DOCSLIB.ORG

Carbohydrate Metabolism

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Carbohydrate Metabolism Carbohydrate Metabolism Carbohydrates are the major source of energy for all living beings. Only green plants have the capability of carbon assimilation from the atmosphere through photosynthesis. The different types of carbohydrates present in the plants are: Monosaccharides Triose-D-glyceraldehyde, Dihydroxyacetone Tetrose- erythrose Pentose- ribose, deoxyribose, xylose, arabinose, ribulose, xylose Hexoses-glucose, fructose, mannose, galactose Heptoses-sedoheptulose Oligosaccharides Diasaccharides- maltose, cellobiose, sucrose Trisaccharides- Raffinose, gentianose Polysaccharides Structural polysaccharides- cellulose, hemicelluloses (xylans, mannans, glucomannans, galactans and arbinoglactans), pectins (galactans,arabinan, galacturonan) and chitin Storage polysaccharides-Starch (amylose and amylopectin), inulin Carbohydrates have several roles in living organisms beside energy transportation, structural, and storage. In plants more than 30% of carbohydrates are used in cell wall synthesis. Carbohydrates are actively involved in fertilization, immune system as well as protecting membranes of the cell. Metabolite Pool and exchange Metabolism is based on enzyme-catalyzed reactions or pathways which do not operate in isolation. Many metabolic pathways are interconnected and share intermediates. These intermediates are maintained at equilibrium with each other by reversible enzymatic reactions. In a cell there are ‘pools’ of different metabolites from where these can be withdrawn or added whenever required thus maintaining almost constant availability of these metabolite. “Metabolite pool” occurs in the subcellular compartments, such as plastid and cytosol. Interchange of the metabolites occurs through cell membrane. Fig. Carbohydrate metabolism: An overview of the major pathways and organelles involved. TPT triose phosphate transporter, GPT glucose phosphate transporter Fig: During daytime, occurrence of photosynthesis in chloroplasts adds to hexose monophosphate pool which is used for synthesis of transitory starch. During nighttime, carbon skeleton stored as starch is mobilized and translocated out of chloroplasts to other parts of plants, either to be used as the substrate for respiration or for storage in non-green plastids of storage organs or is translocated to be used as the source for respiration. Intercellular transport occurs in the form of sucrose Three different pools of carbohydrates metabolites are Hexose monophosphate pool-Hexose monophosphate pool has hexose monophosphate, glucose 1-phosphate, glucose 6-phosphate and fructose 6-phosphate. All these are interconvertible, and the enzymes required are phosphoglucomutase, glucose 6-phosphate isomerase Triose phosphate pool- this consist of interconvertible forms of triose, glyceraldehyde 3- phosphate and dihydroxyacetone phosphate, which are catalyzed by triose phosphate isomerase. Pentose phosphate pool- this include ribose 5-phosphate, ribulose 5-phosphate and xylulose-5-phosphate and the enzyme involved in interconversion is transketolase. Fig. Hexose phosphate, triose phosphate, and pentose phosphate pools and exchange of intermediates in between these pools (both in cytosol and in plastid) Carbon compounds are added in these pools which are produced during photosynthesis or other metabolic pathways. Gluconeogenesis is also responsible for adding metabolite in these pools, Fig: Metabolite pools involved in carbohydrate metabolism. Duplicate pathways are present in cytosol, chloroplast, and non-green plastid Transport of metabolites Only some metabolite whose transporters are present on the membrane can be translocated. Two main transporters are Triose phosphate translocator (TPT): present on inner plastid membrane, antiporter type, responsible for exchange of triose phosphate (formed by calvin cycle) with inorganic phosphate between plastid and cytosol. If inorganic