Polysaccharide-Synthesizing Glycosyltransferases and Carbohydrate Bind- Ing Modules: the Case of Starch Synthase III
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
METACYC ID Description A0AR23 GO:0004842 (Ubiquitin-Protein Ligase
Electronic Supplementary Material (ESI) for Integrative Biology This journal is © The Royal Society of Chemistry 2012 Heat Stress Responsive Zostera marina Genes, Southern Population (α=0. -
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Download (PDF)
Tomono et al.: Glycan evolution based on phylogenetic profiling 1 Supplementary Table S1. List of 173 enzymes that are composed of glycosyltransferases and functionally-linked glycan synthetic enzymes UniProt ID Protein Name Categories of Glycan Localization CAZy Class 1 Q8N5D6 Globoside -1,3-N -acetylgalactosaminyltransferase 1 Glycosphingolipid Golgi apparatus GT6 P16442 Histo-blood group ABO system transferase Glycosphingolipid Golgi apparatus GT6 P19526 Galactoside 2--L-fucosyltransferase 1 Glycosphingolipid Golgi apparatus GT11 Q10981 Galactoside 2--L-fucosyltransferase 2 Glycosphingolipid Golgi apparatus GT11 Q00973 -1,4 N -acetylgalactosaminyltransferase 1 Glycosphingolipid Golgi apparatus GT12 Q8NHY0 -1,4 N -acetylgalactosaminyltransferase 2 O -Glycan, N -Glycan, Glycosphingolipid Golgi apparatus GT12 Q09327 -1,4-mannosyl-glycoprotein 4--N -acetylglucosaminyltransferase N -Glycan Golgi apparatus GT17 Q09328 -1,6-mannosylglycoprotein 6--N -acetylglucosaminyltransferase A N -Glycan Golgi apparatus GT18 Q3V5L5 -1,6-mannosylglycoprotein 6--N -acetylglucosaminyltransferase B O -Glycan, N -Glycan Golgi apparatus GT18 Q92186 -2,8-sialyltransferase 8B (SIAT8-B) (ST8SiaII) (STX) N -Glycan Golgi apparatus GT29 O15466 -2,8-sialyltransferase 8E (SIAT8-E) (ST8SiaV) Glycosphingolipid Golgi apparatus GT29 P61647 -2,8-sialyltransferase 8F (SIAT8-F) (ST8SiaVI) O -Glycan Golgi apparatus GT29 Q9NSC7 -N -acetylgalactosaminide -2,6-sialyltransferase 1 (ST6GalNAcI) (SIAT7-A) O -Glycan Golgi apparatus GT29 Q9UJ37 -N -acetylgalactosaminide -2,6-sialyltransferase -
Supplementary Materials
1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No. -
A Label-Free Cellular Proteomics Approach to Decipher the Antifungal Action of Dimiq, a Potent Indolo[2,3- B]Quinoline Agent, Against Candida Albicans Biofilms
A Label-Free Cellular Proteomics Approach to Decipher the Antifungal Action of DiMIQ, a Potent Indolo[2,3- b]Quinoline Agent, against Candida albicans Biofilms Robert Zarnowski 1,2*, Anna Jaromin 3*, Agnieszka Zagórska 4, Eddie G. Dominguez 1,2, Katarzyna Sidoryk 5, Jerzy Gubernator 3 and David R. Andes 1,2 1 Department of Medicine, School of Medicine & Public Health, University of Wisconsin-Madison, Madison, WI 53706, USA; [email protected] (E.G.D.); [email protected] (D.R.A.) 2 Department of Medical Microbiology, School of Medicine & Public Health, University of Wisconsin-Madison, Madison, WI 53706, USA 3 Department of Lipids and Liposomes, Faculty of Biotechnology, University of Wroclaw, 50-383 Wroclaw, Poland; [email protected] 4 Department of Medicinal Chemistry, Jagiellonian University Medical College, 30-688 Cracow, Poland; [email protected] 5 Department of Pharmacy, Cosmetic Chemicals and Biotechnology, Team of Chemistry, Łukasiewicz Research Network-Industrial Chemistry Institute, 01-793 Warsaw, Poland; [email protected] * Correspondence: [email protected] (R.Z.); [email protected] (A.J.); Tel.: +1-608-265-8578 (R.Z.); +48-71-3756203 (A.J.) Label-Free Cellular Proteomics of Candida albicans biofilms treated with DiMIQ Identified Proteins Accession # Alternate ID Gene names (ORF ) WT DIMIQ Z SCORE Proteins induced by DiMIQ Arginase (EC 3.5.3.1) A0A1D8PP00 CAR1 CAALFM_C504490CA 0.000 6.648 drug induced Glucan 1,3-beta-glucosidase BGL2 (EC 3.2.1.58) (Exo-1Q5AMT2 BGL2 CAALFM_C402250CA -
Flavonoid Glucodiversification with Engineered Sucrose-Active Enzymes Yannick Malbert
