DOCSLIB.ORG

Direct Interference with Rhamnogalacturonan I Biosynthesis in Golgi Vesicles1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Direct Interference with Rhamnogalacturonan I Biosynthesis in Golgi Vesicles1 Direct Interference with Rhamnogalacturonan I Biosynthesis in Golgi Vesicles1 Michael Skjøt, Markus Pauly2, Maxwell S. Bush, Bernhard Borkhardt, Maureen C. McCann, and Peter Ulvskov* Biotechnology Group, Danish Institute of Agricultural Sciences, Thorvaldsensvej 40, 1871 Copenhagen, Denmark (M.S., B.B., P.U.); Department of Plant Biology, Plant Biochemistry Laboratory, The Royal Veterinary and Agricultural University, Thorvaldsensvej 40, 1871 Copenhagen, Denmark (M.P.); and Department of Cell and Developmental Biology, John Innes Centre, Norwich Research Park, Colney Lane, NR4 7UH Norwich, United Kingdom (M.S.B., M.C.M.) Pectin is a class of complex cell wall polysaccharides with multiple roles during cell development. Assigning specific functions to particular polysaccharides is in its infancy, in part, because of the limited number of mutants and transformants available with modified pectic polymers in their walls. Pectins are also important polymers with diverse applications in the food and pharmaceutical industries, which would benefit from technology for producing pectins with specific functional properties. In this report, we describe the generation of potato (Solanum tuberosum L. cv Posmo) tuber transformants producing pectic rhamnogalacturonan I (RGI) with a low level of arabinosylation. This was achieved by the expression of a Golgi membrane-anchored endo-␣-1,5-arabinanase. Sugar composition analysis of RGI isolated from transformed and wild-type tubers showed that the arabinose content was decreased by approximately 70% in transformed cell walls compared with wild type. The modification of the RGI was confirmed by immunolabeling with an antibody recognizing ␣-1,5-arabinan. This is the first time, to our knowledge, that the biosynthesis of a plant cell wall polysaccharide has been manipulated through the action of a glycosyl hydrolase targeted to the Golgi compartment. Current models of the plant cell wall present pec- suggests roles for pectic side-chains, for example, tins as complex matrix polysaccharides embedding arabinans, the polymer of interest to the present in- the load-bearing structures of the wall (cellulose mi- vestigation. Arabinans are very flexible molecules in crofibrils and hemicelluloses) and forming the mid- aqueous solution (Cros et al., 1994), whereas 13C- dle lamella, which cements neighboring cells to- NMR studies by Renard and Jarvis (1999) demon- gether (Carpita and Gibeaut, 1993). The pectic matrix strate that they are also very mobile molecules in has been described as coextensive with the microfi- muro. The authors concluded that arabinans are not brillar and hemicellulosic polymers of the wall (Rob- structural components; rather, they propose a role for erts, 1994), suggesting that some pectic polymers them as plasticizers and water binding agents in the may be structural components rather than mere fill- wall. Testing this working hypothesis requires plants ers of cell wall pores. Pectin constitutes a very com- in which the arabinan structure or content is modi- plex class of polysaccharides (Ridley et al., 2001) and fied, and a technology for producing such plants is presented in this report. their large-scale organization in the cell wall is far Because they are the most abundant bio-polymers from resolved. The prevailing view of pectin fine on Earth (Prade et al., 1999), cell wall polysaccharides structure (Schols and Voragen, 1996) and conforma- are of fundamental interest and are used by industry tion and architecture (Pe´rez et al., 2000) has recently for both food and non-food applications. Biotechno- been challenged and a new pectin model is being logical approaches for their modification and further drafted (J.-P. Vincken, A. Voragen, and H. Schols, exploitation have so far been limited because modi- personal communication). Neither model directly fication and production of carbohydrates has focused primarily on the generation of novel starches and 1 This work was supported by the Danish Research Council’s fructans (Heyer et al., 1999). The primary reason for Technology by Highly Oriented Research program, by The Danish this slow progress in bioengineering is the fact that National Research Foundation, by the European Commission the biosynthetic pathways of cell wall polysaccha- (grant no. BIOTECH CT97–2224), and by a Royal Society Univer- rides have not been fully characterized at the molec- sity Research