The Pennsylvania State University the Graduate School Department

Total Page:16

File Type:pdf, Size:1020Kb

The Pennsylvania State University the Graduate School Department The Pennsylvania State University The Graduate School Department of Biochemistry and Molecular Biology MECHANISTIC STUDIES INTO BACTERIAL CELLULOSE SYNTHESIS A Dissertation in Biochemistry, Microbiology, and Molecular Biology by John B. McManus © 2017 John B. McManus Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2017 This dissertation of John B McManus was approved* by the following: Ming Tien Professor of Biochemistry and Molecular Biology Dissertation Advisor Chair of Committee B. Tracy Nixon Professor of Biochemistry and Molecular Biology Hemant Yennawar Director, X-ray Crystallography Laboratory Frank L. Dorman Associate Professor of Biochemistry and Molecular Biology Squire Booker Professor of Chemistry Professor of Biochemistry and Molecular Biology Scott B. Selleck Department Head, Biochemistry and Molecular Biology *Signatures are on file in the Graduate School ii ABSTRACT Cellulose, a polymer of β-1,4-linked glucose units, is synthesized by plants, animals, fungi, and bacteria. It is the major component of the plant cell wall and, thus, is thought to be the most abundant biological molecule on earth. Cellulose synthase, a membrane-bound glycosyltransferase, synthesizes cellulose through the processive addition of glucose, from UDP-glucose, to the non-reducing end of the cellulose polymer. This enzyme is often found with other proteins in large cellulose synthase complexes. The primary focus of the present work is a greater understanding of the mechanisms for initiation, elongation, and termination of the cellulose polymer. Structural studies of cellulose synthase from Rhodobacter sphaeroides, called BcsA- BcsB, have revealed much regarding the mechanisms for polymer elongation, however the mechanisms for initiation and termination largely remain a mystery. Two tools were developed for the present work. First was the isolation of a core catalytic subunit of the cellulose synthase complex. The catalytic heterodimer, AcsA- AcsB, was isolated from Gluconacetobacter hansenii by two methods—product entrapment and affinity chromatography—and then subsequently kinetically characterized. Second was the development of a tool for the size analysis of in vitro- synthesized cellulose. Existing methods of cellulose solubilization and separation by gel permeation chromatography were adapted for this tool. Initiation of cellulose synthesis can follow either a primer-dependent or a primer- independent mechanism. Using size analysis of in vitro-synthesized cellulose, both AcsA-AcsB and BcsA-BcsB were shown to follow a primer-independent mechanism for iii initiation. Reducing end analysis of in vitro-synthesized cellulose from both enzymes indicated that glucose is sufficient to initiate synthesis. Finally, BcsA-BcsB demonstrated UDP-glucose hydrolase activity, allowing for the construction of a plausible mechanism for self-priming. Here, cellulose synthase hydrolyzes UDP-glucose and subsequently binds the liberated glucose to initiate new cellulose polymer synthesis. Size analysis also revealed processivity differences between the two enzymes. To investigate the factors underlying processivity, changes in selected residues in the BcsA transmembrane channel were made. In one variant, the processivity and kinetic rates were altered. Finally, size analysis indicated that the active elongation of the polymer by both AcsA-AcsB and BcsA-BcsB is faster than the overall turnover numbers. This suggested that the catalytic cycle minimally consists of a fast and a slow phase. With these data, a minimal kinetic mechanism for cellulose synthesis was constructed. To see if the overall turnover number was equally as slow in vivo, quantitative western blotting was employed to calculate the turnover number in whole G. hansenii cells. The turnover number in vivo was much faster than for purified AcsA-AcsB. Three cellulose synthase complex accessory proteins were investigated to test for their involvement in catalysis. Following this, the turnover number for AcsA-AcsB was measured at each step during purification by quantitative western blotting. This analysis showed a decrease in the turnover number immediately after cell lysis, suggesting that association into the cellulose synthase complex, in whole cells, positively impacts the cellulose synthesis rate of AcsA-AcsB. iv TABLE OF CONTENTS LIST OF ABBREVIATIONS ............................................................................................ ix LIST OF FIGURES .............................................................................................................x LIST OF TABLES ............................................................................................................ xii ACKNOWLEDGEMENTS ............................................................................................. xiii CHAPTER 1: CELLULOSE AND CELLULOSE SYNTHESIS .......................................1 Cellulose Morphology, Crystallinity, and Degree of Polymerization .....................3 Cellulose Synthesis in Bacteria ................................................................................6 Regulation of Cellulose Synthesis by cyclic-di-GMP ..................................8 Gluconacetobacter hansenii as a Model for Cellulose Synthesis ................9 The Molecular Biology of Cellulose Synthesis in G. hansenii ...................12 BcsA-BcsB: The Structural Model for the Bacterial CSC Catalytic Core ............................................................................................15 Initiation of Cellulose Synthesis ............................................................................20 Heparosan Synthase...................................................................................22 Cyclic Glucosyl Synthase ...........................................................................22 STATEMENT OF THE PROBLEM .................................................................................23 SUMMARY .......................................................................................................................24 CHAPTER 2: ACSA-ACSB: THE CATALYTIC CORE OF THE CELLULOSE SYNTHASE COMPLEX ...........................................................................28 Introduction ............................................................................................................28 Materials and Methods ...........................................................................................29 Culture Conditions .....................................................................................29 Cloning of AcsAB-his .................................................................................30 Protein Concentration Determination .......................................................30 AcsA-AcsB Purification by Product Entrapment .......................................31 AcsA-AcsB Purification by Affinity Chromatography ...............................32 Radiometric Measurement of Cellulose Synthase Activity ........................32 Spectrophotometric Measurement of Cellulose Synthase Activity.............33 SDS-PAGE and Western Blot Analysis ......................................................33 N-terminal Sequencing...............................................................................34 v Trichloroacetic Acid-Mediated Cell Lysis .................................................34 Results ....................................................................................................................34 Purification of AcsA-AcsB by Product Entrapment ..................................34 Processing of AcsAB ..................................................................................38 Purification of AcsA-AcsB by Affinity Chromatography ...........................38 Kinetic Characterization of AcsA-AcsB .....................................................42 Discussion ..............................................................................................................45 AcsA-AcsB is the Catalytic Core of Cellulose Synthase ............................45 Processing of AcsAB ..................................................................................45 Kinetic Characterization of AcsA-AcsB .....................................................46 CHAPTER 3: INITIATION OF CELLULOSE SYNTHESIS ..........................................48 Introduction ............................................................................................................48 Materials and Methods ...........................................................................................50 Preparation of Solvents..............................................................................50 Expression and Purification of BcsA-BcsB................................................51 Modification and Gel Permeation Chromatography of Cellulose in Tetrahydrofuran .........................................................................................51 Dissolution and Gel Permeation Chromatography of Cellulose in Dimethylacetamide / 8% Lithium Chloride ...............................................52 Reducing End Modification and Analysis ..................................................53 Glucose Quantification by Enzyme-Linked Assay .....................................54 Gel Permeation Chromatography of Glucose and Cellobiose ..................55 Reducing End Quantification Using Bicinchoninic Acid...........................55 Results ....................................................................................................................56
Recommended publications
  • METACYC ID Description A0AR23 GO:0004842 (Ubiquitin-Protein Ligase
    Electronic Supplementary Material (ESI) for Integrative Biology This journal is © The Royal Society of Chemistry 2012 Heat Stress Responsive Zostera marina Genes, Southern Population (α=0.
