The Influence of Selol on the Expression of Oxidative Stress Genes in Normal and Malignant Prostate Cells
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent -
Peroxiredoxins in Neurodegenerative Diseases
antioxidants Review Peroxiredoxins in Neurodegenerative Diseases Monika Szeliga Mossakowski Medical Research Centre, Department of Neurotoxicology, Polish Academy of Sciences, 5 Pawinskiego Street, 02-106 Warsaw, Poland; [email protected]; Tel.: +48-(22)-6086416 Received: 31 October 2020; Accepted: 27 November 2020; Published: 30 November 2020 Abstract: Substantial evidence indicates that oxidative/nitrosative stress contributes to the neurodegenerative diseases. Peroxiredoxins (PRDXs) are one of the enzymatic antioxidant mechanisms neutralizing reactive oxygen/nitrogen species. Since mammalian PRDXs were identified 30 years ago, their significance was long overshadowed by the other well-studied ROS/RNS defense systems. An increasing number of studies suggests that these enzymes may be involved in the neurodegenerative process. This article reviews the current knowledge on the expression and putative roles of PRDXs in neurodegenerative disorders such as Alzheimer’s disease, Parkinson’s disease and dementia with Lewy bodies, multiple sclerosis, amyotrophic lateral sclerosis and Huntington’s disease. Keywords: peroxiredoxin (PRDX); oxidative stress; nitrosative stress; neurodegenerative disease 1. Introduction Under physiological conditions, reactive oxygen species (ROS, e.g., superoxide anion, O2 -; · hydrogen peroxide, H O ; hydroxyl radical, OH; organic hydroperoxide, ROOH) and reactive nitrogen 2 2 · species (RNS, e.g., nitric oxide, NO ; peroxynitrite, ONOO-) are constantly produced as a result of normal · cellular metabolism and play a crucial role in signal transduction, enzyme activation, gene expression, and regulation of immune response [1]. The cells are endowed with several enzymatic (e.g., glutathione peroxidase (GPx); peroxiredoxin (PRDX); thioredoxin (TRX); catalase (CAT); superoxide dismutase (SOD)), and non-enzymatic (e.g., glutathione (GSH); quinones; flavonoids) antioxidant systems that minimize the levels of ROS and RNS. -
Epithelial Ovarian Cancer: Searching for New Modulators of Drug Resistance
UNIVERSITÀ DEGLI STUDI DI UDINE Dipartimento di scienze mediche e biologiche PhD COURSE IN BIOMEDICAL SCIENCES AND BIOTECHNOLOGY XXIX cycle PhD THESIS Epithelial Ovarian Cancer: searching for new modulators of drug resistance. PhD student Supervisor Prof. Carlo Ennio Michele Pucillo Valentina Ranzuglia Co-supervisors Dr. Gustavo Baldassarre Dr. Monica Schiappacassi PhD coordinator Prof. Claudio Brancolini Academic year 2015/2016 This PhD work was done at Centro di Riferimento Oncologico (CRO, National Cancer Institute ) of Aviano, in the Division of Experimental Oncology 2 directed by Dr. Gustavo Baldassarre. i Table of contents Abstract 3 1. Introduction 4 1.1 Epithelial Ovarian Cancer 4 1.1.1 Platinum resistance 5 1.2 Functional Genomic Screening 8 1.3 Serum and glucocorticoid-regulated kinases 9 1.3.1 SGK structure 10 1.3.2 SGK activation and regulation 11 1.3.3 Role of SGKs in regulation of molecular and cellular functions 13 1.3.4 Serum- and glucocorticoid-regulated kinases in cancer 15 1.4 Autophagy 17 2.Aim of the study 21 3.Results 22 3.1 Identification of SGK2 as a mediator of platinum sensitivity in EOC cells. 22 3.2 SGK2 silencing sensitizes EOC cells to platinum. 23 3.3 SGK2 overexpression confers an increased resistance to platinum drug. 25 3.4 SGK2-overexpressing cells present an increased in vitro and in vivo growth 26 rate 3.5 SGK2 kinase activity is involved in EOC sensitivity to platinum treatment. 28 3.6 The SGK1/SGK2 kinase inhibitor, GSK650394, reduces cell viability in 29 combination with platinum. 3.7 GSK650394 is able to make SGK2-expressing cells more sensitive to platinum. -
