DOCSLIB.ORG

Effects of Se-Depletion on Glutathione Peroxidase and Selenoprotein W

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Effects of Se-Depletion on Glutathione Peroxidase and Selenoprotein W CORE Metadata, citation and similar papers at core.ac.uk Provided by Elsevier - Publisher Connector FEBS Letters 579 (2005) 792–796 FEBS 29196 Effects of Se-depletion on glutathione peroxidase and selenoprotein W gene expression in the colon Vasileios Pagmantidisa, Giovanna Bermanob, Stephane Villettea, Iain Broomb, John Arthurc, John Hesketha,* a School of Cell and Molecular Biosciences, University of Newcastle upon Tyne, NE1 7RU, UK b School of Life Sciences, The Robert Gordon University, Aberdeen AB25 1HG, UK c Rowett Research Institute, Bucksburn, Aberdeen AB21 9SB, UK Received 3 September 2004; revised 22 November 2004; accepted 9 December 2004 Available online 27 December 2004 Edited by Lukas Huber tant in determining the level of anti-oxidant protection and Abstract Selenium (Se)-containing proteins have important roles in protecting cells from oxidative damage. This work inves- inflammatory responses in the colon [8]. In addition, supple- tigated the effects of Se-depletion on the expression of the genes mentation with Se above normal intake reduces mortality from encoding selenoproteins in colonic mucosa from rats fed diets of cancer of the colon [2,3], as well as that of lung and prostate. different Se content and in human intestinal Caco-2 cells grown These observations indicate that selenoproteins such as the in Se-adequate or Se-depleted culture medium. Se-depletion pro- GPXs are critical for colon function. However, little is known duced statistically significant (P < 0.05) falls in glutathione per- of how selenoprotein gene expression in colonic cells, particu- oxidase (GPX) 1 mRNA (60–83%) and selenoprotein W mRNA larly in vivo, is regulated by Se availability. (73%) levels, a small but significant fall in GPX4 mRNA (17– The aim of the present work was to investigate how Se- 25%) but no significant change in GPX2. The data show that deficiency modulates expression of a range of selenoprotein SelW expression in the colon is highly sensitive to Se-depletion. genes in the rat colon and a human gastrointestinal cell line. Ó 2004 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. Since patterns of selenoprotein activity are accompanied by altered patterns of mRNA abundances and both are regu- Keywords: Colon; Glutathione peroxidase; Selenium; lated by Se availability [9,10], our approach was to use a no- Selenoprotein; Caco-2; Gene array vel ÔselenoproteinÕ macroarray to screen for genes affected by Se depletion and then to extend the studies using Northern hybridisation. 1. Introduction 2. Materials and methods The micronutrient selenium (Se) is essential for health [1]. 2.1. DNA probes Low intake of Se has been implicated with the increased inci- The GPX1, GPX4 and glyceraldehyde-3-phosphate dehydrogenase dence of disease and Se supplementation lowered both cancer (GAPDH) probes were 880 bp EcoRI, 814 bp EcoRI, and 780 bp incidence and mortality from cancer [2,3]. Se is present in sev- PstI/XbaI fragments, respectively, as used previously [9]. The human eral proteins, called selenoproteins, as the amino-acid seleno- GPX2 probe (from Prof. R. Brigelius-Flohe) was a 663 bp EcoRI frag- cysteine (Se-cys) [4]. Approximately 30 selenoproteins and up ment [11]. The human GPX1 probe was a 300 bp BamHI/XbaI frag- ment [12] and the human GPX4 probe (from Prof. K. Yagi, Gifu) to 25 selenoprotein genes have been identified in mammals was an 874 bp HindIII/XbaI fragment [13]. The SelW probe (from and they have a variety of biological roles [4]. They include Dr. I. Kim) was a 420 bp BamHI/XhoI fragment corresponding to the glutathione peroxidase family of enzymes, all of which the mouse brain cDNA [14]. The 18S rRNA probe