Flavonoid glucodiversification with engineered sucrose-active enzymes Yannick Malbert To cite this version: Yannick Malbert. Flavonoid glucodiversification with engineered sucrose-active enzymes. Biotechnol- ogy. INSA de Toulouse, 2014. English. NNT : 2014ISAT0038. tel-01219406 HAL Id: tel-01219406 https://tel.archives-ouvertes.fr/tel-01219406 Submitted on 22 Oct 2015 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Last name: MALBERT First name: Yannick Title: Flavonoid glucodiversification with engineered sucrose-active enzymes Speciality: Ecological, Veterinary, Agronomic Sciences and Bioengineering, Field: Enzymatic and microbial engineering. Year: 2014 Number of pages: 257 Flavonoid glycosides are natural plant secondary metabolites exhibiting many physicochemical and biological properties. Glycosylation usually improves flavonoid solubility but access to flavonoid glycosides is limited by their low production levels in plants. In this thesis work, the focus was placed on the development of new glucodiversification routes of natural flavonoids by taking advantage of protein engineering. Two biochemically and structurally characterized recombinant transglucosylases, the amylosucrase from Neisseria polysaccharea and the α-(1→2) branching sucrase, a truncated form of the dextransucrase from L. Mesenteroides NRRL B-1299, were selected to attempt glucosylation of different flavonoids, synthesize new α-glucoside derivatives with original patterns of glucosylation and hopefully improved their water-solubility. -
XAX1 from Glycosyltransferase Family 61 Mediates Xylosyltransfer to Rice Xylan
XAX1 from glycosyltransferase family 61 mediates xylosyltransfer to rice xylan Dawn Chiniquya,b, Vaishali Sharmab, Alex Schultinkc,d, Edward E. Baidoob,e, Carsten Rautengartenb, Kun Chengc,d, Andrew Carrollb, Peter Ulvskovf, Jesper Harholtf, Jay D. Keaslingb,e,g, Markus Paulyc,d, Henrik V. Schellerb,c,e, and Pamela C. Ronalda,b,h,1 aDepartment of Plant Pathology and the Genome Center, University of California, Davis, CA 95616; bJoint BioEnergy Institute, Emeryville, CA 94608; cDepartment of Plant and Microbial Biology, dEnergy Biosciences Institute, and gDepartment of Chemical and Biomolecular Engineering, Department of Bioengineering, University of California, Berkeley, CA 94720; ePhysical Biosciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720; fDepartment of Plant Biology and Biotechnology, University of Copenhagen, DK-1871 Frederiksberg C, Denmark; and hDepartment of Plant Molecular Systems Biotechnology and Crop Biotech Institute, Kyung Hee University, Yongin 446-701, Korea Edited by Diter von Wettstein, Washington State University, Pullman, WA, and approved August 31, 2012 (received for review February 6, 2012) Xylan is the second most abundant polysaccharide on Earth and Caulerpa that has β-1,3-D-xylan in place of cellulose, and the red represents an immense quantity of stored energy for biofuel pro- seaweeds Palmariales and Nemaliales that have a mixed linkage duction. Despite its importance, most of the enzymes that synthe- β-(1,3-1,4)-D-xylose backbone (8). Xylans of embryophytes have size xylan have yet to be identified. Xylans have a backbone of a β-1,4–linked xylose backbone. Xylans found in dicots are mostly β-1,4–linked xylose residues with substitutions that include α-(1→2)– restricted to the secondary cell walls, and hence a main component linked glucuronosyl, 4-O-methyl glucuronosyl, and α-1,2- and α-1,3- of wood. -
Global Transcriptome Analysis and Identification of Genes Involved In
www.nature.com/scientificreports OPEN Global transcriptome analysis and identification of genes involved in nutrients accumulation during Received: 19 December 2016 Accepted: 31 August 2017 seed development of rice tartary Published: xx xx xxxx buckwheat (Fagopyrum Tararicum) Juan Huang1, Jiao Deng1, Taoxiong Shi1, Qijiao Chen1, Chenggang Liang1, Ziye Meng1, Liwei Zhu1, Yan Wang1, Fengli Zhao2, Shizhou Yu3 & Qingfu Chen1 Tartary buckwheat seeds are rich in various nutrients, such as storage proteins, starch, and flavonoids. To get a good knowledge of the transcriptome dynamics and gene regulatory mechanism during the process of seed development and nutrients accumulation, we performed a comprehensive global transcriptome analysis using rice tartary buckwheat seeds at different development stages, namely pre-filling stage, filling stage, and mature stage. 