    [Show full text]
  • Bacteria Belonging to Pseudomonas Typographi Sp. Nov. from the Bark Beetle Ips Typographus Have Genomic Potential to Aid in the Host Ecology
    insects Article Bacteria Belonging to Pseudomonas typographi sp. nov. from the Bark Beetle Ips typographus Have Genomic Potential to Aid in the Host Ecology Ezequiel Peral-Aranega 1,2 , Zaki Saati-Santamaría 1,2 , Miroslav Kolaˇrik 3,4, Raúl Rivas 1,2,5 and Paula García-Fraile 1,2,4,5,* 1 Microbiology and Genetics Department, University of Salamanca, 37007 Salamanca, Spain; [email protected] (E.P.-A.); [email protected] (Z.S.-S.); [email protected] (R.R.) 2 Spanish-Portuguese Institute for Agricultural Research (CIALE), 37185 Salamanca, Spain 3 Department of Botany, Faculty of Science, Charles University, Benátská 2, 128 01 Prague, Czech Republic; [email protected] 4 Laboratory of Fungal Genetics and Metabolism, Institute of Microbiology of the Academy of Sciences of the Czech Republic, 142 20 Prague, Czech Republic 5 Associated Research Unit of Plant-Microorganism Interaction, University of Salamanca-IRNASA-CSIC, 37008 Salamanca, Spain * Correspondence: [email protected] Received: 4 July 2020; Accepted: 1 September 2020; Published: 3 September 2020 Simple Summary: European Bark Beetle (Ips typographus) is a pest that affects dead and weakened spruce trees. Under certain environmental conditions, it has massive outbreaks, resulting in attacks of healthy trees, becoming a forest pest. It has been proposed that the bark beetle’s microbiome plays a key role in the insect’s ecology, providing nutrients, inhibiting pathogens, and degrading tree defense compounds, among other probable traits. During a study of bacterial associates from I. typographus, we isolated three strains identified as Pseudomonas from different beetle life stages. In this work, we aimed to reveal the taxonomic status of these bacterial strains and to sequence and annotate their genomes to mine possible traits related to a role within the bark beetle holobiont.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Supplementary Materials
    1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No.
    [Show full text]
  • Embracing Bacterial Cellulose As a Catalyst for Sustainable Fashion
    Running head: BACTERIAL CELLULOSE 1 Embracing Bacterial Cellulose as a Catalyst for Sustainable Fashion Luis Quijano A Senior Thesis submitted in partial fulfillment of the requirements for graduation in the Honors Program Liberty University Fall 2017 BACTERIAL CELLULOSE 2 Acceptance of Senior Honors Thesis This Senior Honors Thesis is accepted in partial fulfillment of the requirements for graduation from the Honors Program of Liberty University. ______________________________ Debbie Benoit, D.Min. Thesis Chair ______________________________ Randall Hubbard, Ph.D. Committee Member ______________________________ Matalie Howard, M.S. Committee Member ______________________________ David E. Schweitzer, Ph.D. Assistant Honors Director ______________________________ Date BACTERIAL CELLULOSE 3 Abstract Bacterial cellulose is a leather-like material produced during the production of Kombucha as a pellicle of bacterial cellulose (SCOBY) using Kombucha SCOBY, water, sugar, and green tea. Through an examination of the bacteria that produces the cellulose pellicle of the interface of the media and the air, currently named Komagataeibacter xylinus, an investigation of the growing process of bacterial cellulose and its uses, an analysis of bacterial cellulose’s properties, and a discussion of its prospects, one can fully grasp bacterial cellulose’s potential in becoming a catalyst for sustainable fashion. By laying the groundwork for further research to be conducted in bacterial cellulose’s applications as a textile, further commercialization of bacterial cellulose may become a practical reality. Keywords: Acetobacter xylinum, alternative textile, bacterial cellulose, fashion, Komagateibacter xylinus, sustainability BACTERIAL CELLULOSE 4 Embracing Bacterial Cellulose as a Catalyst for Sustainable Fashion Introduction One moment the fashionista is “in”, while the next day the fashionista is “out”. The fashion industry is typically known for its ever-changing trends, styles, and outfits.
    [Show full text]
  • A Label-Free Cellular Proteomics Approach to Decipher the Antifungal Action of Dimiq, a Potent Indolo[2,3- B]Quinoline Agent, Against Candida Albicans Biofilms
    A Label-Free Cellular Proteomics Approach to Decipher the Antifungal Action of DiMIQ, a Potent Indolo[2,3- b]Quinoline Agent, against Candida albicans Biofilms Robert Zarnowski 1,2*, Anna Jaromin 3*, Agnieszka Zagórska 4, Eddie G. Dominguez 1,2, Katarzyna Sidoryk 5, Jerzy Gubernator 3 and David R. Andes 1,2 1 Department of Medicine, School of Medicine & Public Health, University of Wisconsin-Madison, Madison, WI 53706, USA; [email protected] (E.G.D.); [email protected] (D.R.A.) 2 Department of Medical Microbiology, School of Medicine & Public Health, University of Wisconsin-Madison, Madison, WI 53706, USA 3 Department of Lipids and Liposomes, Faculty of Biotechnology, University of Wroclaw, 50-383 Wroclaw, Poland; [email protected] 4 Department of Medicinal Chemistry, Jagiellonian University Medical College, 30-688 Cracow, Poland; [email protected] 5 Department of Pharmacy, Cosmetic Chemicals and Biotechnology, Team of Chemistry, Łukasiewicz Research Network-Industrial Chemistry Institute, 01-793 Warsaw, Poland; [email protected] * Correspondence: [email protected] (R.Z.); [email protected] (A.J.); Tel.: +1-608-265-8578 (R.Z.); +48-71-3756203 (A.J.) Label-Free Cellular Proteomics of Candida albicans biofilms treated with DiMIQ Identified Proteins Accession # Alternate ID Gene names (ORF ) WT DIMIQ Z SCORE Proteins induced by DiMIQ Arginase (EC 3.5.3.1) A0A1D8PP00 CAR1 CAALFM_C504490CA 0.000 6.648 drug induced Glucan 1,3-beta-glucosidase BGL2 (EC 3.2.1.58) (Exo-1Q5AMT2 BGL2 CAALFM_C402250CA
    [Show full text]
  • Enzyme Phosphatidylserine Synthase (Saccharomyces Cerevisae/Chol Gene/Transformation) V
    Proc. Nati. Acad. Sci. USA Vol. 80, pp. 7279-7283, December 1983 Genetics Isolation of the yeast structural gene for the membrane-associated enzyme phosphatidylserine synthase (Saccharomyces cerevisae/CHOl gene/transformation) V. A. LETTS*, L. S. KLIG*, M. BAE-LEEt, G. M. CARMANt, AND S. A. HENRY* *Departments of Genetics and Molecular Biology, Albert Einstein College of Medicine, Bronx, NY 10461; and tDepartment of Food Science, Cook College, New Jersey Agricultural Experimental Station, Rutgers University, New Brunswick, NJ 08903 Communicated by Frank Lilly, August 11, 1983 ABSTRACT The structural gene (CHOI) for phosphatidyl- Mammals, for example, synthesize PtdSer by an exchange re- serine synthase (CDPdiacylglycerol:L-serine O-phosphatidyl- action with PtdEtn (9). However, PtdSer synthase is found in transferase, EC 2.7.8.8) was isolated by genetic complementation E. coli and indeed the structural gene for the E. coli enzyme has in Saccharomyces cerevmae from a bank of yeast genomic DNA been cloned (10). Thus, cloning of the structural gene for the on a chimeric plasmid. The cloned DNA (4.0 kilobases long) was yeast enzyme will permit a detailed comparison of the structure shown to represent a unique sequence in the yeast genome. The and function of prokaryotic and eukaryotic genes and gene DNA sequence on an integrative plasmid was shown to recombine products. The availability of a clone of the CHOI gene will per- into the CHOi locus, confwrming its genetic identity. The chol yeast mit analysis of its regulation at the transcriptional level. Fur- strain transformed with this gene on an autonomously replicating thermore, the cloning of the CHOI gene provides us with the plasmid had significantly increased activity of the regulated mem- the levels of PtdSer synthase in the cell, brane-associated enzyme phosphatidylserine synthase.
    [Show full text]
  • Metabolic Control of Hyaluronan Synthases
    MATBIO-00997; No of Pages 6 Matrix Biology xxx (2013) xxx–xxx Contents lists available at ScienceDirect Matrix Biology journal homepage: www.elsevier.com/locate/matbio Metabolic control of hyaluronan synthases Davide Vigetti, Manuela Viola, Evgenia Karousou, Giancarlo De Luca, Alberto Passi ⁎ Dipartimento di Scienze Chirurgiche e Morfologiche, Università degli Studi dell'Insubria, via J.H. Dunant 5, 21100 Varese, Italy article info abstract Available online xxxx Hyaluronan (HA) is a glycosaminoglycan composed by repeating units of D-glucuronic acid (GlcUA) and N-acetylglucosamine (GlcNAc) that is ubiquitously present in the extracellular matrix (ECM) where it has a Keywords: critical role in the physiology and pathology of several mammalian tissues. HA represents a perfect environment Glycosaminoglycan in which cells can migrate and proliferate. Moreover, several receptors can interact with HA at cellular UDP-GlcUA level triggering multiple signal transduction responses. The control of the HA synthesis is therefore critical UDP-GlcNAc in ECM assembly and cell biology; in this review we address the metabolic regulation of HA synthesis. In AMPK O-GlcNAcylation contrast with other glycosaminoglycans, which are synthesized in the Golgi apparatus, HA is produced at the HBP plasma membrane by HA synthases (HAS1-3), which use cytoplasmic UDP-glucuronic acid and UDP-N- acetylglucosamine as substrates. UDP-GlcUA and UDP-hexosamine availability is critical for the synthesis of GAGs, which is an energy consuming process. AMP activated protein kinase (AMPK), which is considered a sensor of the energy status of the cell and is activated by low ATP:AMP ratio, leads to the inhibition of HA secretion by HAS2 phosphorylation at threonine 110.
    [Show full text]
  • Cellulose Digestion and Metabolism Induced Biocatalytic Transitions in Anaerobic Microbial Ecosystems
    Metabolites 2014, 4, 36-52; doi:10.3390/metabo4010036 OPEN ACCESS metabolites ISSN 2218-1989 www.mdpi.com/journal/metabolites/ Article Cellulose Digestion and Metabolism Induced Biocatalytic Transitions in Anaerobic Microbial Ecosystems Akira Yamazawa 1,2, Tomohiro Iikura 2, Yusuke Morioka 2, Amiu Shino 3, Yoshiyuki Ogata 4, Yasuhiro Date 2,3 and Jun Kikuchi 2,3,5,6,* 1 Research Planning and Management Group, Kajima Technical Research Institute, Kajima Corporation, 2-19-1 Tobitakyu, Chofu, Tokyo 182-0036, Japan; E-Mail: [email protected] 2 Graduate School of Medical Life Science, Yokohama City University, 1-7-29 Suehirocho, Tsurumi-ku, Yokohama, Kanagawa 230-0045, Japan; E-Mails: [email protected] (T.I.); [email protected] (Y.M.); [email protected] (Y.D.) 3 RIKEN Center for Sustainable Resource Science, 1-7-22 Suehirocho, Tsurumi-ku, Yokohama, Kanagawa 230-0045, Japan; E-Mail: [email protected] (A.S.) 4 Graduate School of Life and Environmental Sciences, Osaka Prefecture University, Osaka 599-8531, Japan; E-Mail: [email protected] 5 Graduate School of Bioagricultural Sciences, Nagoya University, 1 Furo-cho, Chikusa-ku, Nagoya, Aichi 464-0810, Japan 6 RIKEN Biomass Engineering Program, 2-1 Hirosawa, Wako 351-0198, Japan * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +81-45-503-9439; Fax: +81-45-503-9489. Received: 13 September 2013; in revised form: 18 December 2013 / Accepted: 20 December 2013 / Published: 31 December 2013 Abstract: Anaerobic digestion of highly polymerized biomass by microbial communities present in diverse microbial ecosystems is an indispensable metabolic process for biogeochemical cycling in nature and for industrial activities required to maintain a sustainable society.
    [Show full text]
  • Assembly of the Membrane Domain of ATP Synthase in Human Mitochondria
    Assembly of the membrane domain of ATP synthase in human mitochondria Jiuya Hea,1, Holly C. Forda,1, Joe Carrolla, Corsten Douglasa, Evvia Gonzalesa, Shujing Dinga, Ian M. Fearnleya, and John E. Walkera,2 aMedical Research Council Mitochondrial Biology Unit, University of Cambridge, Cambridge Biomedical Campus, Cambridge CB2 0XY, United Kingdom Contributed by John E. Walker, January 16, 2018 (sent for review December 20, 2017; reviewed by Ulrich Brandt and Nikolaus Pfanner) The ATP synthase in human mitochondria is a membrane-bound mitochondria in human ρ0 cells lack organellar DNA and contain assembly of 29 proteins of 18 kinds. All but two membrane another incomplete ATP synthase, necessarily with no ATP6 or components are encoded in nuclear genes, synthesized on cyto- ATP8 (7, 9). These incomplete vestigial ATP synthases provide plasmic ribosomes, and imported into the matrix of the organelle, insight into the pathway of assembly of the complete enzyme. where they are assembled into the complex with ATP6 and ATP8, Here we investigated the effects of the selective removal of su- the products of overlapping genes in mitochondrial DNA. Disrup- pernumerary membrane subunits e, f, g, DAPIT, and 6.8PL on tion of individual human genes for the nuclear-encoded subunits assembly of human ATP synthase. in the membrane portion of the enzyme leads to the formation of intermediate vestigial ATPase complexes that provide a descrip- Results tion of the pathway of assembly of the membrane domain. The Human Cells Lacking Supernumerary Subunits. The human genes key intermediate complex consists of the F1-c8 complex inhibited ATP5I, ATP5J2, ATP5L, USMG5, and C14orf2 (SI Appendix, Fig.
    [Show full text]
  • Bacterial Cellulose - Properties and Its Potential Application (Bakteria Selulosa - Sifat Dan Keupayaan Aplikasi)
    Sains Malaysiana 50(2)(2021): 493-505 http://dx.doi.org/10.17576/jsm-2021-5002-20 Bacterial Cellulose - Properties and Its Potential Application (Bakteria Selulosa - Sifat dan Keupayaan Aplikasi) IZABELA BETLEJ, SARANI ZAKARIA, KRZYSZTOF J. KRAJEWSKI & PIOTR BORUSZEWSKI* ABSTRACT This review paper is related to the utilization on bacterial cellulose in many applications. The polymer produced from bacterial cellulose possessed a very good physical and mechanical properties, such as high tensile strength, elasticity, absorbency. The polymer from bacterial cellulose has a significantly higher degree of polymerization and crystallinity compared to those derived from plant. The collection of selected literature review shown that bacterial cellulose produced are in the form pure cellulose and can be used in many of applications. These include application in various industries and sectors of the economy, from medicine to paper or electronic industry. Keywords: Acetobacter xylinum; biocomposites; culturing; properties of bacterial cellulose ABSTRAK Ulasan kepustakaan ini adalah mengenai bakteria selulosa yang digunakan dalam banyak aplikasi. Bahan polimer yang terhasil daripada bakteria selulosa mempunyai sifat fizikal dan mekanikal yang sangat baik seperti sifat kekuatan regangan, kelenturan dan serapan. Bahan polimer terhasil daripada selulosa bakteria mempunyai darjah pempolimeran dan kehabluran yang tinggi berbanding daripada sumber tumbuhan. Suntingan kajian daripada beberapa koleksi ulasan kepustakaan menunjukkan bakteria selulosa terhasil adalah selulosa tulen yang boleh digunakan untuk banyak kegunaan. Antaranya adalah untuk pelbagai industri dan sektor ekonomi seperti perubatan atau industri elektronik. Kata kunci: Acetobacter xylinum; komposit-bio; pengkulturan; sifat bakteria selulosa INTRODUCTION Yamada et al. 2012). The first reports on the synthesis of Cellulose is the most common polymer found in nature.
    [Show full text]
  • 1/05661 1 Al
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date _ . ... - 12 May 2011 (12.05.2011) W 2 11/05661 1 Al (51) International Patent Classification: (81) Designated States (unless otherwise indicated, for every C12Q 1/00 (2006.0 1) C12Q 1/48 (2006.0 1) kind of national protection available): AE, AG, AL, AM, C12Q 1/42 (2006.01) AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, (21) Number: International Application DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, PCT/US20 10/054171 HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, (22) International Filing Date: KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, 26 October 2010 (26.10.2010) ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PE, PG, PH, PL, PT, RO, RS, RU, SC, SD, (25) Filing Language: English SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, (26) Publication Language: English TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (30) Priority Data: (84) Designated States (unless otherwise indicated, for every 61/255,068 26 October 2009 (26.10.2009) US kind of regional protection available): ARIPO (BW, GH, GM, KE, LR, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, (71) Applicant (for all designated States except US): ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, TJ, MYREXIS, INC.
    [Show full text]