DOCSLIB.ORG

Role and Regulation of Starch Phosphorylase and Starch Synthase IV in Starch Biosynthesis in Maize Endosperm Amyloplasts

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Role and Regulation of Starch Phosphorylase and Starch Synthase IV in Starch Biosynthesis in Maize Endosperm Amyloplasts Role and Regulation of Starch Phosphorylase and Starch Synthase IV in Starch Biosynthesis in Maize Endosperm Amyloplasts By Renuka M. Subasinghe A Thesis presented to The University of Guelph In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Molecular and Cellular Biology Guelph, Ontario, Canada © Renuka M. Subasinghe, January, 2013 ABSTRACT ROLE AND REGULATION OF PLASTIDIAL STARCH PHOSPHORYLASE AND STARCH SYNTHASE IV IN STARCH BIOSYNTHESIS IN MAIZE ENDOSPERM AMYLOPLASTS Renuka M. Subasinghe Advisor: University of Guelph, 2013 Dr. Ian Tetlow Storage starch is synthesized in sub-cellular organelles called amyloplasts in higher plants. The synthesis of the starch granule is a result of the coordinated activity of several groups of starch biosynthetic enzymes. There are four major groups of these enzymes, ADP-glucose pyrophosphorylase (AGPase), starch synthases (SS), starch branching enzymes (SBE), and starch debranching enzymes (SDE). Starch phosphorylase (SP) exists as both dimeric and tetrameric forms in plastids in developing cereal endosperm and catalyses the reversible transfer of glucosyl units from glucose-1-phosphate to the non- reducing end of α-1-4 linked glucan chains, although the precise role in the pathway remains unclear. The present study was conducted to investigate the role and regulation of SP and SSIV in starch biosynthesis in developing maize endosperm. The results of this study showed that the tetrameric form of SP accounts for the majority of measurable catalytic activity, with the dimeric form being barely active and the monomer catalytically inactive. A catalytically active recombinant maize SP was heterologously expressed and used as an affinity ligand with amyloplast lysates to test protein-protein interactions in vitro. Results showed that the different multimeric status of SP influenced interactions with other enzymes of starch synthesis. Tetrameric SP interacted with SBEI and SSIIa, whilst the dimeric form of the enzyme interacted with SBEI, SBEIIb. All of these interactions were enhanced when amyloplasts were pre-treated with ATP, and broken following treatment with alkaline phosphatase (APase), indicating these interactions are regulated by protein phosphorylation. In addition, the catalytic activity of SSIV was reduced following treatment with APase, indicating a role for protein phosphorylation in the regulation of SSIV activity. Protein- protein interaction experiments also suggested a weak interaction between SSIV and SP. Multimeric forms of SP regulated by protein-protein interactions and protein phosphorylation suggested a role for SP in starch biosynthesis in maize endosperm. Acknowledgements First and foremost I wish to express my gratitude and appreciation to my advisor Dr. Ian Tetlow for providing me the opportunity to conduct a PhD in his laboratory at the Department of Molecular and Cellular Biology, University of Guelph and for the guidance, encouragement and expert advice given through the program. I would especially thank to Dr. Michael Emes, for his excellent guidance and contribution given in his area of expertise. I would like to thank Drs. Robert Mullen and Peter Pauls for serving as the members of my advisory committee. I gratefully acknowledge all members of the examination committee: Dr. Frederic Marsolais (External examiner), Dr. Anthony Clarke, Dr. Robert Mullen, Dr. Peter Pauls and Dr. Janet Wood. The members of the Tetlow/Emes research group have contributed immensely to my personal and professional time at University of Guelph. I am especially grateful to Dr. Fushan Liu for his valuable contribution and Amina Mahmouduva for technical support given towards my research. My sincere thanks also go to Usha, Zaheer, Nadya, Wendy, Mark, John, Lily, Ruby and all the present and pass members in the lab for their support and friendship. I gratefully acknowledge the financial support provided by the BioCar Initiative Project, Ontario and the University of Guelph Graduate Scholarship program. I sincerely thank to my loving mother, my husband and two daughters for their understanding, sacrifice and encouragement given in my life. iv Dedicated to my Loving Family My Husband Wasantha, My daughters Niki and Himi and my mother Karuna v Table of Contents Title Page Abstract Acknowledgements............