DOCSLIB.ORG

The Influence of Selol on the Expression of Oxidative Stress Genes in Normal and Malignant Prostate Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Influence of Selol on the Expression of Oxidative Stress Genes in Normal and Malignant Prostate Cells CANCER GENOMICS & PROTEOMICS 10: 225-232 (2013) The Influence of Selol on the Expression of Oxidative Stress Genes in Normal and Malignant Prostate Cells IZA KSIAZEK1, KAROLINA SITARZ1, MAGDALENA ROSLON1, ELZBIETA ANUSZEWSKA1, PIOTR SUCHOCKI2,3 and JADWIGA DUDKIEWICZ WILCZYNSKA1 Departments of 1Biochemistry and Biofarmaceuticals and 3Pharmaceutical Chemistr, National Medicines Institue, Warsaw, Poland; 2Department of Bioanalysis and Drug Analysis, Medical University of Warsaw, Warsaw, Poland Abstract. Selol is a mixture of selenitriglycerides, obtained Using the Ames test, Rahden-Staroń et al. demonstrated, that by the chemical modification of sunflower oil, which contain Selol has no mutagenic effect on strains of Salmonella selenium at the +4 oxidation state. The aim of the present typhimurium (2). Our own investigations into the cytotoxicity study was to describe the changes in the expression of genes of 5% Selol showed that it is toxic to malignant HeLa cells related to oxidative stress caused by Selol in prostate cells: (3) as well as HL-60 human promyelocytic leukaemia cells, both normal (PNT1A) and malignant (LNCaP). The changes both susceptible and multidrug resistant (4), dependent on in gene expression in PNT1A and LNCaP cell lines under the dosage and incubation time. Work carried out with BJ normal influence of Selol were measured using a 96-well RT2 human fibroblasts and PNT1A normal human prostate Profiler ™PCR Array: Human Oxidative Stress and epithelial cells (data not published) revealed the significantly Antioxidant Defense, which arrayed 84 genes functionally lower toxic effect of Selol on these cell lines when compared involved in the cellular oxidative stress response. Based on to malignant HeLa cells. It was also shown that due to being the obtained data, LNCaP cells exhibited a significantly a mixture of triglycerides, Selol exhibits much lower levels lower potential for antioxidant defence when compared to of in vitro cytotoxicity when compared to sodium selenite, an PNT1A cells. The response of the malignant LNCaP cells to inorganic selenium compound (3). This effect has also been exposure to Selol was significantly different from that of the confirmed through in vivo experiments (5). normal PNT1A cells, especially after 48 h of incubation. In Due to its antioxidant properties, as well as its presence the case of LNCaP cells, Selol causes down-regulation of the as part of certain enzymes, selenium takes part in metabolic expression of many vital genes. Under in vitro conditions, the processes at the cellular level, protecting cellular membranes efficacy of Selol slightly changes with increasing from free radicals, preventing lipid peroxidation, protein concentration, but significantly increases when the oxidation, and DNA and RNA damage, all of which may incubation time is lengthened. lead to a lowered risk of malignant changes taking place (6). On the other hand, a high intracellular selenium The ability of malignant cells to acquire multidrug resistance, concentration leads to the formation of reactive oxygen along with the powerful side-effects caused by chemotherapy species (ROS), which in turn leads to apoptosis due to the are the driving forces behind the constant search for new, imbalance between ROS generation and the antioxidant more efficient and selective therapeutic compounds. potential of the cell (7). One of these potential anticancer agents is Selol [Patent, As part of ongoing research into the mechanism of action Pol. PL 176530 (Cl.A61K31/095)], an organic selenium (IV) of Selol, this article aims to describe the changes in the compound consisting of a mixture of selenotriglycerides expression of genes related to oxidative stress caused by obtained by the chemical modification of sunflower oil (1). Selol in prostate cells, both normal (PNT1A) and malignant (LNCaP). Prior to undertaking molecular analysis, the cytotoxic influence of 5% Selol on selected prostate cells was Correspondence to: Iza Ksiazek, Department of Biochemistry and measured using the salt 3-(4,5-dimethylthiazol-2-yl)-2,5- Biofarmaceuticals, National Medicines Institue, Chelmska 30/34, diphenyltetrazolium bromide (MTT assay). 