was a 328 bp frag- are involved in the cellÕs antioxidant systems [5], the thiore- ment corresponding to nucleotides 4852–5179 of the human ribosomal RNA sequence [15] cloned into the SrfI site of PCR-Script AMP vec- doxin reductases, which are involved in the redox regulation tor (Stratagene) and excised using KpnI and SacI. of gene expression [6] and a number of recently identified sele- noproteins (e.g., SelX, SelN, SelW, and 15 kDa selenoprotein) 2.2. RNA extraction and Northern hybridisation that are less well characterised [4]. The glutathione peroxidases Total RNA was extracted by the guanidinium thiocyanate/phenol/ include cytosolic glutathione peroxidase (GPX1), gastrointesti- chloroform procedure [16]. Northern blotting was carried out using nal glutathione peroxidase (GPX2), plasma glutathione perox- standard procedures [17] and membranes pre-hybridised for 20 min at 68 °C in 10 ml of QuickHyb solution (Stratagene). 25 ng of idase (GPX3) and phospholipid hydroperoxide glutathione 32 DNA probes was labelled with [ P]dCTP by random priming, as peroxidase (GPX4). described previously [9], and hybridisation carried out for 1 h at The phenotype of knock-out mice lacking GPX1 and GPX2 68 °C. Non-specifically bound probe was removed from membranes includes colon pathology and increased susceptibility to coli- by two washes in 2· SSC (1· SSC = 0.15 M NaCl/0.015 M sodium tis[7], leading to the suggestion that these enzymes are impor- citrate)/0.1% SDS at room temperature for 15 min, followed by one wash in 0.1· SSC/0.1% SDS at 60 °C for 30 min. Specific hybridisation was detected using a Canberra Packard Instantimager for quantification (results for each probe were expressed per unit of *Corresponding author. Fax: +44 0 191 222 8684. hybridisation achieved with the 18S rRNA probe to allow correction E-mail address: [email protected] (J. Hesketh). for any variation between loading of RNA on the gel or transfer to 0014-5793/$30.00 Ó 2004 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2004.12.042 V. Pagmantidis et al. / FEBS Letters 579 (2005) 792–796 793 the nylon membrane) and by autoradiography using Fujifilm Super Table 1 FX at À80 °C. After analysis, membranes were stripped by washing Effects of Se-deficiency on expression of a range of genes detected by in 0.1% SDS for 10 min at 95 °C before rehybridisation to other macroarray probes. Gene name Ratio SeÀ/Se+ 2.3. cDNA expression arrays GPX1 0.46 32P-labelled cDNA probe synthesis from 3.5 lg total RNA and GPX2 1.63 hybridisation to the Atlas Array membranes were performed according GPX3 0.67 to the Atlas cDNA expression Arrays User Manual (BD Biosciences GPX4 0.76 Clontech, Palo Alto, USA). Detection was performed with a phos- SelP 0.90 phorimager (Molecular Dynamics, Phosphorimager Storm 860) using SBP1 Up 24 h and 3 days exposure. Analysis of the results was performed using DbpB 0.94 the AtlasImage v2.7 software (BD Biosciences Clontech) with a specific SPS (SelD) 1.03 grid corresponding to our custom made ‘‘selenoprotein’’ array: the ar- Phospholipase A2 0.95 ray was spotted with all available human selenoprotein cDNAs, Cu/Zn SOD 1.29 cDNAs corresponding to genes whose products are associated with Mn SOD 1.04 Se metabolism or arachidonate metabolism, and a series of standard SOD3 (extracellular) 1.58 housekeeping genes (Table 1 and associated legend). To analyse differ- Glutathione-S-transferase A2 1.50 ential gene expression using the Atlas Array hybridisation, intensity Glutathione-S-transferase A4 2.76 differences were normalised by taking into account changes in the Interleukin 1; b 3.89 housekeeping genes. SelN 0.76 SelW 0.27 SelB (elongation factor) Down 2.4. Cell culture tRNA selenocysteine associated protein 1.20 Stocks of human colon adenocarcinoma cells (Caco-2) were grown SelZ f1 Down at 37 °C in DulbeccoÕs modified EagleÕs medium (with 4.5 g/l glucose TR2 