DOCSLIB.ORG

Infection-Induced Colitis in Mice Causes Dynamic and Tissue-Specific Changes in Stress Response and DNA Damage Leading to Colon Cancer

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Infection-Induced Colitis in Mice Causes Dynamic and Tissue-Specific Changes in Stress Response and DNA Damage Leading to Colon Cancer Infection-induced colitis in mice causes dynamic and tissue-specific changes in stress response and DNA damage leading to colon cancer Aswin Mangericha,b, Charles G. Knutsona, Nicola M. Parryc, Sureshkumar Muthupalanic, Wenjie Yea, Erin Prestwicha, Liang Cuia,1, Jose L. McFalinea, Melissa Mobleyc, Zhongming Gec, Koli Taghizadehd, John S. Wishnoka,d, Gerald N. Wogana,d,e,2, James G. Foxa,c,d,2, Steven R. Tannenbauma,d,e,2, and Peter C. Dedona,d,2 aDepartments of Biological Engineering, and eChemistry, cDivision of Comparative Medicine, and dCenter for Environmental Health Science, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, MA 02139; and bUniversity of Konstanz, Department of Biology, D-78457 Konstanz, Germany Contributed by Gerald N. Wogan, May 14, 2012 (sent for review March 20, 2012) −∕− − − Helicobacter hepaticus-infected Rag2 mice emulate many aspects ynitrite (ONOO ), and nitrosoperoxycarbonate (ONOOCO2 ) of human inflammatory bowel disease, including the development (5). Moreover, activated neutrophils are considered the primary of colitis and colon cancer. To elucidate mechanisms of inflamma- source of the potent oxidant and halogenating agent hypochlor- tion-induced carcinogenesis, we undertook a comprehensive ana- ous acid (HOCl) via activation of myeloperoxidase (MPO) (6–8). lysis of histopathology, molecular damage, and gene expression These chemical mediators of inflammation can damage all changes during disease progression in these mice. Infected mice de- classes of cellular molecules, including DNA, RNA, protein, veloped severe colitis and hepatitis by 10 wk post-infection, progres- lipids, and metabolites, by both direct and indirect mechanisms. sing into colon carcinoma by 20 wk post-infection, with pronounced For example, DNA damage caused by halogenation, deamina- pathology in the cecum and proximal colon marked by infiltration tion, and oxidation, as well as by nucleobase adduct formation of neutrophils and macrophages. Transcriptional profiling revealed caused by lipid peroxidation products, can potentially induce de decreased expression of DNA repair and oxidative stress response novo mutations and epigenetic changes initiating tumor develop- genes in colon, but not in liver. Mass spectrometric analysis revealed ment (1, 2, 9). Several recent studies involving mouse models higher levels of DNA and RNA damage products in liver compared to of inflammation have provided evidence supporting such a colon and infection-induced increases in 5-chlorocytosine in DNA scenario (10–12). Similar pathways disrupt the function of RNA, and RNA and hypoxanthine in DNA. Paradoxically, infection was as proposed for major human degenerative diseases such as associated with decreased levels of DNA etheno adducts. Levels Alzheimer’s disease, Parkinson’s disease, and atherosclerosis of nucleic acid damage from the same chemical class were strongly (13, 14), whereas protein damage caused by oxidation, nitration, correlated in both liver and colon. The results support a model of and halogenation can impair function and stability, including inflammation-mediated carcinogenesis involving infiltration of those of tumor suppressors, oncogenes, and factors that maintain phagocytes and generation of reactive species that cause local mo- fidelity during DNA replication (4, 15, 16). lecular damage leading to cell dysfunction, mutation, and cell death. To better understand the complex pathophysiology of inflam- There are strong correlations among histopathology, phagocyte mation, we undertook a comprehensive analysis of chemical and infiltration, and damage chemistry that