Characterization of Starch Synthase I and II Expressed in Early Developing Seeds of Kidney Bean (Phaseolus Vulgaris L.)

Biosci. Biotechnol. Biochem., 68 (9), 1949–1960, 2004

Characterization of Starch Synthase I and II Expressed in Early Developing Seeds of Kidney Bean (Phaseolus vulgaris L.)

Takeshi SENOURA,* Naoto ISONO,*,** Motoyo YOSHIKAWA, Ayako ASAO, y Shigeki HAMADA, Kenji WATANABE, Hiroyuki ITO, and Hirokazu MATSUI

Division of Applied Bioscience, Graduate School of Agriculture, Hokkaido University, Sapporo 060-8589, Japan

Received May 17, 2004; Accepted June 21, 2004

Plant starch synthase (SS) contributes to the elonga- enzymes.1–5) tion of glucan chains during starch biosynthesis and Starch synthase (SS; ADPglucose: 1,4--D-glucan 4- hence plays an essential role in determining the fine -D-glucosyltransferase, EC 2.4.1.21) catalyzes the structure of amylopectin. To elucidate the role of SS transfer of -D-glucose from ADPglucose to the non- activity in the formation of amylopectin in kidney bean reducing end of an -1,4-glucan. Multiple SS isozymes (Phaseolus vulgaris L.), a study was undertaken to have been found in various plant species and classified isolate cDNA clones for SS and to characterize the into five classes (GBSSI, SSI, SSII, SSIII, and SSIV) enzymatic properties of the coded recombinant en- based on their primary sequences.5,6) Each isozyme zymes. Two SS cDNAs, designated pvss1 and pvss21, appears to have distinct properties and to play specific which were isolated from early developing seeds, roles in starch biosynthesis.7,8) To elucidate the mech- encoded SSI and SSII (designated PvSSI and PvSSII- anism of plant starch biosynthesis, it is necessary to 1) that displayed significant identity (more than 65%) investigate the properties of enzymes, containing SS with other SSI and SSII members, respectively. RNA gel isozymes, involved in starch biosynthesis. blot analysis indicated that both transcripts accumulate The role of each SS isozyme in vivo has been derived in leaves and developing seeds at the early stage. from genetic mutants lacking a specific SS isozyme and Immunoblot analysis with antisera raised against both transgenic plants in which the activities of one or more recombinant proteins (rPvSSI and rPvSSII-1) showed SS isozymes have been reduced by the expression of that the accumulation of both proteins parallels the gene antisense RNA(s).3,8) GBSSI, which is exclusively expression profiles, although both were detectable only bound to starch granules, is responsible for the synthesis in starch-granule fractions. Recombinant enzymes ex- of amylose and appears to contribute to the synthesis of pressed by Escherichia coli cells showed distinct chain- amylopectin as well.9) In contrast to GBSSI, other SS length specificities for the extension of glucan chains. isozymes play a role in amylopectin synthesis and might Our results suggest that these SS isozymes for synthesis not participate in amylose synthesis. Analysis of pea of transitory starch are also responsible for synthesis of rug5 mutants with SSII activities eliminated indicated storage starch in early developing seeds of kidney bean. that the amylopectin had altered branching patterns with decreased amounts of intermediate-sized glucans and Key words: amylopectin; kidney bean (Phaseolus vul- increased amounts of short-chain glucans.10) Similar garis L.); kinetics; starch synthase results were observed in amylopectin from barley mutants lacking starch synthase IIa activity11) and Starch, one of the most important carbon reserves in antisense transgenic potato plants with reduced SSII plants, is composed of two glucan polymers, amylose activity.12,13) These results suggest that SSII isozymes and amylopectin. Amylose is a predominantly linear - might have a role in the synthesis or maintenance of 1,4-linked glucan, while amylopectin is a branched intermediate-sized glucan chains in amylopectin. Thus, polymer of -1,4-linked chains with branched -1,6- to understand the specific role of an SS isozyme during linkages. Amylose and amylopectin are synthesized by starch synthesis, analysis of amylopectin structures from the action of multiple enzymes including ADPglucose genetic mutants and/or antisense transgenic plants is a pyrophosphorylases, starch synthases (SSs), starch- validated method but insufficient in some cases, because branching enzymes (SBEs), and starch-debranching there might be pleiotropic effects of the absence or

