per cutting was observed with the application of 2000 ppm IBA References folIorved treatment with 1000 ppm IBA (2.87 cm) and minimum AYDEKSOY,V L and MCLFAY.R A Design of Experir in untreated control 12.80 cm) cuttings !Figure 2c). Deckker Inc Nea York 1974 I - DADBAL,V S and JAXI~L fungi In weather~ngof teak fruits Ind For, 114 328-9 The results clearly show that vertically split cutting of juve- GCIYT~,B S and KCMAREstzmatzon of potentla1 germxi; nile 1-year-old seedlings of teak root easily. It is further evident fruits from twenty three Indian sources by cutting test 1 chat treatment with IBA, especially with 2005 ppm concentra- 808-813 119761 - HU~EK,A and MISIIR~,V K Effect of I on vegetatir~ep~opagatron of Vrrex negitndo L through lee tion, the percentage of rooting and sprouting, as well as growth t~ngafrom hedged shoots dunng rarny season Ind Perf, 4 of roots and shoots can be increased in teak cuttings. Although, (2001 - HUFEX,A and PAL,M Clonal propagat~onof Tec promotion of rooting by IBA in teak and other species has been (Llnn f 1 effects of IBA and leaf area on carbohydrate well known (Nmon, 1970; HUSENand PAL, 2001; HUSENand adventitious root regeneration on branch cuttlngs Ann 88-95 i20Oll - Hcsm, A Adventitious root formations MISHRA,2051; HCSEN,2002), no published information avail- tings of Datura zrznoxza Mill by IBA under Intermittent mi: able on the rooting response of vertical split teak cuttings. 10 (21 280-283 (2002) - HUSEN,A Physiological effects The bark portion of the wound healed up within 45 days and rnones and m~neralnutrients on adventitious root format10 propagation of Tectona grandrs Linn F , Ph D Thesis subm the entire wound zone of split cutting was overgrown by cambi- est Research Institute. Dehra Dun, India (20021 - HLSEX, um and healed in about five months after the cuttings were out M Effect of serial bud grafting and etlolation on rejuvenati planted. Meanwhile, the shoot emerging from the axillary bud lng cuttings of mature trees of Tectona grandls Linn f Slit 84-88 120031 - I~DIR~,E P, CHAL'DBASHA, S and CHI had already established itself on the main shoot and, further (2) Effect of seed size grading on the germtnatlon and growth c growth of the propagules was determined by this shoot only. tona grand~r)seedling J of Trop For Sc , 12 (1) 21-27 Thus, the growth and wood quality of the trees propagated by KAOSA-ARD,A Teak (Tectona grandzs Llnn f ). Domest] split cutting method would be comparable to normal cuttings. Breeding UNDPFAO, LQS Banos, Phtlllppines RASi91i00. MASCAREK~AS,A. F, KUNDURILXR,S V and KHUPSE,S S Mi( Hence, such cuttings can be successfully used for rapid mass tion of teak In. Mlcropropagat~onof woody Plants, M R 1 production of juvenile clonal planting material of teak. Kluwer Acadernlc Publishers, Netherlands, pp 247-262 Km~.4,K K Investlgatlons on the use of Auxins in Vegetal ductlon of Forest Plants Final Report of PL 480 Research 7FS-11 t FG In 255) pp 1-215 (1970). - TEWARI,D hT A mor This work was supported by the World Bank FREE Project and Indian Teak {Tectona grandts Llnn f) Internat~onalBook Distribut Council of Forestry Research and Education, Dehra Dun, India. Dun (Ind~a),pp 479 11992)

Amplification of North American Red Oak Microsatellite Markers in European White Oaks and Chinese Chestnut

By P. R. ALDRICH'~~',M. JAG TAP^', C. H. MICHLER~)and J. ROMERO-SE\~ERSON~'

(Received gthJuly 2003)