AGC Kinases in Mtor Signaling, in Mike Hall and Fuyuhiko Tamanoi: the Enzymes, Vol
Provided for non-commercial research and educational use only. Not for reproduction, distribution or commercial use. This chapter was originally published in the book, The Enzymes, Vol .27, published by Elsevier, and the attached copy is provided by Elsevier for the author's benefit and for the benefit of the author's institution, for non-commercial research and educational use including without limitation use in instruction at your institution, sending it to specific colleagues who know you, and providing a copy to your institution’s administrator. All other uses, reproduction and distribution, including without limitation commercial reprints, selling or licensing copies or access, or posting on open internet sites, your personal or institution’s website or repository, are prohibited. For exceptions, permission may be sought for such use through Elsevier's permissions site at: http://www.elsevier.com/locate/permissionusematerial From: ESTELA JACINTO, AGC Kinases in mTOR Signaling, In Mike Hall and Fuyuhiko Tamanoi: The Enzymes, Vol. 27, Burlington: Academic Press, 2010, pp.101-128. ISBN: 978-0-12-381539-2, © Copyright 2010 Elsevier Inc, Academic Press. Author's personal copy 7 AGC Kinases in mTOR Signaling ESTELA JACINTO Department of Physiology and Biophysics UMDNJ-Robert Wood Johnson Medical School, Piscataway New Jersey, USA I. Abstract The mammalian target of rapamycin (mTOR), a protein kinase with homology to lipid kinases, orchestrates cellular responses to growth and stress signals. Various extracellular and intracellular inputs to mTOR are known. mTOR processes these inputs as part of two mTOR protein com- plexes, mTORC1 or mTORC2. Surprisingly, despite the many cellular functions that are linked to mTOR, there are very few direct mTOR substrates identified to date. -
(ER) Membrane Contact Sites (MCS) Uses Toxic Waste to Deliver Messages Edgar Djaha Yoboue1, Roberto Sitia1 and Thomas Simmen2
Yoboue et al. Cell Death and Disease (2018) 9:331 DOI 10.1038/s41419-017-0033-4 Cell Death & Disease REVIEW ARTICLE Open Access Redox crosstalk at endoplasmic reticulum (ER) membrane contact sites (MCS) uses toxic waste to deliver messages Edgar Djaha Yoboue1, Roberto Sitia1 and Thomas Simmen2 Abstract Many cellular redox reactions housed within mitochondria, peroxisomes and the endoplasmic reticulum (ER) generate hydrogen peroxide (H2O2) and other reactive oxygen species (ROS). The contribution of each organelle to the total cellular ROS production is considerable, but varies between cell types and also over time. Redox-regulatory enzymes are thought to assemble at a “redox triangle” formed by mitochondria, peroxisomes and the ER, assembling “redoxosomes” that sense ROS accumulations and redox imbalances. The redoxosome enzymes use ROS, potentially toxic by-products made by some redoxosome members themselves, to transmit inter-compartmental signals via chemical modifications of downstream proteins and lipids. Interestingly, important components of the redoxosome are ER chaperones and oxidoreductases, identifying ER oxidative protein folding as a key ROS producer and controller of the tri-organellar membrane contact sites (MCS) formed at the redox triangle. At these MCS, ROS accumulations could directly facilitate inter-organellar signal transmission, using ROS transporters. In addition, ROS influence the flux 2+ 2+ of Ca ions, since many Ca handling proteins, including inositol 1,4,5 trisphosphate receptors (IP3Rs), SERCA pumps or regulators of the mitochondrial Ca2+ uniporter (MCU) are redox-sensitive. Fine-tuning of these redox and ion signaling pathways might be difficult in older organisms, suggesting a dysfunctional redox triangle may accompany 1234567890 1234567890 the aging process. -
In Thyroid Cancer