y To whom correspondence should be addressed. Fax: +81-11-706-2508; E-mail: [email protected] * These authors contributed equally to this work. ** Present address: Faculty of Bioresources, Mie University, Kamihama 1515, Tsu 514-8507, Japan Abbreviations: dp, degree of polymerization; GBSSI, granule-bound starch synthase I; GS, glycogen synthase; PCR, polymerase chain reaction; PvSSI, PvSSII-1, and PvSSII-2, kidney bean (Phaseolus vulgaris L.) starch synthase I, II-1 and II-2 respectively; rPvSSI and rPvSSII-1, recombinant PvSSI and PvSSII-1 respectively; RACE, rapid amplification of cDNA end; RT-PCR, reverse transcriptase mediated PCR; SS, starch synthase 1950 T. SENOURA et al. reduction of a specific SS isozyme on other starch cDNA cloning. Total RNA was extracted from biosynthetic enzymes. developing and mature seeds and leaves of kidney bean An alternative approach to understanding the individ- by the standard phenol/SDS method.20) RT-PCR and 30- ual properties of SS isozymes is to investigate the RACE were performed with an RNA PCR Kit (AMV) biochemical characterization of purified enzymes. But Ver. 2.1 (Takara Bio, Kyoto, Japan). The first strand purification of each native SS isozyme from plant cDNA mixture was prepared from total RNA of small- materials is extremely difficult due to low abundance. size developing seeds (early stage of development) with Accordingly, it has been difficult to illuminate the the oligo-dT adaptor primer and reverse transcriptase. detailed enzymatic properties of native SS isozymes. To amplify cDNA fragments for starch synthases from Recently, recombinant SS isozymes, including maize kidney bean seeds, the first strand cDNA mixture was SSI and SSII and potato GBSSI and SSII, have been subjected to RT-PCR with two degenerated primers, ss- expressed in Escherichia coli, purified, and character- rt1 and ss-rt2. The amplified fragments were subcloned ized.14–17) In particular, progress has been made in into pT7Blue T-vector (Novagen, Madison, WI, USA) understanding the chain-length specificities of maize SSI and several clones were sequenced on both strands. and its role in amylopectin synthesis.18) Hence, prepa- Based on the sequences, information on the full-length ration of recombinant SS enzymes is an important tool cDNA clones for starch synthase I and II was obtained for examining the properties of each SS isozyme. by combination of 30- and 50-RACE. 30-RACE was Combining the results from in vitro enzymatic properties performed with primers ss1-3race and M13M4 or ss2- and in vivo analysis of genetic mutants and transgenic 3race and M13M4, and the first strand cDNA mixture as plants might provide insight into the roles of SS a template. 50-RACE was done using total RNA from isozymes and amylopectin biosynthesis. small-size developing seeds with a 50 RACE System for Here we describe the isolation and expression of two Rapid Amplification of cDNA Ends kit (Invitrogen, cDNA clones, designated pvss1 and pvss21, for kidney Carlsbad, CA, USA). The first strand synthesis was bean starch synthase I (PvSSI) and II-1 (PvSSII-1) primed with the specific primer (ss1-5race1 or ss2- respectively. We have already isolated a cDNA clone 5race1). Terminal deoxynucleotidyl transferase was (pvss22) for another SSII isozyme (PvSSII-2) from used to add homopolymeric (C) tails to the 30 end of kidney bean seeds.19) The pvss22 transcripts accumu- the first strand cDNAs. For amplification of target lated predominantly in developing seeds at the middle to cDNAs, first round PCR was performed with the dC- late stages, whereas the transcripts for pvss1 and pvss21 tailed cDNAs as templates using the AAP (supplied by a occurred mainly in leaves and early developing seeds. In 50-RACE system, Invitrogen) and ss1-5race1 or ss2- this study, recombinant PvSSI (rPvSSI) and PvSSII-1 5race1 primers. These amplified products were then (rPvSSII-1) enzymes were produced in E. coli and subjected to a second round PCR with the AUAP and the purified to apparent homogeneity. We also found that nested specific primer (ss1-5race2 or ss2-5race2). The rPvSSI and rPvSSII-1 have distinct chain-length prefer- amplified DNA fragments by 30- and 50-RACE were ences. Based on the results in this study, the role of subcloned into pT7Blue T-vector and then sequenced on PvSSI and PvSSII-1 in amylopectin synthesis is dis- both strands. Eventually, based on the sequence infor- cussed. mation for the full-length cDNA, the DNA fragment including the whole coding region was amplified by RT- Materials and Methods PCR with the specific primers (ss1-up and ss1-dw for pvss1 or ss2-up and ss2-dw for pvss21). The amplified Materials. Amylopectin and ADPglucose were ob- fragments were cloned into pBluescript SK(+) (Stra- tained from Sigma Chemical Co. (St. Louis, MO, USA). tagene, La Jolla, CA, USA) to construct pBS-SS1 and ADP-[U-14C]-glucose and [-32P]dCTP were purchased pBS-SS21 plasmids and sequenced on both strands. The from Amersham Bioscience (Tokyo, Japan). Isoamylase nucleotide sequence data reported in this paper appear in from Pseudomonas was obtained from Nacalai Tesque the DDBJ Nucleotide Sequence Database under acces- (Kyoto, Japan). Amylose EX-I (the average dp is 17) sion nos. AB126832 for pvss1 and AB126833 for was purchased from Hayashibara Biochemical Labora- pvss21. tories (Okayama, Japan). The oligonucleotides used in this study are listed in Table 1. RNA gel blot analysis. Total RNA (20 g/lane) was fractionated on a formaldehyde/1% (w/v) agarose gel Plant materials. Kidney bean (Phaseolus vulgaris L. and transferred to a nylon membrane (Hybond Nþ, cv. Toramame) plants were grown in the field at Amersham Bioscience). The blot was hybridized with a Hokkaido University, Japan. Developing seeds at sev- 32P-labeled pvss1 cDNA fragment between the ss1-up eral stages, mature seeds, and fully expanded leaves and ss1-5race2 primers or a 32P-labeled pvss21 cDNA were harvested and stored in liquid nitrogen. The fragment between the ss2-up and ss-rb primers at 42 C developing seeds were separated as small- (4–8 mm), for 16 h in standard hybridization buffer containing 50% mid- (10–12 mm), and large-size (14–16 mm) seeds. (w/v) formamide (Roche Diagnostics Corp., Indian- apolis, IN, USA). The probe was prepared with Table 1. Oligonucleotide Primers Used for Isolation and Expression of the pvss1 and pvss21 cDNA Clones

Primers Sequences (50 to 30)a Comments Position in pvss1 or pvss21 cDNAc

ss-rt1 AARWCIGGIGGICTHGGWGA Degenerated primer 525–544 1951 (pvss1)/873–892 (pvss21) Bean Kidney from Synthases Starch Two of Characterization ss-rt2 TGDWYBAGICCRCAIGGYTCRAA Degenerated primer 1,705–1,684 (pvss1)/2,020–1,998 (pvss21) ------ss1-3race GGGAAGGCCAAATGCAAGTA 30-RACE primer 1,371–1,390 (pvss1) ss1-5race1 ACTGATTATCCCCAAAAGTC 50-RACE primer 822–803 (pvss1) ss1-5race2 CCATACGGATTCCCTGGTCT 50-RACE primer and RNA blot analysis 790–771 (pvss1) ss1-up CCACTTTTCTTCTTGGTTCA Isolation of pvss1 clone and RNA blot analysis 23–42 (pvss1) ss1-dw ACAAATCATGTCGGTCACTC Isolation of pvss1 clone 2,381–2,362 (pvss1) ss1-nco1 TCGCAACTTCCCCATGGTTTCTGCTCACAA Expression of recombinant PvSSI 191–220 (pvss1) ss1-xho1 GCAATCTTCCTCGAGGCAATAGGGTGGGCCGAT Expression of recombinant PvSSI 2,027–1,995 (pvss1) ------ss2-3race CCCTCGGTTTGATGTTCACT 30-RACE primer 1,619–1,638 (pvss21) ss2-5race1 TCCCCCATATATGTTACGTT 50-RACE primer 1,124–1,105 (pvss21) ss2-5race2 TTACTTCCGCATCATGACCATC 50-RACE primer 1,035–1,014 (pvss21) ss2-up CAGATGTACTCATTCAGTTCAAG Isolation of pvss21 clone and RNA blot analysis 2–24 (pvss21) ss2-dw CCACAGCATTGCAATTACAT Isolation of pvss21 clone 2,476–2,457 (pvss21) ss2-rb GAGAGAGTATCAGGCCTATT RNA blot analysis 724–705 (pvss21) ss2-nde1 CATTCGTGCCATATGGCAACAGGTGGTAAC Expression of recombinant PvSSII-1 231–260 (pvss21) ss2-xho1 ATAAATGCAAAACTCGAGCCATTGGTATTTGGCAG Expression of recombinant PvSSII-1 2,324–2,290 for pvss21 ------M13M4 GTTTTCCCAGTCACGAC Supplied by RNA PCR Kit (Takara Bio) AAPb GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG Supplied by 50-RACE System (Invitrogen) AUAPb GGCCACGCGTCGACTAGTAC Supplied by 50-RACE System (Invitrogen)

a B, C/G/T; D, A/G/T; H, A/C/T; I, inosine; R, A/G; W, A/T; Y, C/T. b AAP, abridged anchor primer; AUAP, abridged universal amplification primer. c Both sequences have appeared in the DDBJ Nucleotide Sequence Database under accession nos. AB126832 for pvss1 and AB126833 for pvss21. 1952 T. SENOURA et al. 1.85 MBq of [-32P]dCTP and the PCR-amplified frag- Assay of SS activity. The reaction mixture (0.2 ml) ment between ss1-up and ss1-5race2 or the ss2-up and contained 100 mM Bicine (pH 8.0), 5 mM EDTA, 25 mM ss-rb primers using a BcabestÔ Labeling kit (Takara potassium acetate, 10 mM DTT, 10 mg/ml potato amy- Bio). The membranes were rinsed twice with 2 SSC/ lopectin (Sigma Chemical), and 1 mM ADP-[U-14C]- 0.1% SDS at room temperature for 15 min each, then glucose at 3.3 GBq/mol, unless indicated otherwise. In twice with 0:1 SSC/0.1% SDS at 68 C for 15 min the case of SS activity for several malto-oligosaccha- each. The membrane was subjected to autoradiography rides, 10 mM malto-oligosaccharide was added to the with intensifying screens at 80 C. Equal loading of above reaction mixture instead of amylopectin. Assay total RNA was confirmed by monitoring the levels of was initiated by the addition of ADPglucose and ribosomal RNA stained with methylene blue. incubated at 30 C for 10 min. After boiling for 5 min, the remaining ADPglucose was removed with Dowex 1- Expression of recombinant PvSSI and PvSSII-1. A X8 anion exchange resin (200–400 mesh, chloride form; 1,837 bp of cDNA fragment for PvSSI was amplified by Sigma Chemical). Columns of Dowex 1-X8 were PCR with primers ss1-nco1 and ss1-xho1 and with pBS- prepared in 1 ml pipette tips with cotton wool, adding SS1 plasmid as a template. Likewise, a 2,094 bp of 1 ml of a suspension of 0.5 g/ml resin in water. Excess fragment for PvSSII-1 was amplified with ss2-nde1 and water in columns was removed by centrifugation at 50 ss2-xho1 primers and with pBS-SS21 plasmid as a g for 5 min. Each reaction mixture was passed over a template. The amplified fragments were cloned to column by centrifugation at 50 g for 5 min. The pT7Blue T-vector and sequenced to verify that no error columns were washed with two 250 l aliquots of water had occurred. A 1,815 bp of NcoI/XhoI fragment for and radioactivity in the eluate was determined by liquid PvSSI and a 2,066 bp of NdeI/XhoI fragment for scintillation counting. All assays were performed under PvSSII-1 were cloned into the NcoI/XhoI sites of pET- conditions where the amount of incorporation of glucose 23d (Novagen) and the NdeI/XhoI sites of pET-23a into primer was linearly proportional to the amount of (Novagen) to generate pET-SS1 and pET-SS21 respec- enzyme and to the incubation time. The effects of pH tively, and then introduced into E. coli BL21 (DE3) were measured in 100 mM of each buffer (pH 5.5–6.5, pLysS cells (Novagen). The cells were grown in 2.4 litre MES; pH 6.5–7.5, MOPS; pH 7.5–9.0, Bicine; pH 9.0– Luria–Bertani medium containing 100 g/ml ampicillin 10.5, Glycine). For pH stability, the enzyme was kept in and 34 g/ml chloramphenicol at 25 C to an absorb- 1=5 concentration of Britton–Robinson’s buffer (various ance of 0.7 at 600 nm, then induced by the addition of pH levels) at 4 C for 24 h. For temperature stability, the 0.1 mM isopropyl--D-thiogalactoside. Following growth enzyme was kept in 20 mM Tris–HCl (pH 8.0) at various at 25 C for 12 h, the cells were collected by centrifu- temperatures for 15 min. Kinetic parameters were gation at 4;000 g at 4 C for 10 min. measured as described previously.23)

Purification of recombinant proteins. The cells were Immunoblot analysis. Antisera against rPvSSI and resuspended in buffer A (20 mM sodium phosphate, rPvSSII-1 were raised in rabbits as described previous- pH 7.5, 0.5 M NaCl, 50 mM imidazole and 10% glycerol) ly.21) Proteins of soluble and granule fractions from and disrupted with a French pressure cell (Ohtake seeds and leaves were prepared by the methods of Works, Tokyo, Japan). After centrifugation at 40;000 Smith24) and Tomlinson et al.,25) and immunoblotted g at 4 C for 30 min, the supernatant was applied at a with the antisera against rPvSSI and rPvSSII-1, as flow rate of 5 ml/min to a HiTrap Chelating HP column described previously.21) (5 ml, Amersham Bioscience) charged with nickel ions and equilibrated with buffer A. The column was washed Product analysis. Reaction by starch synthase was with buffer A, then enzymes were eluted with a 100 ml performed as described above under ‘‘Assay of SS gradient of 50–500 mM imidazole in buffer A. Fractions activity’’ except that the volume of reaction mixture was with SS activity were pooled and dialyzed against 1 ml. To remove the remaining ADPglucose, the buffer B (20 mM Tris–HCl, pH 7.2, 1 mM EDTA, 1 mM reaction mixture was mixed with 0.5 ml of 0.5 g/ml DTT and 10% (v/v) glycerol). The dialyzate was Dowex 1-X8 for 5 min, and then 1 ml of supernatant was applied at a flow rate 0.5 ml/min to a Mono Q HR 5/ recovered by centrifugation at 10;000 g for 5 min. 5 (Amersham Bioscience) equilibrated with buffer B. After this procedure was repeated once more, the The column was washed with buffer B, then the recovered supernatant was incubated together with enzymes were eluted with a 40 ml gradient of 0–1 M 50 lof1M sodium acetate (pH 3.5) and 100 units of NaCl in buffer B. The purity of the enzyme was isoamylase at 45 C for 12 h. The reaction was termi- determined by SDS-PAGE (7.5% (w/v) gel) and the nated with the addition of 0.3 ml 5 M NaOH. One ml of N-terminal sequence was determined as described the sample filtered through 0.22 m filter was applied at previously.21) The protein concentration was determined a flow rate 0.5 ml/min to a column (1:6 70 cm) of by the method of Bradford with bovine serum albumin Toyopearl HW-50S (Tosoh Bioscience, Tokyo, Japan) as a standard.22) equilibrated and eluted with 20 mM NaOH and 0.2% (w/v) NaCl. Fractions of 2 ml each were collected and Characterization of Two Starch Synthases from Kidney Bean 1953 the radioactivity in the fraction was measured by liquid SSs31–35) (Figs. 1A and B). The mature PvSSI protein scintillation counting. The carbohydrate content and sequence showed significant sequence identity (60– reducing residues in the fractions were determined by 64%) with those of SSI members and lower identity 26) the phenol/H2SO4 method and the modified Park– (about 45%) with those of SSII members (Fig. 1C). Johnson method27) respectively. The number-average Mature PvSSII-1 protein showed substantial identity degree of polymerization (dp) was calculated from the (55–62%) with SSII members and lower identity (40– values of carbohydrate content and reducing residues. 48%) with SSI members (Fig. 1C). Both the PvSSI and PvSSII-1 sequences displayed much lower identity with Results the other SS or GS members (about 35, 20, and 30% with GBSSI, SSIII, and GS members respectively). Isolation of pvss1 and pvss21 cDNA clones To isolate cDNA clones for starch synthases, RT-PCR Expression of pvss1 and pvss21 in developing and was performed with the ss-rt1 and ss-rt2 primers and the mature seeds and leaves single-strand cDNA mixture from early developing RNA gel blot analysis was performed with total RNA seeds of kidney bean. The amplified fragments (about extracted from developing seeds at three different 1.1 kb) were subcloned and several clones were se- stages, and from mature seeds, and leaves (Fig. 2). quenced. Some predicted amino acid sequences of the The accumulation profiles of both transcripts were very clones showed significant similarities to those of SSI or close in spite of differences in their signal intensities. SSII members, indicating that the fragments are part of This observation might indicate that both gene expres- the cDNAs for kidney bean starch synthase I and II sions are regulated by similar processes in kidney bean (designated pvss1 and pvss21 cDNA respectively). The plants. In seeds, both transcripts attained their maximum partial sequence of pvss21 was different from that of levels at the early to middle stages of development. Both pvss22 that had been isolated from developing seeds at transcripts were also detected at much stronger inten- the middle stage.19) The sequences of the other clones sities in leaves than in developing seeds. were identical to that of PvGBSSIa from kidney bean seeds.23) Subsequently, to obtain sequence information Purification of recombinant PvSSI and PvSSII-1 about the full-length pvss1 and pvss21 cDNAs, 30- To investigate the enzymatic properties of PvSSI and RACE and 50-RACE were performed. PvSSII-1, the recombinant enzymes (designated rPvSSI The pvss1 and pvss21 cDNA clones were 2,444 and and rPvSSII-1) were produced in E. coli cells. Two 2,570 bp in length and contained open reading frames of plasmids, pET-SS1 and pET-SS21, were constructed to 1,938 and 2,175 bp respectively. The proteins encoded express the mature PvSSI and PvSSII-1 proteins without by pvss1 and pvss21 (designated PvSSI and PvSSII-1 the predicted transit peptides but with hexahistidine tags respectively) corresponded to 645 and 724 amino acid at their C-termini. The expected N-terminal sequences residues with predicted molecular masses of 71.4 and of rPvSSI and rPvSSII-1 were ‘‘MVSAHNG...’’ and 80.1 kDa respectively. One of the determined N-terminal ‘‘MATGGNS...’’ respectively. Although more than sequences of starch-granule bound proteins from kidney 80% of the recombinant proteins were found in inclusion bean developing seeds, SAHNGGAASQ, was located in bodies, sufficient activity was present in the soluble the deduced amino acid sequences of PvSSI. These phase for protein purification. Both recombinant pro- results indicate that PvSSI is synthesized as a preprotein teins were purified by Chelating Sepharose and Mono Q with a signal sequence of 44 residues, whereas the chromatography. The final enzyme preparation from mature N-terminus of PvSSII-1 was not found in the each 2.4 litre of cultured cells contained 4.3 mg of sequences of starch-granule bound proteins (data not rPvSSI and 1.4 mg of rPvSSII-1, with specific activities shown). But when the primary sequence of PvSSII-1 of 10.6 and 3.8 mol/min/mg respectively. The homo- was analyzed for a putative signal sequence with the geneities of purified rPvSSI and rPvSSII-1 were con- TargetP28) and ChloroP29) network programs, the protein firmed by SDS-PAGE. Both enzymes migrated as a was predicted to contain a plastid-targeting sequence clear single band on the gel (Fig. 3A). The N-terminal with a cleavage site between Arg-37 and Ala-38. The sequences of purified rPvSSI and rPvSSII-1 were predicted site is identical to that of pea SSII30) when determined to be ‘‘VSAHNG...’’ and ‘‘ATGGNS...’’ aligned with the amino acid sequences between pea SSII respectively, indicating that the initiation methionine and PvSSII-1 (Fig. 1). Therefore the putative N-terminal residues were removed, probably by E. coli methionine sequence and the expected molecular mass of the mature amino peptidase.36) PvSSII-1 protein were predicted to be ‘‘ATGGNS...’’ and 76.0 kDa respectively. The primary sequences of Distribution of PvSSI and PvSSII-1 PvSSI and PvSSII-1 had significant similarity to other To identify native PvSSI and PvSSII-1 proteins in plant SSs (Fig. 1). Several amino acids that have been seeds and leaves, immunoblot analysis with specific identified as residues involved in interaction with antisera against rPvSSI and rPvSSII-1 was performed for substrates and enzymatic catalysis for SSs and glycogen soluble and starch granule-associated proteins from synthases (GSs) were completely conserved among all developing and mature seeds and leaves. No signal for 1954 T. SENOURA et al.

Continued. Characterization of Two Starch Synthases from Kidney Bean 1955

Fig. 1. Alignment of the Primary Sequences and Phylogenetic Tree of Several Plant SSI and SSII Members. The sequences of the two type members were obtained from the GenBankÒ/EMBL/DDBJ databases: Arabidopsis SSI and SSII (Arabidopsis thaliana; AB006701 and AY054467), barley SSI and SSII (Hordeum vulgare; AF234163 and AY133249), cassava SSII (Manihot esculenta; AF173900), maize SSI, SSIIa, and SSIIb (Zea mays; AF036891, AF019296, and AF019297), PvSSI, PvSSII-1, and PvSSII-2 (Phaseolus vulgaris; AB126832, AB126833, and AB127938), pea SSII (Pisum sativum; X88790), potato SSI and SSII (Solanum tuberosum; Y10416 and X87988), rice SSI, SSII-1, SSII-2, and SSII-3 (Oryza sativa; D16202, AF383878, AF395537, and AF419099), sorghum SS (Sorghum bicolor; AF168786), taro SSI (Colocasia esculenta; AY142712), wheat SSI and SSII (Triticum aestivum; AF091803 and AF155217). Multiple sequence alignments for several plant SSI (A) and SSII (B) members were determined using the ClustalW program. Residues showing more than 75% sequence identity among all SSI or SSII members are indicated by white letters on a black background. The characters with a gray background are similar residues in SSI or SSII members. The asterisks indicate residues involved in interaction with substrates or enzyme catalysis for SSs and GSs. Based on the sequence alignment, a phylogenetic tree was constructed (C).

tions suggest that both SS isozymes contribute to the synthesis of transitory starch in leaves and storage starch in early developing seeds.

Properties of rPvSSI and rPvSSII-1 The enzymatic properties of purified rPvSSI and rPvSSII-1 are summarized in Table 2. rPvSSI and rPvSSII-1 were most active at approximately pH 8.5 and 8.0 respectively at 30 C. More than 90% of the Fig. 2. Accumulation Profiles of pvss1 and pvss21 Transcripts in original activity remained after incubation at 4 C for Developing and Mature Seeds and Leaves. 24 h between pH 7.0 and 9.5 for rPvSSI and between Each lane was loaded with 20 g of total RNA isolated from pH 7.0 and 9.0 for rPvSSII-1. Lineweaver–Burk plots of developing and mature seeds and leaves. Lanes S, M, L, Ma and Lf the reaction catalyzed by rPvSSI yielded Km and Vmax indicate small- (4–8 mm), middle- (10–12 mm), and large- (14– values for amylopectin and glycogen of 5.0 mg/ml and 16 mm) size developing seeds, mature seeds, and leaves respective- ly. Equal loading of RNA was confirmed by methylene blue staining 16 mol/min/mg for amylopectin and 21 mg/ml and of ribosomal RNA. 33 mol/min/mg for glycogen respectively, when as- sayed in the presence of 1 mM ADPglucose. Likewise, the Km and Vmax values of rPvSSII-1 for amylopectin PvSSI or PvSSII-1 was detected in any soluble fraction and glycogen were estimated to be 0.29 mg/ml and from seeds or leaves (data not shown). In the starch- 4.0 mol/min/mg for amylopectin and 0.21 mg/ml and granule fractions, the anti-rPvSSI antibody recognized a 4.0 mol/min/mg for glycogen respectively. The ki- polypeptide band at about 66 kDa (Fig. 3B), whereas the netic parameters of both enzymes for ADPglucose in the anti-rPvSSII-1 antibody reacted with a band of about presence of 10 mg/ml amylopectin had similar values in 78 kDa (Fig. 3C). The rPvSSI and rPvSSII-1 proteins the presence of 10 mg/ml glycogen, suggesting that the migrated as a somewhat larger band than the reacted species of glucan primer have no effect on the affinity of bands, due to the addition of hexahistidine-tags. The PvSS enzymes for ADPglucose. temporal accumulation of these proteins during seed To investigate the specificities of rPvSSI and rPvSSII- development and in leaves substantially paralleled the 1 for chains of amylopectin and glycogen, enzyme gene expression pattern (Figs. 2 and 3). These observa- reactions were performed with 10 mg/ml amylopectin or 1956 T. SENOURA et al.

Fig. 3. SDS-PAGE of Purified rPvSSI and rPvSSII-1 and Immunoblot Analyses. (A) CBB-stained SDS-PAGE (7.5% (w/v) gel). Lanes 1 and 2 contained 1 g of purified rPvSSI and rPvSSII-1 respectively. Lane Std was loaded with standard proteins; myosin (200 kDa), -galactosidase (116 kDa), phosphorylase b (97 kDa), BSA (66 kDa), and ovalbumin (45 kDa). (B) and (C) Proteins from starch granules of developing and mature seeds and leaves were separated by SDS-PAGE (7.5% (w/v) gel) and then transferred to nitrocellulose membranes. The membranes were incubated with anti-rPvSSI (B) or anti-rPvSSII-1 (C). The granule–bound proteins were prepared from 1 and 3 mg starch granules for immunodetection by anti-rPvSSI and anti-PvSSII-1 respectively. Lanes S, M, and L, small- (4–8 mm), middle- (10–12 mm), and large- (14–16 mm) size developing seeds; lanes Ma and Lf, mature seeds and leaves; lanes rSS1 and rSS21, 10 ng each of purified rPvSSI and rPvSSII-1 respectively.

fractions with unit chains of around dp ¼ 15 and less Table 2. Some Properties of rPvSSI and rPvSSII-1 than dp ¼ 10 (solid line in Fig. 4A). Likewise, in the Properties rPvSSI rPvSSII-1 case of glycogen, the 14C-label by rPvSSI was found at pH stabilitya 7.0–9.5 7.0–9.0 around dp ¼ 10 and less than dp ¼ 6 (solid line in Optimum pHa 8.5 8.0 Fig. 4B). In contrast, most of the 14C-label incorporated Thermal stability (C)a <35 <35 into glucan by rPvSSII-1 was detected in the fractions containing unit chains of around dp ¼ 15 in the case of b Km for amylopectin (mg/ml) 5.0 0.29 amylopectin and glycogen (Figs. 4C and D). These data V for amylopectin (mol/min/mg)b 16 4.0 max show that rPvSSI and rPvSSII-1 use unit chains of dp ¼ c Km for ADPglucose (mM) 0.09 0.09 10 to 15 similarly, and that rPvSSI also has a high c Vmax for ADPglucose (mol/min/mg) 10 3.7 elongation performance for extremely short chains of less than dp ¼ 6 as compared to rPvSSII-1. This is b Km for glycogen (mg/ml) 21 0.21 further supported by comparison of the specific activities V for glycogen (mol/min/mg)b 33 4.0 max of the two SS isozymes for several malto-oligosaccha- d Km for ADPglucose (mM) 0.1 0.12 rides (Fig. 5). rPvSSI showed similar specific activity d Vmax for ADPglucose (mol/min/mg) 10 3.8 (around 1.8 mol/min/mg) for glucans of dp ¼ 3 to 17, a pH stability was defined as the pH range over which more than 95% of and also had 0.4 mol/min/mg of the specific activity residual activity remained after being treated as described previously.21,23) even for maltose. In contrast, rPvSSII-1 hardly acts on Optimum pH is the pH at which there was maximum activity under the maltose, and the specific activities for maltotriose and conditions described previously.21,23) Thermal stability is the temperature limit within which more than 95% of the original activity remained after maltohexaose were half as much as for amylose EX-I, being treated as described previously.21,23) with the average at dp ¼ 17. b In the presence of 1 mM ADPglucose. c In the presence of 10 mg/ml amylopectin. d In the presence of 10 mg/ml glycogen. Discussion

This study reports the isolation and characterization of glycogen and 1 mM of 14C-labeled ADPglucose. After two cDNA clones, pvss1 and pvss21, encoding PvSSI the products were debranched by isoamylase and and PvSSII-1 respectively, from kidney bean. The separated on a Toyopearl HW-50S column, the carbo- recombinant enzymes, rPvSSI and rPvSSII-1, share hydrate contents and radioactivity in each fraction were similar physicochemical properties but show differences determined (Fig. 4). Two peaks (around dp ¼ 45 and in kinetic parameters for primer molecules and prefer- 15) of carbohydrate contents were found in unit chains ences for elongating chain-lengths, indicating that both of amylopectin (broken lines in Figs. 4A and C), enzymes have a distinct role in the synthesis of whereas only a single peak (around dp ¼ 10)of amylopectin. carbohydrate contents was observed in those of glyco- The deduced amino acid sequences from pvss1 and gen (broken lines in Figs. 4B and D). When amylopectin pvss21 were similar to SSI and SSII class enzymes was used as a primer glucan, the 14C-label incorporated respectively (Fig. 1). Alignment of the primary se- into the glucan by rPvSSI was predominantly detected in quences indicated that the N-terminal regions of both Characterization of Two Starch Synthases from Kidney Bean 1957

Fig. 4. Analysis of Products by rPvSSI and rPvSSII-1 Using Amylopectin or Glycogen as a Primer. rPvSSI and rPvSSII-1 (10 mol/min/ml each) were incubated with 14C-labeled 1 mM ADPglucose and 10 mg/ml of amylopectin (A and C) or glycogen (B and D) in a total volume of 1 ml for 1 h at 30 C. After reaction, the remaining ADPglucose was removed and glucans were debranched by isoamylase. The debranched products were separated on a column of Toyopearl HW-50S. Eluate was collected and total carbohydrate, radioactivity, and dp were determined. The solid and broken lines indicate carbohydrate contents (mg/ml) and incorporated glucose (nmol/ml) respectively. (A) and (B) Products by rPvSSI with amylopectin and glycogen respectively. (C) and (D) Products by rPvSSII-1 with amylopectin and glycogen respectively.