Summary widely applicable to genetic studies of Quercus and other mem- We examined the cross-species amplification success of thirty bers of the Fagaceae. microsatellite markers developed from North American north- Key words: Castartea nzollissima, genetic diversity, marker, Quercus ern red oak (Quercus rubra) in other members of the family petraea, Q. rubra, Q. robur, SSR, transferability. Fagaceae. Sixteen of these markers are newly developed and we report primer sequences and amplification conditions here. Twelve of the thirty (40.0%) red oak markers amplified and urere polymorphic in the European white oaks Quercus petraea The family Fagaceae includes ecologically and economically and Quercus robur. Five of the thirty loci (16.7%) also amplified important tree taxa such as oak (Quercus), chestnut (Cas- and four were polymorphic in the phylogenetically distant Chi- tanea), and beech fFagus).Until very recently, most microsatel- nese chestnut tcastanea mollissima). These markers should be lite marker development in the Fagaceae has focused on two clades within the genus Quercus: the white oak group sub- genus Quercus section Quercus {[Quercus petraea (Matt.) "USDA Forest Semce, Sorth Central Research Station, Hardwood Liebl.; 17 microsatellite loci; STEINKELLNERet al., 1997a1, Tree Improvement and Regeneratton Center, Purdue Unlverslty [Qriereus robur L.; 32 loci; KAMPFER et al., 19981, and [Quercus Department of Forestry and Katural Resources, West Lafayette, IS 47907-2033; macrocarpa Michx.; 3 loci; DOWet at., 19951), as well as the Hardwood Tree Improvement and Regeneration Center, Purdue U~I- more basal cycle-cup oaks Quercus subgenus Cyctobalanopsis versity Department of Forestry and ihiatural Resources, West (Quercus tnyrsinifolia Blume; 9 Ioci; ISAGIand SUHANDONO, Lafayette, IK 47907-2033; 19971. Several of these markers have been transferred success- 3, PRESTON R. ALDRICHt USTfA I?orest fully to other taxa including other white oaks fe.g., Quercus Sel-vice. NCRS, HTIRC, Purdue University Department of Forestfy suber L,, GoM~Zet at., 2001) and red oaks (Q~~~~~~subgenus and Pu'atural Resources, 195 Marsteller Street, West Lafayette, ne: 765-496-7256, F~~:765-496-1255, ~-~~~i:Quercus section Lobatae) such as Quercus rubra L. and Quer- cus humboldtii Bonpl. (e.g., FERYANDEZet al., 2000). Some

176 Silvae Genetica 52,3-4 12003) Table 1. - Locus name, clone repeat slze, prlmer sequences and anneaItng temperature In C iTa)for sixteen tGAIp microsatellite loci isolated from Quercus rubra.

Locus (GA), Primer sequences (5'+ 3')

forward reverse

ArnATARAGCATAAGGGTG GGCTI'CACATTGAGAACG?TG 50

TGTTGTTGTCCCCATT CAGTGGCATTTGTTCACGAA 45

CACCGTGATTTTA'ITGCCCAACA CGGCGGACTTGCATTAAC 42

ATATGGTCCCGATTAATTC CGGGAACATTCAAATGTATCTA 50

AGTGGGATGGGGATTCATAATA CTCCGTGTCGCTCCGTTGTT 50

GClTTGGGCTTGTTCCTACIT CAACACTTCTCATGGATTAGAGA 50

CAAKT1'CCACTGAGTCGTCGGT CTCTCGC'ITTGATTTCACTCCCA 58

CAGCCTCATCGATTACCCCAAAC GGTCGCTGAGGGGGAAAG 50

AGrnGGGTCAAATACCTCC AGATAATCCTATGATI'GGTCGAG 50

AAGATGCATGGTATTGTAGCAGG GCTTGTTGCGGTAGGTTA 50

GTTTGTGCTTGCTGGGAGG TTCTTCTTAGCTTCCCAACTGAA 53

ACCACTGTTGCCGACCTCCACCC CTCTTCTTGCCGCTATTGACCC 57

GCCAACAAATTTAACTATCCAT TAACTGGGCTAGATAATCAG 50

ATTACCLGAGCGTGCAGT GTGCTCCACGAATGCTCTAGCCA 58

CACTTCAAATGCATCCCCCAAA GCAGGATGTAGGGGCTTCCAG'TT 54

CCA AGCGCACCCCATCACTAAC Tfj(;CGC?%ACTCCGAGAT 53

markers have transferred as far as Castanea (e.g., BOTTAet al., (northern red oak) trunks in an old-growth stand at the Davis- 1999). To our knowledge, few microsatellite markers have been Purdue Research Forest near Muncie, IN, USA. Bark cambium developed from taxa within the Fagaceae outside of the white was macerated in a wood pulverizer (CertiPrep 6750 oak and cycle-cup oak groups. Exceptions include Fagus (9 loci; FreezerlMill, Spex, Inc.) and an agitating centrifuge (Fastprep TANAKAet al., 1999), Castanopsis (7 loci; UENOet al., 20001, and BiolOl, Savant), and DNA isolated using a modification of the recently Q. rubra, northern red oak 114 loci; ALDRICHet al., DNeasy Plant Minikit (Qiagen, Inc.) (see ALDRICHet al., 2002). 2002). Here, we describe an additional sixteen loci developed We obtained DNA from six individuals of the European white from Q. rubra and report the cross-species amplification of the oaks Quercus petraea Matt. (Liebl.) (sessile oak) and Quercus thirty Q. rubra microsatellite markers in the European white robur L. ipendunculate oak) kindly provided by A. KREMER oaks (Q. petraea and Q. robur) and Chinese chestnut (Castanea (INRA, France). These two species are known to hybridize mollissima). readily (PETITet al., 1997) and we treat them collectively here as Q. petraea - robul: 1Ve isolated DNA from leaf tissue from a Materials and Methods single individual of Castanea mollissima Blume (Chinese We obtained samples from six individuals each of North chestnut) collected from the Purdue University campus, West American northern red oak and European white oaks, and Lafayette, IN, USA, using the method described in ALDRICHet from a single individual of Chinese chestnut (Table 2). We col- al. (2002). DNA concentrations of all samples were adjusted to lected cambium tissue from the base of six Quercus rubra L. 5-10 ng/pl on an FL600 Microplate Fluorescence Reader (Bio- Tek Instruments, Inc.). Research Genetics), which together afforded detection of + 1 bp We tested the amplification of the thirty Q. rubra microsatel- differences. Primers that amplified one or two clearly defined Iite markers, fourteen from ALDRICHet al. 12002) and the six- peaks were scored as homozygotes and heterozygotes, respec- teen reported here. Primer sequences and optimal annealing tively. We identified +A alleles consistently within a locus and temperatures iTaj for amplification in Q. rubra are in Table 1 in cases where stutter bands were present we scored the high- and in AI~DRICHef al. (2002). In the present study, we used est peak (most intense band) as the allele. Fragment sizes were these same optimal TP2sfor amplifications involving the red oak estimated relative to a 22-band Beckman standard (60-420 samples, but 45OC (generally 5-10°C below T,'s recommended bpi. for red oak) for all amplifications of the European oaks and chestnut. PCR reactions included [lx Ex Taq Buffer (Panvera, Results and Discussion proprietary except 2.0 mM MgCl,), lo0 pM dh'TP each, 72 nm Twelve of the thirty microsatellite markers transferred from each upper and lower primer, 0.01 Ufpl Takara Ex Tag Poly- northern red oak to one or both of the other taxa in the merase (Panvera), and 0.2-0.4 ngipl DNA]. The PCR profile Fagaceae. Five loci amplified successfully in both Q. petraea - was [94"C, 1 min; 40 cycles of (94"C, 30 sec; Ta,45 sec; 72"C, robur and C. moltissitna (Table 2; guru-GA-OCl1 [see Figure 11, 1.5 minf; 7Z°C, 10 min]. 4C19 [see Figure 11, -0MO7, -1C08, and -13'02). Seven loci PCR products were separated on 1,5%, lxTAE agarose gels amplified in Q. petraea - robur but not in C. rnollissima (Table stained with ethidium bromide and visualized on an Eagle Eye 2; quru-GA-OC21, -0MO5, -1G13, -1106, -1115, -1J11, and I1 imaging system (Stratagene) to determine that amplicons -1M17). The remaining eighteen loci failed to amplify success- consisted of one or two bands in roughly the expected size for fully in either Q. petraea - robur or C. moltissima (guru-GA- Q. rubra. Cases of no visible product, smudges, multi-banded OAOI, -0A03, -0C03, -0E09, -0101, -0121, -1C06, -1D09, profiles, or bands displaying a large deviation from the expect- -1F07, -1H14, -1L05, -1M18, -2F05, -2G07, -21114, -2H18, ed size were all scored as '-' (Table 2). We resolved genotypes -2M04, and -2N03). These rates of successful transfer are con- using an 8-capillary genotyper (CEQZOOOXL, Beckman Coul- servative conlpared to other reports for these and related ter) and an end-labeled upper primer (phosphoramadite dyes, species. Our finding that 40.0% of Q. rubra microsatellite