0.73 and Glutamax) supplemented with 10% (v/v) foetal calf serum (Sigma, TR3 1.33 Poole, UK), 60 lg/ml gentamycin, 1% (v/v) non-essential amino acids MHC; class1; C Up and penicillin/streptomycin (100 units/ml and 100 lg/ml, respectively). b-Actin 1.08 Cells were transferred to serum-free medium to which was added either GAPDH 1.11 insulin (5 lg/ml) and transferrin (5 lg/ml) (selenium-deficient cells), or a-Tubulin 1.20 insulin, transferrin and selenium as sodium selenite (7 ng/ml) (sele- Ubiquitin 1.09 nium-replete cells) [18]. Medium was changed every 2 days. Ribosomal protein L13a 0.90 Ribosomal protein S9 0.96 2.5. Animals and diets HPRT 1.67 Weanling Male Hooded Lister Rats of the Rowett strain were ran- Genomic DNA 1.19 domly allocated to groups of six and fed ad libitum on a semi-synthetic mRNA abundances were measured in Caco-2 cells after 2 days in Se- diet containing different amounts of Se for 6 weeks. The basal diet [19] deficient or Se-replete conditions. Results are the mean values obtained contained 8 ng of Se/g (severely Se-deficient) and the other diets con- from two experiments each analysed using duplicate arrays. Results tained 33, 63 (Se-deficient) or 111 (Se-adequate) ng of Se/g as sodium are expressed as a ratio of the Se-depleted cells to Se-adequate cells. selenite. At the end of the 6 weeks, the animals were anaesthetised with GPX1 and SelW mRNA abundances; showed greater than twofold isofluorane and blood samples were taken by cardiac puncture. The change; which is considered to be significant. When expression levels animals were killed by cervical dislocation and the entire colon dis- were close to the limit of detection the ratio of expression is given as sected out and washed with cold sterile PBS; the colon was then cut up/down and not as a precise value. The following genes were also open, the mucosa scraped off and then rapidly frozen in liquid nitrogen present on the array but expression was not detected: thioredoxin and stored at À80 °C.
Load more

Recommended publications
  • Identification and Characterization of a Selenoprotein Family Containing a Diselenide Bond in a Redox Motif
    Identification and characterization of a selenoprotein family containing a diselenide bond in a redox motif Valentina A. Shchedrina, Sergey V. Novoselov, Mikalai Yu. Malinouski, and Vadim N. Gladyshev* Department of Biochemistry, University of Nebraska, Lincoln, NE 68588-0664 Edited by Arne Holmgren, Karolinska Institute, Stockholm, Sweden, and accepted by the Editorial Board July 13, 2007 (received for review April 16, 2007) Selenocysteine (Sec, U) insertion into proteins is directed by trans- notable exception. Vertebrate selenoprotein P (SelP) has 10–18 lational recoding of specific UGA codons located upstream of a Sec, whose insertion is governed by two SECIS elements (11). It is stem-loop structure known as Sec insertion sequence (SECIS) ele- thought that Sec residues in SelP (perhaps with the exception of the ment. Selenoproteins with known functions are oxidoreductases N-terminal Sec residue present in a UxxC motif) have no redox or containing a single redox-active Sec in their active sites. In this other catalytic functions. work, we identified a family of selenoproteins, designated SelL, Selenoproteins with known functions are oxidoreductases con- containing two Sec separated by two other residues to form a taining catalytic redox-active Sec (12). Their Cys mutants are UxxU motif. SelL proteins show an unusual occurrence, being typically 100–1,000 times less active (13). Although there are many present in diverse aquatic organisms, including fish, invertebrates, known selenoproteins, proteins containing diselenide bonds have and marine bacteria. Both eukaryotic and bacterial SelL genes use not been described. Theoretically, such proteins could exist, but the single SECIS elements for insertion of two Sec.