Fellowship (to M.C.M.). ular level. Despite significant efforts to elucidate the * Corresponding author; e-mail [email protected]; fax 45–3528–2581. biogenesis of cell wall carbohydrates through mutant 2 Present address: Max-Planck-Institute for Molecular Plant screening programs (Zablackis et al., 1996; Reiter et Physiology, Am Muehlenberg 1, 14476 Golm, Germany. al., 1997) and through cloning and characterization of Article, publication date, and citation information can be found enzymes involved in cellulose (Arioli et al., 1998), at www.plantphysiol.org/cgi/doi/10.1104/pp.010948. xyloglucan (Perrin et al., 1999), and galactomannan Plant Physiology, May 2002, Vol. 129, pp. 95–102, www.plantphysiol.org © 2002 American Society of Plant Biologists 95 Skjøtetal. (Edwards et al., 1999) biosynthesis, the cell wall poly- saccharide biosynthetic apparatus will remain elu- sive for quite a while given the large number of genes predicted to be involved (Mohnen, 1999). Simpler approaches are called for. We have previously dem- onstrated that ␤-1,4-galactan side-chains of the pectic polymer rhamnogalacturonan I (RGI) can be enzy- matically cleaved post deposition in the cell wall Figure 1. Expression cassettes. 1, The pGED/ARA expression cassette without compromising plant viability (Sørensen et for apoplastic targeting. 2, The pGED/ST::ARA cassette conferring ␣ al., 2000). This was achieved through the targeting of Golgi targeting. Dotted bar, Region encoding the A. aculeatus -1,5- a fungal endo-1,4-␤-d-galactanase to the apoplast in endo-arabinanase signal sequence. Black bar, Mature A. aculeatus ␣-1,5-endo-arabinanase. Gray bar, Region encoding the potato (Solanum tuberosum L. cv Posmo) tubers. In ␤-galactoside ␣-2,6-sialyltransferase cytoplasmic domain. Hatched this paper, we present technology for direct interfer- bar, Region encoding the ␤-galactoside ␣-2,6-sialyltransferase mem- ence with pectin biosynthesis in Golgi vesicles. By brane spanning/signal sequence domain. White bar, Region encod- targeting a rat ␣-2,6 sialyl transferase-endo-␣-1,5- ing a truncated ␤-galactoside ␣-2,6-sialyltransferase catalytic do- arabinanase fusion protein to the Golgi compartment main. Pro, Tuber-specific granule-bound starch synthase promoter. of potato tuber cells, arabinan side-chains on RGI can Term, Nopaline synthase terminator and polyadenylation site. be hydrolyzed at the site of pectin biosynthesis. We demonstrate that this approach reduces the biosyn- thesis of RGI-arabinans in transgenic potato tubers starch synthase promoter was induced using the without compromising the viability of plants. method described previously (Visser et al., 1991). In addition, polyclonal antibodies raised against the endo-arabinanase recognized a protein in the extracts RESULTS from induced plantlets. The molecular mass of this The Endo-Arabinanase Displays Activity toward Potato protein was in range with the 34 kD (Skjøt et al., 2001) Rhamnogalacturonan I in Vitro determined for the arabinanase when expressed in Aspergillus oryzae (Fig. 3). The absence of tubers from A purified recombinant endo-arabinanase from As- the pGED/ARA plants made it particularly relevant pergillus aculeatus shows endo-activity in vitro to develop a Golgi-anchored version of the arabinan- against debranched sugar beet arabinan releasing ase as an alternative approach to modifying pectins primarily arabinobiose and arabinotriose (Skjøt et al., in planta. 2001). We verified that it is also active toward RGI isolated from wild-type (WT) potato tubers. Monosaccharide analysis of isolated RGI from potato Generation of Potato Plants Expressing a treated with the arabinanase, showed that enzyme Golgi-Localized Arabinanase treatment resulted in a 75% reduction in the Ara To generate a Golgi-localized enzyme, we fused the content compared with the untreated sample (not 52 N-terminal amino acids of a rat ␣-2,6 sialyl trans- shown). ferase (ST; Munro, 1991) to the mature part of the arabinanase creating pGED/ST::ARA (Fig. 1). The Tubers Are Not Recovered if Arabinanase Is fusion protein has a calculated molecular mass of 39 Targeted to the Apoplast kD. Previous analyses of the primary structure of ST suggest that the protein comprises a nine-residue The cDNA encoding an A. aculeatus endo-␣-1,5- N-terminal cytoplasmic domain, a 17-residue hydro- arabinanase including the fungal secretion signal phobic sequence that serves as a membrane anchor (Skjøt et al., 2001) was transcriptionally fused to the and signal sequence, and a large Golgi-lumenal, cat- tuber-specific granule-bound starch synthase pro- alytic domain (Weinstein et al., 1987). The region moter (Visser et al., 1991), giving the vector pGED/ including the N-terminal cytoplasmic domain, the ARA (Fig. 1). Transformation with pGED/ARA re- hydrophobic sequence, and 26 residues of the cata- duced the transformation frequency: 27% compared lytic domain has previously been shown to direct with approximately 80% for the empty pGED vector. Golgi targeting of green fluorescent protein (Boevink Regenerated in vitro plantlets were tested for the et al., 1998) and lysozyme (Munro, 1991)