Metere et al. Cancer Cell Int (2018) 18:7 https://doi.org/10.1186/s12935-018-0504-4 Cancer Cell International PRIMARY RESEARCH Open Access A possible role for selenoprotein glutathione peroxidase (GPx1) and thioredoxin reductases (TrxR1) in thyroid cancer: our experience in thyroid surgery Alessio Metere1* , Francesca Frezzotti1, Claire Elizabeth Graves2, Massimo Vergine1, Alessandro De Luca1, Donatella Pietraforte3 and Laura Giacomelli1 Abstract Background: Oxidative stress is responsible for some alterations in the chemical structure and, consequently, in the function of proteins, lipids, and DNA. Recent studies have linked oxidative stress to cancers, particularly thyroid cancer, but the mechanisms remain unclear. Here, we further characterize the role of oxidative stress in thyroid cancer by analyzing the expression of two selenium antioxidant molecules, glutathione peroxidase (GPx1) and thioredoxin reductase (TrxR1) in thyroid cancer cells. Methods: Samples of both healthy thyroid tissue and thyroid tumor were taken for analysis after total thyroidectomy. The expression of GPx1 and TrxR1 was revealed by Western blot analysis and quantifed by densitometric analy- ses, while the evaluation of free radicals was performed by Electron Paramagnetic Resonance (EPR)-spin trapping technique. Results: Our results show a decrease in the expression of GPx1 and TrxR1 ( 45.7 and 43.2% respectively, p < 0.01) in the thyroid cancer cells compared to the healthy cells. In addition, the EPR− technique− shows an increase of free radicals in tumor tissue, signifcantly higher than that found in healthy thyroid tissue ( 116.3%, p < 0.01). + Conclusions: Our fndings underscore the relationship between thyroid cancer and oxidative stress, showing the imbalance of the oxidant/antioxidant system in thyroid cancer tissue. -
PRDX4 (Human) ELISA Kit 1
PRDX4 (Human) ELISA Kit 1. The Association of Peroxiredoxin 4 with the Initiation and Progression of Hepatocellular Carcinoma. Guo X, Catalog Number: KA2121 Noguchi H, Ishii N, Homma T, Hamada T, Hiraki T, Zhang J, Matsuo K, Yokoyama S, Ishibashi H, Regulatory Status: For research use only (RUO) Fukushige T, Kanekura T, Fujii J, Uramoto H, Tanimoto A, Yamada S. Antioxid Redox Signal. 2018 Apr 24. Product Description: PRDX4 (Human) ELISA Kit is a [Epub ahead of print] sandwich enzyme immunoassay for the quantitative 2. Galectin-3 downregulates antioxidant peroxiredoxin-4 measurement of human PRDX4. in human cardiac fibroblasts: a new pathway to induce cardiac damage? Ibarrola J, Arrieta V, Sadaba R, Suitable Sample: Buffered solution Martinez-Martinez E, Garcia-Pena A, Alvarez V, Fernandez-Celis A, Gainza A, Santamaria E, Sample Volume: 100 uL Fernandez-Irigoyen J, Cachofeiro V, Zalba G, Fay R, Label: HRP-conjugated Rossignol P, Lopez-Andres N. Clin Sci (Lond). 2018 Apr 19. pii: CS20171389. [Epub ahead of print] Detection Method: Colorimetric 3. Overexpression of Peroxiredoxin 4 Affects Intestinal Function in a Dietary Mouse Model of Nonalcoholic Fatty Calibration Range: 78.13 to 5000 pg/mL Liver Disease. Nawata A, Noguchi H, Mazaki Y, Kurahashi T, Izumi H, Wang KY, Guo X, Uramoto H, Limit of Detection: 6.77 pg/mL Kohno K, Taniguchi H, Tanaka Y, Fujii J, Sasaguri Y, Tanimoto A, Nakayama T, Yamada S. PLoS One. 2016 Reactivity: Human Apr 1;11(4):e0152549. Applications: Quant (See our web site product page for detailed applications information) Protocols: See our web site at http://www.abnova.com/support/protocols.asp or product page for detailed protocols Storage Instruction: Store the kit at 4°C. -
Differential Effects of Tranylcypromine and Imidazole on Mammary Carcinogenesis in Rats Fed Low and High Fat Diets1
