Exposure of Associations between GPX1 Pro198Leu polymorphism, JH. Reactivity of plasma glutathione peroxidase with mouse skin to organic peroxides: subchronic effects erythrocyte GPX activity, alcohol consumption and hydroperoxide substrates and glutathione. Arch Bio- related to carcinogenic potential. Carcinogenesis 2004; breast cancer risk in a prospective cohort study. chem Biophys 1993;307:29–34. 25:431–7. Carcinogenesis 2006;27:820–5. www.aacrjournals.org 4757 Cancer Res 2007; 67: (10).May 15, 2007

21. Gromadzinska J, Wasowicz W. The role of reactive human keratinocytes with peroxides. J Invest Dermatol epidermal growth factor receptor. Carcinogenesis 2006; oxygen species in the development of malignancies. Int J 1993;100:829–33. 27:225–31. Occup Med Environ Health 2000;13:233–45. 30. Nakamura Y, Feng Q, Kumagai T, et al. Ebselen, a 39. Ziegler A, Jonason AS, Leffell DJ, et al. Sunburn and 22. Petersen AB, Gniadecki R, Vicanova J, Thorn T, Wulf glutathione peroxidase mimetic seleno-organic com- p53 in the onset of skin cancer. Nature 1994;372:773–6. HC. Hydrogen peroxide is responsible for UVA-induced pound, as a multifunctional antioxidant. Implication for 40. Giglia-Mari G, Sarasin A. TP53 mutations in human DNA damage measured by alkaline comet assay in inflammation-induced carcinogenesis. J Biol Chem 2002; skin cancers. Hum Mutat 2003;21:217–28. HaCaT keratinocytes. J Photochem Photobiol 2000;59: 277:2687–94. 41. Halliday GM, Bestak R, Yuen KS, Cavanagh LL, 123–31. 31. Wong CF, Barnes LM, Dahler AL, et al. A role for Barnetson R. UVA-induced immunosuppression. Mutat 23. Jones SJ. Dicker AJ, Dahler AL, Saunders NA. E2F as a E2F in the modulation of keratinocyte squamous Res 1998;422:139–45. regulator of keratinocyte proliferation: implications for differentiation: implications for the use of an E2F 42. Thiele JJ, Hsieh SN, Ekanayake-Mudiyanselage S. skin tumour development. J Invest Dermatol 1997;109: inhibitor in squamous cell carcinoma. J Biol Chem Vitamin E: critical review of its current use in cosmetic 187–93. 2003;278:28516–22. and clinical dermatology. Dermatol Surg 2005;31:805–13. 24. Saunders NA, Dicker AJ, Jones SJ, Dahler AL. E2F1 32. Wong CF, Barnes LM, Dahler AL, et al. Sp1 is a 43. Nishigori C, Hattori Y, Toyokuni S. Role of reactive mRNA is destabilized in response to growth inhibitors downstream effector of E2F-mediated suppression of oxygen species in skin carcinogenesis. Antioxid Redox in normal human keratinocytes but not in a squamous squamous differentiation. Oncogene 2005;24:3525–34. Signal 2004;6:561–70. carcinoma cell line. Cancer Res 1998;58:1646–9. 33. Nakamura Y, Murakami A, Ohto Y, Torikai K, Tanaka 44. Agar NS, Halliday GM, Barnetson RC, Ananthaswamy 25. Brinkmann H, Dahler AL, Popa C, et al. Histone T, Ohigashi H. Suppression of tumor promoter-induced HN, Wheeler M, Jones AM. The basal layer in human hyperacetylation induced by histone deacetylase oxidative stress and inflammatory responses in mouse squamous tumors harbors more UVA than UVB finger- inhibitors is not sufficient to cause growth inhibition skin by a superoxide generation inhibitor 1¶-acetoxy- print mutations: a role for UVA in human skin in human dermal fibroblasts. J Biol Chem 2001;276: chavicol acetate. Cancer Res 1998;58:4832–9. carcinogenesis. Proc Natl Acad Sci U S A 2004;101:4954–9. 22491–9. 34. Widyarini S, Domanski D, Painter N, Reeve VE. 45. Ullrich SE. Mechanisms underlying UV-induced 26. Dicker AJ, Popa C, Dahler AL, et al. E2F-1 induces Estrogen receptor signaling protects against immune immune suppression. Mutat Res 2005;571:185–205. proliferation-specific genes and suppresses squamous suppression by UV radiation exposure. Proc Natl Acad 46. Georginou G. How to flip the (redox) switch. Cell differentiation-specific genes in human epidermal Sci U S A 2006;103:12837–42. 2002;111:607–10. keratinocytes. Oncogene 2000;19:2887–94. 35. Boukamp P. Non-melanoma skin cancer: what drives 47. Woo HA, Kang SW, Kim HK, Yang KS, Chae HZ, Rhee 27. Dicker AJ, Serewko MM, Dahler AL, et al. Functional tumor development and progression? Carcinogenesis SG. Reversible oxidation of the active site cysteine of characterization of cultured cells derived from an 2005;26:1657–67. peroxiredoxins to cysteine sulfinic acid. Immunoblot intraepidermal carcinoma of the skin (IEC-1). Exp Cell 36. Pierce AM, Gimenez-Conti IB, Scheider-Broussard R, detection with antibodies specific for the hyperoxidized Res 2000;258:352–60. Martinez LA, Conti CJ, Johnson DG. Increased E2F1 cysteine-containing sequence. J Biol Chem 2003;278: 28. Chu FF, Esworthy RS, Akman S, Doroshow JH. activity induces skin tumours in mice heterozygous and 47361–4. Modulation of glutathione peroxidase expression by nullizygous for p53. Proc Natl Acad Sci U S A 1998;95: 48. Miyamoto Y, Koh YH, Park YS, et al. Oxidative stress selenium: effect on human MCF-7 breast cancer cell 8858–63. caused by inactivation of glutathione peroxidase and transfectants expressing a cellular glutathione peroxi- 37. Khavari PA. Modelling cancer in human skin tissue. adaptive responses. Biol Chem 2003;384:567–74. dase cDNA and doxorubicin-resistant MCF-7 cells. Nat Rev Cancer 2006;6:270–80. 49. Boukamp P, Popp S, Bleuel K, Tomakidi E, Burkle A, Nucleic Acids Res 1990;18:1531–9. 38. El-Abaseri TB, Putta S, Hansen LA. Ultraviolet Fusenig NE. Tumorigenic conversion of immortal 29. Vessey DA, Lee KH. Inactivation of enzymes of the irradiation induces keratinocyte proliferation and epi- human skin keratinocytes (HaCaT) by elevated tempera- glutathione antioxidant system by treatment of cultured dermal hyperplasia through the activation of the ture. Oncogene 1999;18:5638–45.

Cancer Res 2007; 67: (10).May 15, 2007 4758 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 23, 2021. © 2007 American Association for Cancer Research. Inactivation of Glutathione Peroxidase Activity Contributes to UV-Induced Squamous Cell Carcinoma Formation

Jennifer Walshe, Magdalena M. Serewko-Auret, Ngari Teakle, et al.

Cancer Res 2007;67:4751-4758.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/67/10/4751

Cited articles This article cites 49 articles, 19 of which you can access for free at: http://cancerres.aacrjournals.org/content/67/10/4751.full#ref-list-1

Citing articles This article has been cited by 2 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/67/10/4751.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/67/10/4751. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.