24 819 expressed genes, including 108 specifically expressed genes, and 11 676 differentially expressed genes (DEGs) were identified. qRT-PCR analysis was performed on 34 DEGs to validate the transcriptome data, and a good consistence was obtained. Based on their expression patterns, the identified DEGs were classified to eight clusters, and the enriched GO items in each cluster were analyzed. In addition, 633 DEGs related to plant hormones were identified. Furthermore, genes in the biosynthesis pathway of nutrients accumulation were analyzed, including 10, 20, and 23 DEGs corresponding to the biosynthesis of seed storage proteins, flavonoids, and starch, respectively. This is the first transcriptome analysis during seed development of tartary buckwheat. It would provide us a comprehensive understanding of the complex transcriptome dynamics during seed development and gene regulatory mechanism of nutrients accumulation. Seed is the primary storage organ in plants for storing nutrients such as starch, lipids, and proteins1. -
Aberrant Sialylation in Cancer: Biomarker and Potential Target for Therapeutic Intervention?
cancers Review Aberrant Sialylation in Cancer: Biomarker and Potential Target for Therapeutic Intervention? Silvia Pietrobono * and Barbara Stecca * Tumor Cell Biology Unit, Core Research Laboratory, Institute for Cancer Research and Prevention (ISPRO), Viale Pieraccini 6, 50139 Florence, Italy * Correspondence: [email protected] (S.P.); [email protected] (B.S.); Tel.: +39-055-7944568 (S.P.); +39-055-7944567 (B.S.) Simple Summary: Sialylation is a post-translational modification that consists in the addition of sialic acid to growing glycan chains on glycoproteins and glycolipids. Aberrant sialylation is an established hallmark of several types of cancer, including breast, ovarian, pancreatic, prostate, colorectal and lung cancers, melanoma and hepatocellular carcinoma. Hypersialylation can be the effect of increased activity of sialyltransferases and results in an excess of negatively charged sialic acid on the surface of cancer cells. Sialic acid accumulation contributes to tumor progression by several paths, including stimulation of tumor invasion and migration, and enhancing immune evasion and tumor cell survival. In this review we explore the mechanisms by which sialyltransferases promote cancer progression. In addition, we provide insights into the possible use of sialyltransferases as biomarkers for cancer and summarize findings on the development of sialyltransferase inhibitors as potential anti-cancer treatments. Abstract: Sialylation is an integral part of cellular function, governing many biological processes Citation: Pietrobono, S.; Stecca, B. including cellular recognition, adhesion, molecular trafficking, signal transduction and endocytosis. Aberrant Sialylation in Cancer: Sialylation is controlled by the levels and the activities of sialyltransferases on glycoproteins and Biomarker and Potential Target for lipids. Altered gene expression of these enzymes in cancer yields to cancer-specific alterations of Therapeutic Intervention? Cancers glycoprotein sialylation. -
Arnt Proteins That Catalyse the Glycosylation of Lipopolysaccharide Share Common Features with Bacterial N-Oligosaccharyltransferases
ArnT proteins that catalyse the glycosylation of lipopolysaccharide share common features with bacterial N-oligosaccharyltransferases Tavares-Carreón, F., Mohamed, Y. F., Andrade, A., & Valvano, M. A. (2016). ArnT proteins that catalyse the glycosylation of lipopolysaccharide share common features with bacterial N-oligosaccharyltransferases. Glycobiology, 26(3), 286-300. https://doi.org/10.1093/glycob/cwv095 Published in: Glycobiology Document Version: Peer reviewed version Queen's University Belfast - Research Portal: Link to publication record in Queen's University Belfast Research Portal Publisher rights © [2015] Oxford University Press This is a pre-copyedited, author-produced PDF of an article accepted for publication in Glycobiology following peer review. The version of record Tavares-Carreón, F, Mohamed, YF, Andrade, A & Valvano, MA 2016, 'ArnT proteins that catalyse the glycosylation of lipopolysaccharide share common features with bacterial N-oligosaccharyltransferases' Glycobiology, vol 26, no. 3, pp. 286-300. is available online at:http://glycob.oxfordjournals.org/content/26/3/286 General rights Copyright for the publications made accessible via the Queen's University Belfast Research Portal is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The Research Portal is Queen's institutional repository that provides access to Queen's research output. Every effort has been made to ensure that content in the Research Portal does not infringe any person's rights, or applicable UK laws. If you discover content in the Research Portal that you believe breaches copyright or violates any law, please contact [email protected]. -
Two Arabidopsis Proteins Synthesize Acetylated Xylan Invitro
The Plant Journal (2014) 80, 197–206 doi: 10.1111/tpj.12643 FEATURED ARTICLE Two Arabidopsis proteins synthesize acetylated xylan in vitro Breeanna R. Urbanowicz, Maria J. Pena*,~ Heather A. Moniz, Kelley W. Moremen and William S. York* Complex Carbohydrate Research Center, University of Georgia, 315 Riverbend Road, Athens, GA 30602, USA Received 4 June 2014; revised 18 July 2014; accepted 1 August 2014; published online 21 August 2014. *For correspondence (e-mails [email protected]; [email protected]). SUMMARY Xylan is the third most abundant glycopolymer on earth after cellulose and chitin. As a major component of wood, grain and forage, this natural biopolymer has far-reaching impacts on human life. This highly acetylated cell wall polysaccharide is a vital component of the plant cell wall, which functions as a molecular scaffold, pro- viding plants with mechanical strength and flexibility. Mutations that impair synthesis of the xylan backbone give rise to plants that fail to grow normally because of collapsed xylem cells in the vascular system. Phenotypic analysis of these mutants has implicated many proteins in xylan biosynthesis; however, the enzymes directly responsible for elongation and acetylation of the xylan backbone have not been unambiguously identified. Here we provide direct biochemical evidence that two Arabidopsis thaliana proteins, IRREGULAR XYLEM 10–L (IRX10-L) and ESKIMO1/TRICOME BIREFRINGENCE 29 (ESK1/TBL29), catalyze these respective processes in vi- tro. By identifying the elusive xylan synthase and establishing ESK1/TBL29 as the archetypal plant polysaccha- ride O-acetyltransferase, we have resolved two long-standing questions in plant cell wall biochemistry. -
Multiplexed Engineering Glycosyltransferase Genes in CHO Cells Via Targeted Integration for Producing Antibodies with Diverse Complex‑Type N‑Glycans Ngan T
www.nature.com/scientificreports OPEN Multiplexed engineering glycosyltransferase genes in CHO cells via targeted integration for producing antibodies with diverse complex‑type N‑glycans Ngan T. B. Nguyen, Jianer Lin, Shi Jie Tay, Mariati, Jessna Yeo, Terry Nguyen‑Khuong & Yuansheng Yang* Therapeutic antibodies are decorated with complex‑type N‑glycans that signifcantly afect their biodistribution and bioactivity. The N‑glycan structures on antibodies are incompletely processed in wild‑type CHO cells due to their limited glycosylation capacity. To improve N‑glycan processing, glycosyltransferase genes have been traditionally overexpressed in CHO cells to engineer the cellular N‑glycosylation pathway by using random integration, which is often associated with large clonal variations in gene expression levels. In order to minimize the clonal variations, we used recombinase‑mediated‑cassette‑exchange (RMCE) technology to overexpress a panel of 42 human glycosyltransferase genes to screen their impact on antibody N‑linked glycosylation. The bottlenecks in the N‑glycosylation pathway were identifed and then released by overexpressing single or multiple critical genes. Overexpressing B4GalT1 gene alone in the CHO cells produced antibodies with more than 80% galactosylated bi‑antennary N‑glycans. Combinatorial overexpression of B4GalT1 and ST6Gal1 produced antibodies containing more than 70% sialylated bi‑antennary N‑glycans. In addition, antibodies with various tri‑antennary N‑glycans were obtained for the frst time by overexpressing MGAT5 alone or in combination with B4GalT1 and ST6Gal1. The various N‑glycan structures and the method for producing them in this work provide opportunities to study the glycan structure‑and‑function and develop novel recombinant antibodies for addressing diferent therapeutic applications.