[CANCER RESEARCH 49, 3168-3172, June 15, 1989] Differential Effects of Tranylcypromine and Imidazole on Mammary Carcinogenesis in Rats Fed Low and High Fat Diets1 David L. McCormick,2 Ann M. Spicer, and Jacqueline L. Hollister Life Sciences Department, IIT Research Institute, Chicago, Illinois 60616 ABSTRACT studies with this class of compounds used inhibitors of the cyclooxygenase pathway of arachidonic acid catabolism; exper Neoplastic development in the rat mammary gland can be suppressed iments performed in our laboratory and by Ip and coworkers by inhibition of the activity of several enzymes involved in eicosanoid biosynthesis. In order to investigate the potential utility of prostacyclin demonstrated that the postcarcinogen phase of rat mammary and thromboxane synthetases as targets for mammary cancer chemopre- carcinogenesis can be suppressed by dietary administration of vention, experiments were conducted to determine the influence of tran- indomethacin (7, 8) or flurbiprofen (9). However, although the ylcypromine (TCP), an inhibitor of prostacyclin synthetase, and ¡mida/ole anticarcinogenic activity of indomethacin is similar to that of (IMI), an inhibitor of thromboxane synthetase, on mammary carcinogen- more widely studied inhibitors of mammary carcinogenesis such esis induced in rats by 7V-methyl-/V-nitrosourea. Fifty-day-old female as retinyl acetate (10) and selenium (11), the dose levels of Sprague-Dawley |Hsd:SD(BR)l rats received a single s.c. dose of 0 or 40 indomethacin required for chemopreventive efficacy in rats are mg of .V-mcth>l-.Y-nitrosoiirea per kg of body weight. Beginning 7 days close to the threshold of lethal toxicity (12). For this reason, after carcinogen administration, groups of rats were fed isoenergetic, studies are ongoing to identify additional modifiers of arachi casein-based diets containing 3 or 20% corn oil (w/w), supplemented with donic acid metabolism whose administration provides an effec (per kg of diet) 10 mg of TCP, 1000 mg of IMI, or sucrose carrier only. -
Curative Effect of Selenium Against Indomethacin-Induced Gastric Ulcers in Rats
J. Microbiol. Biotechnol. (2011), 21(4), 400–404 doi: 10.4014/jmb.1012.12019 First published online 19 January 2011 Curative Effect of Selenium Against Indomethacin-Induced Gastric Ulcers in Rats Kim, Jeong-Hwan1, Byung-Woo Kim1,3,4, Hyun-Ju Kwon1,3,4, and Soo-Wan Nam1,2,4* 1Department of Biomaterial Control, 2Department of Biotechnology and Bioengineering, 3Department of Life Science and Biotechnology, and 4Blue-Bio Industry RIC, Dong-Eui University, Busan 614-714, Korea Received: December 16, 2010 / Revised: December 30, 2010 / Accepted: December 31, 2010 Indomethacin is a nonsteroid anti-inflammatory agent erosions, ulcerative lesions, and petechial bleeding in the that is known to induce severe gastric mucosal lesions. In mucosa of stomach as serious side effects [10, 18]. According this study, we investigated the effect of selenium on gastric to previous reports, the oral administration of indomethacin in mucosal lesions in rats. To confirm the curative effect of rats causes ulcerative lesions in the gastric mucosa [7, 13]. selenium against indomethacin-induced gastric ulcers, Furthermore, the development of the gastric mucosal lesions gastric ulcers were induced by oral administration of induced by indomethacin is mainly mediated through 25 mg/kg indomethacin, and then different doses (10, 50, generation of oxygen free radicals and lipid peroxidation and 100 µg/kg of body weight) of selenium or vehicle were [6, 22, 25, 26, 28, 29]. treated by oral gavage for 3 days. Oral administration of Selenium is an essential nutrient of fundamental importance indomethacin clearly increased the gastric ulcer area in to human biology. It has important metabolic functions in the stomach, whereas selenium applied for 3 days significantly animals, including protection of membrane lipids and decreased the gastric ulcer area in a dose-dependent macromolecules from oxidative damage produced by peroxides manner. -