suggest a major role for biological end points in an established model of human IBD: neutrophils in inflammation-associated cancer progression. Further, Rag2−∕− mice infected with Helicobacter hepaticus (17, 18). This paradoxical changes in nucleic acid damage were observed in tissue- Gram-negative spiral bacterium colonizes the liver and intestinal and chemistry-specific patterns. The results also reveal features of crypts of the cecum and the colon of several mouse strains, estab- cell stress response that point to microbial pathophysiology and me- lishing a life-long infection (19, 20). H. hepaticus does not typi- chanisms of cell senescence as important mechanistic links to cancer. cally cause disease in immunocompetent mice, but infection in susceptible inbred strains can lead to hepatitis whereas immuno- ∣ mass spectrometry biomarkers deficient mice develop chronic colitis (21–23). For example, mice lacking the recombinase-activating gene-2 (Rag2) do not possess hronic inflammation is a major risk factor for many human functional lymphocytes, and H. hepaticus infection results in Cdiseases, including cancer. Epidemiological studies suggest chronic colitis and colon cancer (17). H. hepaticus infection in that at least 20% of all cancers are caused by chronic inflamma- Rag2−∕− mice emulates many aspects of human IBD, with colo- tory conditions, such as the causative role of Heliobacter pylori nic and cecal infiltration of macrophages and neutrophils pre- and hepatitis B virus infections in gastric and liver cancer, respec- sumably causing increased production of reactive chemical tively, and the strong association of inflammatory bowel disease species at sites of infection (18). (IBD) and colon cancer (1, 2). Although the underlying molecu- lar mechanisms linking inflammation and cancer are poorly un- derstood, many of the steps have been defined. In the case of Author contributions: A.M., C.G.K., E.P., L.C., J.L.M., J.S.W., G.N.W., J.G.F., S.R.T., and P.C.D. infection, the inciting event is tissue injury, with local release of designed research; A.M., W.Y., E.P., L.C., J.L.M., M.M., Z.G., K.T., and J.S.W. performed research; A.M., N.M.P., S.M., W.Y., E.P., L.C., M.M., Z.G., K.T., J.S.W., G.N.W., J.G.F., S.R.T., cytokines and other chemotactic factors causing infiltration and and P.C.D. analyzed data; and A.M., C.G.K., N.M.P., S.M., W.Y., E.P., L.C., J.L.M., M.M., activation of macrophages and neutrophils to produce large Z.G., K.T., J.S.W., G.N.W., J.G.F., S.R.T., and P.C.D. wrote the paper. quantities of other cytokines and chemokines as well as reactive The authors declare no conflict of interest. chemical species that cause mutagenic and cytotoxic damage 1Present address: Singapore-MIT Alliance for Research and Technology, Center for Life (3, 4). For example, up-regulation and activation of inducible NO Sciences, National University of Singapore, 28 Medical Drive, #05-06, Singapore 117456. synthase (iNOS) and NADPH oxidase in macrophages produces 2To whom correspondence may be addressed. E-mail: [email protected], [email protected], •− nitric oxide (NO) and superoxide (O2 ), respectively. Subse- [email protected], or [email protected]. quent reactions yield a battery of reactive species, including the See Author Summary on page 10753 (volume 109, number 27). potent nitrosating agent nitrous anhydride (N2O3) and the oxidiz- This article contains supporting information online at www.pnas.org/lookup/suppl/ • ing and nitrating agents nitrogen dioxide radical (NO2 ), perox- doi:10.1073/pnas.1207829109/-/DCSupplemental. E1820–E1829 ∣ PNAS ∣ Published online June 11, 2012 www.pnas.org/cgi/doi/10.1073/pnas.1207829109 Downloaded by guest on September 26, 2021 To test this hypothesis and identify potential biomarkers of the A B PNAS PLUS pathophysiology of inflammation, we characterized the time course of colon and liver pathology in H. hepaticus-infected Rag2−∕− mice with a battery of quantitative molecular, histolo- gical, and bioanalytical assays. For example, we developed and applied an isotope-dilution liquid chromatography-coupled tandem mass spectrometry (LC-MS/MS) method (SI Appendix, Fig. S1) to quantify 14 different DNA and RNA damage products anticipated to represent the full spectrum of inflammation chemistries. This included the 2-deoxyribo- and ribonucleoside forms of base halogenation (5-chlorocytosine, 5-Cl-C), nitrosa- tive deamination (xanthine, X; hypoxanthine, I), alkylation by lipid peroxidation products (1, N6-ethenoadenine, εA; 3,N4- ethenocytosine, εC), and oxidation (8-oxo-7,8-dihydroguanine, CD 8-oxo-G; spiroiminodihydantoin, Sp; guanidinohydantoin, Gh) (see SI Appendix, Fig. S2). Data from these chemical assays were correlated with quantitative scores from histopathological, immunohistochemical, and gene expression analyses. These ana- lyses revealed a variety of unique features of infection-induced colitis and carcinogenesis. Results Histological Analysis of Colon and Liver from H. hepaticus-infected Rag2−∕− Mice. To monitor and characterize disease progression, colon and liver tissues were harvested at two different time-points following H. hepaticus infection: 10 and 20 weeks post-infection (w p.i.). Quantitative PCR analysis revealed that all infected Fig. 1. H. hepaticus-infected mice develop chronic colitis, colon carcinoma, Rag2−∕− mice were positive for H. hepaticus, whereas the sham and sporadic hepatitis. (A–C) HAIs of colitis were calculated by summing controls were negative. The tissue samples were subjected to a individual scores of inflammation, edema, epithelial defects, crypt atrophy, hyperplasia, and dysplasia for (A)cecum,(B) proximal colon, and (C) distal wide range of analyses, starting with histopathology and immuno- colon. (D) HIs were calculated by summing individual subfeature histopathol- histochemistry. Although there were minimal or no lesions in ogy scores from lobular, portal, and interface inflammation,
Load more

Recommended publications
  • MPO) in Inflammatory Communication
    antioxidants Review The Enzymatic and Non-Enzymatic Function of Myeloperoxidase (MPO) in Inflammatory Communication Yulia Kargapolova * , Simon Geißen, Ruiyuan Zheng, Stephan Baldus, Holger Winkels * and Matti Adam Department III of Internal Medicine, Heart Center, Faculty of Medicine and University Hospital of Cologne, 50937 North Rhine-Westphalia, Germany; [email protected] (S.G.); [email protected] (R.Z.); [email protected] (S.B.); [email protected] (M.A.) * Correspondence: [email protected] (Y.K.); [email protected] (H.W.) Abstract: Myeloperoxidase is a signature enzyme of polymorphonuclear neutrophils in mice and humans. Being a component of circulating white blood cells, myeloperoxidase plays multiple roles in various organs and tissues and facilitates their crosstalk. Here, we describe the current knowledge on the tissue- and lineage-specific expression of myeloperoxidase, its well-studied enzymatic activity and incoherently understood non-enzymatic role in various cell types and tissues. Further, we elaborate on Myeloperoxidase (MPO) in the complex context of cardiovascular disease, innate and autoimmune response, development and progression of cancer and neurodegenerative diseases. Keywords: myeloperoxidase; oxidative burst; NETs; cellular internalization; immune response; cancer; neurodegeneration Citation: Kargapolova, Y.; Geißen, S.; Zheng, R.; Baldus, S.; Winkels, H.; Adam, M. The Enzymatic and Non-Enzymatic Function of 1. Introduction. MPO Conservation Across Species, Maturation in Myeloid Progenitors, Myeloperoxidase (MPO) in and its Role in Immune Responses Inflammatory Communication. Myeloperoxidase (MPO) is a lysosomal protein and part of the organism’s host-defense Antioxidants 2021, 10, 562. https:// system. MPOs’ pivotal function is considered to be its enzymatic activity in response to doi.org/10.3390/antiox10040562 invading pathogenic agents.
    [Show full text]
  • In Thyroid Cancer
    Metere et al. Cancer Cell Int (2018) 18:7 https://doi.org/10.1186/s12935-018-0504-4 Cancer Cell International PRIMARY RESEARCH Open Access A possible role for selenoprotein glutathione peroxidase (GPx1) and thioredoxin reductases (TrxR1) in thyroid cancer: our experience in thyroid surgery Alessio Metere1* , Francesca Frezzotti1, Claire Elizabeth Graves2, Massimo Vergine1, Alessandro De Luca1, Donatella Pietraforte3 and Laura Giacomelli1 Abstract Background: Oxidative stress is responsible for some alterations in the chemical structure and, consequently, in the function of proteins, lipids, and DNA. Recent studies have linked oxidative stress to cancers, particularly thyroid cancer, but the mechanisms remain unclear. Here, we further characterize the role of oxidative stress in thyroid cancer by analyzing the expression of two selenium antioxidant molecules, glutathione peroxidase (GPx1) and thioredoxin reductase (TrxR1) in thyroid cancer cells. Methods: Samples of both healthy thyroid tissue and thyroid tumor were taken for analysis after total thyroidectomy. The expression of GPx1 and TrxR1 was revealed by Western blot analysis and quantifed by densitometric analy- ses, while the evaluation of free radicals was performed by Electron Paramagnetic Resonance (EPR)-spin trapping technique. Results: Our results show a decrease in the expression of GPx1 and TrxR1 ( 45.7 and 43.2% respectively, p < 0.01) in the thyroid cancer cells compared to the healthy cells. In addition, the EPR− technique− shows an increase of free radicals in tumor tissue, signifcantly higher than that found in healthy thyroid tissue ( 116.3%, p < 0.01). + Conclusions: Our fndings underscore the relationship between thyroid cancer and oxidative stress, showing the imbalance of the oxidant/antioxidant system in thyroid cancer tissue.
    [Show full text]
  • Lncrna-MEG3 Functions As Ferroptotic Promoter to Mediate OGD Combined High Glucose-Induced Death of Rat Brain Microvascular Endothelial Cells Via the P53-GPX4 Axis
    LncRNA-MEG3 functions as ferroptotic promoter to mediate OGD combined high glucose-induced death of rat brain microvascular endothelial cells via the p53-GPX4 axis Cheng Chen Xiangya Hospital Central South University Yan Huang Xiangya Hospital Central South University Pingping Xia Xiangya Hospital Central South University Fan Zhang Xiangya Hospital Central South University Longyan Li Xiangya Hospital Central South University E Wang Xiangya Hospital Central South University Qulian Guo Xiangya Hospital Central South University Zhi Ye ( [email protected] ) Xiangya Hospital Central South University https://orcid.org/0000-0002-7678-0926 Research article Keywords: lncRNA-MEG3, p53, ferroptosis, ischemia, GPX4, OGD, hyperglycemia, Posted Date: May 18th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-28622/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/21 Abstract Background Individuals with diabetes are exposed to a higher risk of perioperative stroke than non- diabetics mainly due to persistent hyperglycemia. lncRNA-MEG3 (long non-coding RNA maternally expressed gene 3) has been considered as an important mediator in regulating ischemic stroke. However, the functional and regulatory roles of lncRNA-MEG3 in diabetic brain ischemic injury remain unclear. Results In this study, RBMVECs (the rat brain microvascular endothelial cells) were exposed to 6 h of OGD (oxygen and glucose deprivation), and subsequent reperfusion via incubating cells with glucose of various high concentrations for 24 h to imitate in vitro diabetic brain ischemic injury. It was shown that the marker events of ferroptosis and increased lncRNA-MEG3 expression occurred after the injury induced by OGD combined with hyperglycemic treatment.