    [Show full text]
  • The Role of Glutathionperoxidase 4 (GPX4) in Hematopoiesis and Leukemia
    The role of glutathionperoxidase 4 (GPX4) in hematopoiesis and leukemia von Kira Célénie Stahnke Inaugral- Dissertation zur Erlangung der Doktorwürde der TierärztliChen Fakultät der Ludwig-Maximilians-Universität MünChen The role of glutathionperoxidase 4 (GPX4) in hematopoiesis and leukemia von Kira Célénie Stahnke aus Dortmund München 2016 Aus dem VeterinärwissensChaftliChen Department der TierärztliChen Fakultät der Ludwig-Maximilians-Universität München Lehrstuhl für Molekulare Tierzucht und Biotechnologie Arbeit angefertigt unter der Leitung von Univ.-Prof. Dr. Eckhard Wolf Angefertigt am Institut für Experimentelle TumorforsChung Universitätsklinikum Ulm Mentor: Prof. Dr. Christian Buske GedruCkt mit Genehmigung der TierärztliChen Fakultät der Ludwig-Maximilians-Universität München Dekan: Univ.-Prof. Dr. JoaChim Braun Berichterstatter: Univ.-Prof. Dr. Eckard Wolf Korreferent/en: Priv.-Doz. Dr. Bianka Schulz Tag der Promotion: 06.02.2016 Table of contents List of Abbreviations..............................................................................2 1 Introduction ........................................................................................6 1.1 ROS and oxidative stress in physiology and pathology..................................................... 6 1.1.1 SourCes of Reactive Oxygen SpeCies..................................................................................................6 1.1.2 PhysiologiCal role of ROS........................................................................................................................8
    [Show full text]
  • Generation of Recombinant Mammalian Selenoproteins Through Ge- Netic Code Expansion with Photocaged Selenocysteine
    bioRxiv preprint doi: https://doi.org/10.1101/759662; this version posted September 5, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Generation of Recombinant Mammalian Selenoproteins through Ge- netic Code Expansion with Photocaged Selenocysteine. Jennifer C. Peeler, Rachel E. Kelemen, Masahiro Abo, Laura C. Edinger, Jingjia Chen, Abhishek Chat- terjee*, Eranthie Weerapana* Department of Chemistry, Boston College, Chestnut Hill, Massachusetts 02467, United States Supporting Information Placeholder ABSTRACT: Selenoproteins contain the amino acid sele- neurons susceptible to ferroptotic cell death due to nocysteine and are found in all domains of life. The func- overoxidation and inactivation of GPX4-Cys.4 This ob- tions of many selenoproteins are poorly understood, servation demonstrates a potential advantage conferred partly due to difficulties in producing recombinant sele- by the energetically expensive production of selenopro- noproteins for cell-biological evaluation. Endogenous teins. mammalian selenoproteins are produced through a non- Sec incorporation deviates from canonical protein canonical translation mechanism requiring suppression of translation, requiring suppression of the UGA stop codon. the UGA stop codon, and a selenocysteine insertion se- In eukaryotes, Sec biosynthesis occurs directly on the quence (SECIS) element in the 3’ untranslated region of suppressor tRNA (tRNA[Ser]Sec). Specifically, tRNA[Ser]Sec the mRNA. Here, recombinant selenoproteins are gener- is aminoacylated with serine by seryl-tRNA synthetase ated in mammalian cells through genetic code expansion, (SerS), followed by phosphorylation by phosphoseryl- circumventing the requirement for the SECIS element, tRNA kinase (PSTK), and subsequent Se incorporation and selenium availability.
    [Show full text]
  • In Thyroid Cancer
    Metere et al. Cancer Cell Int (2018) 18:7 https://doi.org/10.1186/s12935-018-0504-4 Cancer Cell International PRIMARY RESEARCH Open Access A possible role for selenoprotein glutathione peroxidase (GPx1) and thioredoxin reductases (TrxR1) in thyroid cancer: our experience in thyroid surgery Alessio Metere1* , Francesca Frezzotti1, Claire Elizabeth Graves2, Massimo Vergine1, Alessandro De Luca1, Donatella Pietraforte3 and Laura Giacomelli1 Abstract Background: Oxidative stress is responsible for some alterations in the chemical structure and, consequently, in the function of proteins, lipids, and DNA. Recent studies have linked oxidative stress to cancers, particularly thyroid cancer, but the mechanisms remain unclear. Here, we further characterize the role of oxidative stress in thyroid cancer by analyzing the expression of two selenium antioxidant molecules, glutathione peroxidase (GPx1) and thioredoxin reductase (TrxR1) in thyroid cancer cells. Methods: Samples of both healthy thyroid tissue and thyroid tumor were taken for analysis after total thyroidectomy. The expression of GPx1 and TrxR1 was revealed by Western blot analysis and quantifed by densitometric analy- ses, while the evaluation of free radicals was performed by Electron Paramagnetic Resonance (EPR)-spin trapping technique. Results: Our results show a decrease in the expression of GPx1 and TrxR1 ( 45.7 and 43.2% respectively, p < 0.01) in the thyroid cancer cells compared to the healthy cells. In addition, the EPR− technique− shows an increase of free radicals in tumor tissue, signifcantly higher than that found in healthy thyroid tissue ( 116.3%, p < 0.01). + Conclusions: Our fndings underscore the relationship between thyroid cancer and oxidative stress, showing the imbalance of the oxidant/antioxidant system in thyroid cancer tissue.