Load more

Recommended publications
  • METACYC ID Description A0AR23 GO:0004842 (Ubiquitin-Protein Ligase
    Electronic Supplementary Material (ESI) for Integrative Biology This journal is © The Royal Society of Chemistry 2012 Heat Stress Responsive Zostera marina Genes, Southern Population (α=0.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Supplementary Materials
    1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No.
    [Show full text]
  • A Label-Free Cellular Proteomics Approach to Decipher the Antifungal Action of Dimiq, a Potent Indolo[2,3- B]Quinoline Agent, Against Candida Albicans Biofilms
    A Label-Free Cellular Proteomics Approach to Decipher the Antifungal Action of DiMIQ, a Potent Indolo[2,3- b]Quinoline Agent, against Candida albicans Biofilms Robert Zarnowski 1,2*, Anna Jaromin 3*, Agnieszka Zagórska 4, Eddie G. Dominguez 1,2, Katarzyna Sidoryk 5, Jerzy Gubernator 3 and David R. Andes 1,2 1 Department of Medicine, School of Medicine & Public Health, University of Wisconsin-Madison, Madison, WI 53706, USA; [email protected] (E.G.D.); [email protected] (D.R.A.) 2 Department of Medical Microbiology, School of Medicine & Public Health, University of Wisconsin-Madison, Madison, WI 53706, USA 3 Department of Lipids and Liposomes, Faculty of Biotechnology, University of Wroclaw, 50-383 Wroclaw, Poland; [email protected] 4 Department of Medicinal Chemistry, Jagiellonian University Medical College, 30-688 Cracow, Poland; [email protected] 5 Department of Pharmacy, Cosmetic Chemicals and Biotechnology, Team of Chemistry, Łukasiewicz Research Network-Industrial Chemistry Institute, 01-793 Warsaw, Poland; [email protected] * Correspondence: [email protected] (R.Z.); [email protected] (A.J.); Tel.: +1-608-265-8578 (R.Z.); +48-71-3756203 (A.J.) Label-Free Cellular Proteomics of Candida albicans biofilms treated with DiMIQ Identified Proteins Accession # Alternate ID Gene names (ORF ) WT DIMIQ Z SCORE Proteins induced by DiMIQ Arginase (EC 3.5.3.1) A0A1D8PP00 CAR1 CAALFM_C504490CA 0.000 6.648 drug induced Glucan 1,3-beta-glucosidase BGL2 (EC 3.2.1.58) (Exo-1Q5AMT2 BGL2 CAALFM_C402250CA
    [Show full text]
  • Global Transcriptome Analysis and Identification of Genes Involved In
    www.nature.com/scientificreports OPEN Global transcriptome analysis and identification of genes involved in nutrients accumulation during Received: 19 December 2016 Accepted: 31 August 2017 seed development of rice tartary Published: xx xx xxxx buckwheat (Fagopyrum Tararicum) Juan Huang1, Jiao Deng1, Taoxiong Shi1, Qijiao Chen1, Chenggang Liang1, Ziye Meng1, Liwei Zhu1, Yan Wang1, Fengli Zhao2, Shizhou Yu3 & Qingfu Chen1 Tartary buckwheat seeds are rich in various nutrients, such as storage proteins, starch, and flavonoids. To get a good knowledge of the transcriptome dynamics and gene regulatory mechanism during the process of seed development and nutrients accumulation, we performed a comprehensive global transcriptome analysis using rice tartary buckwheat seeds at different development stages, namely pre-filling stage, filling stage, and mature stage. 24 819 expressed genes, including 108 specifically expressed genes, and 11 676 differentially expressed genes (DEGs) were identified. qRT-PCR analysis was performed on 34 DEGs to validate the transcriptome data, and a good consistence was obtained. Based on their expression patterns, the identified DEGs were classified to eight clusters, and the enriched GO items in each cluster were analyzed. In addition, 633 DEGs related to plant hormones were identified. Furthermore, genes in the biosynthesis pathway of nutrients accumulation were analyzed, including 10, 20, and 23 DEGs corresponding to the biosynthesis of seed storage proteins, flavonoids, and starch, respectively. This is the first transcriptome analysis during seed development of tartary buckwheat. It would provide us a comprehensive understanding of the complex transcriptome dynamics during seed development and gene regulatory mechanism of nutrients accumulation. Seed is the primary storage organ in plants for storing nutrients such as starch, lipids, and proteins1.