phosphate is absent then no exchange takes place. This can transport glucose and maltose but phosphorylated form of glucose and maltose cannot be translocated. Glucose 6-phosphate/phosphate translocator (GPT): is present and is localized in the inner envelop of the plastid. Transport of glucose 6-phosphate in exchange of inorganic phosphate takes place through GPT. It can also bring about exchange of triose phosphate and xylulose 5-phosphate with cytosolic inorganic phosphate. There is a direct correlation in between the metabolite pools of cytosol and plastids, which involves lot of exchange of sugars between these compartments. Since carbohydrates in plants are primarily transported in the form of sucrose and are stored as starch, study involving metabolism of sucrose and starch, both their synthesis and catabolism, is significant. Sucrose Metabolism Sucrose is the major form of carbohydrates which is translocated from source to sink in sieve elements of plants. Characteristic features of sucrose It is the most ubiquitous and abundant disaccharide (α-D-glucopyranosyl-β-D- fructofuranoside) in plant tissues. Two monosaccharides (α-D-glucopyranose and β-D-fructofuranose) by joining C-1 of α- D-glucose to C-2 of β-D-fructose by 1α→2β glycosidic bond forms sucrose. It is a non reducing sugar since glycosidic bond joins the carbonyl carbons of glucose and fructose. Fructose protects potentially reactive groups from oxidation and from non-specific enzyme attack making it structurally stable. As it stable, highly soluble, and relatively inert molecule, it becomes quite suitable for transport (other forms of carbohydrates such as raffinose, verbascose, stachyose (in members of family Cucurbitaceae) and sorbitol (in many plants of family Rosaceae) are also translocated). In some plants, e.g., beetroot (Beta vulgaris), sugarcane (Saccharum sp.), and carrot (Daucus carota), sucrose can also be stored. It only has osmotic effect in a cell and does not affect other biological processes. Biosynthesis Sucrose synthesis occurs only in plants and bacteria. In plants, sucrose is synthesized mainly in cytosol of photosynthetic tissues or in germinating seeds. In mesophyll cells, source for triose phosphates is the Calvin cycle which occurs in chloroplasts. Triose phosphate is precursor of sucrose synthesis Fig. Synthesis of sucrose in a mesophyll cell. Glucose is activated by UDP to form UDP- glucose. Activated glucose is transferred to fructose 6-phosphate resulting in synthesis of sucrose phosphate. The two reactions catalyzed by fructose 1,6-biphosphatase and sucrose- phosphate phosphatase are irreversible. These two reactions make sucrose synthesis irreversible Fig. Synthesis of sucrose: Activation of glucose occurs by transferring glucose molecules from glucose 1-phosphate to UTP resulting in synthesis of UDP-glucose. Reaction is catalyzed by UDP-glucose pyrophosphorylase. The reaction is coupled with release of PPi (pyrophosphate) and becomes irreversible due to hydrolysis of sucrose-phosphate to sucrose. Activated glucose is transferred from UDP-glucose to fructose 6-phosphate resulting in synthesis of sucrose 6-phosphate (phosphate is linked to 6-C of fructose) in a reversible reaction catalyzed by the enzyme sucrose-phosphate synthase. Sucrose-phosphate phosphatase catalyzes hydrolysis of sucrose-phosphate resulting in formation of sucrose and release in Pi. This is an exothermic reaction coupled with °′ −1 release of energy (ΔG = −18.4 kJ.mol ). Release of Pi is necessary for sucrose biosynthesis because it makes the reactions irreversible. Additionally, recycling of Pi to chloroplast is essential. Both allosteric modulation and covalent modulation of the enzyme protein due to phosphorylation regulates SPS activity. SPS is allosterically modulated by glucose 6-phosphate and Pi. Glucose 6- phosphate activates the enzyme, while its activity is inhibited by Pi. An increase in cytosolic hexose monophosphates is coupled with reduction in Pi, thus