00-725 Warsaw, Poland. E-mail: [email protected] The levels of gene expression were determined using real- Key Words: LNCaP, PNT1A, Selol, gene expression, oxidative time polymerase chain reaction (PCR) using a commercially stress. available array containing 84 genes related to cellular 1109-6535/2013 225 CANCER GENOMICS & PROTEOMICS 10: 225-232 (2013) responses to oxidative stress. The array was selected based to exposure to the compounds of interest using the conditions on the pro-oxidative properties of selenium described in the described above, in order to reach a similar level of confluence literature. It was assumed that the toxic properties of Selol, (approx. 70%). observed in cytotoxic studies, are due in part to its ability to Incubation with Selol. For the purposes of investigating gene disrupt the cellular oxidoreductive balance, leading to the expression in PNT1A and LNCaP cells, the concentration of Selol induction of apoptosis and subsequent cell death (7, 8). was chosen based on a previously performed cytotoxicity assay A complex statistical analysis was carried out on genes (MTT). The concentration chosen was one that caused an which displayed changes in expression level, which then led approximately 30% reduction in the number of live LNCaP cells in to conclusions concerning the cellular processes taking place culture following a 24-h incubation, i.e. 150 μM with respect to under the influence of Selol. selenium. The same concentration was used for PNT1A cells. The impact of Selol on gene expression was observed in both cell lines Materials and Methods following 24 and 48 h of incubation. A culture of appropriate cells in medium was used as a control. Compounds and reagents. Selol was synthesized at the Department of Analysis of Medicines at the Medical University of Warsaw, as RNA isolation and quantification. Total RNA was isolated from cells described in the patent (1). A micellar solution of Selol was used using the GeneMatrix Universal RNA/miRNA Purification Kit. The (based on lecithin, water and Selol), with a declared selenium isolation was performed in three independent replicates for each concentration of 5% (w/v). experimental system. The quantity and quality of isolated RNA was The following reagents were used: phosphate buffered saline determined using a NanoDrop spectrophotometer (Thermo (PBS) without Mg2+ and Ca2+ ions (Institute of Immunology and Scientific, Wilmington, USA). The isolated RNA was stored at Experimental Therapy, Wroclaw, Poland), sterile water (Polfa, −70˚C with added RiboLock™ RNase Inhibitor (Fermentas). Lublin, Poland), RPMI and fetal bovine serum (FBS) (Lonza, Verviers, Belgium), antibiotics: penicillin, streptomycin, PCR array. The investigation of gene expression in the chosen amphotericin B (Lonza, Walkersville MD, USA), trypsin-EDTA and experimental systems was carried out using RT2 Profiler ™ PCR Array: glucose (Sigma, St. Louis MD, USA), HEPES, sodium pyruvate and Human Oxidative Stress and Antioxidant Defense (Qiagen). The (Sigma, Irvine, USA), GeneMatrix Universal RNA/miRNA efficiency of cDNA synthesis along with the quality of the resulting Purification Kit (EURx, Gdansk, Poland), RT2 First-Strand Kit material were examined using RT2 RNA QC PCR Array (Qiagen). (Qiagen, Maryland, USA), RT2 SYBR Green/ROX qPCR Master Mix (Qiagen) and RiboLock™ RNase Inhibitor (Fermentas, ABO, Measuring gene expression using real-time PCR. The experiment Gdansk, Poland). consisted of the following steps: a) Clean-up of the isolated RNA in order to remove contaminating DNA followed by cDNA synthesis Cell culture. The model system described in literature for using RT2 First Strand Kit. b) Confirmation of the presence of cDNA investigating the properties of selenium is a pair of prostate cell in the samples using Human RT2 RNA QC PCR Array. c) Quantitative lines, one normal (PNT1A) and one malignant (LNCaP) (9, 10). The analysis of gene expression in the samples using RT2 Profiler™ PCR LNCaP cell line was first derived from prostate metastases in the Array: Human Oxidative Stress and Antioxidant Defense, using an superclavicular lymph nodes (11). In vitro testing showed that this MX3005p cycler (Stratagene) and RT2 SYBR Green/ROX qPCR line has a doubling time longer than most malignant cell lines, of Master Mix. d) Data analysis using the ΔΔCt method, using RT2 approximately 60 h. LNCaP cells present with morphology Profiler PCR Array Data Analysis software version 3.5 characteristic of malignant epithelial cells, including the expression (http://pcrdataanalysis.sabiosciences.com/pcr/arrayanalysis.php). of specific cytokeratins 8 and 18, as well as a lack of desmin and Quantitative assessment of gene expression is usually carried out factor VIII (12). Due to high sensitivity and low adherence using real-time PCR, where gene expression is measured through following splitting, they require a 48-hour incubation period to quantitative and qualitative changes in mRNA caused by an external properly adhere to the culture flask. The PNT1A normal cell line factor (14). The changes in gene expression in PNT1A and LNCaP was derived from the prostate of a 25-year-old man and cell lines under the influence of Selol were measured using a 96- immortalised by transfection with a plasmid containing the SV40 well RT2 Profiler ™PCR Array: Human Oxidative Stress and viral
Load more

Recommended publications
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Peroxiredoxins in Neurodegenerative Diseases
    antioxidants Review Peroxiredoxins in Neurodegenerative Diseases Monika Szeliga Mossakowski Medical Research Centre, Department of Neurotoxicology, Polish Academy of Sciences, 5 Pawinskiego Street, 02-106 Warsaw, Poland; [email protected]; Tel.: +48-(22)-6086416 Received: 31 October 2020; Accepted: 27 November 2020; Published: 30 November 2020 Abstract: Substantial evidence indicates that oxidative/nitrosative stress contributes to the neurodegenerative diseases. Peroxiredoxins (PRDXs) are one of the enzymatic antioxidant mechanisms neutralizing reactive oxygen/nitrogen species. Since mammalian PRDXs were identified 30 years ago, their significance was long overshadowed by the other well-studied ROS/RNS defense systems. An increasing number of studies suggests that these enzymes may be involved in the neurodegenerative process. This article reviews the current knowledge on the expression and putative roles of PRDXs in neurodegenerative disorders such as Alzheimer’s disease, Parkinson’s disease and dementia with Lewy bodies, multiple sclerosis, amyotrophic lateral sclerosis and Huntington’s disease. Keywords: peroxiredoxin (PRDX); oxidative stress; nitrosative stress; neurodegenerative disease 1. Introduction Under physiological conditions, reactive oxygen species (ROS, e.g., superoxide anion, O2 -; · hydrogen peroxide, H O ; hydroxyl radical, OH; organic hydroperoxide, ROOH) and reactive nitrogen 2 2 · species (RNS, e.g., nitric oxide, NO ; peroxynitrite, ONOO-) are constantly produced as a result of normal · cellular metabolism and play a crucial role in signal transduction, enzyme activation, gene expression, and regulation of immune response [1]. The cells are endowed with several enzymatic (e.g., glutathione peroxidase (GPx); peroxiredoxin (PRDX); thioredoxin (TRX); catalase (CAT); superoxide dismutase (SOD)), and non-enzymatic (e.g., glutathione (GSH); quinones; flavonoids) antioxidant systems that minimize the levels of ROS and RNS.
    [Show full text]
  • Epithelial Ovarian Cancer: Searching for New Modulators of Drug Resistance
    UNIVERSITÀ DEGLI STUDI DI UDINE Dipartimento di scienze mediche e biologiche PhD COURSE IN BIOMEDICAL SCIENCES AND BIOTECHNOLOGY XXIX cycle PhD THESIS Epithelial Ovarian Cancer: searching for new modulators of drug resistance. PhD student Supervisor Prof. Carlo Ennio Michele Pucillo Valentina Ranzuglia Co-supervisors Dr. Gustavo Baldassarre Dr. Monica Schiappacassi PhD coordinator Prof. Claudio Brancolini Academic year 2015/2016 This PhD work was done at Centro di Riferimento Oncologico (CRO, National Cancer Institute ) of Aviano, in the Division of Experimental Oncology 2 directed by Dr. Gustavo Baldassarre. i Table of contents Abstract 3 1. Introduction 4 1.1 Epithelial Ovarian Cancer 4 1.1.1 Platinum resistance 5 1.2 Functional Genomic Screening 8 1.3 Serum and glucocorticoid-regulated kinases 9 1.3.1 SGK structure 10 1.3.2 SGK activation and regulation 11 1.3.3 Role of SGKs in regulation of molecular and cellular functions 13 1.3.4 Serum- and glucocorticoid-regulated kinases in cancer 15 1.4 Autophagy 17 2.Aim of the study 21 3.Results 22 3.1 Identification of SGK2 as a mediator of platinum sensitivity in EOC cells. 22 3.2 SGK2 silencing sensitizes EOC cells to platinum. 23 3.3 SGK2 overexpression confers an increased resistance to platinum drug. 25 3.4 SGK2-overexpressing cells present an increased in vitro and in vivo growth 26 rate 3.5 SGK2 kinase activity is involved in EOC sensitivity to platinum treatment. 28 3.6 The SGK1/SGK2 kinase inhibitor, GSK650394, reduces cell viability in 29 combination with platinum. 3.7 GSK650394 is able to make SGK2-expressing cells more sensitive to platinum.
    [Show full text]
  • AGC Kinases in Mtor Signaling, in Mike Hall and Fuyuhiko Tamanoi: the Enzymes, Vol
    Provided for non-commercial research and educational use only. Not for reproduction, distribution or commercial use. This chapter was originally published in the book, The Enzymes, Vol .27, published by Elsevier, and the attached copy is provided by Elsevier for the author's benefit and for the benefit of the author's institution, for non-commercial research and educational use including without limitation use in instruction at your institution, sending it to specific colleagues who know you, and providing a copy to your institution’s administrator. All other uses, reproduction and distribution, including without limitation commercial reprints, selling or licensing copies or access, or posting on open internet sites, your personal or institution’s website or repository, are prohibited. For exceptions, permission may be sought for such use through Elsevier's permissions site at: http://www.elsevier.com/locate/permissionusematerial From: ESTELA JACINTO, AGC Kinases in mTOR Signaling, In Mike Hall and Fuyuhiko Tamanoi: The Enzymes, Vol. 27, Burlington: Academic Press, 2010, pp.101-128. ISBN: 978-0-12-381539-2, © Copyright 2010 Elsevier Inc, Academic Press. Author's personal copy 7 AGC Kinases in mTOR Signaling ESTELA JACINTO Department of Physiology and Biophysics UMDNJ-Robert Wood Johnson Medical School, Piscataway New Jersey, USA I. Abstract The mammalian target of rapamycin (mTOR), a protein kinase with homology to lipid kinases, orchestrates cellular responses to growth and stress signals. Various extracellular and intracellular inputs to mTOR are known. mTOR processes these inputs as part of two mTOR protein com- plexes, mTORC1 or mTORC2. Surprisingly, despite the many cellular functions that are linked to mTOR, there are very few direct mTOR substrates identified to date.
    [Show full text]
  • (ER) Membrane Contact Sites (MCS) Uses Toxic Waste to Deliver Messages Edgar Djaha Yoboue1, Roberto Sitia1 and Thomas Simmen2
    Yoboue et al. Cell Death and Disease (2018) 9:331 DOI 10.1038/s41419-017-0033-4 Cell Death & Disease REVIEW ARTICLE Open Access Redox crosstalk at endoplasmic reticulum (ER) membrane contact sites (MCS) uses toxic waste to deliver messages Edgar Djaha Yoboue1, Roberto Sitia1 and Thomas Simmen2 Abstract Many cellular redox reactions housed within mitochondria, peroxisomes and the endoplasmic reticulum (ER) generate hydrogen peroxide (H2O2) and other reactive oxygen species (ROS). The contribution of each organelle to the total cellular ROS production is considerable, but varies between cell types and also over time. Redox-regulatory enzymes are thought to assemble at a “redox triangle” formed by mitochondria, peroxisomes and the ER, assembling “redoxosomes” that sense ROS accumulations and redox imbalances. The redoxosome enzymes use ROS, potentially toxic by-products made by some redoxosome members themselves, to transmit inter-compartmental signals via chemical modifications of downstream proteins and lipids. Interestingly, important components of the redoxosome are ER chaperones and oxidoreductases, identifying ER oxidative protein folding as a key ROS producer and controller of the tri-organellar membrane contact sites (MCS) formed at the redox triangle. At these MCS, ROS accumulations could directly facilitate inter-organellar signal transmission, using ROS transporters. In addition, ROS influence the flux 2+ 2+ of Ca ions, since many Ca handling proteins, including inositol 1,4,5 trisphosphate receptors (IP3Rs), SERCA pumps or regulators of the mitochondrial Ca2+ uniporter (MCU) are redox-sensitive. Fine-tuning of these redox and ion signaling pathways might be difficult in older organisms, suggesting a dysfunctional redox triangle may accompany 1234567890 1234567890 the aging process.
    [Show full text]
  • In Thyroid Cancer
    Metere et al. Cancer Cell Int (2018) 18:7 https://doi.org/10.1186/s12935-018-0504-4 Cancer Cell International PRIMARY RESEARCH Open Access A possible role for selenoprotein glutathione peroxidase (GPx1) and thioredoxin reductases (TrxR1) in thyroid cancer: our experience in thyroid surgery Alessio Metere1* , Francesca Frezzotti1, Claire Elizabeth Graves2, Massimo Vergine1, Alessandro De Luca1, Donatella Pietraforte3 and Laura Giacomelli1 Abstract Background: Oxidative stress is responsible for some alterations in the chemical structure and, consequently, in the function of proteins, lipids, and DNA. Recent studies have linked oxidative stress to cancers, particularly thyroid cancer, but the mechanisms remain unclear. Here, we further characterize the role of oxidative stress in thyroid cancer by analyzing the expression of two selenium antioxidant molecules, glutathione peroxidase (GPx1) and thioredoxin reductase (TrxR1) in thyroid cancer cells. Methods: Samples of both healthy thyroid tissue and thyroid tumor were taken for analysis after total thyroidectomy. The expression of GPx1 and TrxR1 was revealed by Western blot analysis and quantifed by densitometric analy- ses, while the evaluation of free radicals was performed by Electron Paramagnetic Resonance (EPR)-spin trapping technique. Results: Our results show a decrease in the expression of GPx1 and TrxR1 ( 45.7 and 43.2% respectively, p < 0.01) in the thyroid cancer cells compared to the healthy cells. In addition, the EPR− technique− shows an increase of free radicals in tumor tissue, signifcantly higher than that found in healthy thyroid tissue ( 116.3%, p < 0.01). + Conclusions: Our fndings underscore the relationship between thyroid cancer and oxidative stress, showing the imbalance of the oxidant/antioxidant system in thyroid cancer tissue.
    [Show full text]
  • PRDX4 (Human) ELISA Kit 1
    PRDX4 (Human) ELISA Kit 1. The Association of Peroxiredoxin 4 with the Initiation and Progression of Hepatocellular Carcinoma. Guo X, Catalog Number: KA2121 Noguchi H, Ishii N, Homma T, Hamada T, Hiraki T, Zhang J, Matsuo K, Yokoyama S, Ishibashi H, Regulatory Status: For research use only (RUO) Fukushige T, Kanekura T, Fujii J, Uramoto H, Tanimoto A, Yamada S. Antioxid Redox Signal. 2018 Apr 24. Product Description: PRDX4 (Human) ELISA Kit is a [Epub ahead of print] sandwich enzyme immunoassay for the quantitative 2. Galectin-3 downregulates antioxidant peroxiredoxin-4 measurement of human PRDX4. in human cardiac fibroblasts: a new pathway to induce cardiac damage? Ibarrola J, Arrieta V, Sadaba R, Suitable Sample: Buffered solution Martinez-Martinez E, Garcia-Pena A, Alvarez V, Fernandez-Celis A, Gainza A, Santamaria E, Sample Volume: 100 uL Fernandez-Irigoyen J, Cachofeiro V, Zalba G, Fay R, Label: HRP-conjugated Rossignol P, Lopez-Andres N. Clin Sci (Lond). 2018 Apr 19. pii: CS20171389. [Epub ahead of print] Detection Method: Colorimetric 3. Overexpression of Peroxiredoxin 4 Affects Intestinal Function in a Dietary Mouse Model of Nonalcoholic Fatty Calibration Range: 78.13 to 5000 pg/mL Liver Disease. Nawata A, Noguchi H, Mazaki Y, Kurahashi T, Izumi H, Wang KY, Guo X, Uramoto H, Limit of Detection: 6.77 pg/mL Kohno K, Taniguchi H, Tanaka Y, Fujii J, Sasaguri Y, Tanimoto A, Nakayama T, Yamada S. PLoS One. 2016 Reactivity: Human Apr 1;11(4):e0152549. Applications: Quant (See our web site product page for detailed applications information) Protocols: See our web site at http://www.abnova.com/support/protocols.asp or product page for detailed protocols Storage Instruction: Store the kit at 4°C.
    [Show full text]
  • Differential Effects of Tranylcypromine and Imidazole on Mammary Carcinogenesis in Rats Fed Low and High Fat Diets1
    [CANCER RESEARCH 49, 3168-3172, June 15, 1989] Differential Effects of Tranylcypromine and Imidazole on Mammary Carcinogenesis in Rats Fed Low and High Fat Diets1 David L. McCormick,2 Ann M. Spicer, and Jacqueline L. Hollister Life Sciences Department, IIT Research Institute, Chicago, Illinois 60616 ABSTRACT studies with this class of compounds used inhibitors of the cyclooxygenase pathway of arachidonic acid catabolism; exper Neoplastic development in the rat mammary gland can be suppressed iments performed in our laboratory and by Ip and coworkers by inhibition of the activity of several enzymes involved in eicosanoid biosynthesis. In order to investigate the potential utility of prostacyclin demonstrated that the postcarcinogen phase of rat mammary and thromboxane synthetases as targets for mammary cancer chemopre- carcinogenesis can be suppressed by dietary administration of vention, experiments were conducted to determine the influence of tran- indomethacin (7, 8) or flurbiprofen (9). However, although the ylcypromine (TCP), an inhibitor of prostacyclin synthetase, and ¡mida/ole anticarcinogenic activity of indomethacin is similar to that of (IMI), an inhibitor of thromboxane synthetase, on mammary carcinogen- more widely studied inhibitors of mammary carcinogenesis such esis induced in rats by 7V-methyl-/V-nitrosourea. Fifty-day-old female as retinyl acetate (10) and selenium (11), the dose levels of Sprague-Dawley |Hsd:SD(BR)l rats received a single s.c. dose of 0 or 40 indomethacin required for chemopreventive efficacy in rats are mg of .V-mcth>l-.Y-nitrosoiirea per kg of body weight. Beginning 7 days close to the threshold of lethal toxicity (12). For this reason, after carcinogen administration, groups of rats were fed isoenergetic, studies are ongoing to identify additional modifiers of arachi casein-based diets containing 3 or 20% corn oil (w/w), supplemented with donic acid metabolism whose administration provides an effec (per kg of diet) 10 mg of TCP, 1000 mg of IMI, or sucrose carrier only.
    [Show full text]
  • Curative Effect of Selenium Against Indomethacin-Induced Gastric Ulcers in Rats
    J. Microbiol. Biotechnol. (2011), 21(4), 400–404 doi: 10.4014/jmb.1012.12019 First published online 19 January 2011 Curative Effect of Selenium Against Indomethacin-Induced Gastric Ulcers in Rats Kim, Jeong-Hwan1, Byung-Woo Kim1,3,4, Hyun-Ju Kwon1,3,4, and Soo-Wan Nam1,2,4* 1Department of Biomaterial Control, 2Department of Biotechnology and Bioengineering, 3Department of Life Science and Biotechnology, and 4Blue-Bio Industry RIC, Dong-Eui University, Busan 614-714, Korea Received: December 16, 2010 / Revised: December 30, 2010 / Accepted: December 31, 2010 Indomethacin is a nonsteroid anti-inflammatory agent erosions, ulcerative lesions, and petechial bleeding in the that is known to induce severe gastric mucosal lesions. In mucosa of stomach as serious side effects [10, 18]. According this study, we investigated the effect of selenium on gastric to previous reports, the oral administration of indomethacin in mucosal lesions in rats. To confirm the curative effect of rats causes ulcerative lesions in the gastric mucosa [7, 13]. selenium against indomethacin-induced gastric ulcers, Furthermore, the development of the gastric mucosal lesions gastric ulcers were induced by oral administration of induced by indomethacin is mainly mediated through 25 mg/kg indomethacin, and then different doses (10, 50, generation of oxygen free radicals and lipid peroxidation and 100 µg/kg of body weight) of selenium or vehicle were [6, 22, 25, 26, 28, 29]. treated by oral gavage for 3 days. Oral administration of Selenium is an essential nutrient of fundamental importance indomethacin clearly increased the gastric ulcer area in to human biology. It has important metabolic functions in the stomach, whereas selenium applied for 3 days significantly animals, including protection of membrane lipids and decreased the gastric ulcer area in a dose-dependent macromolecules from oxidative damage produced by peroxides manner.
    [Show full text]
  • Independent Evolution of Four Heme Peroxidase Superfamilies
    Archives of Biochemistry and Biophysics xxx (2015) xxx–xxx Contents lists available at ScienceDirect Archives of Biochemistry and Biophysics journal homepage: www.elsevier.com/locate/yabbi Independent evolution of four heme peroxidase superfamilies ⇑ Marcel Zámocky´ a,b, , Stefan Hofbauer a,c, Irene Schaffner a, Bernhard Gasselhuber a, Andrea Nicolussi a, Monika Soudi a, Katharina F. Pirker a, Paul G. Furtmüller a, Christian Obinger a a Department of Chemistry, Division of Biochemistry, VIBT – Vienna Institute of BioTechnology, University of Natural Resources and Life Sciences, Muthgasse 18, A-1190 Vienna, Austria b Institute of Molecular Biology, Slovak Academy of Sciences, Dúbravská cesta 21, SK-84551 Bratislava, Slovakia c Department for Structural and Computational Biology, Max F. Perutz Laboratories, University of Vienna, A-1030 Vienna, Austria article info abstract Article history: Four heme peroxidase superfamilies (peroxidase–catalase, peroxidase–cyclooxygenase, peroxidase–chlo- Received 26 November 2014 rite dismutase and peroxidase–peroxygenase superfamily) arose independently during evolution, which and in revised form 23 December 2014 differ in overall fold, active site architecture and enzymatic activities. The redox cofactor is heme b or Available online xxxx posttranslationally modified heme that is ligated by either histidine or cysteine. Heme peroxidases are found in all kingdoms of life and typically catalyze the one- and two-electron oxidation of a myriad of Keywords: organic and inorganic substrates. In addition to this peroxidatic activity distinct (sub)families show pro- Heme peroxidase nounced catalase, cyclooxygenase, chlorite dismutase or peroxygenase activities. Here we describe the Peroxidase–catalase superfamily phylogeny of these four superfamilies and present the most important sequence signatures and active Peroxidase–cyclooxygenase superfamily Peroxidase–chlorite dismutase superfamily site architectures.
    [Show full text]
  • A Machine Learning Tool for Predicting Protein Function Anna
    The Woolf Classifier Building Pipeline: A Machine Learning Tool for Predicting Protein Function Anna Farrell-Sherman Submitted in Partial Fulfillment of the Prerequisite for Honors in Computer Science under the advisement of Eni Mustafaraj and Vanja Klepac-Ceraj May 2019 © 2019 Anna Farrell-Sherman Abstract Proteins are the machinery that allow cells to grow, reproduce, communicate, and create multicellular organisms. For all of their importance, scientists still have a hard time understanding the function of a protein based on its sequence alone. For my honors thesis in computer science, I created a machine learning tool that can predict the function of a protein based solely on its amino acid sequence. My tool gives scientists a structure in which to build a � Nearest Neighbor or random forest classifier to distinguish between proteins that can and cannot perform a given function. Using default Min-Max scaling, and the Matthews Correlation Coefficient for accuracy assessment, the Woolf Pipeline is built with simplified choices to guide users to success. i Acknowledgments There are so many people who made this thesis possible. First, thank you to my wonderful advisors, Eni and Vanja, who never gave up on me, and always pushed me to try my hardest. Thank you also to the other members of my committee, Sohie Lee, Shikha Singh, and Rosanna Hertz for supporting me through this process. To Kevin, Sophie R, Sophie E, and my sister Phoebe, thank you for reading my drafts, and advising me when the going got tough. To all my wonderful friends, who were always there with encouraging words, warm hugs, and many congratulations, I cannot thank you enough.
    [Show full text]
  • SUPPLEMENTARY DATA Supplementary Figure 1. The
    SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary
    [Show full text]