    [Show full text]
  • Supplementary Information
    Supplementary Information Table S1. Pathway analysis of the 1246 dwf1-specific differentially expressed genes. Fold Change Fold Change Fold Change Gene ID Description (dwf1/WT) (XL-5/WT) (XL-6/WT) Carbohydrate Metabolism Glycolysis/Gluconeogenesis POPTR_0008s11770.1 Glucose-6-phosphate isomerase −1.7382 0.512146 0.168727 POPTR_0001s47210.1 Fructose-bisphosphate aldolase, class I 1.599591 0.044778 0.18237 POPTR_0011s05190.3 Probable phosphoglycerate mutase −2.11069 −0.34562 −0.9738 POPTR_0012s01140.1 Pyruvate kinase −1.25054 0.074697 −0.16016 POPTR_0016s12760.1 Pyruvate decarboxylase 2.664081 0.021062 0.371969 POPTR_0012s08010.1 Aldehyde dehydrogenase (NAD+) −1.41556 0.479957 −0.21366 POPTR_0014s13710.1 Acetyl-CoA synthetase −1.337 0.154552 −0.26532 POPTR_0017s11660.1 Aldose 1-epimerase 2.770518 0.016874 0.73016 POPTR_0010s11970.1 Phosphoglucomutase −1.25266 −0.35581 0.074064 POPTR_0012s14030.1 Phosphoglucomutase −1.15872 −0.68468 −0.93596 POPTR_0002s10850.1 Phosphoenolpyruvate carboxykinase (ATP) 1.489119 0.967284 0.821559 Citrate cycle (TCA cycle) 2-Oxoglutarate dehydrogenase E2 component POPTR_0014s15280.1 −1.63733 0.076435 0.170827 (dihydrolipoamide succinyltransferase) POPTR_0002s26120.1 Succinyl-CoA synthetase β subunit −1.29244 −0.38517 −0.3497 POPTR_0007s12750.1 Succinate dehydrogenase (ubiquinone) flavoprotein subunit −1.83751 0.519356 0.309149 POPTR_0002s10850.1 Phosphoenolpyruvate carboxykinase (ATP) 1.489119 0.967284 0.821559 Pentose phosphate pathway POPTR_0008s11770.1 Glucose-6-phosphate isomerase −1.7382 0.512146 0.168727 POPTR_0013s00660.1 Glucose-6-phosphate 1-dehydrogenase −1.26949 −0.18314 0.374822 POPTR_0015s00960.1 6-Phosphogluconolactonase 2.022223 0.168877 0.971431 POPTR_0010s11970.1 Phosphoglucomutase −1.25266 −0.35581 0.074064 POPTR_0012s14030.1 Phosphoglucomutase −1.15872 −0.68468 −0.93596 POPTR_0001s47210.1 Fructose-bisphosphate aldolase, class I 1.599591 0.044778 0.18237 S2 Table S1.