Table 2. - Successful cross-species amplifications of twelve Quercus rubra microsatellite loci. Observed number of alleles (No), observed heterozygosity (H,),and size range in base pairs detected in SIX samples of each of North American northern red oak (Q,rubra) and European white oaks 1Q. petraea - Q.rohur), and one sample from Chinese chestnut (Castanea rnollissitna).

Q. rubra Q.petraea - rohur C. rnnllissirna

Locus Na Ho bp Na Ho bp Na bp ed C. tnollissima (Figure 1). These twelve markers should prove useful for a variety of genetic applications in the Fagaceae.

We thank A. DE\VOODY.P. PIJLT, K WC)E*WE,and anonymous reviewers for comments, and the USDA Forest Serv~ceand Purdue University for support of the project. A. KREMERIIII'RA, France) klndly provided sam- ples of Q. petraea and Q. rcibur DSA, and W. SUKprov~ded logistical support.

References ALDRICH,P. R., MICHLER,C. H., SC'N, W. and ROMERO-SEVERSON,J.: Microsatellite markers for northern red oak fFagaceae: Quercus rubra). Mot. Ecol. Notes 2: 472-474 (2002). - BOTTA,R., AKKAK,A,, MARINONI, D., Bouxotis, G., KM~PFER,S., STEINKEL~ER,H, and LEXER,C.: Evalua- tion of microsatellite markers for characterizing chestnut cultivars. I I Acta Hort. (ISHS) 494: 277-282 (1999). - DIRLEWWGER,E., COSSON,P., Figure 1. - Amplification results of two Qucrcus rubra (northern red TAVAUD,M., AR~~UZAVA, M. J., POIZM,C., ZAXET~O,A., ARUS,P. and LAI- oak) microsatellite markers in Castartca tnollissima (Chinese chestnut): GRET. F.: Development of microsatellite markers in peach [Prunus persi- A. quru-GA-OC11, B. guru-GA-OC19. ca (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry (Prunus aviurl~L.). Theor. Appl. Genet. 105: 127-138 (2002). - Dow, B. D., A~HLEY,M. V. and HOWE,H. F.: Characterization primers transferred to Q. petraea - robur was slightly less than of highly variable (GA/CTjn microsatellites in the bur oak, Quercus the 47% (8 of 17) transfer rate reported by STEIN~LLNERet at. tnacrocarpa. Theor. Appl. Genet. 91: 137-141 (1995). - FERNANDEZ,J. F., SORK,%? L., GALLEGO,G., LOPEZ,J., BOHORQUES,A. and TOHME,J.: (1997b) for Q. petraea microsatellite primers amplifying in Q. Cross-amplification of microsatellite loci in a Neotropical Quercus spe- rubra. We were able to transfer 17% of the Q. rubra markers to cies and standardization of DNA extraction from mature leaves dried in C. mollissirna. BOTTAet al. (1999) transferred 40% (12 of 30) of silica gel. Plant Mol. Biol. Reporter 18: 397a-397e 12000). - GOMEZ,A., Q. petraea and Q. robur primers to Castanea sativa, and nine of PINTOS,B., ACUIRLANO,E., M~WZENER~,J. A. and BUENO,M. A.: SSR markers for Quercus suber tree identification and embryo analysis. J. these were polymorphic. DIRLEWANGERet al. (2002) reported Hered. 92: 292-295 12001). - ISAGI,Y. and SUHAVDONO,S.: PCR primers transferring 31.7% (13 of 41) microsatellite markers from amplifying microsatellite loci of Quercus myrsinifolia Blume and their Prunus persica (Rosaceae) to C. sativa (Fagaceae). conservation between oak species. Mol. Ecol. 6: 897-899 (1997). - KAMPFER,S., LEXER,C., GLOSSL,J. and STEINKELLNER,H.: Characteriza- The primers that amplified well outside of Q. rubra also tion of (GA), microsatellite loci from Quercus robur. Hereditas 129: 183- revealed high levels of genetic variation. All loci were variable 186 (1998). - Nrxolv, K. C.: Infrageneric classification of Quercus (Faga- in Q. rubra, and those that amplified in Q. petraea - robur also ceae} and typification of sectional names. Ann. Sci. For. 50 were variable in Q. petraea - robur. Four of the five markers Suppl(l):25s-34s 11993). -PETIT, R. J., PINEAU,E., DEMESURE,B., BACI- LIERI,R., DUCOUSSO,A. and KREMER,A.: Chloroplast DNA footprints of that worked in C. rnollissima amplified a heterozygote in the postglacial recolonization by oaks. Proc. Natl. Acad. Sci. USA 94: 9996- singie sample. There was low correspondence between the 10001 (19971. - STEINKELLNER,H., FLUCH,S., TURETSCHEK,E., LEXER, number of alleles detected per locus in the six red and six white C., STREIFF,R., KREMER,A., BURG,K. and GLOSSL,J.: Identification and oak samples (R = 0.06), but the mean number of alleles per characterization of (GA/CTIn microsatellite loci from Quercus petraea. Plant. Mol. Biol. 33: 1093-1096 (1997a). - STEINKELLNER,H., LEXER,C., locus was very similar for the twelve loci that transferred TURETSCHEK,E. and GLOSSL,J.: Conservation of (GA), microsatellite loci (Q. rubra, 5.7; Q. petraea - robur, 5.5). The fragment sizes of between Quercus species. Mol. Ecol. 6: 1189-1194 (1997b). - TANAKA, the Q. petraea - robur and C. mollissima alleles overlapped K., TS~~MURA,Y. and NAKMVURA,TI: Development and polymorphism of those of the Q. rubra alleles at each locus except for quru-GA- microsatellite markers for Fagus crenata and the closely related E japo- nica. Theor. Appl. Genet. 99: 11-15 (1999). - UENO,S., YOSHIMARU,H., allele was smaller) and IF02 (C. rnollissima quru-GA-1106 KAw~,T. and YAMAMOTO,S.: Isolation of microsatellite markers in (Q.petraea - robur alleles were smaller). The overall quality of ' Castanopsis cuspidate var. sieboldii Nakai from an enriched library. successful amplifications was high, even in the distantly relat- Mol. Ecol. Notes 9: 1187-1189 (2000).