    [Show full text]
  • SUPPLEMENTARY DATA Supplementary Figure 1. The
    SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary
    [Show full text]
  • Thiol Peroxidases Mediate Specific Genome-Wide Regulation of Gene Expression in Response to Hydrogen Peroxide
    Thiol peroxidases mediate specific genome-wide regulation of gene expression in response to hydrogen peroxide Dmitri E. Fomenkoa,1,2, Ahmet Koca,1, Natalia Agishevaa, Michael Jacobsena,b, Alaattin Kayaa,c, Mikalai Malinouskia,c, Julian C. Rutherfordd, Kam-Leung Siue, Dong-Yan Jine, Dennis R. Winged, and Vadim N. Gladysheva,c,2 aDepartment of Biochemistry, University of Nebraska, Lincoln, NE 68588-0664; bDepartment of Life Sciences, Wayne State College, Wayne, NE 68787; dDepartment of Medicine, University of Utah Health Sciences Center, Salt Lake City, UT 84132; eDepartment of Biochemistry, University of Hong Kong, Hong Kong, China; and cDivision of Genetics, Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115 Edited by Joan Selverstone Valentine, University of California, Los Angeles, CA, and approved December 22, 2010 (received for review July 21, 2010) Hydrogen peroxide is thought to regulate cellular processes by and could withstand significant oxidative stress. It responded to direct oxidation of numerous cellular proteins, whereas antioxi- several redox stimuli by robust transcriptional reprogramming. dants, most notably thiol peroxidases, are thought to reduce However, it was unable to transcriptionally respond to hydrogen peroxides and inhibit H2O2 response. However, thiol peroxidases peroxide. The data suggested that thiol peroxidases transfer have also been implicated in activation of transcription factors oxidative signals from peroxides to target proteins, thus activating and signaling. It remains unclear if these enzymes stimulate or various transcriptional programs. This study revealed a previously inhibit redox regulation and whether this regulation is widespread undescribed function of these proteins, in addition to their roles or limited to a few cellular components.
    [Show full text]
  • Role of Oxidative Stress and Nrf2/KEAP1 Signaling in Colorectal Cancer: Mechanisms and Therapeutic Perspectives with Phytochemicals
    antioxidants Review Role of Oxidative Stress and Nrf2/KEAP1 Signaling in Colorectal Cancer: Mechanisms and Therapeutic Perspectives with Phytochemicals Da-Young Lee, Moon-Young Song and Eun-Hee Kim * College of Pharmacy and Institute of Pharmaceutical Sciences, CHA University, Seongnam 13488, Korea; [email protected] (D.-Y.L.); [email protected] (M.-Y.S.) * Correspondence: [email protected]; Tel.: +82-31-881-7179 Abstract: Colorectal cancer still has a high incidence and mortality rate, according to a report from the American Cancer Society. Colorectal cancer has a high prevalence in patients with inflammatory bowel disease. Oxidative stress, including reactive oxygen species (ROS) and lipid peroxidation, has been known to cause inflammatory diseases and malignant disorders. In particular, the nuclear factor erythroid 2-related factor 2 (Nrf2)/Kelch-like ECH-related protein 1 (KEAP1) pathway is well known to protect cells from oxidative stress and inflammation. Nrf2 was first found in the homolog of the hematopoietic transcription factor p45 NF-E2, and the transcription factor Nrf2 is a member of the Cap ‘N’ Collar family. KEAP1 is well known as a negative regulator that rapidly degrades Nrf2 through the proteasome system. A range of evidence has shown that consumption of phytochemicals has a preventive or inhibitory effect on cancer progression or proliferation, depending on the stage of colorectal cancer. Therefore, the discovery of phytochemicals regulating the Nrf2/KEAP1 axis and Citation: Lee, D.-Y.; Song, M.-Y.; verification of their efficacy have attracted scientific attention. In this review, we summarize the role Kim, E.-H. Role of Oxidative Stress of oxidative stress and the Nrf2/KEAP1 signaling pathway in colorectal cancer, and the possible and Nrf2/KEAP1 Signaling in utility of phytochemicals with respect to the regulation of the Nrf2/KEAP1 axis in colorectal cancer.
    [Show full text]
  • Programmed Cell-Death by Ferroptosis: Antioxidants As Mitigators
    International Journal of Molecular Sciences Review Programmed Cell-Death by Ferroptosis: Antioxidants as Mitigators Naroa Kajarabille 1 and Gladys O. Latunde-Dada 2,* 1 Nutrition and Obesity Group, Department of Nutrition and Food Sciences, University of the Basque Country (UPV/EHU), 01006 Vitoria, Spain; [email protected] 2 King’s College London, Department of Nutritional Sciences, Faculty of Life Sciences and Medicine, Franklin-Wilkins Building, 150 Stamford Street, London SE1 9NH, UK * Correspondence: [email protected] Received: 9 September 2019; Accepted: 2 October 2019; Published: 8 October 2019 Abstract: Iron, the fourth most abundant element in the Earth’s crust, is vital in living organisms because of its diverse ligand-binding and electron-transfer properties. This ability of iron in the redox cycle as a ferrous ion enables it to react with H2O2, in the Fenton reaction, to produce a hydroxyl radical ( OH)—one of the reactive oxygen species (ROS) that cause deleterious oxidative damage • to DNA, proteins, and membrane lipids. Ferroptosis is a non-apoptotic regulated cell death that is dependent on iron and reactive oxygen species (ROS) and is characterized by lipid peroxidation. It is triggered when the endogenous antioxidant status of the cell is compromised, leading to lipid ROS accumulation that is toxic and damaging to the membrane structure. Consequently, oxidative stress and the antioxidant levels of the cells are important modulators of lipid peroxidation that induce this novel form of cell death. Remedies capable of averting iron-dependent lipid peroxidation, therefore, are lipophilic antioxidants, including vitamin E, ferrostatin-1 (Fer-1), liproxstatin-1 (Lip-1) and possibly potent bioactive polyphenols.
    [Show full text]
  • Myeloperoxidase-Mediated Platelet Release Reaction
    Myeloperoxidase-Mediated Platelet Release Reaction Robert A. Clark J Clin Invest. 1979;63(2):177-183. https://doi.org/10.1172/JCI109287. Research Article The ability of the neutrophil myeloperoxidase-hydrogen peroxide-halide system to induce the release of human platelet constituents was examined. Both lytic and nonlytic effects on platelets were assessed by comparison of the simultaneously measured release of a dense-granule marker, [3H]serotonin, and a cytoplasmic marker, [14C]adenine. Incubation of platelets with H2O2 alone (20 μM H2O2 for 10 min) resulted in a small, although significant, release of both serotonin and adenine, suggesting some platelet lysis. Substantial release of these markers was observed only with increased H2O2 concentrations (>0.1 mM) or prolonged incubation (1-2 h). Serotonin release by H2O2 was markedly enhanced by the addition of myeloperoxidase and a halide. Under these conditions, there was a predominance of release of serotonin (50%) vs. adenine (13%), suggesting, in part, a nonlytic mechanism. Serotonin release by the complete peroxidase system was rapid, reaching maximal levels in 2-5 min, and was active at H2O2 concentrations as low as 10 μM. It was blocked by agents which inhibit peroxidase (azide, cyanide), 2+ degrade H2O2 (catalase), chelate Mg (EDTA, but not EGTA), or inhibit platelet metabolic activity (dinitrophenol, deoxyglucose). These results suggest that the myeloperoxidase system initiates the release of platelet constituents primarily by a nonlytic process analogous to the platelet release reaction. Because components of the peroxidase system (myeloperoxidase, H2O2) are secreted by activated neutrophils, the reactions described here […] Find the latest version: https://jci.me/109287/pdf Myeloperoxidase-Mediated Platelet Release Reaction ROBERT A.
    [Show full text]
  • MK+10-025-Mouse-Model-For-Inflammatory-Bowel-Diseases
    Intellectual Property (Non-confidential) NATIONAL MEDICAL CENTER AND BECKMAN RESEARCH INSTITUTE Mouse Model for Inflammatory Bowel Diseases DESCRIPTION This is a transgenic double-knockout (DKO) mouse (Gpx1 and Gpx2). Both GPX1 and GPX2 belong to a selenium-dependent glutathione peroxidase (GPXs) family, which are enzymes that are efficient in the reduction of hydroperoxides. Gpx1 is expressed ubiquitously, and Gpx2 is highly expressed in the epithelium of the gastrointestinal (GI) tract. Gpx1/2-DKO mice have early-onset spontaneous ileocolitis beginning around weaning. These mice are an excellent model for human inflammatory bowel diseases (IBD) because they share similar disease etiology, which includes that the disease severity is highly influenced by genetic background, gut microflora, diet, and higher cancer risk in the distal GI tract. Unlike most mouse IBD models which have disrupted genes playing an important role in regulation of adaptive immunity, these Gpx1/2-DKO mice have intact immunity- which resembles human IBD. KEY ASPECTS • Homozygous disruption of both the endogenous Gpx1 and Gpx2 genes. • Disease characteristics include ileitis, colitis, hypothermia, growth retardation, runting, perianal ulceration, diarrhea, wasting syndrome,, IBD histopathology, tumors/cancer in the ileum or colon PUBLISHED DATA • Esworthy RS, Binder SW, Doroshow JH, and Chu FF, Microflora trigger colitis in mice deficient in selenium-dependent glutathione peroxidase and induce Gpx2 gene expression. Biol. Chem. 384: 597- 607, 2003 • Lee D-H, Esworthy RS, Chu, C, Pfeifer GP, and Chu, F-F. Mutation accumulation in the intestine and colon of mice deficient in two intracellular glutathione peroxidases. Cancer Res. 66: 9845-9851, 2006 • Hahn MA, Hahn T, Lee DH, Esworthy RS, Kim B, Riggs AD, Chu F-F, and Pfeifer GP.
    [Show full text]
  • GRAS Notice 665, Lactoperoxidase System
    GRAS Notice (GRN) No. 665 http://www.fda.gov/Food/IngredientsPackagingLabeling/GRAS/NoticeInventory/default.htm ORIGINAL SUBMISSION 000001 Mo•·gan Lewis Gf<N Ob()&h5 [R1~~~~~~[Q) Gary L. Yingling Senior Counsel JUL 1 8 2016 + 1.202. 739 .5610 gary.yingling@morganlewis .com OFFICE OF FOO~ ADDITIVE SAFETY July 15, 2016 VIA FEDERAL EXPRESS Dr. Antonia Mattia Director Division of Biotechnology and GRAS Notice Review Office of Food Additive Safety (HFS-200) Center for Food Safety and Applied Nutrition Food and Drug Administration 5100 Paint Branch Parkway College Park, MD 20740-3835 Re: GRAS Notification for the Lactoperoxidase System Dear Dr. Mattia: On behalf of Taradon Laboratory C'Taradon"), we are submitting under cover of this letter three paper copies and one eCopy of DSM's generally recognized as safe ("GRAS'') notification for its lactoperoxidase system (''LPS''). The electronic copy is provided on a virus-free CD, and is an exact copy of the paper submission. Taradon has determined through scientific procedures that its lactoperoxidase system preparation is GRAS for use as a microbial control adjunct to standard dairy processing procedures such as maintaining appropriate temperatures, pasteurization, or other antimicrobial treatments to extend the shelf life of the products. In many parts of the world, the LPS has been used to protect dairy products, particularly in remote areas where farmers are not in close proximity to the market. In the US, the LPS is intended to be used as a processing aid to extend the shelf life of avariety of dairy products, specifically fresh cheese including mozzarella and cottage cheeses, frozen dairy desserts, fermented milk, flavored milk drinks, and yogurt.