SSI and SSII members have no significant identity (Fig. 1). A similar situation is also observed in the N- terminal regions for plant SBEs.37) Although the precise roles of the diverse N-terminal regions remain unclear, the regions might be involved in interaction with primer molecules and/or other proteins. Work on the expres- sion of maize SBEs in yeast suggested that the SBEs interact with yeast GS.38) More recently, it was reported that wheat SBEI and IIb form protein complexes with starch phosphorylase via phosphorylation on serine residues.39) It was also shown that wheat SSIIa proteins are phosphorylated though it is unclear whether the SSIIa forms a complex with other proteins. These relative facts suggest the hypothesis that a functional complex of SS(s) and SBE(s) is constituted through phosphorylation on serine residues of each N-terminal Fig. 5. Comparison of Specific Activities of rPvSSI and rPvSSII-1 region. for Malto-oligosaccharides. SSI class isozymes appear to be responsible for a Enzyme activity was measured using 1 mM ADPglucose and 10 mM maltose (G2), maltotriose (G3), maltohexaose (G6), or large part of starch synthase activity in the developing amylose EX-I (EX). endosperm of monocot plants.15,40,41) In contrast, there 1958 T. SENOURA et al. are only a few reports on dicot SSI isozymes. In potato Unlike rPvSSI, the 14C-label incorporated into amy- plants, the SSI gene expresses predominantly in leaves lopectin and glycogen during the rPvSSII-1 reaction was and almost no transcript is accumulated in tubers.42) detected as a single peak. Chains of around dp ¼ 15, Unlike potato SSI, the accumulations of pvss1 tran- which were added glucosyl units by rPvSSII-1, are most scripts and PvSSI proteins were found in leaves and abundant in amylopectin molecules, as mentioned developing seeds at an early stage. SSII isozyme is the above. Even in the case in which glycogen was used major form in the soluble fraction of pea (Pisum as a primer molecular, however, rPvSSII-1 elongated the sativum) embryos.10,30,43) Probably, the PvSSII-2 iso- chains of around dp ¼ 15 that account for only a minor zyme of kidney bean has a role corresponding to pea fraction of glycogen. Thus, these observations indicate SSII, because the accumulation profiles of pvss22 that rPvSSII-1 selects and uses A and B1 chains of transcripts for PvSSII-2 are very close to those for pea amylopectin as favorable substrates and then synthesizes SSII. But pvss21 transcripts and PvSSII-1 proteins intermediate chains (perhaps B2 and B3 chains), sup- accumulated in leaves and early developing seeds as porting the results from the amylopectin structure of pea well as pvss1 transcripts and PvSSI proteins, indicating rug5 mutants.10) One of the pea mutants, rug5-a, has an that the profiles are largely different from those of undetectable SSII protein in the embryos, and the 19) 30) PvSSII-2 and pea SSII. These results suggest that amylopectin is increased in A and B1 chains and PvSSI and PvSSII-1 participate in the synthesis of early decreased in B2 and B3 chains as compared to that from storage starch core, and thereafter PvSSII-2 uses the the wild type.10) On the other hand, in antisense core as a primer to elongate glucan chains. transgenic potato plants, elimination of SSII isozyme SS isozymes, except for GBSSI isozymes, exist as has a smaller effect on amylopectin structure.13,16) This both soluble and starch granule-bound forms. But it has difference in amylopectin structures between the pea been suggested that the granule-bound SSs, as well as mutants and transgenic potatoes is explained by the SBEs, are not active in starch biosynthesis but are distinct contribution of each SSII to both plants. SSII simply trapped within the growing amylopectin structure isozyme is a major form of total SS for pea embryos, as it becomes converted into a crystallized starch whereas it is a minor form for potato tubers. granule.44) Though such a view indicates that SS Overall, the properties of SSI and SSII isozymes in isozymes elongate glucan chains in the soluble phase, vivo and in vitro suggest that SSI and SSII synergically in this study, both PvSSI and PvSSII-1 proteins were extend glucan chains of amylopectin as SSII elongates detectable only in granule fractions. Probably this is due the chains synthesized by SSI. One unique finding from to their low amounts in soluble fractions, below our studies is that PvSSI and PvSSII-1 function detection limits by anti-PvSS antisera. predominantly in the early stage of seed development. Since no genetic mutant in an SSI gene has been That rPvSSI is capable of using short glucan chains such reported, and transgenic potato plants with completely as maltose and maltotriose unlike other SS isozymes suppressed SSI gene expression showed almost the same from kidney bean suggests that PvSSI and PvSSII-1 are starch properties as wild-type plants,42) the role of SSI cooperatively involved in the initial elongation of glucan isozymes in amylopectin synthesis is obscure. Amylo- chains in starch synthesis. In addition to PvSSI and pectin is composed of three classes of chains, A, B, and PvSSII-1, we have already isolated cDNAs for other SS C.45) A chains carry no chains and bind to B chains at the isozymes, PvGBSSIa,23) PvGBSSIb,47) PvSSII-2,19) and reducing termini. B chains carry A chains or other B PvSSIII (unpublished results) from kidney bean plants. chains, and further divided into four types (B1–B4) The occurrence of various SS isozymes suggests that the according to the number of clusters spanned.46) C chains elongation of glucan chains in vivo is intricately carry other chains but are not linked to another chains. A regulated by multiple SS isozymes during amylopectin rice mutant in which the SSI gene was disrupted by a biosynthesis. Hence, further definition of the individual retro-transposon had endosperm amylopectin with a roles of SSs is required for further understanding of increase in chains of dp ¼ 6 to 7 and a decrease in plant amylopectin biosynthesis. chains of dp ¼ 8 to 12, as compared to the wild type.4) The chains of dp ¼ 8 to 12 correspond to A and B1 Acknowledgments chains of amylopectin. In addition, maize SSI isozyme preferentially adds glucosyl units to chains below dp ¼ This work was supported by a grant-in-aid for 10 of glycogen.18) These observations, which coincide Scientific Research from the Ministry of Education, with the chain-length specificity of rPvSSI, suggest that Science, Sports, and Culture of Japan (grant no. SSI isozymes contribute to the synthesis of A and B1 13660071 to H.I.). chains from shorter chains. In addition to elongation of the short chains, rPvSSI extended the most plentiful References chains in both amylopectin and glycogen (Fig. 4). Although we must be cautious of these results obtained 1) Slattery, C. J., Kavakli, I. H., and Okita, T. W., under in vitro conditions, PvSSI might be partly Engineering starch for increased quantity and quality. involved in the elongation of A and B1 chains in vivo. Trends Plant Sci., 5, 291–298 (2000). Characterization of Two Starch Synthases from Kidney Bean 1959 2) Myers, A. M., Morell, M. K., James, M. J., and Ball, S. properties. Arch. Biochem. Biophys., 362, 131–138 G., Recent progress toward understanding biosynthesis (1999). of the amylopectin crystal. Plant Physiol., 122, 989–997 18) Commuri, P. D., and Keeling, P. L., Chain-length (2000). specificities of maize starch synthase I enzyme: studies 3) Smith, A. M., The biosynthesis of starch granules. of glucan affinity and catalytic properties. Plant J., 25, Biomacromolecules, 2, 335–341 (2001). 475–486 (2001). 4) Nakamura, Y., Towards a better understanding of the 19) Isono, N., Senoura, T., Yoshikawa, M., Sakurai, Y., metabolic system for amylopectin biosynthesis in plants: Watanabe, K., Ito, H., and Matsui, H., Occurrence of rice endosperm as a model tissue. Plant Cell Physiol., multiple forms for starch synthase II isozyme in devel- 43, 718–725 (2002). oping seeds of kidney bean. J. Appl. Glycosci., 51, 101– 5) Ball, S. G., and Morell, M. K., From bacterial glycogen 107 (2004). to starch: understanding the biogenesis of the plant 20) Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., starch granule. Annu. Rev. Plant Biol., 54, 207–233 Seidman, J. G., Smith, J. A., and Struhl, K., ‘‘Short (2003). Protocols in Molecular Biology’’ 3rd ed., John Wiley 6) Smith, A. M., Making starch. Curr. Opin. Plant Biol., 2, and Sons Inc., New York (1992). 223–229 (1999). 21) Hamada, S., Nozaki, K., Ito, H., Yoshimoto, Y., 7) Smith, A. M., Denyer, K., and Martin, C., The synthesis Yoshida, H., Hiraga, S., Onodera, S., Honma, M., of the starch granule. Annu. Rev. Plant Physiol. Plant Takeda, Y., and Matsui, H., Two starch-branching- Mol. Biol., 48, 67–87 (1997). enzyme isoforms occur in different fractions of devel- 8) Kossmann, J., and Lloyd, J., Understanding and influ- oping seeds of kidney bean. Biochem. J., 359, 23–34 encing starch biochemistry. Crit. Rev. Plant Sci., 19, (2001). 171–226 (2000). 22) Bradford, M. M., A Rapid and sensitive method for the 9) Denyer, K., Johnson, P., Zeeman, S., and Smith, A. M., quantitation of microgram quantities of protein utilizing The control of amylose synthesis. J. Plant Physiol., 158, the principle of protein-dye binding. Anal. Biochem., 72, 479–487 (2001). 248–254 (1976). 10) Craig, J., Lloyd, J. R., Tomlinson, K., Barber, L., 23) Isono, N., Ito, H., Senoura, T., Yoshikawa, M., Nozaki, Edwards, E., Wang, T. L., Martin, C., Hedley, C. L., and K., and Matsui, H., Molecular cloning of a cDNA Smith, A. M., Mutations in the gene encoding starch encoding granule-bound starch synthase I from kidney synthase II profoundly alter amylopectin structure in pea bean seeds and expression in Escherichia coli. J. Appl. embryos. Plant Cell, 10, 413–426 (1998). Glycosci., 50, 355–360 (2003). 11) Morell, M. K., Kosar-Hashemi, B., Cmiel, M., Samuel, 24) Smith, A. M., Evidence that the ‘waxy’ protein of pea M. S., Chandler, P., Rahman, S., Buleon, A., Batey, I. L., (Pisum sativum L.) is not the major starch-granule-bound and Li, Z., Barley sex6 mutants lack starch synthase IIa starch synthase. Planta, 182, 599–604 (1990). activity and contain a starch with novel properties. Plant 25) Tomlinson, K. L., Lloyd, J. R., and Smith, A. M., J., 34, 173–185 (2003). Importance of isoforms of starch-branching enzyme in 12) Edwards, A., Fulton, D. C., Hylton, C. M., Jobling, S. A., determining the structure of starch in pea leaves. Plant Gidley, M., Ro¨ssner, U., Martin, C., and Smith, A. M., A J., 11, 31–43 (1997). combined reduction in activity of starch synthase II and 26) Dubois, M., Gilles, K. A., Hamilton, J. K., Rebers, P. A., III of potato has novel effects on the starch of tubers. and Smith, F., Colorimetric method for determination of Plant J., 17, 251–261 (1999). sugars and related substances. Anal. Chem., 28, 350–356 13) Lloyd, J. R., Landschu¨tze, V., and Kossmann, J., (1956). Simultaneous antisense inhibition of two starch-synthase 27) Hizukuri, S., Takeda, Y., and Yasuda, M., Multi- isoforms in potato tubers leads to accumulation of branched nature of amylose and the action of debranch- grossly modified amylopectin. Biochem. J., 338, 515– ing enzymes. Carbohydr. Res., 94, 205-213 (1981). 521 (1999). 28) Emanuelsson, O., Nielsen, H., Brunak, S., and von 14) Imparl-Radosevich, J. M., Li, P., Zhang, L., McKean, A. Heijne, G., Predicting subcellular localization of proteins L., Keeling, P. L., and Guan, H. P., Purification and based on their N-terminal amino acid sequence. J. Mol. characterization of maize starch synthase I and its Biol., 300, 1005–1016 (2000). truncated forms. Arch. Biochem. Biophys., 353, 64–72 29) Emanuelsson, O., Nielsen, H., and von Heijne, G., (1998). ChloroP, a neural network-based method for predicting 15) Knight, M. F., Harn, C., Lilley, C. E. R., Guan, H., chloroplast transit peptides and their cleavage sites. Singletary, G. W., Mu-Forster, C., Wasserman, B. P., Protein Sci., 8, 978–984 (1999). and Keeling, P. L., Molecular cloning of starch syntha- 30) Dry, I., Smith, A., Edwards, A., Bhattacharyya, M., se I from maize (W64) endosperm and expression in Dunn, P., and Martin, C., Characterization of cDNAs Escherichia coli. Plant J., 14, 613–622 (1998). encoding two isoforms of granule-bound starch synthase 16) Edwards, A., Borthakur, A., Bornemann, S., Venail, J., which show differential expression in developing storage Denyer, K., Waite, D., Fulton, D., Smith, A., and Martin, organs of pea and potato. Plant J., 2, 193-202 (1992). C., Specificity of starch synthase isoforms from potato. 31) Furukawa, K., Tagaya, M., Inouye, M., Preiss, J., and Eur. J. Biochem., 266, 724–736 (1999). Fukui, T., Identification of lysine 15 at the active site in 17) Imparl-Radosevich, J. M., Nichols, D. J., Li, P., Escherichia coli glycogen synthase. J. Biol. Chem., 265, McKean, A. L., Keeling, P. L., and Guan, H. P., 2086–2090 (1990). Analysis of purified maize starch synthases IIa and IIb: 32) Furukawa, K., Tagaya, M., Tanizawa, K., and Fukui, T., SS isoforms can be distinguished based on their kinetic Role of the conserved Lys-X-Gly-Gly sequence at the 1960 T. SENOURA et al. ADP-glucose-binding site in Escherichia coli glycogen protein interactions. Plant Cell, 16, 694–708 (2004). synthase. J. Biol. Chem., 268, 23837–23842 (1993). 40) Baba, T., Nishihara, M., Mizuno, K., Kawasaki, T., 33) Imparl-Radosevich, J. M., Keeling, P. L., and Guan, H. Shimada, H., Kobayashi, E., Ohnishi, S., Tanaka, K., and P., Essential arginine residues in maize starch synthase Arai, Y., Identification, cDNA cloning, and gene IIa are involved in both ADP-glucose and primer expression of soluble starch synthase in rice (Oryza binding. FEBS Lett., 457, 357–362 (1999). sativa L.) immature seeds. Plant Physiol., 103, 565–573 34) Nichols, D. J., Keeling, P. L., Spalding, M., and Guan, (1993). H., Involvement of conserved aspartate and glutamate 41) Li, Z., Rahman, S., Kosar-Hashemi, B., Mouille, G., residues in the catalysis and substrate binding of maize Appels, R., and Morell, M. K., Cloning and character- starch synthase. Biochemistry, 39, 7820–7825 (2000). ization of a gene encoding wheat starch synthase I. 35) Yep, A., Ballicora, M. A., Sivak, M. N., and Preiss, J., Theor. Appl. Genet., 98, 1208–1216 (1999). Identification and characterization of a critical region in 42) Kossmann, J., Abel, G. J. W., Springer, F., Lloyd, J. R., the glycogen synthase from Escherichia coli. J. Biol. and Willmitzer, L., Cloning and functional analysis of a Chem., 279, 8359–8367 (2004). cDNA encoding a starch synthase from potato (Solanum 36) Ben-Bassat, A., Bauer, K., Chang, S. Y., Myambo, K., tuberosum L.) that is predominantly expressed in leaf Boosman, A., and Chang, S., Processing of the initiation tissue. Planta, 208, 503–511 (1999). methionine from proteins: Properties of the Escherichia 43) Denyer, K., and Smith, A., The purification and coli methionine aminopeptidase and its gene structure. characterization of the two forms of soluble starch J. Bacteriol., 169, 751–757 (1987). synthase from developing pea embryos. Planta, 186, 37) Burton, R. A., Bewley, J. D., Smith, A. M., 609–617 (1992). Bhattacharyya, M. K., Tatge, H., Ring, S., Bull, V., 44) Denyer, K., Sidebottom, C., Hylton, C. M., and Smith, Hamilton, W. D. O., and Martin, C., Starch branching A. M., Soluble isoforms of starch synthase and starch- enzymes belonging to distinct enzyme families are branching enzyme also occur within starch granules in deferentially expressed during pea embryo development. developing pea embryos. Plant J., 4, 191–198 (1993). Plant J., 7, 3–15 (1995). 45) Peat, S., Whelan, W. J., and Thomas, G. J., Evidence of 38) Seo, B.-S., Kim, S., Scott, M. P., Singletary, G. W., multiple branching in waxy maize starch. J. Chem. Soc., Wong, K.-S., James, M. G., and Myers, A. M., Func- 4546–4548 (1952). tional interactions between heterologously expressed 46) Hizukuri, S., Polymodal distribution of the chain lengths starch-branching enzymes of maize and the glycogen of amylopectins, and its significance. Carbohydr. Res., synthases of brewer’s yeast. Plant Physiol., 128, 1189– 147, 342–347 (1986). 1199 (2002). 47) Matsui, H., Senoura, T., Isono, N., Sakurai, Y., Hamada, 39) Tetlow, I. J., Wait, R., Lu, Z., Akkasaeng, R., Bowsher, S., and Ito, H., Granule-bound starch synthase isozyme C. G., Esposito, S., Kosar-Hashemi, B., Morell, M. K., localized predominantly in kidney bean leaves. J. Appl. and Emes, M. J., Protein phosphorylation in amyloplasts Glycosci., 50, 493–497 (2003). regulates starch branching enzyme activity and protein–