activating SPS. Sucrose Catabolism Sucrose is the major form of carbohydrate that is transported in plants from source (e.g., photosynthetic tissues) to sinks (non-photosynthetic tissues). In a cell, sucrose is generally stored in vacuoles. Larger size of vacuoles is advantageous for storage. Whenever cell requires more energy it withdraws sucrose from vacuole. Sucrose may be transported in apoplastic or symplastic way, depending upon the type of the plant or the tissues involved. Enzymes involved in sugar catabolism are invertase and sucrose synthase (SS). Sucrose synthase catalyzes reversible reaction and thus is responsible for synthesis of sucrose also. SS is more significant during catabolism of sucrose, either when it is used as an energy source or is metabolized for starch biosynthesis. Invertase is hydrolytic enzyme, which hydrolyzes sucrose to glucose and fructose. Different isoforms of invertases Apoplastic Vacuolar Cytosolic Acidic pH-5 Acidic pH-5 Alkaline pH-7.5 Present in apoplast Conc. is high where sucrose is either consumed as an hexoses are energy source after being hydrolyzed accumulated e.g.fruits, by cytosolic invertase or is meristems transported across tonoplast to be stored in the vacuole. It has significant cell expansion, sugar Cytosolic invertases are important role when sucrose storage, and in for plant growth, especially roots. transport is regulation of cold- apoplastic. induced sweetening. Sucrose synthase Invertase It utilizes UDP for catalyzing sucrose Hydrolysis of sucrose by invertase yields glucose breakdown, releasing UDP-glucose and and fructose and then phosphorylated by ATP fructose. UDP-glucose is converted to glucose 1-phosphate
Load more

Recommended publications
  • METACYC ID Description A0AR23 GO:0004842 (Ubiquitin-Protein Ligase
    Electronic Supplementary Material (ESI) for Integrative Biology This journal is © The Royal Society of Chemistry 2012 Heat Stress Responsive Zostera marina Genes, Southern Population (α=0.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • The Analysis for Alteration in Starch Biosynthesis Metabolism in a Japonica Rice Grain Mutant Which Does Not Accumulate Starch
    MOJ Proteomics & Bioinformatics Research Article Open Access The analysis for alteration in starch biosynthesis metabolism in a japonica rice grain mutant which does not accumulate starch Abstract Volume 7 Issue 5 - 2018 Rice grain‒filling is an important agronomic trait that contributes greatly to grain Weidong Xu,1,2 Chunhai Shi,1 Zhenzhen weight. A grain mutant from the japonica cultivar Nipponbare by mutagenesis with 1 1 3 ethyl methane sulfonate (EMS), which had no accumulation of starch granules in Cao, Fangmin Cheng, Jianguo Wu 1Department of Agronomy, Zhejiang University, China endosperm with a transparent liquid during grain filling stage, was used to analyze 2Jiaxing Academy of Agricultural Sciences Institute, China the caryopsis development and starch biosynthesis metabolism in present study. 3Department of Horticulture, Zhejiang A&F University, China Measurement of soluble substances in the liquid of developing endosperm showed that there was remarkably higher soluble sugar content in this no starch mutant. Correspondence: Chunhai Shi, Agronomy Department, Semi‒quantitative reverse transcription‒PCR (RT‒PCR) analysis of the starch‒ College of Agriculture and Biotechnology, Zhejiang University, synthesizing genes revealed that soluble starch synthase1 (SSS1) gene could be Yuhangtang Road 866, Hangzhou 310058, PR. China, Tel normally expressed in the mutant. Substantially lower expressions of starch branching +86 57188982691, Email [email protected] enzyme1 (SBE1), isoamylase1 (ISA1) and pullulanase (PUL) were detected in the no starch mutant compared with the wild type, whereas the expression of ADP‒glucose Received:‒ September 19, 2018 | Published: October 31, 2018 pyrophosphorylase large subunit 1 (AGPL1) and ADP‒glucose pyrophosphorylase small subunit 1 (AGPS1) were visibly increased.
    [Show full text]
  • Mslsc2001c04
    Metabolism MSLSC2001C04 Course Instructor Dr. Gautam Kumar Dr.Gautam Kr. Dept. of Life Sc. 1 Dr.Gautam Kr. Dept. of Life Sc. 2 Dr.Gautam Kr. Dept. of Life Sc. 3 Dr.Gautam Kr. Dept. of Life Sc. 4 • Cellulose is a major constituent of plant cell walls, providing strength and rigidity • Preventing the swelling of the cell and rupture of the plasma membrane • Plants synthesize more than 1011 metric tons of cellulose, making this simple polymer one of the most abundant compounds in the biosphere. • cellulose must be synthesized from intracellular precursors but deposited and assembled outside the plasma membrane. Dr.Gautam Kr. Dept. of Life Sc. 5 • Terminal complexes, also called rosettes, to be composed of six large particles arranged in a regular hexagon. • The outside surface of the plant plasma membrane in a freeze-fractured sample, viewed here with electron microscopy • Enzyme complex includes a catalytic subunit with eight transmembrane segments and several other subunits that are presumed to act in threading cellulose chains through the catalytic site and out of the cell, and in the crystallization of 36 cellulose strands into the paracrystalline microfibrils Rosettes Dr.Gautam Kr. Dept. of Life Sc. 6 • The complex enzymatic machinery that assembles cellulose chains spans the plasma membrane • UDP-glucose, in the cytosol and another part extending to the outside, responsible for elongating and crystallizing cellulose molecules in the extracellular space. • UDP-glucose used for cellulose synthesis is generated from sucrose produced during photosynthesis, by the reaction catalysed by sucrose synthase • Cellulose synthase spans the plasma Model for the structure of membrane and uses cytosolic UDP-glucose as Cellulose synthase.
    [Show full text]
  • Supplementary Materials
    1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No.
    [Show full text]
  • A Label-Free Cellular Proteomics Approach to Decipher the Antifungal Action of Dimiq, a Potent Indolo[2,3- B]Quinoline Agent, Against Candida Albicans Biofilms
    A Label-Free Cellular Proteomics Approach to Decipher the Antifungal Action of DiMIQ, a Potent Indolo[2,3- b]Quinoline Agent, against Candida albicans Biofilms Robert Zarnowski 1,2*, Anna Jaromin 3*, Agnieszka Zagórska 4, Eddie G. Dominguez 1,2, Katarzyna Sidoryk 5, Jerzy Gubernator 3 and David R. Andes 1,2 1 Department of Medicine, School of Medicine & Public Health, University of Wisconsin-Madison, Madison, WI 53706, USA; [email protected] (E.G.D.); [email protected] (D.R.A.) 2 Department of Medical Microbiology, School of Medicine & Public Health, University of Wisconsin-Madison, Madison, WI 53706, USA 3 Department of Lipids and Liposomes, Faculty of Biotechnology, University of Wroclaw, 50-383 Wroclaw, Poland; [email protected] 4 Department of Medicinal Chemistry, Jagiellonian University Medical College, 30-688 Cracow, Poland; [email protected] 5 Department of Pharmacy, Cosmetic Chemicals and Biotechnology, Team of Chemistry, Łukasiewicz Research Network-Industrial Chemistry Institute, 01-793 Warsaw, Poland; [email protected] * Correspondence: [email protected] (R.Z.); [email protected] (A.J.); Tel.: +1-608-265-8578 (R.Z.); +48-71-3756203 (A.J.) Label-Free Cellular Proteomics of Candida albicans biofilms treated with DiMIQ Identified Proteins Accession # Alternate ID Gene names (ORF ) WT DIMIQ Z SCORE Proteins induced by DiMIQ Arginase (EC 3.5.3.1) A0A1D8PP00 CAR1 CAALFM_C504490CA 0.000 6.648 drug induced Glucan 1,3-beta-glucosidase BGL2 (EC 3.2.1.58) (Exo-1Q5AMT2 BGL2 CAALFM_C402250CA
    [Show full text]
  • Flavonoid Glucodiversification with Engineered Sucrose-Active Enzymes Yannick Malbert
    Flavonoid glucodiversification with engineered sucrose-active enzymes Yannick Malbert To cite this version: Yannick Malbert. Flavonoid glucodiversification with engineered sucrose-active enzymes. Biotechnol- ogy. INSA de Toulouse, 2014. English. NNT : 2014ISAT0038. tel-01219406 HAL Id: tel-01219406 https://tel.archives-ouvertes.fr/tel-01219406 Submitted on 22 Oct 2015 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Last name: MALBERT First name: Yannick Title: Flavonoid glucodiversification with engineered sucrose-active enzymes Speciality: Ecological, Veterinary, Agronomic Sciences and Bioengineering, Field: Enzymatic and microbial engineering. Year: 2014 Number of pages: 257 Flavonoid glycosides are natural plant secondary metabolites exhibiting many physicochemical and biological properties. Glycosylation usually improves flavonoid solubility but access to flavonoid glycosides is limited by their low production levels in plants. In this thesis work, the focus was placed on the development of new glucodiversification routes of natural flavonoids by taking advantage of protein engineering. Two biochemically and structurally characterized recombinant transglucosylases, the amylosucrase from Neisseria polysaccharea and the α-(1→2) branching sucrase, a truncated form of the dextransucrase from L. Mesenteroides NRRL B-1299, were selected to attempt glucosylation of different flavonoids, synthesize new α-glucoside derivatives with original patterns of glucosylation and hopefully improved their water-solubility.
    [Show full text]
  • Global Transcriptome Analysis and Identification of Genes Involved In
    www.nature.com/scientificreports OPEN Global transcriptome analysis and identification of genes involved in nutrients accumulation during Received: 19 December 2016 Accepted: 31 August 2017 seed development of rice tartary Published: xx xx xxxx buckwheat (Fagopyrum Tararicum) Juan Huang1, Jiao Deng1, Taoxiong Shi1, Qijiao Chen1, Chenggang Liang1, Ziye Meng1, Liwei Zhu1, Yan Wang1, Fengli Zhao2, Shizhou Yu3 & Qingfu Chen1 Tartary buckwheat seeds are rich in various nutrients, such as storage proteins, starch, and flavonoids. To get a good knowledge of the transcriptome dynamics and gene regulatory mechanism during the process of seed development and nutrients accumulation, we performed a comprehensive global transcriptome analysis using rice tartary buckwheat seeds at different development stages, namely pre-filling stage, filling stage, and mature stage. 24 819 expressed genes, including 108 specifically expressed genes, and 11 676 differentially expressed genes (DEGs) were identified. qRT-PCR analysis was performed on 34 DEGs to validate the transcriptome data, and a good consistence was obtained. Based on their expression patterns, the identified DEGs were classified to eight clusters, and the enriched GO items in each cluster were analyzed. In addition, 633 DEGs related to plant hormones were identified. Furthermore, genes in the biosynthesis pathway of nutrients accumulation were analyzed, including 10, 20, and 23 DEGs corresponding to the biosynthesis of seed storage proteins, flavonoids, and starch, respectively. This is the first transcriptome analysis during seed development of tartary buckwheat. It would provide us a comprehensive understanding of the complex transcriptome dynamics during seed development and gene regulatory mechanism of nutrients accumulation. Seed is the primary storage organ in plants for storing nutrients such as starch, lipids, and proteins1.
    [Show full text]
  • Carbohydrates: Structure and Function
    CARBOHYDRATES: STRUCTURE AND FUNCTION Color index: . Very important . Extra Information. “ STOP SAYING I WISH, START SAYING I WILL” 435 Biochemistry Team *هذا العمل ﻻ يغني عن المصدر المذاكرة الرئيسي • The structure of carbohydrates of physiological significance. • The main role of carbohydrates in providing and storing of energy. • The structure and function of glycosaminoglycans. OBJECTIVES: 435 Biochemistry Team extra information that might help you 1-synovial fluid: - It is a viscous, non-Newtonian fluid found in the cavities of synovial joints. - the principal role of synovial fluid is to reduce friction between the articular cartilage of synovial joints during movement O 2- aldehyde = terminal carbonyl group (RCHO) R H 3- ketone = carbonyl group within (inside) the compound (RCOR’) 435 Biochemistry Team the most abundant organic molecules in nature (CH2O)n Carbohydrates Formula *hydrate of carbon* Function 1-provides important part of energy Diseases caused by disorders of in diet . 2-Acts as the storage form of energy carbohydrate metabolism in the body 3-structural component of cell membrane. 1-Diabetesmellitus. 2-Galactosemia. 3-Glycogen storage disease. 4-Lactoseintolerance. 435 Biochemistry Team Classification of carbohydrates monosaccharides disaccharides oligosaccharides polysaccharides simple sugar Two monosaccharides 3-10 sugar units units more than 10 sugar units Joining of 2 monosaccharides No. of carbon atoms Type of carbonyl by O-glycosidic bond: they contain group they contain - Maltose (α-1, 4)= glucose + glucose -Sucrose (α-1,2)= glucose + fructose - Lactose (β-1,4)= glucose+ galactose Homopolysaccharides Heteropolysaccharides Ketone or aldehyde Homo= same type of sugars Hetero= different types Ketose aldose of sugars branched unBranched -Example: - Contains: - Contains: Examples: aldehyde group glycosaminoglycans ketone group.
    [Show full text]
  • Generate Metabolic Map Poster
    Authors: Pallavi Subhraveti Anamika Kothari Quang Ong Ron Caspi An online version of this diagram is available at BioCyc.org. Biosynthetic pathways are positioned in the left of the cytoplasm, degradative pathways on the right, and reactions not assigned to any pathway are in the far right of the cytoplasm. Transporters and membrane proteins are shown on the membrane. Ingrid Keseler Peter D Karp Periplasmic (where appropriate) and extracellular reactions and proteins may also be shown. Pathways are colored according to their cellular function. Csac1394711Cyc: Candidatus Saccharibacteria bacterium RAAC3_TM7_1 Cellular Overview Connections between pathways are omitted for legibility. Tim Holland TM7C00001G0420 TM7C00001G0109 TM7C00001G0953 TM7C00001G0666 TM7C00001G0203 TM7C00001G0886 TM7C00001G0113 TM7C00001G0247 TM7C00001G0735 TM7C00001G0001 TM7C00001G0509 TM7C00001G0264 TM7C00001G0176 TM7C00001G0342 TM7C00001G0055 TM7C00001G0120 TM7C00001G0642 TM7C00001G0837 TM7C00001G0101 TM7C00001G0559 TM7C00001G0810 TM7C00001G0656 TM7C00001G0180 TM7C00001G0742 TM7C00001G0128 TM7C00001G0831 TM7C00001G0517 TM7C00001G0238 TM7C00001G0079 TM7C00001G0111 TM7C00001G0961 TM7C00001G0743 TM7C00001G0893 TM7C00001G0630 TM7C00001G0360 TM7C00001G0616 TM7C00001G0162 TM7C00001G0006 TM7C00001G0365 TM7C00001G0596 TM7C00001G0141 TM7C00001G0689 TM7C00001G0273 TM7C00001G0126 TM7C00001G0717 TM7C00001G0110 TM7C00001G0278 TM7C00001G0734 TM7C00001G0444 TM7C00001G0019 TM7C00001G0381 TM7C00001G0874 TM7C00001G0318 TM7C00001G0451 TM7C00001G0306 TM7C00001G0928 TM7C00001G0622 TM7C00001G0150 TM7C00001G0439 TM7C00001G0233 TM7C00001G0462 TM7C00001G0421 TM7C00001G0220 TM7C00001G0276 TM7C00001G0054 TM7C00001G0419 TM7C00001G0252 TM7C00001G0592 TM7C00001G0628 TM7C00001G0200 TM7C00001G0709 TM7C00001G0025 TM7C00001G0846 TM7C00001G0163 TM7C00001G0142 TM7C00001G0895 TM7C00001G0930 Detoxification Carbohydrate Biosynthesis DNA combined with a 2'- di-trans,octa-cis a 2'- Amino Acid Degradation an L-methionyl- TM7C00001G0190 superpathway of pyrimidine deoxyribonucleotides de novo biosynthesis (E.
    [Show full text]
  • Structural Features
    1 Structural features As defined by the International Union of Pure and Applied Chemistry gly- cans are structures of multiple monosaccharides linked through glycosidic bonds. The terms sugar and saccharide are synonyms, depending on your preference for Arabic (“sukkar”) or Greek (“sakkēaron”). Saccharide is the root for monosaccha- rides (a single carbohydrate unit), oligosaccharides (3 to 20 units) and polysac- charides (large polymers of more than 20 units). Carbohydrates follow the basic formula (CH2O)N>2. Glycolaldehyde (CH2O)2 would be the simplest member of the family if molecules of two C-atoms were not excluded from the biochemical repertoire. Glycolaldehyde has been found in space in cosmic dust surrounding star-forming regions of the Milky Way galaxy. Glycolaldehyde is a precursor of several organic molecules. For example, reaction of glycolaldehyde with propenal, another interstellar molecule, yields ribose, a carbohydrate that is also the backbone of nucleic acids. Figure 1 – The Rho Ophiuchi star-forming region is shown in infrared light as captured by NASA’s Wide-field Infrared Explorer. Glycolaldehyde was identified in the gas surrounding the star-forming region IRAS 16293-2422, which is is the red object in the centre of the marked square. This star-forming region is 26’000 light-years away from Earth. Glycolaldehyde can react with propenal to form ribose. Image source: www.eso.org/public/images/eso1234a/ Beginning the count at three carbon atoms, glyceraldehyde and dihydroxy- acetone share the common chemical formula (CH2O)3 and represent the smallest carbohydrates. As their names imply, glyceraldehyde has an aldehyde group (at C1) and dihydoxyacetone a carbonyl group (at C2).
    [Show full text]
  • Supplementary Information
    Supplementary Information Table S1. Pathway analysis of the 1246 dwf1-specific differentially expressed genes. Fold Change Fold Change Fold Change Gene ID Description (dwf1/WT) (XL-5/WT) (XL-6/WT) Carbohydrate Metabolism Glycolysis/Gluconeogenesis POPTR_0008s11770.1 Glucose-6-phosphate isomerase −1.7382 0.512146 0.168727 POPTR_0001s47210.1 Fructose-bisphosphate aldolase, class I 1.599591 0.044778 0.18237 POPTR_0011s05190.3 Probable phosphoglycerate mutase −2.11069 −0.34562 −0.9738 POPTR_0012s01140.1 Pyruvate kinase −1.25054 0.074697 −0.16016 POPTR_0016s12760.1 Pyruvate decarboxylase 2.664081 0.021062 0.371969 POPTR_0012s08010.1 Aldehyde dehydrogenase (NAD+) −1.41556 0.479957 −0.21366 POPTR_0014s13710.1 Acetyl-CoA synthetase −1.337 0.154552 −0.26532 POPTR_0017s11660.1 Aldose 1-epimerase 2.770518 0.016874 0.73016 POPTR_0010s11970.1 Phosphoglucomutase −1.25266 −0.35581 0.074064 POPTR_0012s14030.1 Phosphoglucomutase −1.15872 −0.68468 −0.93596 POPTR_0002s10850.1 Phosphoenolpyruvate carboxykinase (ATP) 1.489119 0.967284 0.821559 Citrate cycle (TCA cycle) 2-Oxoglutarate dehydrogenase E2 component POPTR_0014s15280.1 −1.63733 0.076435 0.170827 (dihydrolipoamide succinyltransferase) POPTR_0002s26120.1 Succinyl-CoA synthetase β subunit −1.29244 −0.38517 −0.3497 POPTR_0007s12750.1 Succinate dehydrogenase (ubiquinone) flavoprotein subunit −1.83751 0.519356 0.309149 POPTR_0002s10850.1 Phosphoenolpyruvate carboxykinase (ATP) 1.489119 0.967284 0.821559 Pentose phosphate pathway POPTR_0008s11770.1 Glucose-6-phosphate isomerase −1.7382 0.512146 0.168727 POPTR_0013s00660.1 Glucose-6-phosphate 1-dehydrogenase −1.26949 −0.18314 0.374822 POPTR_0015s00960.1 6-Phosphogluconolactonase 2.022223 0.168877 0.971431 POPTR_0010s11970.1 Phosphoglucomutase −1.25266 −0.35581 0.074064 POPTR_0012s14030.1 Phosphoglucomutase −1.15872 −0.68468 −0.93596 POPTR_0001s47210.1 Fructose-bisphosphate aldolase, class I 1.599591 0.044778 0.18237 S2 Table S1.
    [Show full text]