………………………………………………….....………………..iv Dedication..............................................................................................................................v Table of Contents………..........………………………………………………………………………………..vi List of Figures ………………………………………………………………………………………………….....xiii List of Tables ………………………………………………………………............…….………………….xviii List of Abbreviations…………………………………………………………………………………........….xvv Page CHAPTER 1..........................................................................................................................1 1. General Introduction................................................................................................2 1.1 Starch Metabolism........................................................................................................2 1.1.1. Molecular structure of starch.............................................................................3 1.1.2. Starch Biosynthesis.............................................................................................7 1.1.2.1. Starch biosynthetic enzymes......................................................................8 1.1.2.1.1. ADP-glucose pyrophosphorylase (AGPase EC 2.7.7.27)................8 1.1.2.1.2. Starch synthase (SS, EC 2.4.1.21)..................................................13 1.1.2.1.2.1. Granule bound starch synthases (GBSS)................................16 1.1.2.1.2.2. Starch synthase I (SSI)...............................................................16 1.1.2.1.2.3. Starch synthase II (SSII)............................................................18 1.1.2.1.2.4. Starch Synthase III (SSIII…........…………......…………..…......20 1.1.2.1.2.5. Starch synthase IV (SSIV)………........…….……………….........21 vi 1.1.2.1.3. Starch branching enzyme (SBEs)......................................................25 1.1.2.1.3.1. Starch branching enzyme I (SBEI)...........................................25 1.1.2.1.3.2. Starch branching enzyme II (SBEII)........................................26 1.1.2.1.4. Starch de-branching enzyme (DBE)…………....……………............27 1.1.2.1.5. Disproportionating enzyme (D-enzyme).........................................28 1.1.2.1.6. Starch phosphorylase (SP).................................................................29 1.1.2.1.6.1. Importance of SP in starch metabolism…………..…......……..30 1.1.2.1.6.2. The isoforms of SP in higher plants………………....................30 1.1.2.1.6.3. Characterization of SP…………………………...…...…................32 1.1.2.1.6.4. Biochemical characterization of SP……….……………...…........33 1.1.2.1.6.5. SP and starch biosynthesis models...........................................40 1.1.2.1.6.6. Evidences of interaction of SP with SSIV….....…….................41 1.1.2.2. Post transitional modification of starch biosynthesis enzymes..........42 1.2. Objectives of the study…………………………………………………………….........43 CHAPTER 2: Biochemical Investigation of the Regulation of Plastidial Starch Phosphorylase in Maize Endosperm….....……....…………………………45 2.1. Introduction……..………………………………………….......………….......................46 2.2. Materials and Methods……...............………......…...………………….....…………...52 2.2.1. Materials……………………………………………………………...........................52 2.2.2. Methods..…………………………………………………………………......………..52 2.2.2.1. Amyloplast purification from maize endosperms.......…………………..52 vii 2.2.2.2. Preparation of whole cell extracts.……………………………………………………53 2.2.2.3. Localization of SP in the plastid..………...........……………………………54 2.2.2.4. Preparation of granule bound proteins…………….