    [Show full text]
  • Recent Progress Toward Understanding the Role of Starch Biosynthetic Enzymes in the Cereal Endosperm
    Amylase 2017; 1: 59–74 Review Article Cheng Li, Prudence O. Powell, Robert G. Gilbert* Recent progress toward understanding the role of starch biosynthetic enzymes in the cereal endosperm DOI 10.1515/amylase-2017-0006 Abbreviations: ADPGlc, adenosine 5'-diphosphate Received July 31, 2017; accepted September 22, 2017 glucose; AGPase, ADP-glucose pyrophosphorylase; Abstract: Starch from cereal endosperm is a major CBM, carbohydrate-binding module; CLD, chain-length energy source for many mammals. The synthesis of this distribution; DAF, days after flowering; DBE, debranching starch involves a number of different enzymes whose enzyme; D-enzyme, disproportionating enzyme; mode of action is still not completely understood. ADP- DP, degree of polymerization; GBSS, granule bound glucose pyrophosphorylase is involved in the synthesis starch synthase; GH, glycoside hydrolase; GT, glycosyl of starch monomer (ADP-glucose), a process, which transferase; ISA, isoamylase; MOS, maltooligosaccharides; almost exclusively takes place in the cytosol. ADP- 3-PGA, 3-phosphoglyceric acid; Pi, inorganic phosphate; glucose is then transported into the amyloplast and PUL, pullulanase; SBE, starch-branching enzyme; SP, incorporated into starch granules by starch synthase, starch phosphorylase; SS, starch synthases; SuSy, sucrose starch-branching enzyme and debranching enzyme. synthase; UDPGlc, nucleoside diphosphate glucose. Additional enzymes, including starch phosphorylase and disproportionating enzyme, may be also involved in the formation of starch granules, although their exact 1 Introduction functions are still obscure. Interactions between these Starch is a highly branched d-glucose homopolymer enzymes in the form of functional complexes have been with a wide range of uses. It is accumulated in the cereal proposed and investigated, resulting more complicated endosperm as an energy reserve for seed germination, as starch biosynthetic pathways.
    [Show full text]
  • アミロース製造に利用する酵素の開発と改良 Phosphorylase and Muscle Phosphorylase B
    125 J. Appl. Glycosci., 54, 125―131 (2007) !C 2007 The Japanese Society of Applied Glycoscience Proceedings of the Symposium on Amylases and Related Enzymes, 2006 Developing and Engineering Enzymes for Manufacturing Amylose (Received December 5, 2006; Accepted January 5, 2007) Michiyo Yanase,1,＊ Takeshi Takaha1 and Takashi Kuriki1 1 Biochemical Research Laboratory, Ezaki Glico Co., Ltd. (4 ―6 ―5, Utajima, Nishiyodogawa-ku, Osaka 555-8502, Japan) Abstract: Amylose is a functional biomaterial and is expected to be used for various industries. However at present, manufacturing of amylose is not done, since the purification of amylose from starch is very difficult. It has been known that amylose can be produced in vitro by using α-glucan phosphorylases. In order to ob- tain α-glucan phosphorylase suitable for manufacturing amylose, we isolated an α-glucan phosphorylase gene from Thermus aquaticus and expressed it in Escherichia coli. We also obtained thermostable α-glucan phos- phorylase by introducing amino acid replacement onto potato enzyme. α-Glucan phosphorylase is suitable for the synthesis of amylose; the only problem is that it requires an expensive substrate, glucose 1-phosphate. We have avoided this problem by using α-glucan phosphorylase either with sucrose phosphorylase or cellobiose phosphorylase, where inexpensive raw material, sucrose or cellobiose, can be used instead. In these combined enzymatic systems, α-glucan phosphorylase is a key enzyme. This paper summarizes our work on engineering practical α-glucan phosphorylase for industrial processes and its use in the enzymatic synthesis of essentially linear amylose and other glucose polymers. Key words: amylose, glucose polymer, α-glucan phosphorylase, glycogen debranching enzyme, protein engi- neering α-1,4 glucan is the major form of energy reserve from Enzymes for amylose synthesis.
