DOCSLIB.ORG

アミロース製造に利用する酵素の開発と改良 Phosphorylase and Muscle Phosphorylase B

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
アミロース製造に利用する酵素の開発と改良 Phosphorylase and Muscle Phosphorylase B 125 J. Appl. Glycosci., 54, 125―131 (2007) !C 2007 The Japanese Society of Applied Glycoscience Proceedings of the Symposium on Amylases and Related Enzymes, 2006 Developing and Engineering Enzymes for Manufacturing Amylose (Received December 5, 2006; Accepted January 5, 2007) Michiyo Yanase,1,＊ Takeshi Takaha1 and Takashi Kuriki1 1 Biochemical Research Laboratory, Ezaki Glico Co., Ltd. (4 ―6 ―5, Utajima, Nishiyodogawa-ku, Osaka 555-8502, Japan) Abstract: Amylose is a functional biomaterial and is expected to be used for various industries. However at present, manufacturing of amylose is not done, since the purification of amylose from starch is very difficult. It has been known that amylose can be produced in vitro by using α-glucan phosphorylases. In order to ob- tain α-glucan phosphorylase suitable for manufacturing amylose, we isolated an α-glucan phosphorylase gene from Thermus aquaticus and expressed it in Escherichia coli. We also obtained thermostable α-glucan phos- phorylase by introducing amino acid replacement onto potato enzyme. α-Glucan phosphorylase is suitable for the synthesis of amylose; the only problem is that it requires an expensive substrate, glucose 1-phosphate. We have avoided this problem by using α-glucan phosphorylase either with sucrose phosphorylase or cellobiose phosphorylase, where inexpensive raw material, sucrose or cellobiose, can be used instead. In these combined enzymatic systems, α-glucan phosphorylase is a key enzyme. This paper summarizes our work on engineering practical α-glucan phosphorylase for industrial processes and its use in the enzymatic synthesis of essentially linear amylose and other glucose polymers. Key words: amylose, glucose polymer, α-glucan phosphorylase, glycogen debranching enzyme, protein engi- neering α-1,4 glucan is the major form of energy reserve from Enzymes for amylose synthesis. microorganisms to animals, and mainly occurs in the form Amylose can be produced by the enzymes listed in Ta- of starch (amylose and amylopectin) or glycogen. Amy- ble 1. Starch (glycogen) synthase (EC 2.4.1.21) is the en- lose is a mostly linear polymer of α-1,4-linked glucose zyme employed for starch (glycogen) biosynthesis in vivo. with rare α-1,6 branched points and normally contains ap- The enzymes from plants and microorganisms use ADP- proximately 20% in starch granules.1,2) Amylopectin is the glucose as a substrate, whereas the enzymes from animals major component of starch (80%), in which short amylose use UDP-glucose.10,11) Since ADP-glucose and UDP-glu- chains are connected together with α-1,6 linkages to form cose are very expensive, these are not practical starting a characteristic cluster structure.2,3) Glycogen is also a materials for manufacturing amylose. Therefore, these re- branched glucan, but it differs from amylopectin in the actions are not suitable for industrial production of syn- number and organization of α-1,6 branched linkages and thetic amylose. absence of a cluster structure.4) Cyclodextrin or cycloamy- Isoamylase (EC 3.2.1.68) and pullulanase (EC 3.2.1.41) lose is another form of α-1,4 glucan. Cyclodextrins are catalyze the hydrolysis of α-1,6-glucosidic linkage in cyclic α-1,4 glucans with a degree of polymerization (DP) starch.12,13) These enzymes have been known to be used for from 6 to 8,5) which are produced by treating starch with the conversion of amylopectin into amylose. However, cyclomaltodextrin glucanotransferase (CGTase, EC 2.4.1. most of the amylose produced retains the original unit 19). Cycloamyloses are larger homologues of cyclodex- chains of amylopectin; therefore, the average DP of the trins with a DP larger than 17 and produced by an intra- amylose is around 20. From this reason, it is not possible molecular transglycosylation reaction of amylomaltases to produce amylose with controlled molecular size with (EC 2.4.1.25).6,7) These glucose polymers are different not these enzymes. only in their structure but also in their physical and Amylosucrase (EC 2.4.1.4) catalyzes the transfer of the chemical properties. Among the four glucose polymers glucose moiety from sucrose to the accepter molecule and described above, amylopectin and cyclodextrins (DP 6―8) produces amylose.14) Amylosucrase is very attractive since are available in pure form as industrial raw materials, but it produces amylose directly from sucrose, a less expen- neither amylose nor glycogen is currently available as an sive and renewable biomass. However, the molecular size industrial raw material. We have been studying enzymes of amylose produced by this enzyme is reported to be that can be used to produce many types of glucose poly- about 10 kDa or smaller.15) The amylosucrase system is mers with controlled molecular size and structures.8) Amy- not suitable to produce amylose either, since it cannot lose is one of most interesting targets, since it is expected produce amylose with the desired molecular size. to be used in various industries as a functional biomaterial Cyclomaltodextrin glucanotransferases catalyze the and also as starting material to produce cycloamylose and linearization of cyclodextrin with a so-called “coupling re- other glucose polymers.8,9) action” and produce amylose.16) Though the maximum yield of amylose was more than 90%, the DP of the prod- ＊ Corresponding author (Tel. +81―6―6477―8425, Fax. +81―6―6477― uct was reported to be 34―43 glucose units. This system 8362, E-mail: [email protected]). is also unable to produce amylose with the desired mo- 126 J. Appl. Glycosci., Vol. 54, No. 2 (2007) Table 1. Various enzymes for the amylose synthesis. Enzyme Substrate (1) Starch synthase (EC 2.4.1.21) ADP-Glucose (Glycogen synthase) (UDP-Glucose) (2) α-Glucan phosphorylase (EC 2.4.1.1) Glucose 1-phosphate (3) Amylosucrase (EC 2.4.1.4) Sucrose (4) Pullulanase (EC 3.2.1.41) Starch Isoamylase (EC 3.2.1.68) (5) Cyclodextrin glucano- (EC 2.4.1.19) Cyclodextrin transferase (6) Glycogen debranching (EC 2.4.1.25／ Starch enzyme EC 3.2.1.33) lecular size. Fig. 1. Action of glycogen debranching enzyme. Amylose synthesis using glycogen debranching en- Glycogen debranching enzyme transfers maltosyl or maltotriosyl zyme. units from the shortened chain to a non-reducing end of another Glycogen debranching enzyme (EC 2.4.1.25／EC 3.2.1. chain with its 4-α-glucanotransferase activity (A), and leaves a sin- gle glucosyl residue attached. The glycosyl stub remaining at the 33) is a multifunctional enzyme and possesses 4 -α- branch point is next cleaved with its amylo-1,6-glucosidase activity glucanotransferase and amylo-1,6-glucosidase activities, in (B). When glycogen debranching enzyme was reacted with amy- the same polypeptide chain.17,18) Glycogen debranching en- lopectin, amylose was produced in the early stage of the reaction. zyme is distributed in mammals and yeasts and is in- Then this enzyme next catalyzed the cyclization reaction of amy- lose to produce cycloamylose (C). Open and closed circles indicate volved in the degradation of glycogen together with α- glucosyl residue connected with α-1,4-glucosidic linkage, and verti- glucan phosphorylase (EC 2.4.1.1) in vivo. α-Glucan cal lines indicate α-1,6-branched linkage. phosphorylase degrades glycogen from its non-reducing ends, leaving dextrin with shortened side chains. Glyco- origins differ in their modes of regulation and their sub- gen debranching enzyme then transfers maltosyl or malto- strate preferences.21,25) α-Glucan phosphorylases from po- triosyl units from the shortened chain to a non-reducing tato26,27) and rabbit muscle20) have been successfully em- end of another chain with its transferase activity, and ployed in the synthesis of amylose in vitro. The molecular leaves a single glucosyl residue attached. The glucosyl weight of the amylose thus produced has a narrow distri- stub remaining at the branch point is next cleaved with its bution (Mw／Mn<1.2) and can be controlled by the G-1-P／ amylo-1,6-glucosidase activity. We presumed relatively primer molar ratio.26) long amylose might be produced when glycogen de- branching enzyme acts on amylopectin in vitro in the ab- α-Glucan phosphrylase from Thermus aquaticus. sence of α-glucan phosphorylase (Fig. 1). When glycogen Enzymes used in industrial processes are required to be debranching enzyme reacted with amylopectin, amylose stable, even at elevated temperatures or when stored. Be- was produced in the early stage of the reaction. However, cause amylose easily forms a precipitate at low tempera- this enzyme next catalyzes the cyclization reaction of tures and this precipitation can be significantly inhibited amylose to produce cycloamylose, which account for at elevated temperatures, α-glucan phosphorylase for amy- about 60% in the final stage of the reaction (Fig. 1). We lose production also expected to be thermostable. The α- discovered that glycogen debranching enzyme was not glucan phosphorylase gene from T. aquaticus was iso- suitable for amylose production but was a very attractive lated, and the properties of the enzyme expressed in Es- enzyme for producing cycloamylose from starch.19) cherichia coli were characterized.28) The optimum tem- perature for phosphorylation reaction of the enzyme was Amylose synthesis using α-glucan phosphorylase. 70°C and the optimum temperature for glucan synthetic α-Glucan phosphorylase catalyzes a transfer of the glu- reaction was 50°C, and the enzyme retained about 80% of cose moiety from glucose 1-phosphate (G-1-P) to malto- its activity even after incubation at 80°C for 30 min. The dextrin primer and can produce essentially linear amylose minimum primer for glucan synthesis reaction and the by repeating this activity. The molecular size of amylose minimum effective substrate for phosphorylation of the has been reported to be controlled by changing the G-1-P enzyme from T.
Load more

Recommended publications
  • METACYC ID Description A0AR23 GO:0004842 (Ubiquitin-Protein Ligase
    Electronic Supplementary Material (ESI) for Integrative Biology This journal is © The Royal Society of Chemistry 2012 Heat Stress Responsive Zostera marina Genes, Southern Population (α=0.
    [Show full text]
  • Bacteria Belonging to Pseudomonas Typographi Sp. Nov. from the Bark Beetle Ips Typographus Have Genomic Potential to Aid in the Host Ecology
    insects Article Bacteria Belonging to Pseudomonas typographi sp. nov. from the Bark Beetle Ips typographus Have Genomic Potential to Aid in the Host Ecology Ezequiel Peral-Aranega 1,2 , Zaki Saati-Santamaría 1,2 , Miroslav Kolaˇrik 3,4, Raúl Rivas 1,2,5 and Paula García-Fraile 1,2,4,5,* 1 Microbiology and Genetics Department, University of Salamanca, 37007 Salamanca, Spain; [email protected] (E.P.-A.); [email protected] (Z.S.-S.); [email protected] (R.R.) 2 Spanish-Portuguese Institute for Agricultural Research (CIALE), 37185 Salamanca, Spain 3 Department of Botany, Faculty of Science, Charles University, Benátská 2, 128 01 Prague, Czech Republic; [email protected] 4 Laboratory of Fungal Genetics and Metabolism, Institute of Microbiology of the Academy of Sciences of the Czech Republic, 142 20 Prague, Czech Republic 5 Associated Research Unit of Plant-Microorganism Interaction, University of Salamanca-IRNASA-CSIC, 37008 Salamanca, Spain * Correspondence: [email protected] Received: 4 July 2020; Accepted: 1 September 2020; Published: 3 September 2020 Simple Summary: European Bark Beetle (Ips typographus) is a pest that affects dead and weakened spruce trees. Under certain environmental conditions, it has massive outbreaks, resulting in attacks of healthy trees, becoming a forest pest. It has been proposed that the bark beetle’s microbiome plays a key role in the insect’s ecology, providing nutrients, inhibiting pathogens, and degrading tree defense compounds, among other probable traits. During a study of bacterial associates from I. typographus, we isolated three strains identified as Pseudomonas from different beetle life stages. In this work, we aimed to reveal the taxonomic status of these bacterial strains and to sequence and annotate their genomes to mine possible traits related to a role within the bark beetle holobiont.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Stereoselective Synthesis of a 4- -Glucoside of Valienamine and Its X
    www.nature.com/scientificreports OPEN Stereoselective synthesis of a 4‑⍺‑glucoside of valienamine and its X‑ray structure in complex with Streptomyces coelicolor GlgE1‑V279S Anshupriya Si1,4, Thilina D. Jayasinghe2,4, Radhika Thanvi1, Sunayana Kapil3, Donald R. Ronning2* & Steven J. Sucheck1* Glycoside hydrolases (GH) are a large family of hydrolytic enzymes found in all domains of life. As such, they control a plethora of normal and pathogenic biological functions. Thus, understanding selective inhibition of GH enzymes at the atomic level can lead to the identifcation of new classes of therapeutics. In these studies, we identifed a 4‑⍺‑glucoside of valienamine (8) as an inhibitor of Streptomyces coelicolor (Sco) GlgE1‑V279S which belongs to the GH13 Carbohydrate Active EnZyme family. The results obtained from the dose–response experiments show that 8 at a concentration of 1000 µM reduced the enzyme activity of Sco GlgE1‑V279S by 65%. The synthetic route to 8 and a closely related 4‑⍺‑glucoside of validamine (7) was achieved starting from readily available D‑maltose. A key step in the synthesis was a chelation‑controlled addition of vinylmagnesium bromide to a maltose‑derived enone intermediate. X‑ray structures of both 7 and 8 in complex with Sco GlgE1‑ V279S were solved to resolutions of 1.75 and 1.83 Å, respectively. Structural analysis revealed the valienamine derivative 8 binds the enzyme in an E2 conformation for the cyclohexene fragment. Also, the cyclohexene fragment shows a new hydrogen‑bonding contact from the pseudo‑diaxial C(3)–OH to the catalytic nucleophile Asp 394 at the enzyme active site.
    [Show full text]
  • Supplementary Materials
    1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No.
    [Show full text]
  • Towards the Molecular Understanding of Glycogen Elongation by Amylosucrase
    Towards the molecular understanding of glycogen elongation by amylosucrase. Cécile Albenne, Lars K Skov, Vinh Tran, Michael Gajhede, Pierre Monsan, Magali Remaud Simeon, Gwenaëlle André-Leroux To cite this version: Cécile Albenne, Lars K Skov, Vinh Tran, Michael Gajhede, Pierre Monsan, et al.. Towards the molecular understanding of glycogen elongation by amylosucrase.. Proteins - Structure, Function and Bioinformatics, Wiley, 2007, 66 (1), pp.118-26. 10.1002/prot.21083. hal-02663870 HAL Id: hal-02663870 https://hal.inrae.fr/hal-02663870 Submitted on 31 May 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution - ShareAlike| 4.0 International License PROTEINS: Structure, Function, and Bioinformatics 66:118–126 (2007) Towards the Molecular Understanding of Glycogen Elongation by Amylosucrase Ce´cile Albenne,1 Lars K. Skov,2 Vinh Tran,3 Michael Gajhede,2 Pierre Monsan,4 Magali Remaud-Sime´on,4* and Gwe´nae¨lle Andre´-Leroux5 1Laboratoire Surfaces Cellulaires et Signalisation chez les Ve´ge´taux, UMR 5546
    [Show full text]
  • A Label-Free Cellular Proteomics Approach to Decipher the Antifungal Action of Dimiq, a Potent Indolo[2,3- B]Quinoline Agent, Against Candida Albicans Biofilms
    A Label-Free Cellular Proteomics Approach to Decipher the Antifungal Action of DiMIQ, a Potent Indolo[2,3- b]Quinoline Agent, against Candida albicans Biofilms Robert Zarnowski 1,2*, Anna Jaromin 3*, Agnieszka Zagórska 4, Eddie G. Dominguez 1,2, Katarzyna Sidoryk 5, Jerzy Gubernator 3 and David R. Andes 1,2 1 Department of Medicine, School of Medicine & Public Health, University of Wisconsin-Madison, Madison, WI 53706, USA; [email protected] (E.G.D.); [email protected] (D.R.A.) 2 Department of Medical Microbiology, School of Medicine & Public Health, University of Wisconsin-Madison, Madison, WI 53706, USA 3 Department of Lipids and Liposomes, Faculty of Biotechnology, University of Wroclaw, 50-383 Wroclaw, Poland; [email protected] 4 Department of Medicinal Chemistry, Jagiellonian University Medical College, 30-688 Cracow, Poland; [email protected] 5 Department of Pharmacy, Cosmetic Chemicals and Biotechnology, Team of Chemistry, Łukasiewicz Research Network-Industrial Chemistry Institute, 01-793 Warsaw, Poland; [email protected] * Correspondence: [email protected] (R.Z.); [email protected] (A.J.); Tel.: +1-608-265-8578 (R.Z.); +48-71-3756203 (A.J.) Label-Free Cellular Proteomics of Candida albicans biofilms treated with DiMIQ Identified Proteins Accession # Alternate ID Gene names (ORF ) WT DIMIQ Z SCORE Proteins induced by DiMIQ Arginase (EC 3.5.3.1) A0A1D8PP00 CAR1 CAALFM_C504490CA 0.000 6.648 drug induced Glucan 1,3-beta-glucosidase BGL2 (EC 3.2.1.58) (Exo-1Q5AMT2 BGL2 CAALFM_C402250CA
    [Show full text]
  • Flavonoid Glucodiversification with Engineered Sucrose-Active Enzymes Yannick Malbert
    Flavonoid glucodiversification with engineered sucrose-active enzymes Yannick Malbert To cite this version: Yannick Malbert. Flavonoid glucodiversification with engineered sucrose-active enzymes. Biotechnol- ogy. INSA de Toulouse, 2014. English. NNT : 2014ISAT0038. tel-01219406 HAL Id: tel-01219406 https://tel.archives-ouvertes.fr/tel-01219406 Submitted on 22 Oct 2015 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Last name: MALBERT First name: Yannick Title: Flavonoid glucodiversification with engineered sucrose-active enzymes Speciality: Ecological, Veterinary, Agronomic Sciences and Bioengineering, Field: Enzymatic and microbial engineering. Year: 2014 Number of pages: 257 Flavonoid glycosides are natural plant secondary metabolites exhibiting many physicochemical and biological properties. Glycosylation usually improves flavonoid solubility but access to flavonoid glycosides is limited by their low production levels in plants. In this thesis work, the focus was placed on the development of new glucodiversification routes of natural flavonoids by taking advantage of protein engineering. Two biochemically and structurally characterized recombinant transglucosylases, the amylosucrase from Neisseria polysaccharea and the α-(1→2) branching sucrase, a truncated form of the dextransucrase from L. Mesenteroides NRRL B-1299, were selected to attempt glucosylation of different flavonoids, synthesize new α-glucoside derivatives with original patterns of glucosylation and hopefully improved their water-solubility.
    [Show full text]
  • Global Transcriptome Analysis and Identification of Genes Involved In
    www.nature.com/scientificreports OPEN Global transcriptome analysis and identification of genes involved in nutrients accumulation during Received: 19 December 2016 Accepted: 31 August 2017 seed development of rice tartary Published: xx xx xxxx buckwheat (Fagopyrum Tararicum) Juan Huang1, Jiao Deng1, Taoxiong Shi1, Qijiao Chen1, Chenggang Liang1, Ziye Meng1, Liwei Zhu1, Yan Wang1, Fengli Zhao2, Shizhou Yu3 & Qingfu Chen1 Tartary buckwheat seeds are rich in various nutrients, such as storage proteins, starch, and flavonoids. To get a good knowledge of the transcriptome dynamics and gene regulatory mechanism during the process of seed development and nutrients accumulation, we performed a comprehensive global transcriptome analysis using rice tartary buckwheat seeds at different development stages, namely pre-filling stage, filling stage, and mature stage. 24 819 expressed genes, including 108 specifically expressed genes, and 11 676 differentially expressed genes (DEGs) were identified. qRT-PCR analysis was performed on 34 DEGs to validate the transcriptome data, and a good consistence was obtained. Based on their expression patterns, the identified DEGs were classified to eight clusters, and the enriched GO items in each cluster were analyzed. In addition, 633 DEGs related to plant hormones were identified. Furthermore, genes in the biosynthesis pathway of nutrients accumulation were analyzed, including 10, 20, and 23 DEGs corresponding to the biosynthesis of seed storage proteins, flavonoids, and starch, respectively. This is the first transcriptome analysis during seed development of tartary buckwheat. It would provide us a comprehensive understanding of the complex transcriptome dynamics during seed development and gene regulatory mechanism of nutrients accumulation. Seed is the primary storage organ in plants for storing nutrients such as starch, lipids, and proteins1.
    [Show full text]
  • Enzymatic Glycosylation of Small Molecules
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by University of Groningen University of Groningen Enzymatic Glycosylation of Small Molecules Desmet, Tom; Soetaert, Wim; Bojarova, Pavla; Kren, Vladimir; Dijkhuizen, Lubbert; Eastwick- Field, Vanessa; Schiller, Alexander; Křen, Vladimir Published in: Chemistry : a European Journal DOI: 10.1002/chem.201103069 IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below. Document Version Publisher's PDF, also known as Version of record Publication date: 2012 Link to publication in University of Groningen/UMCG research database Citation for published version (APA): Desmet, T., Soetaert, W., Bojarova, P., Kren, V., Dijkhuizen, L., Eastwick-Field, V., ... Křen, V. (2012). Enzymatic Glycosylation of Small Molecules: Challenging Substrates Require Tailored Catalysts. Chemistry : a European Journal, 18(35), 10786-10801. https://doi.org/10.1002/chem.201103069 Copyright Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons). Take-down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.
    [Show full text]
  • TO Thermostable Sucrose Phosphorylase 20120924
    Thermostable sucrose phosphorylase Ghent Bio-Energy Valley, a consortium of research laboratories of Ghent University, is seeking partners interested in the industrial and enzymatic production of glycosides or glucose-1-phosphate at temperatures of 60°C or higher using a thermostable phosphorylase. Introduction Sucrose phosphorylase catalyses the reversible phosphorolysis of sucrose into α-glucose-1-phosphate and fructose. Because of the broad acceptor specificity of the enzyme, it can further be used for the production of a number of glycosylated compounds. At the industrial scale, such production processes are preferably run at 60°C or higher, mainly to avoid microbial contamination. Unfortunately, no sucrose phosphorylases are known yet which perform well at such high temperatures. Technology Researchers at Ghent University have identified a thermostable sucrose phosphorylase derived from the prokaryote Bifidobacterium adolescentis which performs well at 60°C or higher. The enzyme is active for at least 16h at 60°C when it is in the continuous presence of its substrate, and/or, when it is mutated at specific residues, and/or, when it is immobilized on a carrier or when it is immobilized by cross-linking so that it is part of a so-called “cross- linked enzyme aggregate (CLEA)”. Applications Enzymatic and/or recombinant methods to produce high value glycosides at elevated temperatures. Advantages • being able to produce glycosylated compounds at high temperatures avoids microbial contamination; • recycling of the immobilized biocatalyst in consecutive reactions increases the commercial potential. Status of development The sucrose phosphorylase of B. adolescentis was recombinantly expressed in E. coli and further purified. In addition, the enzyme was immobilized on an epoxy- activated enzyme carrier (Sepabeads EC-HFA) or was incorporated in a CLEA or was mutated to obtain enzyme variants.
    [Show full text]
  • Of Sucrose Phosphorylase: Combining Improved Stability with Altered Specificity
    Int. J. Mol. Sci. 2012, 13, 11333-11342; doi:10.3390/ijms130911333 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Article An Imprinted Cross-Linked Enzyme Aggregate (iCLEA) of Sucrose Phosphorylase: Combining Improved Stability with Altered Specificity Karel De Winter, Wim Soetaert and Tom Desmet * Centre of Expertise for Industrial Biotechnology and Biocatalysis, Department of Biochemical and Microbial Technology, Faculty of Biosciences Engineering, Ghent University, Coupure Links 653, Ghent B-9000, Belgium; E-Mails: [email protected] (K.D.W.); [email protected] (W.S.) * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +32-9-2649-920; Fax: +32-9-2646-032. Received: 28 August 2012; in revised form: 5 September 2012 / Accepted: 5 September 2012 / Published: 11 September 2012 Abstract: The industrial use of sucrose phosphorylase (SP), an interesting biocatalyst for the selective transfer of α-glucosyl residues to various acceptor molecules, has been hampered by a lack of long-term stability and low activity towards alternative substrates. We have recently shown that the stability of the SP from Bifidobacterium adolescentis can be significantly improved by the formation of a cross-linked enzyme aggregate (CLEA). In this work, it is shown that the transglucosylation activity of such a CLEA can also be improved by molecular imprinting with a suitable substrate. To obtain proof of concept, SP was imprinted with α-glucosyl glycerol and subsequently cross-linked with glutaraldehyde. As a consequence, the enzyme’s specific activity towards glycerol as acceptor substrate was increased two-fold while simultaneously providing an exceptional stability at 60 °C.
    [Show full text]