    [Show full text]
  • SUPPLEMENTARY DATA Supplementary Figure 1. The
    SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary
    [Show full text]
  • GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis Giovanni C
    REVIEW GPX4 www.proteomics-journal.com GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis Giovanni C. Forcina and Scott J. Dixon* formation of toxic radicals (e.g., R-O•).[5] Oxygen is necessary for aerobic metabolism but can cause the harmful The eight mammalian GPX proteins fall oxidation of lipids and other macromolecules. Oxidation of cholesterol and into three clades based on amino acid phospholipids containing polyunsaturated fatty acyl chains can lead to lipid sequence similarity: GPX1 and GPX2; peroxidation, membrane damage, and cell death. Lipid hydroperoxides are key GPX3, GPX5, and GPX6; and GPX4, GPX7, and GPX8.[6] GPX1–4 and 6 (in intermediates in the process of lipid peroxidation. The lipid hydroperoxidase humans) are selenoproteins that contain glutathione peroxidase 4 (GPX4) converts lipid hydroperoxides to lipid an essential selenocysteine in the enzyme + alcohols, and this process prevents the iron (Fe2 )-dependent formation of active site, while GPX5, 6 (in mouse and toxic lipid reactive oxygen species (ROS). Inhibition of GPX4 function leads to rats), 7, and 8 use an active site cysteine lipid peroxidation and can result in the induction of ferroptosis, an instead. Unlike other family members, GPX4 (PHGPx) can act as a phospholipid iron-dependent, non-apoptotic form of cell death. This review describes the hydroperoxidase to reduce lipid perox- formation of reactive lipid species, the function of GPX4 in preventing ides to lipid alcohols.[7,8] Thus,GPX4ac- oxidative lipid damage, and the link between GPX4 dysfunction, lipid tivity is essential to maintain lipid home- oxidation, and the induction of ferroptosis. ostasis in the cell, prevent the accumula- tion of toxic lipid ROS and thereby block the onset of an oxidative, iron-dependent, non-apoptotic mode of cell death termed 1.
    [Show full text]
  • Thiol Peroxidases Mediate Specific Genome-Wide Regulation of Gene Expression in Response to Hydrogen Peroxide
    Thiol peroxidases mediate specific genome-wide regulation of gene expression in response to hydrogen peroxide Dmitri E. Fomenkoa,1,2, Ahmet Koca,1, Natalia Agishevaa, Michael Jacobsena,b, Alaattin Kayaa,c, Mikalai Malinouskia,c, Julian C. Rutherfordd, Kam-Leung Siue, Dong-Yan Jine, Dennis R. Winged, and Vadim N. Gladysheva,c,2 aDepartment of Biochemistry, University of Nebraska, Lincoln, NE 68588-0664; bDepartment of Life Sciences, Wayne State College, Wayne, NE 68787; dDepartment of Medicine, University of Utah Health Sciences Center, Salt Lake City, UT 84132; eDepartment of Biochemistry, University of Hong Kong, Hong Kong, China; and cDivision of Genetics, Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115 Edited by Joan Selverstone Valentine, University of California, Los Angeles, CA, and approved December 22, 2010 (received for review July 21, 2010) Hydrogen peroxide is thought to regulate cellular processes by and could withstand significant oxidative stress. It responded to direct oxidation of numerous cellular proteins, whereas antioxi- several redox stimuli by robust transcriptional reprogramming. dants, most notably thiol peroxidases, are thought to reduce However, it was unable to transcriptionally respond to hydrogen peroxides and inhibit H2O2 response. However, thiol peroxidases peroxide. The data suggested that thiol peroxidases transfer have also been implicated in activation of transcription factors oxidative signals from peroxides to target proteins, thus activating and signaling. It remains unclear if these enzymes stimulate or various transcriptional programs. This study revealed a previously inhibit redox regulation and whether this regulation is widespread undescribed function of these proteins, in addition to their roles or limited to a few cellular components.