…......……………….54 2.2.2.5. Biochemical Characterization of SP in maize endosperm………….…55 2.2.2.5.1. Phosphorylation and dephosphorylation of amyloplast lysates..............................................................................55 2.2.2.5.2. Enzyme Assays………………………....................……………………...56 2.2.2.5.2.1. Starch phosphorylase glucan synthetic activity assay………56 2.2.2.5.2.2. Starch phosphorylase glucan degradative activity assay...56 2.2.2.5.3. Gel Filtration Chromatography (GPC)…...…………….………..........57 2.2.2.6. Protein analysis………………………………………………………………….58 2.2.2.6.1. Quantification of proteins……………………………………………......58 2.2.2.6.2. Sodium dodecyl sulfate polyacrylamide gel electrophoresis…...58 2.2.2.6.3. SP-Native affinity Zymogram…………………………………..............59 2.2.2.6.4. Coomassie blue staining………………………………………………….60 2.2.2.6.5. Silver staining………………………………………………………............60 2.2.2.6.6. Mobility shift detection of phosphorylated proteins (Phos-TagTM)………………………………………………………………..60 2.2.2.6.7. Immunological techniques……………………………………………….62 2.2.2.6.7.1. Preparation of Peptides and Antisera…………………………...62 2.2.2.6.7.2. Antibody Purification………………………………………………...63 2.2.2.6.7.3. Immunoblot analysis………………………………………………...64 2.2.2.6.7.4. Immunoprecipitation……………………………………….………….......64 viii 2.3 Results…………………………………………………………………………………………………............66 2.3.1. Subcellular localization of SP in maize endosperm.....................................66 2.3.2. The synthetic activity of SP in developing maize endosperm..................69 2.3.3. Investigating the regulation of SP by protein phosphorylation................71
Load more

Recommended publications
  • METACYC ID Description A0AR23 GO:0004842 (Ubiquitin-Protein Ligase
    Electronic Supplementary Material (ESI) for Integrative Biology This journal is © The Royal Society of Chemistry 2012 Heat Stress Responsive Zostera marina Genes, Southern Population (α=0.
    [Show full text]
  • Bacteria Belonging to Pseudomonas Typographi Sp. Nov. from the Bark Beetle Ips Typographus Have Genomic Potential to Aid in the Host Ecology
    insects Article Bacteria Belonging to Pseudomonas typographi sp. nov. from the Bark Beetle Ips typographus Have Genomic Potential to Aid in the Host Ecology Ezequiel Peral-Aranega 1,2 , Zaki Saati-Santamaría 1,2 , Miroslav Kolaˇrik 3,4, Raúl Rivas 1,2,5 and Paula García-Fraile 1,2,4,5,* 1 Microbiology and Genetics Department, University of Salamanca, 37007 Salamanca, Spain; [email protected] (E.P.-A.); [email protected] (Z.S.-S.); [email protected] (R.R.) 2 Spanish-Portuguese Institute for Agricultural Research (CIALE), 37185 Salamanca, Spain 3 Department of Botany, Faculty of Science, Charles University, Benátská 2, 128 01 Prague, Czech Republic; [email protected] 4 Laboratory of Fungal Genetics and Metabolism, Institute of Microbiology of the Academy of Sciences of the Czech Republic, 142 20 Prague, Czech Republic 5 Associated Research Unit of Plant-Microorganism Interaction, University of Salamanca-IRNASA-CSIC, 37008 Salamanca, Spain * Correspondence: [email protected] Received: 4 July 2020; Accepted: 1 September 2020; Published: 3 September 2020 Simple Summary: European Bark Beetle (Ips typographus) is a pest that affects dead and weakened spruce trees. Under certain environmental conditions, it has massive outbreaks, resulting in attacks of healthy trees, becoming a forest pest. It has been proposed that the bark beetle’s microbiome plays a key role in the insect’s ecology, providing nutrients, inhibiting pathogens, and degrading tree defense compounds, among other probable traits. During a study of bacterial associates from I. typographus, we isolated three strains identified as Pseudomonas from different beetle life stages. In this work, we aimed to reveal the taxonomic status of these bacterial strains and to sequence and annotate their genomes to mine possible traits related to a role within the bark beetle holobiont.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Supplementary Materials
    1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No.
    [Show full text]
  • A Label-Free Cellular Proteomics Approach to Decipher the Antifungal Action of Dimiq, a Potent Indolo[2,3- B]Quinoline Agent, Against Candida Albicans Biofilms
    A Label-Free Cellular Proteomics Approach to Decipher the Antifungal Action of DiMIQ, a Potent Indolo[2,3- b]Quinoline Agent, against Candida albicans Biofilms Robert Zarnowski 1,2*, Anna Jaromin 3*, Agnieszka Zagórska 4, Eddie G. Dominguez 1,2, Katarzyna Sidoryk 5, Jerzy Gubernator 3 and David R. Andes 1,2 1 Department of Medicine, School of Medicine & Public Health, University of Wisconsin-Madison, Madison, WI 53706, USA; [email protected] (E.G.D.); [email protected] (D.R.A.) 2 Department of Medical Microbiology, School of Medicine & Public Health, University of Wisconsin-Madison, Madison, WI 53706, USA 3 Department of Lipids and Liposomes, Faculty of Biotechnology, University of Wroclaw, 50-383 Wroclaw, Poland; [email protected] 4 Department of Medicinal Chemistry, Jagiellonian University Medical College, 30-688 Cracow, Poland; [email protected] 5 Department of Pharmacy, Cosmetic Chemicals and Biotechnology, Team of Chemistry, Łukasiewicz Research Network-Industrial Chemistry Institute, 01-793 Warsaw, Poland; [email protected] * Correspondence: [email protected] (R.Z.); [email protected] (A.J.); Tel.: +1-608-265-8578 (R.Z.); +48-71-3756203 (A.J.) Label-Free Cellular Proteomics of Candida albicans biofilms treated with DiMIQ Identified Proteins Accession # Alternate ID Gene names (ORF ) WT DIMIQ Z SCORE Proteins induced by DiMIQ Arginase (EC 3.5.3.1) A0A1D8PP00 CAR1 CAALFM_C504490CA 0.000 6.648 drug induced Glucan 1,3-beta-glucosidase BGL2 (EC 3.2.1.58) (Exo-1Q5AMT2 BGL2 CAALFM_C402250CA
    [Show full text]
  • Glucan Phosphorylase-Catalyzed Enzymatic Reactions Using Analog Substrates to Synthesize Non-Natural Oligo- and Polysaccharides
    catalysts Review α-Glucan Phosphorylase-Catalyzed Enzymatic Reactions Using Analog Substrates to Synthesize Non-Natural Oligo- and Polysaccharides Jun-ichi Kadokawa Department of Chemistry, Biotechnology, and Chemical Engineering, Graduate School of Science and Engineering, Kagoshima University, 1-21-40 Korimoto, Kagoshima 860-0065, Japan; [email protected]; Tel.: +81-99-285-7743 Received: 9 October 2018; Accepted: 16 October 2018; Published: 19 October 2018 Abstract: As natural oligo- and polysaccharides are important biomass resources and exhibit vital biological functions, non-natural oligo- and polysaccharides with a well-defined structure can be expected to act as new functional materials with specific natures and properties. α-Glucan phosphorylase (GP) is one of the enzymes that have been used as catalysts for practical synthesis of oligo- and polysaccharides. By means of weak specificity for the recognition of substrates by GP, non-natural oligo- and polysaccharides has precisely been synthesized. GP-catalyzed enzymatic glycosylations using several analog substrates as glycosyl donors have been carried out to produce oligosaccharides having different monosaccharide residues at the non-reducing end. Glycogen, a highly branched natural polysaccharide, has been used as the polymeric glycosyl acceptor and primer for the GP-catalyzed glycosylation and polymerization to obtain glycogen-based non-natural polysaccharide materials. Under the conditions of removal of inorganic phosphate, thermostable GP-catalyzed enzymatic polymerization of analog monomers occurred to give amylose analog polysaccharides. Keywords: analog substrate; α-glucan phosphorylase; non-natural oligo- and polysaccharides 1. Introduction Oligo- and polysaccharides are widely distributed in nature and enact specific important biological functions in accordance with their chemical structures [1].
    [Show full text]
  • Global Transcriptome Analysis and Identification of Genes Involved In
    www.nature.com/scientificreports OPEN Global transcriptome analysis and identification of genes involved in nutrients accumulation during Received: 19 December 2016 Accepted: 31 August 2017 seed development of rice tartary Published: xx xx xxxx buckwheat (Fagopyrum Tararicum) Juan Huang1, Jiao Deng1, Taoxiong Shi1, Qijiao Chen1, Chenggang Liang1, Ziye Meng1, Liwei Zhu1, Yan Wang1, Fengli Zhao2, Shizhou Yu3 & Qingfu Chen1 Tartary buckwheat seeds are rich in various nutrients, such as storage proteins, starch, and flavonoids. To get a good knowledge of the transcriptome dynamics and gene regulatory mechanism during the process of seed development and nutrients accumulation, we performed a comprehensive global transcriptome analysis using rice tartary buckwheat seeds at different development stages, namely pre-filling stage, filling stage, and mature stage. 24 819 expressed genes, including 108 specifically expressed genes, and 11 676 differentially expressed genes (DEGs) were identified. qRT-PCR analysis was performed on 34 DEGs to validate the transcriptome data, and a good consistence was obtained. Based on their expression patterns, the identified DEGs were classified to eight clusters, and the enriched GO items in each cluster were analyzed. In addition, 633 DEGs related to plant hormones were identified. Furthermore, genes in the biosynthesis pathway of nutrients accumulation were analyzed, including 10, 20, and 23 DEGs corresponding to the biosynthesis of seed storage proteins, flavonoids, and starch, respectively. This is the first transcriptome analysis during seed development of tartary buckwheat. It would provide us a comprehensive understanding of the complex transcriptome dynamics during seed development and gene regulatory mechanism of nutrients accumulation. Seed is the primary storage organ in plants for storing nutrients such as starch, lipids, and proteins1.
    [Show full text]
  • Supplementary Information
    Supplementary Information Table S1. Pathway analysis of the 1246 dwf1-specific differentially expressed genes. Fold Change Fold Change Fold Change Gene ID Description (dwf1/WT) (XL-5/WT) (XL-6/WT) Carbohydrate Metabolism Glycolysis/Gluconeogenesis POPTR_0008s11770.1 Glucose-6-phosphate isomerase −1.7382 0.512146 0.168727 POPTR_0001s47210.1 Fructose-bisphosphate aldolase, class I 1.599591 0.044778 0.18237 POPTR_0011s05190.3 Probable phosphoglycerate mutase −2.11069 −0.34562 −0.9738 POPTR_0012s01140.1 Pyruvate kinase −1.25054 0.074697 −0.16016 POPTR_0016s12760.1 Pyruvate decarboxylase 2.664081 0.021062 0.371969 POPTR_0012s08010.1 Aldehyde dehydrogenase (NAD+) −1.41556 0.479957 −0.21366 POPTR_0014s13710.1 Acetyl-CoA synthetase −1.337 0.154552 −0.26532 POPTR_0017s11660.1 Aldose 1-epimerase 2.770518 0.016874 0.73016 POPTR_0010s11970.1 Phosphoglucomutase −1.25266 −0.35581 0.074064 POPTR_0012s14030.1 Phosphoglucomutase −1.15872 −0.68468 −0.93596 POPTR_0002s10850.1 Phosphoenolpyruvate carboxykinase (ATP) 1.489119 0.967284 0.821559 Citrate cycle (TCA cycle) 2-Oxoglutarate dehydrogenase E2 component POPTR_0014s15280.1 −1.63733 0.076435 0.170827 (dihydrolipoamide succinyltransferase) POPTR_0002s26120.1 Succinyl-CoA synthetase β subunit −1.29244 −0.38517 −0.3497 POPTR_0007s12750.1 Succinate dehydrogenase (ubiquinone) flavoprotein subunit −1.83751 0.519356 0.309149 POPTR_0002s10850.1 Phosphoenolpyruvate carboxykinase (ATP) 1.489119 0.967284 0.821559 Pentose phosphate pathway POPTR_0008s11770.1 Glucose-6-phosphate isomerase −1.7382 0.512146 0.168727 POPTR_0013s00660.1 Glucose-6-phosphate 1-dehydrogenase −1.26949 −0.18314 0.374822 POPTR_0015s00960.1 6-Phosphogluconolactonase 2.022223 0.168877 0.971431 POPTR_0010s11970.1 Phosphoglucomutase −1.25266 −0.35581 0.074064 POPTR_0012s14030.1 Phosphoglucomutase −1.15872 −0.68468 −0.93596 POPTR_0001s47210.1 Fructose-bisphosphate aldolase, class I 1.599591 0.044778 0.18237 S2 Table S1.
    [Show full text]
  • An Evolving Hierarchical Family Classification for Glycosyltransferases
    doi:10.1016/S0022-2836(03)00307-3 J. Mol. Biol. (2003) 328, 307–317 COMMUNICATION An Evolving Hierarchical Family Classification for Glycosyltransferases Pedro M. Coutinho1, Emeline Deleury1, Gideon J. Davies2 and Bernard Henrissat1* 1Architecture et Fonction des Glycosyltransferases are a ubiquitous group of enzymes that catalyse the Macromole´cules Biologiques transfer of a sugar moiety from an activated sugar donor onto saccharide UMR6098, CNRS and or non-saccharide acceptors. Although many glycosyltransferases catalyse Universite´s d’Aix-Marseille I chemically similar reactions, presumably through transition states with and II, 31 Chemin Joseph substantial oxocarbenium ion character, they display remarkable diversity Aiguier, 13402 Marseille in their donor, acceptor and product specificity and thereby generate a Cedex 20, France potentially infinite number of glycoconjugates, oligo- and polysacchar- ides. We have performed a comprehensive survey of glycosyltransferase- 2Structural Biology Laboratory related sequences (over 7200 to date) and present here a classification of Department of Chemistry, The these enzymes akin to that proposed previously for glycoside hydrolases, University of York, Heslington into a hierarchical system of families, clans, and folds. This evolving York YO10 5YW, UK classification rationalises structural and mechanistic investigation, harnesses information from a wide variety of related enzymes to inform cell biology and overcomes recurrent problems in the functional prediction of glycosyltransferase-related open-reading frames. q 2003 Elsevier Science Ltd. All rights reserved Keywords: glycosyltransferases; protein families; classification; modular *Corresponding author structure; genomic annotations The biosynthesis of complex carbohydrates and are involved in glycosyl transfer and thus conquer polysaccharides is of remarkable biological import- what Sharon has provocatively described as “the ance.
    [Show full text]
  • A Genomic Study of Soybean Iron Deficiency Chlorosis Jamie Aileen O'rourke Iowa State University
    Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations 2008 A genomic study of soybean iron deficiency chlorosis Jamie Aileen O'Rourke Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/rtd Part of the Agricultural Science Commons, Agronomy and Crop Sciences Commons, and the Horticulture Commons Recommended Citation O'Rourke, Jamie Aileen, "A genomic study of soybean iron deficiency chlorosis" (2008). Retrospective Theses and Dissertations. 15824. https://lib.dr.iastate.edu/rtd/15824 This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. A genomic study of soybean iron deficiency chlorosis by Jamie Aileen O’Rourke A dissertation submitted to the graduate faculty in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Major: Genetics Program of Study Committee: Randy C. Shoemaker, Co-Major Professor Steve Whitham, Co-Major Professor Silvia Cianzio Thomas Baum David Hannapel Iowa State University Ames, Iowa 2008 Copyright © Jamie Aileen O’Rourke, 2008. All rights reserved. 3316180 3316180 2008 ii Dedicated to: To my parents, Tamia and Dennis, and my sisters, Kelly and Darcy. For always believing in and supporting my
    [Show full text]
  • Recent Progress Toward Understanding the Role of Starch Biosynthetic Enzymes in the Cereal Endosperm
    Amylase 2017; 1: 59–74 Review Article Cheng Li, Prudence O. Powell, Robert G. Gilbert* Recent progress toward understanding the role of starch biosynthetic enzymes in the cereal endosperm DOI 10.1515/amylase-2017-0006 Abbreviations: ADPGlc, adenosine 5'-diphosphate Received July 31, 2017; accepted September 22, 2017 glucose; AGPase, ADP-glucose pyrophosphorylase; Abstract: Starch from cereal endosperm is a major CBM, carbohydrate-binding module; CLD, chain-length energy source for many mammals. The synthesis of this distribution; DAF, days after flowering; DBE, debranching starch involves a number of different enzymes whose enzyme; D-enzyme, disproportionating enzyme; mode of action is still not completely understood. ADP- DP, degree of polymerization; GBSS, granule bound glucose pyrophosphorylase is involved in the synthesis starch synthase; GH, glycoside hydrolase; GT, glycosyl of starch monomer (ADP-glucose), a process, which transferase; ISA, isoamylase; MOS, maltooligosaccharides; almost exclusively takes place in the cytosol. ADP- 3-PGA, 3-phosphoglyceric acid; Pi, inorganic phosphate; glucose is then transported into the amyloplast and PUL, pullulanase; SBE, starch-branching enzyme; SP, incorporated into starch granules by starch synthase, starch phosphorylase; SS, starch synthases; SuSy, sucrose starch-branching enzyme and debranching enzyme. synthase; UDPGlc, nucleoside diphosphate glucose. Additional enzymes, including starch phosphorylase and disproportionating enzyme, may be also involved in the formation of starch granules, although their exact 1 Introduction functions are still obscure. Interactions between these Starch is a highly branched d-glucose homopolymer enzymes in the form of functional complexes have been with a wide range of uses. It is accumulated in the cereal proposed and investigated, resulting more complicated endosperm as an energy reserve for seed germination, as starch biosynthetic pathways.
    [Show full text]
  • Plant Nucleotide Sugar Formation, Interconversion, and Salvage by Sugar Recycling*
    Plant Nucleotide Sugar Formation, Interconversion, and Salvage by Sugar Recycling∗ Maor Bar-Peled1,2 and Malcolm A. O’Neill2 1Department of Plant Biology and 2Complex Carbohydrate Research Center, University of Georgia, Athens, Georgia 30602; email: [email protected], [email protected] Annu. Rev. Plant Biol. 2011. 62:127–55 Keywords First published online as a Review in Advance on nucleotide sugar biosynthesis, nucleotide sugar interconversion, March 1, 2011 nucleotide sugar salvage, UDP-glucose, UDP-xylose, The Annual Review of Plant Biology is online at UDP-arabinopyranose mutase plant.annualreviews.org This article’s doi: Abstract 10.1146/annurev-arplant-042110-103918 Nucleotide sugars are the universal sugar donors for the formation Copyright c 2011 by Annual Reviews. by Oak Ridge National Lab on 05/20/11. For personal use only. of polysaccharides, glycoproteins, proteoglycans, glycolipids, and All rights reserved glycosylated secondary metabolites. At least 100 genes encode proteins 1543-5008/11/0602-0127$20.00 involved in the formation of nucleotide sugars. These nucleotide ∗ Annu. Rev. Plant Biol. 2011.62:127-155. Downloaded from www.annualreviews.org Dedicated to Peter Albersheim for his inspiration sugars are formed using the carbohydrate derived from photosynthesis, and his pioneering studies in determining the the sugar generated by hydrolyzing translocated sucrose, the sugars structure and biological functions of complex carbohydrates. released from storage carbohydrates, the salvage of sugars from glycoproteins and glycolipids, the recycling of sugars released during primary and secondary cell wall restructuring, and the sugar generated during plant-microbe interactions. Here we emphasize the importance of the salvage of sugars released from glycans for the formation of nucleotide sugars.
    [Show full text]