    [Show full text]
  • Characterization of Cytosolic Glutathione Peroxidase And
    Aquatic Toxicology 130–131 (2013) 97–111 Contents lists available at SciVerse ScienceDirect Aquatic Toxicology jou rnal homepage: www.elsevier.com/locate/aquatox Characterization of cytosolic glutathione peroxidase and phospholipid-hydroperoxide glutathione peroxidase genes in rainbow trout (Oncorhynchus mykiss) and their modulation by in vitro selenium exposure a a b a d c a,∗ D. Pacitti , T. Wang , M.M. Page , S.A.M. Martin , J. Sweetman , J. Feldmann , C.J. Secombes a Scottish Fish Immunology Research Centre, Institute of Biological and Environmental Sciences, University of Aberdeen, Aberdeen AB24 2TZ, United Kingdom b Integrative and Environmental Physiology, Institute of Biological and Environmental Sciences, University of Aberdeen, Aberdeen AB24 2TZ, United Kingdom c Trace Element Speciation Laboratory, Department of Chemistry, University of Aberdeen, Aberdeen AB24 3UE, United Kingdom d Alltech Biosciences Centre, Sarney, Summerhill Rd, Dunboyne, Country Meath, Ireland a r t i c l e i n f o a b s t r a c t Article history: Selenium (Se) is an oligonutrient with both essential biological functions and recognized harmful effects. Received 4 July 2012 As the selenocysteine (SeCys) amino acid, selenium is integrated in several Se-containing proteins Received in revised form (selenoproteins), many of which are fundamental for cell homeostasis. Nevertheless, selenium may exert 19 December 2012 toxic effects at levels marginally above those required, mainly through the generation of reactive oxygen Accepted 20 December 2012 species (ROS). The selenium chemical speciation can strongly affect the bioavailability of this metal and its impact on metabolism, dictating the levels that can be beneficial or detrimental towards an organism.
    [Show full text]
  • Kinetics of Interconversion of Redox Intermediates of Lactoperoxidase
    Jpn. J. Infect. Dis., 57, 2004 Kinetics of Interconversion of Redox Intermediates of Lactoperoxidase, Eosinophil Peroxidase and Myeloperoxidase Paul Georg Furtmüller, Walter Jantschko, Martina Zederbauer, Christa Jakopitsch, Jürgen Arnhold1 and Christian Obinger* Metalloprotein Research Group, Division of Biochemistry, Department of Chemistry, BOKU-University of Natural Resources and Applied Life Sciences, 1Institute of Medical Physics and Biophysics, School of Medicine, University of Leipzig, Leipzig, Germany SUMMARY: Myeloperoxidase, eosinophil peroxidase and lactoperoxidase are heme-containing oxidoreductases, which undergo a series of redox reactions. Though sharing functional and structural homology, reflecting their phylogenetic origin, differences are observed regarding their spectral features, substrate specificities, redox properties and kinetics of interconversion of the relevant redox intermediates ferric and ferrous peroxidase, compound I, compound II and compound III. Depending on substrate availability, these heme enzymes path through the halogenation cycle and/or the peroxidase cycle and/or act as poor (pseudo-) catalases. Today - based on sequence homologies, tertiary structure and the halide ions is the following: I– > Br– > Cl–. All peroxidases can nature of the heme group - two heme peroxidase superfamilies are oxidize iodide. At neutral pH, only MPO is capable to oxidize distinguished, namely the superfamily containing enzymes from chloride at a reasonable rate (4), and it is assumed that chloride and archaea, bacteria, fungi and plants (1) and the superfamily of thiocyanate are competing substrates in vivo. EPO can oxidize mammalian enzymes (2), which contains myeloperoxidase (MPO), chloride only at acidic pH (5), and at normal plasma concentrations, eosinophil peroxidase (EPO), lactoperoxidase (LPO) and thyroid bromide and thiocyanate function as substrates, whereas for LPO peroxidase (TPO).
    [Show full text]