Independent Evolution of Four Heme Peroxidase Superfamilies
Archives of Biochemistry and Biophysics xxx (2015) xxx–xxx Contents lists available at ScienceDirect Archives of Biochemistry and Biophysics journal homepage: www.elsevier.com/locate/yabbi Independent evolution of four heme peroxidase superfamilies ⇑ Marcel Zámocky´ a,b, , Stefan Hofbauer a,c, Irene Schaffner a, Bernhard Gasselhuber a, Andrea Nicolussi a, Monika Soudi a, Katharina F. Pirker a, Paul G. Furtmüller a, Christian Obinger a a Department of Chemistry, Division of Biochemistry, VIBT – Vienna Institute of BioTechnology, University of Natural Resources and Life Sciences, Muthgasse 18, A-1190 Vienna, Austria b Institute of Molecular Biology, Slovak Academy of Sciences, Dúbravská cesta 21, SK-84551 Bratislava, Slovakia c Department for Structural and Computational Biology, Max F. Perutz Laboratories, University of Vienna, A-1030 Vienna, Austria article info abstract Article history: Four heme peroxidase superfamilies (peroxidase–catalase, peroxidase–cyclooxygenase, peroxidase–chlo- Received 26 November 2014 rite dismutase and peroxidase–peroxygenase superfamily) arose independently during evolution, which and in revised form 23 December 2014 differ in overall fold, active site architecture and enzymatic activities. The redox cofactor is heme b or Available online xxxx posttranslationally modified heme that is ligated by either histidine or cysteine. Heme peroxidases are found in all kingdoms of life and typically catalyze the one- and two-electron oxidation of a myriad of Keywords: organic and inorganic substrates. In addition to this peroxidatic activity distinct (sub)families show pro- Heme peroxidase nounced catalase, cyclooxygenase, chlorite dismutase or peroxygenase activities. Here we describe the Peroxidase–catalase superfamily phylogeny of these four superfamilies and present the most important sequence signatures and active Peroxidase–cyclooxygenase superfamily Peroxidase–chlorite dismutase superfamily site architectures. -
A Machine Learning Tool for Predicting Protein Function Anna
The Woolf Classifier Building Pipeline: A Machine Learning Tool for Predicting Protein Function Anna Farrell-Sherman Submitted in Partial Fulfillment of the Prerequisite for Honors in Computer Science under the advisement of Eni Mustafaraj and Vanja Klepac-Ceraj May 2019 © 2019 Anna Farrell-Sherman Abstract Proteins are the machinery that allow cells to grow, reproduce, communicate, and create multicellular organisms. For all of their importance, scientists still have a hard time understanding the function of a protein based on its sequence alone. For my honors thesis in computer science, I created a machine learning tool that can predict the function of a protein based solely on its amino acid sequence. My tool gives scientists a structure in which to build a � Nearest Neighbor or random forest classifier to distinguish between proteins that can and cannot perform a given function. Using default Min-Max scaling, and the Matthews Correlation Coefficient for accuracy assessment, the Woolf Pipeline is built with simplified choices to guide users to success. i Acknowledgments There are so many people who made this thesis possible. First, thank you to my wonderful advisors, Eni and Vanja, who never gave up on me, and always pushed me to try my hardest. Thank you also to the other members of my committee, Sohie Lee, Shikha Singh, and Rosanna Hertz for supporting me through this process. To Kevin, Sophie R, Sophie E, and my sister Phoebe, thank you for reading my drafts, and advising me when the going got tough. To all my wonderful friends, who were always there with encouraging words, warm hugs, and many congratulations, I cannot thank you enough. -
SUPPLEMENTARY DATA Supplementary Figure 1. The
SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary