DOCSLIB.ORG

Recent Progress Toward Understanding the Role of Starch Biosynthetic Enzymes in the Cereal Endosperm

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Recent Progress Toward Understanding the Role of Starch Biosynthetic Enzymes in the Cereal Endosperm Amylase 2017; 1: 59–74 Review Article Cheng Li, Prudence O. Powell, Robert G. Gilbert* Recent progress toward understanding the role of starch biosynthetic enzymes in the cereal endosperm DOI 10.1515/amylase-2017-0006 Abbreviations: ADPGlc, adenosine 5'-diphosphate Received July 31, 2017; accepted September 22, 2017 glucose; AGPase, ADP-glucose pyrophosphorylase; Abstract: Starch from cereal endosperm is a major CBM, carbohydrate-binding module; CLD, chain-length energy source for many mammals. The synthesis of this distribution; DAF, days after flowering; DBE, debranching starch involves a number of different enzymes whose enzyme; D-enzyme, disproportionating enzyme; mode of action is still not completely understood. ADP- DP, degree of polymerization; GBSS, granule bound glucose pyrophosphorylase is involved in the synthesis starch synthase; GH, glycoside hydrolase; GT, glycosyl of starch monomer (ADP-glucose), a process, which transferase; ISA, isoamylase; MOS, maltooligosaccharides; almost exclusively takes place in the cytosol. ADP- 3-PGA, 3-phosphoglyceric acid; Pi, inorganic phosphate; glucose is then transported into the amyloplast and PUL, pullulanase; SBE, starch-branching enzyme; SP, incorporated into starch granules by starch synthase, starch phosphorylase; SS, starch synthases; SuSy, sucrose starch-branching enzyme and debranching enzyme. synthase; UDPGlc, nucleoside diphosphate glucose. Additional enzymes, including starch phosphorylase and disproportionating enzyme, may be also involved in the formation of starch granules, although their exact 1 Introduction functions are still obscure. Interactions between these Starch is a highly branched d-glucose homopolymer enzymes in the form of functional complexes have been with a wide range of uses. It is accumulated in the cereal proposed and investigated, resulting more complicated endosperm as an energy reserve for seed germination, as starch biosynthetic pathways. An overall picture and well as serving as the primary carbohydrate component in recent advances in understanding of the functions of our diets, with the higher fraction for Asian diets. Besides, these enzymes is summarized in this review to provide it has numerous important industrial applications, with insights into how starch granules are synthesized in extensive use in paper-making, minerals processing, cereal endosperm. personal care, renewable and/or biodegradable packaging. There are two common components of starch: Keywords: starch biosynthesis; sucrose synthase; ADP- amylose, with moderate molecular weight and a small glucose pyrophosphorylase; starch synthase; starch- number of long branches, and amylopectin, with a much branching enzyme; debranching enzyme; enzyme higher molecular weight and a large number of short complex branches. Both have a wide distribution of molecular sizes and molecular weights. Each starch molecule contains a single reducing end and many non-reducing ends (at the *Corresponding author: Robert G. Gilbert, Joint International terminus of each branch). Research Laboratory of Agriculture and Agri-Product Safety, College Starch structure could be divided into six levels [1], of Agriculture, Yangzhou University, Yangzhou, Jiangsu 225009, with the lowest five levels schematically shown in Figure People’s Republic of China, E-mail: [email protected] 1. It starts with individual chains as the first level, which Cheng Li, Joint International Research Laboratory of Agriculture and Agri-Product Safety, College of Agriculture, Yangzhou University, are formed by ADP-glucose through (1→4)-α-glycosidic Yangzhou, Jiangsu 225009, People’s Republic of China linkages. Those chains in amylopectin have been further Prudence O. Powell Robert G. Gilbert, The University of Queens- denoted as C chains having the reducing end, A chains land, Centre for Nutrition & Food Sciences, Queensland Alliance for (degree of polymerization, DP, 6-12) carrying no branches, Agriculture & Food Innovations, Brisbane, QLD 4072, Australia B1 chains (DP 13-24) carrying A chains, B2 chains (DP Open Access. © 2017 Cheng Li et al., published by De Gruyter Open. This work is licensed under the Creative Commons Attribution- NonCommercial-NoDerivs 3.0 License. 60 C. Li, et al. # " " " ! ! Figure 1. The hierarchical structural levels of organization of cereal endosperm starch. Level 1 is individual chain and imbedded in the Level 1 box is the chain length of A and B chains of amylopectin molecules. Level 2 is the amylose and amylopectin molecules and the different colours in the Level 2 box show the A (red), B (purple) and C (blue) chains. Level 3 is the amylopectin double-helix cluster with the repeat distance of the crystalline (~6 nm) and amorphous (~3 nm) lamellae. The arrangement of the amylopectin double helices from the bottom view is shown on the right side of Level 3 box. The level 4 structure contains the semi-crystalline growth ring formed by the amylopectin molecules and amorphous growth ring, which finally forms the level 5 structure, starch granules. The reducing end is represented by the left-to-right crossed “O”. 25-36) carrying B1 chains, B3 chains (DP > 36) carrying B2 molecules and parts of longer amylopectin chains, to chains, and so on (for a recent review, see [2]). Although form the level 4 structure. The water-insoluble starch still occasionally one finds statements to the contrary, granules with varied sizes and morphologies are finally amylose is not solely linear, but contains a small but developed by these growth rings as level 5, and with significant number of long-chain branches [3]. This the other components, such as proteins, non-starch structural level is quantified as the number of weight of polysaccharides and lipids, form the whole grain (level 6 chains as a function of degree of DP, the chain-length structure). distribution (CLD). These chains are further connected The synthesis and determination of this architecturally together through (1→6)-α-glycosidic linkages to form complex polymer assembly is achieved through the amylose and amylopectin molecules as the second level coordinated interactions of a suite of starch biosynthetic of structure. The third level of structure is formed by enzymes. Although significant process in elucidating neighbouring amylopectin chains intertwined into double the mechanism of these enzymes, either individually or helices and further into clusters. These amylopectin co-operatively, has been made, many aspects regarding double helices can arrange as a monoclinic unit cell this complex process are still unclear. The various (A-type crystal polymorph) or hexagonal unit cell (B-type isoforms of the many starch metabolic enzymes can be crystal polymorph). A cluster has a regular repeat distance found in different plant or different tissues in the same of ~9 nm in granules (see [2]). These clusters lie alongside plant. In this review, we mainly focus on the starch to form the semi-crystalline growth rings, alternated with biosynthetic enzymes in the cereal endosperm, beginning amorphous growth rings, probably containing amylose with the formation of ADP-glucose monomer and ending Biosynthesis of starch granules 61 with the architecturally complex starch granule, to 3 ADP-glucose pyrophosphorylase summarize the progress in understanding the starch biosynthesis process and noting what is missing in the (AGPase) literature. The degradation of sucrose derived from The formation of starch monomer, ADPGlc, is by AGPase photosynthesis has also been included because of its (EC 2.7.7.27). AGPase is heterotetrameric in higher plants, significant contribution to the synthesis of ADP-glucose consisting of two large (AGP-L) subunits and two small and seed sink strength. For the potential application of (AGP-S) catalytic subunits encoded by distinct genes, these enzymes for future cereal starch bioengineering and respectively [6]. Genes expressing these subunits can some other complementary information of, e.g., granule be expressed differently in different parts of the same initiation and control of starch granule size, please refer plant and thus produce AGPase with varying degrees of to recent reviews like [4-6]. Throughout this review, sensitivity to allosteric effectors, which are suited to the affiliation of individual starch metabolizing enzymes to particular metabolic demands of a given tissue/organ various families of glycoside hydrolases (GH) and glycosyl [6]. The AGP-S subunits are generally responsible for transferases (GT) as well as their carbohydrate-binding enzymatic complex catalytic activity, whereas the AGP-L modules (CBM) reflects their classification within the subunits are thought to modulate the enzymatic regulatory CAZy database (http://www.cazy.org/). properties that increase the allosteric response of small subunit to 3-phosphoglyceric acid (3-PGA) and inorganic 2 Sucrose synthase (SuSy) phosphate (Pi) [23-25]. The enzyme is now known to be largely extra-plastidial (i.e. 85-95%) in cereal endosperm, SuSy (EC 2.4.1.13) catalyses the reversible conversion but plastidial in other cereal tissues and in all tissues of of sucrose and a nucleoside diphosphate into the non-cereal plants [16,26-30]. The starch-deficient kernel corresponding nucleoside diphosphate glucose (UDPGlc) phenotypes of maize shrunken2 and brittle2 is caused and fructose [7,8] and is of family GT4, possibly with by the loss of endosperm-specific cytosolic AGP-L and different families of CBM, e.g., CBM20. In cereal endosperm, AGP-S isoforms, respectively,
Load more

Recommended publications
  • METACYC ID Description A0AR23 GO:0004842 (Ubiquitin-Protein Ligase
    Electronic Supplementary Material (ESI) for Integrative Biology This journal is © The Royal Society of Chemistry 2012 Heat Stress Responsive Zostera marina Genes, Southern Population (α=0.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • The Analysis for Alteration in Starch Biosynthesis Metabolism in a Japonica Rice Grain Mutant Which Does Not Accumulate Starch
    MOJ Proteomics & Bioinformatics Research Article Open Access The analysis for alteration in starch biosynthesis metabolism in a japonica rice grain mutant which does not accumulate starch Abstract Volume 7 Issue 5 - 2018 Rice grain‒filling is an important agronomic trait that contributes greatly to grain Weidong Xu,1,2 Chunhai Shi,1 Zhenzhen weight. A grain mutant from the japonica cultivar Nipponbare by mutagenesis with 1 1 3 ethyl methane sulfonate (EMS), which had no accumulation of starch granules in Cao, Fangmin Cheng, Jianguo Wu 1Department of Agronomy, Zhejiang University, China endosperm with a transparent liquid during grain filling stage, was used to analyze 2Jiaxing Academy of Agricultural Sciences Institute, China the caryopsis development and starch biosynthesis metabolism in present study. 3Department of Horticulture, Zhejiang A&F University, China Measurement of soluble substances in the liquid of developing endosperm showed that there was remarkably higher soluble sugar content in this no starch mutant. Correspondence: Chunhai Shi, Agronomy Department, Semi‒quantitative reverse transcription‒PCR (RT‒PCR) analysis of the starch‒ College of Agriculture and Biotechnology, Zhejiang University, synthesizing genes revealed that soluble starch synthase1 (SSS1) gene could be Yuhangtang Road 866, Hangzhou 310058, PR. China, Tel normally expressed in the mutant. Substantially lower expressions of starch branching +86 57188982691, Email [email protected] enzyme1 (SBE1), isoamylase1 (ISA1) and pullulanase (PUL) were detected in the no starch mutant compared with the wild type, whereas the expression of ADP‒glucose Received:‒ September 19, 2018 | Published: October 31, 2018 pyrophosphorylase large subunit 1 (AGPL1) and ADP‒glucose pyrophosphorylase small subunit 1 (AGPS1) were visibly increased.
    [Show full text]
  • Mslsc2001c04
    Metabolism MSLSC2001C04 Course Instructor Dr. Gautam Kumar Dr.Gautam Kr. Dept. of Life Sc. 1 Dr.Gautam Kr. Dept. of Life Sc. 2 Dr.Gautam Kr. Dept. of Life Sc. 3 Dr.Gautam Kr. Dept. of Life Sc. 4 • Cellulose is a major constituent of plant cell walls, providing strength and rigidity • Preventing the swelling of the cell and rupture of the plasma membrane • Plants synthesize more than 1011 metric tons of cellulose, making this simple polymer one of the most abundant compounds in the biosphere. • cellulose must be synthesized from intracellular precursors but deposited and assembled outside the plasma membrane. Dr.Gautam Kr. Dept. of Life Sc. 5 • Terminal complexes, also called rosettes, to be composed of six large particles arranged in a regular hexagon. • The outside surface of the plant plasma membrane in a freeze-fractured sample, viewed here with electron microscopy • Enzyme complex includes a catalytic subunit with eight transmembrane segments and several other subunits that are presumed to act in threading cellulose chains through the catalytic site and out of the cell, and in the crystallization of 36 cellulose strands into the paracrystalline microfibrils Rosettes Dr.Gautam Kr. Dept. of Life Sc. 6 • The complex enzymatic machinery that assembles cellulose chains spans the plasma membrane • UDP-glucose, in the cytosol and another part extending to the outside, responsible for elongating and crystallizing cellulose molecules in the extracellular space. • UDP-glucose used for cellulose synthesis is generated from sucrose produced during photosynthesis, by the reaction catalysed by sucrose synthase • Cellulose synthase spans the plasma Model for the structure of membrane and uses cytosolic UDP-glucose as Cellulose synthase.
    [Show full text]
  • Supplementary Materials
    1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No.
    [Show full text]
  • A Label-Free Cellular Proteomics Approach to Decipher the Antifungal Action of Dimiq, a Potent Indolo[2,3- B]Quinoline Agent, Against Candida Albicans Biofilms
    A Label-Free Cellular Proteomics Approach to Decipher the Antifungal Action of DiMIQ, a Potent Indolo[2,3- b]Quinoline Agent, against Candida albicans Biofilms Robert Zarnowski 1,2*, Anna Jaromin 3*, Agnieszka Zagórska 4, Eddie G. Dominguez 1,2, Katarzyna Sidoryk 5, Jerzy Gubernator 3 and David R. Andes 1,2 1 Department of Medicine, School of Medicine & Public Health, University of Wisconsin-Madison, Madison, WI 53706, USA; [email protected] (E.G.D.); [email protected] (D.R.A.) 2 Department of Medical Microbiology, School of Medicine & Public Health, University of Wisconsin-Madison, Madison, WI 53706, USA 3 Department of Lipids and Liposomes, Faculty of Biotechnology, University of Wroclaw, 50-383 Wroclaw, Poland; [email protected] 4 Department of Medicinal Chemistry, Jagiellonian University Medical College, 30-688 Cracow, Poland; [email protected] 5 Department of Pharmacy, Cosmetic Chemicals and Biotechnology, Team of Chemistry, Łukasiewicz Research Network-Industrial Chemistry Institute, 01-793 Warsaw, Poland; [email protected] * Correspondence: [email protected] (R.Z.); [email protected] (A.J.); Tel.: +1-608-265-8578 (R.Z.); +48-71-3756203 (A.J.) Label-Free Cellular Proteomics of Candida albicans biofilms treated with DiMIQ Identified Proteins Accession # Alternate ID Gene names (ORF ) WT DIMIQ Z SCORE Proteins induced by DiMIQ Arginase (EC 3.5.3.1) A0A1D8PP00 CAR1 CAALFM_C504490CA 0.000 6.648 drug induced Glucan 1,3-beta-glucosidase BGL2 (EC 3.2.1.58) (Exo-1Q5AMT2 BGL2 CAALFM_C402250CA
    [Show full text]
  • Flavonoid Glucodiversification with Engineered Sucrose-Active Enzymes Yannick Malbert
    Flavonoid glucodiversification with engineered sucrose-active enzymes Yannick Malbert To cite this version: Yannick Malbert. Flavonoid glucodiversification with engineered sucrose-active enzymes. Biotechnol- ogy. INSA de Toulouse, 2014. English. NNT : 2014ISAT0038. tel-01219406 HAL Id: tel-01219406 https://tel.archives-ouvertes.fr/tel-01219406 Submitted on 22 Oct 2015 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Last name: MALBERT First name: Yannick Title: Flavonoid glucodiversification with engineered sucrose-active enzymes Speciality: Ecological, Veterinary, Agronomic Sciences and Bioengineering, Field: Enzymatic and microbial engineering. Year: 2014 Number of pages: 257 Flavonoid glycosides are natural plant secondary metabolites exhibiting many physicochemical and biological properties. Glycosylation usually improves flavonoid solubility but access to flavonoid glycosides is limited by their low production levels in plants. In this thesis work, the focus was placed on the development of new glucodiversification routes of natural flavonoids by taking advantage of protein engineering. Two biochemically and structurally characterized recombinant transglucosylases, the amylosucrase from Neisseria polysaccharea and the α-(1→2) branching sucrase, a truncated form of the dextransucrase from L. Mesenteroides NRRL B-1299, were selected to attempt glucosylation of different flavonoids, synthesize new α-glucoside derivatives with original patterns of glucosylation and hopefully improved their water-solubility.
    [Show full text]
  • Global Transcriptome Analysis and Identification of Genes Involved In
    www.nature.com/scientificreports OPEN Global transcriptome analysis and identification of genes involved in nutrients accumulation during Received: 19 December 2016 Accepted: 31 August 2017 seed development of rice tartary Published: xx xx xxxx buckwheat (Fagopyrum Tararicum) Juan Huang1, Jiao Deng1, Taoxiong Shi1, Qijiao Chen1, Chenggang Liang1, Ziye Meng1, Liwei Zhu1, Yan Wang1, Fengli Zhao2, Shizhou Yu3 & Qingfu Chen1 Tartary buckwheat seeds are rich in various nutrients, such as storage proteins, starch, and flavonoids. To get a good knowledge of the transcriptome dynamics and gene regulatory mechanism during the process of seed development and nutrients accumulation, we performed a comprehensive global transcriptome analysis using rice tartary buckwheat seeds at different development stages, namely pre-filling stage, filling stage, and mature stage. 24 819 expressed genes, including 108 specifically expressed genes, and 11 676 differentially expressed genes (DEGs) were identified. qRT-PCR analysis was performed on 34 DEGs to validate the transcriptome data, and a good consistence was obtained. Based on their expression patterns, the identified DEGs were classified to eight clusters, and the enriched GO items in each cluster were analyzed. In addition, 633 DEGs related to plant hormones were identified. Furthermore, genes in the biosynthesis pathway of nutrients accumulation were analyzed, including 10, 20, and 23 DEGs corresponding to the biosynthesis of seed storage proteins, flavonoids, and starch, respectively. This is the first transcriptome analysis during seed development of tartary buckwheat. It would provide us a comprehensive understanding of the complex transcriptome dynamics during seed development and gene regulatory mechanism of nutrients accumulation. Seed is the primary storage organ in plants for storing nutrients such as starch, lipids, and proteins1.
    [Show full text]
  • Generate Metabolic Map Poster
    Authors: Pallavi Subhraveti Anamika Kothari Quang Ong Ron Caspi An online version of this diagram is available at BioCyc.org. Biosynthetic pathways are positioned in the left of the cytoplasm, degradative pathways on the right, and reactions not assigned to any pathway are in the far right of the cytoplasm. Transporters and membrane proteins are shown on the membrane. Ingrid Keseler Peter D Karp Periplasmic (where appropriate) and extracellular reactions and proteins may also be shown. Pathways are colored according to their cellular function. Csac1394711Cyc: Candidatus Saccharibacteria bacterium RAAC3_TM7_1 Cellular Overview Connections between pathways are omitted for legibility. Tim Holland TM7C00001G0420 TM7C00001G0109 TM7C00001G0953 TM7C00001G0666 TM7C00001G0203 TM7C00001G0886 TM7C00001G0113 TM7C00001G0247 TM7C00001G0735 TM7C00001G0001 TM7C00001G0509 TM7C00001G0264 TM7C00001G0176 TM7C00001G0342 TM7C00001G0055 TM7C00001G0120 TM7C00001G0642 TM7C00001G0837 TM7C00001G0101 TM7C00001G0559 TM7C00001G0810 TM7C00001G0656 TM7C00001G0180 TM7C00001G0742 TM7C00001G0128 TM7C00001G0831 TM7C00001G0517 TM7C00001G0238 TM7C00001G0079 TM7C00001G0111 TM7C00001G0961 TM7C00001G0743 TM7C00001G0893 TM7C00001G0630 TM7C00001G0360 TM7C00001G0616 TM7C00001G0162 TM7C00001G0006 TM7C00001G0365 TM7C00001G0596 TM7C00001G0141 TM7C00001G0689 TM7C00001G0273 TM7C00001G0126 TM7C00001G0717 TM7C00001G0110 TM7C00001G0278 TM7C00001G0734 TM7C00001G0444 TM7C00001G0019 TM7C00001G0381 TM7C00001G0874 TM7C00001G0318 TM7C00001G0451 TM7C00001G0306 TM7C00001G0928 TM7C00001G0622 TM7C00001G0150 TM7C00001G0439 TM7C00001G0233 TM7C00001G0462 TM7C00001G0421 TM7C00001G0220 TM7C00001G0276 TM7C00001G0054 TM7C00001G0419 TM7C00001G0252 TM7C00001G0592 TM7C00001G0628 TM7C00001G0200 TM7C00001G0709 TM7C00001G0025 TM7C00001G0846 TM7C00001G0163 TM7C00001G0142 TM7C00001G0895 TM7C00001G0930 Detoxification Carbohydrate Biosynthesis DNA combined with a 2'- di-trans,octa-cis a 2'- Amino Acid Degradation an L-methionyl- TM7C00001G0190 superpathway of pyrimidine deoxyribonucleotides de novo biosynthesis (E.
    [Show full text]
  • Supplementary Information
    Supplementary Information Table S1. Pathway analysis of the 1246 dwf1-specific differentially expressed genes. Fold Change Fold Change Fold Change Gene ID Description (dwf1/WT) (XL-5/WT) (XL-6/WT) Carbohydrate Metabolism Glycolysis/Gluconeogenesis POPTR_0008s11770.1 Glucose-6-phosphate isomerase −1.7382 0.512146 0.168727 POPTR_0001s47210.1 Fructose-bisphosphate aldolase, class I 1.599591 0.044778 0.18237 POPTR_0011s05190.3 Probable phosphoglycerate mutase −2.11069 −0.34562 −0.9738 POPTR_0012s01140.1 Pyruvate kinase −1.25054 0.074697 −0.16016 POPTR_0016s12760.1 Pyruvate decarboxylase 2.664081 0.021062 0.371969 POPTR_0012s08010.1 Aldehyde dehydrogenase (NAD+) −1.41556 0.479957 −0.21366 POPTR_0014s13710.1 Acetyl-CoA synthetase −1.337 0.154552 −0.26532 POPTR_0017s11660.1 Aldose 1-epimerase 2.770518 0.016874 0.73016 POPTR_0010s11970.1 Phosphoglucomutase −1.25266 −0.35581 0.074064 POPTR_0012s14030.1 Phosphoglucomutase −1.15872 −0.68468 −0.93596 POPTR_0002s10850.1 Phosphoenolpyruvate carboxykinase (ATP) 1.489119 0.967284 0.821559 Citrate cycle (TCA cycle) 2-Oxoglutarate dehydrogenase E2 component POPTR_0014s15280.1 −1.63733 0.076435 0.170827 (dihydrolipoamide succinyltransferase) POPTR_0002s26120.1 Succinyl-CoA synthetase β subunit −1.29244 −0.38517 −0.3497 POPTR_0007s12750.1 Succinate dehydrogenase (ubiquinone) flavoprotein subunit −1.83751 0.519356 0.309149 POPTR_0002s10850.1 Phosphoenolpyruvate carboxykinase (ATP) 1.489119 0.967284 0.821559 Pentose phosphate pathway POPTR_0008s11770.1 Glucose-6-phosphate isomerase −1.7382 0.512146 0.168727 POPTR_0013s00660.1 Glucose-6-phosphate 1-dehydrogenase −1.26949 −0.18314 0.374822 POPTR_0015s00960.1 6-Phosphogluconolactonase 2.022223 0.168877 0.971431 POPTR_0010s11970.1 Phosphoglucomutase −1.25266 −0.35581 0.074064 POPTR_0012s14030.1 Phosphoglucomutase −1.15872 −0.68468 −0.93596 POPTR_0001s47210.1 Fructose-bisphosphate aldolase, class I 1.599591 0.044778 0.18237 S2 Table S1.
    [Show full text]
  • Leloir Glycosyltransferases in Applied Biocatalysis: a Multidisciplinary Approach
    International Journal of Molecular Sciences Review Leloir Glycosyltransferases in Applied Biocatalysis: A Multidisciplinary Approach Luuk Mestrom 1, Marta Przypis 2,3 , Daria Kowalczykiewicz 2,3, André Pollender 4 , Antje Kumpf 4,5, Stefan R. Marsden 1, Isabel Bento 6, Andrzej B. Jarz˛ebski 7, Katarzyna Szyma ´nska 8, Arkadiusz Chru´sciel 9, Dirk Tischler 4,5 , Rob Schoevaart 10, Ulf Hanefeld 1 and Peter-Leon Hagedoorn 1,* 1 Department of Biotechnology, Delft University of Technology, Section Biocatalysis, Van der Maasweg 9, 2629 HZ Delft, The Netherlands; [email protected] (L.M.); [email protected] (S.R.M.); [email protected] (U.H.) 2 Department of Organic Chemistry, Bioorganic Chemistry and Biotechnology, Silesian University of Technology, B. Krzywoustego 4, 44-100 Gliwice, Poland; [email protected] (M.P.); [email protected] (D.K.) 3 Biotechnology Center, Silesian University of Technology, B. Krzywoustego 8, 44-100 Gliwice, Poland 4 Environmental Microbiology, Institute of Biosciences, TU Bergakademie Freiberg, Leipziger Str. 29, 09599 Freiberg, Germany; [email protected] (A.P.); [email protected] (A.K.); [email protected] (D.T.) 5 Microbial Biotechnology, Faculty of Biology & Biotechnology, Ruhr-Universität Bochum, Universitätsstr. 150, 44780 Bochum, Germany 6 EMBL Hamburg, Notkestraβe 85, 22607 Hamburg, Germany; [email protected] 7 Institute of Chemical Engineering, Polish Academy of Sciences, Bałtycka 5, 44-100 Gliwice, Poland; [email protected] 8 Department of Chemical and Process Engineering, Silesian University of Technology, Ks. M. Strzody 7, 44-100 Gliwice Poland.; [email protected] 9 MEXEO Wiesław Hreczuch, ul.
    [Show full text]
  • An Evolving Hierarchical Family Classification for Glycosyltransferases
    doi:10.1016/S0022-2836(03)00307-3 J. Mol. Biol. (2003) 328, 307–317 COMMUNICATION An Evolving Hierarchical Family Classification for Glycosyltransferases Pedro M. Coutinho1, Emeline Deleury1, Gideon J. Davies2 and Bernard Henrissat1* 1Architecture et Fonction des Glycosyltransferases are a ubiquitous group of enzymes that catalyse the Macromole´cules Biologiques transfer of a sugar moiety from an activated sugar donor onto saccharide UMR6098, CNRS and or non-saccharide acceptors. Although many glycosyltransferases catalyse Universite´s d’Aix-Marseille I chemically similar reactions, presumably through transition states with and II, 31 Chemin Joseph substantial oxocarbenium ion character, they display remarkable diversity Aiguier, 13402 Marseille in their donor, acceptor and product specificity and thereby generate a Cedex 20, France potentially infinite number of glycoconjugates, oligo- and polysacchar- ides. We have performed a comprehensive survey of glycosyltransferase- 2Structural Biology Laboratory related sequences (over 7200 to date) and present here a classification of Department of Chemistry, The these enzymes akin to that proposed previously for glycoside hydrolases, University of York, Heslington into a hierarchical system of families, clans, and folds. This evolving York YO10 5YW, UK classification rationalises structural and mechanistic investigation, harnesses information from a wide variety of related enzymes to inform cell biology and overcomes recurrent problems in the functional prediction of glycosyltransferase-related open-reading frames. q 2003 Elsevier Science Ltd. All rights reserved Keywords: glycosyltransferases; protein families; classification; modular *Corresponding author structure; genomic annotations The biosynthesis of complex carbohydrates and are involved in glycosyl transfer and thus conquer polysaccharides is of remarkable biological import- what Sharon has provocatively described as “the ance.
    [Show full text]