    [Show full text]
  • Selenium Vs. Sulfur: Investigating the Substrate Specificity of a Selenocysteine Lyase
    University of Central Florida STARS Electronic Theses and Dissertations, 2004-2019 2019 Selenium vs. Sulfur: Investigating the Substrate Specificity of a Selenocysteine Lyase Michael Johnstone University of Central Florida Part of the Biotechnology Commons Find similar works at: https://stars.library.ucf.edu/etd University of Central Florida Libraries http://library.ucf.edu This Masters Thesis (Open Access) is brought to you for free and open access by STARS. It has been accepted for inclusion in Electronic Theses and Dissertations, 2004-2019 by an authorized administrator of STARS. For more information, please contact [email protected]. STARS Citation Johnstone, Michael, "Selenium vs. Sulfur: Investigating the Substrate Specificity of a Selenocysteine Lyase" (2019). Electronic Theses and Dissertations, 2004-2019. 6511. https://stars.library.ucf.edu/etd/6511 SELENIUM VS. SULFUR: INVESTIGATING THE SUBSTRATE SPECIFICITY OF A SELENOCYSTEINE LYASE by MICHAEL ALAN JOHNSTONE B.S. University of Central Florida, 2017 A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science in the Burnett School of Biomedical Sciences in the College of Medicine at the University of Central Florida Orlando, Florida Summer Term 2019 Major Professor: William T. Self © 2019 Michael Alan Johnstone ii ABSTRACT Selenium is a vital micronutrient in many organisms. While traces are required for survival, excess amounts are toxic; thus, selenium can be regarded as a biological “double-edged sword”. Selenium is chemically similar to the essential element sulfur, but curiously, evolution has selected the former over the latter for a subset of oxidoreductases. Enzymes involved in sulfur metabolism are less discriminate in terms of preventing selenium incorporation; however, its specific incorporation into selenoproteins reveals a highly discriminate process that is not completely understood.
    [Show full text]
  • The C718T Polymorphism in the 3″-Untranslated
    Hypertension Research (2012) 35, 507–512 & 2012 The Japanese Society of Hypertension All rights reserved 0916-9636/12 www.nature.com/hr ORIGINAL ARTICLE The C718T polymorphism in the 3¢-untranslated region of glutathione peroxidase-4 gene is a predictor of cerebral stroke in patients with essential hypertension Alexey V Polonikov1, Ekaterina K Vialykh2, Mikhail I Churnosov3, Thomas Illig4, Maxim B Freidin5, Oksana V Vasil¢eva1, Olga Yu Bushueva1, Valentina N Ryzhaeva1, Irina V Bulgakova1 and Maria A Solodilova1 In the present study we have investigated the association of three single nucleotide polymorphisms in glutathione peroxidase (GPx) genes GPX1 rs1050450 (P198L), GPX3 rs2070593 (G930A) and GPX4 rs713041 (T718C) with the risk of cerebral stroke (CS) in patients with essential hypertension (EH). A total of 667 unrelated EH patients of Russian origin, including 306 hypertensives (the EH–CS group) who suffered from CS and 361 people (the EH–CS group) who did not have cerebrovascular accidents, were enrolled in the study. The variant allele 718C of the GPX4 gene was found to be significantly associated with an increased risk of CS in hypertensive patients (odds ratio (OR) 1.53, 95% confidence interval (CI) 1.23–1.90, Padj¼0.0003). The prevalence of the 718TC and 718CC genotypes of the GPX4 gene was higher in the EH–CS group than the EH-alone group (OR¼2.12, 95%CI 1.42–3.16, Padj¼0.0018). The association of the variant GPX4 genotypes with the increased risk of CS in hypertensives remained statistically significant after adjusting for confounding variables such as sex, body mass index (BMI), blood pressure and antihypertensive medication use (OR¼2.18, 95%CI 1.46–3.27, P¼0.0015).
    [Show full text]
  • Programmed Cell-Death by Ferroptosis: Antioxidants As Mitigators
    International Journal of Molecular Sciences Review Programmed Cell-Death by Ferroptosis: Antioxidants as Mitigators Naroa Kajarabille 1 and Gladys O. Latunde-Dada 2,* 1 Nutrition and Obesity Group, Department of Nutrition and Food Sciences, University of the Basque Country (UPV/EHU), 01006 Vitoria, Spain; [email protected] 2 King’s College London, Department of Nutritional Sciences, Faculty of Life Sciences and Medicine, Franklin-Wilkins Building, 150 Stamford Street, London SE1 9NH, UK * Correspondence: [email protected] Received: 9 September 2019; Accepted: 2 October 2019; Published: 8 October 2019 Abstract: Iron, the fourth most abundant element in the Earth’s crust, is vital in living organisms because of its diverse ligand-binding and electron-transfer properties. This ability of iron in the redox cycle as a ferrous ion enables it to react with H2O2, in the Fenton reaction, to produce a hydroxyl radical ( OH)—one of the reactive oxygen species (ROS) that cause deleterious oxidative damage • to DNA, proteins, and membrane lipids. Ferroptosis is a non-apoptotic regulated cell death that is dependent on iron and reactive oxygen species (ROS) and is characterized by lipid peroxidation. It is triggered when the endogenous antioxidant status of the cell is compromised, leading to lipid ROS accumulation that is toxic and damaging to the membrane structure. Consequently, oxidative stress and the antioxidant levels of the cells are important modulators of lipid peroxidation that induce this novel form of cell death. Remedies capable of averting iron-dependent lipid peroxidation, therefore, are lipophilic antioxidants, including vitamin E, ferrostatin-1 (Fer-1), liproxstatin-1 (Lip-1) and possibly potent bioactive polyphenols.
    [Show full text]
  • Profile-Based Scanning of Eukaryotic Genome Sequences For
    Vol. 26 no. 21 2010, pages 2656–2663 BIOINFORMATICS ORIGINAL PAPER doi:10.1093/bioinformatics/btq516 Genome analysis Advance Access publication September 21, 2010 Selenoprofiles: profile-based scanning of eukaryotic genome sequences for selenoprotein genes M. Mariotti∗ and R. Guigó∗ Bioinformatics and genomics group, Center for Genomic Regulation and Universitat Pompeu Fabra, Barcelona, Catalonia, Spain Associate Editor: Martin Bishop ABSTRACT (Copeland et al., 2001; Grundner-Culemann et al., 1999). Seleno- Motivation: Selenoproteins are a group of proteins that contain protein homologs (not containing Sec) have been found both selenocysteine (Sec), a rare amino acid inserted co-translationally as orthologs and paralogs. In most of them, a cysteine residue into the protein chain. The Sec codon is UGA, which is normally a is aligned to Sec. There are currently 21 known families of stop codon. In selenoproteins, UGA is recoded to Sec in presence selenoproteins in higher eukaryotes: Glutathione Peroxidases (GPx), of specific features on selenoprotein gene transcripts. Due to Iodothyronine Deiodinase (DI), Selenoprotein 15 (Sel15 or 15kDa), the dual role of the UGA codon, selenoprotein prediction and Fish selenoprotein 15 (Fep15), SelM, SelH, SelI, SelJ, SelK, SelL, annotation are difficult tasks, and even known selenoproteins are SelN, SelO, SelP, SelR, SelS, SelT, SelU, SelV, SelW, Thioredoxin often misannotated in genome databases. Reductases (TR), SelenoPhosphate Synthetase (SPS). Some of these Results: We present an homology-based in silico method to scan families may contain more than one member in a given genome genomes for members of the known eukaryotic selenoprotein (e.g. Homo sapiens contains 25 selenoproteins belonging to 17 families: selenoprofiles.
    [Show full text]
  • Why Nature Chose Selenium Hans J
    Reviews pubs.acs.org/acschemicalbiology Why Nature Chose Selenium Hans J. Reich*, ‡ and Robert J. Hondal*,† † University of Vermont, Department of Biochemistry, 89 Beaumont Ave, Given Laboratory, Room B413, Burlington, Vermont 05405, United States ‡ University of WisconsinMadison, Department of Chemistry, 1101 University Avenue, Madison, Wisconsin 53706, United States ABSTRACT: The authors were asked by the Editors of ACS Chemical Biology to write an article titled “Why Nature Chose Selenium” for the occasion of the upcoming bicentennial of the discovery of selenium by the Swedish chemist Jöns Jacob Berzelius in 1817 and styled after the famous work of Frank Westheimer on the biological chemistry of phosphate [Westheimer, F. H. (1987) Why Nature Chose Phosphates, Science 235, 1173−1178]. This work gives a history of the important discoveries of the biological processes that selenium participates in, and a point-by-point comparison of the chemistry of selenium with the atom it replaces in biology, sulfur. This analysis shows that redox chemistry is the largest chemical difference between the two chalcogens. This difference is very large for both one-electron and two-electron redox reactions. Much of this difference is due to the inability of selenium to form π bonds of all types. The outer valence electrons of selenium are also more loosely held than those of sulfur. As a result, selenium is a better nucleophile and will react with reactive oxygen species faster than sulfur, but the resulting lack of π-bond character in the Se−O bond means that the Se-oxide can be much more readily reduced in comparison to S-oxides.
    [Show full text]