    [Show full text]
  • 1 SUPPLEMENTARY INFORMATION 1 2 an Archaeal Symbiont
    1 SUPPLEMENTARY INFORMATION 2 3 An archaeal symbiont-host association from the deep terrestrial subsurface 4 5 Katrin Schwank1, Till L. V. Bornemann1, Nina Dombrowski2, Anja Spang2,3, Jillian F. Banfield4 and 6 Alexander J. Probst1* 7 8 9 1 Group for Aquatic Microbial Ecology (GAME), Biofilm Center, Department of Chemistry, 10 University of Duisburg-Essen, Germany 11 2Department of Marine Microbiology and Biogeochemistry (MMB), Royal Netherlands Institute 12 for Sea Research (NIOZ), and Utrecht University, Den Burg, Netherlands 13 3Department of Cell- and Molecular Biology, Science for Life Laboratory, Uppsala University, SE- 14 75123, Uppsala, Sweden 15 4 Department for Earth and Planetary Sciences, University of California, Berkeley, USA 16 17 *to whom the correspondence should be addressed: 18 Alexander J. Probst 19 University of Duisburg-Essen 20 Universitätsstrasse 4 21 45141 Essen 22 [email protected] 23 24 25 Content: 26 1. Supplementary Methods 27 2. Supplementary Tables 28 3. Supplementary Figure 29 4. References 30 31 32 33 1. Supplementary methods 34 Phylogenetic analysis 35 Hmm profiles of the 37 maker genes used by the phylosift v1.01 software [1, 2] were queried 36 against a representative set of archaeal genomes from NCBI (182) and the GOLD database (3) as 37 well as against the huberarchaeal population genome (for details on genomes please see 38 Supplementary Data file 1) using the phylosift search mode [1, 2]. Protein sequences 39 corresponding to each of the maker genes were subsequently aligned using mafft-linsi v7.407 [3] 40 and trimmed with BMGE-1.12 (parameters: -t AA -m BLOSUM30 -h 0.55) [4].
    [Show full text]
  • O O2 Enzymes Available from Sigma Enzymes Available from Sigma
    COO 2.7.1.15 Ribokinase OXIDOREDUCTASES CONH2 COO 2.7.1.16 Ribulokinase 1.1.1.1 Alcohol dehydrogenase BLOOD GROUP + O O + O O 1.1.1.3 Homoserine dehydrogenase HYALURONIC ACID DERMATAN ALGINATES O-ANTIGENS STARCH GLYCOGEN CH COO N COO 2.7.1.17 Xylulokinase P GLYCOPROTEINS SUBSTANCES 2 OH N + COO 1.1.1.8 Glycerol-3-phosphate dehydrogenase Ribose -O - P - O - P - O- Adenosine(P) Ribose - O - P - O - P - O -Adenosine NICOTINATE 2.7.1.19 Phosphoribulokinase GANGLIOSIDES PEPTIDO- CH OH CH OH N 1 + COO 1.1.1.9 D-Xylulose reductase 2 2 NH .2.1 2.7.1.24 Dephospho-CoA kinase O CHITIN CHONDROITIN PECTIN INULIN CELLULOSE O O NH O O O O Ribose- P 2.4 N N RP 1.1.1.10 l-Xylulose reductase MUCINS GLYCAN 6.3.5.1 2.7.7.18 2.7.1.25 Adenylylsulfate kinase CH2OH HO Indoleacetate Indoxyl + 1.1.1.14 l-Iditol dehydrogenase L O O O Desamino-NAD Nicotinate- Quinolinate- A 2.7.1.28 Triokinase O O 1.1.1.132 HO (Auxin) NAD(P) 6.3.1.5 2.4.2.19 1.1.1.19 Glucuronate reductase CHOH - 2.4.1.68 CH3 OH OH OH nucleotide 2.7.1.30 Glycerol kinase Y - COO nucleotide 2.7.1.31 Glycerate kinase 1.1.1.21 Aldehyde reductase AcNH CHOH COO 6.3.2.7-10 2.4.1.69 O 1.2.3.7 2.4.2.19 R OPPT OH OH + 1.1.1.22 UDPglucose dehydrogenase 2.4.99.7 HO O OPPU HO 2.7.1.32 Choline kinase S CH2OH 6.3.2.13 OH OPPU CH HO CH2CH(NH3)COO HO CH CH NH HO CH2CH2NHCOCH3 CH O CH CH NHCOCH COO 1.1.1.23 Histidinol dehydrogenase OPC 2.4.1.17 3 2.4.1.29 CH CHO 2 2 2 3 2 2 3 O 2.7.1.33 Pantothenate kinase CH3CH NHAC OH OH OH LACTOSE 2 COO 1.1.1.25 Shikimate dehydrogenase A HO HO OPPG CH OH 2.7.1.34 Pantetheine kinase UDP- TDP-Rhamnose 2 NH NH NH NH N M 2.7.1.36 Mevalonate kinase 1.1.1.27 Lactate dehydrogenase HO COO- GDP- 2.4.1.21 O NH NH 4.1.1.28 2.3.1.5 2.1.1.4 1.1.1.29 Glycerate dehydrogenase C UDP-N-Ac-Muramate Iduronate OH 2.4.1.1 2.4.1.11 HO 5-Hydroxy- 5-Hydroxytryptamine N-Acetyl-serotonin N-Acetyl-5-O-methyl-serotonin Quinolinate 2.7.1.39 Homoserine kinase Mannuronate CH3 etc.
    [Show full text]
  • REGULATION of MAIZE (Zea Mays L.) STARCH SYNTHASE Iia by PROTEIN PHOSPHORYLATION
    Regulation of Maize (Zea mays L.) Starch Synthase IIa by Protein Phosphorylation by Usha P. Rayirath A Thesis presented to The University of Guelph In partial fulfillment of requirements for the degree of Doctor of Philosophy in Molecular and Cellular Biology Guelph, Ontario, Canada © Usha P. Rayirath, May, 2014 ABSTRACT REGULATION OF MAIZE (Zea mays L.) STARCH SYNTHASE IIa BY PROTEIN PHOSPHORYLATION Usha P. Rayirath Advisor: Dr. Michael J. Emes University of Guelph, 2014 Starch is a significant carbohydrate reserve in plants and has enormous use in both food and non-food industries. Biosynthesis of storage starch in maize (Zea mays L.) occurs in the amyloplasts of the developing endosperm, through the coordinated actions of several enzymes, including ADP-glucose pyrophosphorylase (AGPase), starch synthases (SS), starch branching enzymes (SBE) and debranching enzymes (DBE). Starch synthase IIa (SSIIa) catalyzes the synthesis of intermediate glucan chains (DP 12- 25) and plays a significant role in starch biosynthesis. Previous studies indicate that in cereal endosperm, protein phosphorylation plays a major role in regulating the formation of functional multi-enzyme complexes between SSs and SBEs during starch biosynthesis and that SSIIa forms the core of such a functional protein complex, with SSI and SBEIIb. The present study investigated the specific role of protein phosphorylation on the regulation of SSIIa, in the amyloplasts of developing maize endosperm, during starch biosynthesis. In vitro phosphorylation of stromal SSIIa in maize amyloplasts was detected by phosphate affinity Mn2+ Phos-tagTM gel electrophoresis, Pro-Q® Diamond phospho-protein gel staining, and by autoradiography following radio labelling with γ- [32-P] ATP.
    [Show full text]
  • The Analysis of Global Gene Expression Related to Starch, Lipid and Protein Composition
    Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations 2006 The na alysis of global gene expression related to starch, lipid and protein composition Ling Li Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/rtd Part of the Genetics Commons, and the Molecular Biology Commons Recommended Citation Li, Ling, "The na alysis of global gene expression related to starch, lipid and protein composition " (2006). Retrospective Theses and Dissertations. 1864. https://lib.dr.iastate.edu/rtd/1864 This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. The analysis of global gene expression related to starch, lipid and protein composition by Ling Li A dissertation submitted to the graduate faculty in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Major: Genetics Program of Study Committee: Eve Syrkin Wurtele, Major Professor Martin H. Spalding Mark E. Westgate Dan S. Nettleton Martha G. James Basil J. Nikolau Iowa State University Ames, Iowa 2006 Copyright © Ling Li, 2006. All rights reserved. UMI Number: 3243820 Copyright 2007 by Li, Ling All rights reserved. UMI Microform 3243820 Copyright 2007 by ProQuest Information and Learning Company. All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code. ProQuest Information and Learning Company 300 North Zeeb Road P.O.
    [Show full text]