DOCSLIB.ORG
Explore
Sign Up
Log In
Upload
Search
Home
» Tags
» FMO2
FMO2
Download
Table 2. Significant
Regulation of Xenobiotic and Bile Acid Metabolism by the Anti-Aging Intervention Calorie Restriction in Mice
Flavin-Containing Monooxygenases: Mutations, Disease and Drug Response Phillips, IR; Shephard, EA
Hanna Joleen 2018 Thesis.Pdf
High-Altitude Adaptation in Rhesus Macaques 4 5 Zachary A
Glucocorticoids Are Not Always Deleterious for Bone
FMO3) As a Novel Genetic Determinant of Acetaminophen (APAP) Induced Hepatotoxicity Swetha Rudraiah University of Connecticut - Storrs,
[email protected]
2018 Southern Regional Meeting
Drosophila and Human Transcriptomic Data Mining Provides Evidence for Therapeutic
Identification of Nondiabetic Heart Failure‑Associated Genes by Bioinformatics Approaches in Patients with Dilated Ischemic Cardiomyopathy
Genetic Determinants of Brain Structure
Supplemental Table 1 List of Genes Differentially Expressed In
Consequences of Exchanging Carbohydrates for Proteins in the Cholesterol Metabolism of Mice Fed a High-Fat Diet
Soluble Compounds Released by Hypoxic Stroma Confer Invasive Properties to Pancreatic Ductal Adenocarcinoma
Methods and Compositions for the Treatment of Non-Small Cell Lung Cancer
HPV Microarrays
Vitamin D Signaling Pathway and Breast Cancer
Top View
About Gempharmatech
Transcriptome Profiling Reveals the Complexity of Pirfenidone Effects in IPF
Supplemental Figures 04 12 2017
Comparative Gene Expression Analysis to Identify Common Factors in Multiple Cancers
Reviewer Answer 2
Supplemental Data
The Role of Semen and Seminal Plasma in Inducing Large-Scale Genomic Changes in the Female Porcine Peri-Ovulatory Tract M
High Fat Diet Significantly Changed the Global Gene Expression Profile Involved in Hepatic Drug Metabolism and Pharmacokinetic System in Mice
Endogenous Roles of Mammalian Flavin-Containing Monooxygenases
Supplementary Tables 1
UC San Diego UC San Diego Electronic Theses and Dissertations
Widespread Signals of Convergent Adaptation to High Altitude in Asia and America
1 Drug Metabolism by Flavin-Containing Monooxygenases of Human and Mouse
The in Vivo Endothelial Cell Translatome Is Highly Heterogeneous Across Vascular Beds
Supplementary Methods Effects of Gender on Smokers
{'Ess': 0, 'Noness': 3} True 70007 AAGATCTAAAACTTTACACTAG []
SUPPLEMENTARY APPENDIX Targetable Driver Mutations in Multicentric Reticulohistiocytosis
Genetic Variation in the FMO2 Gene: Evolution & Functional Consequences Al-Sulaimani, Maha Saleh
The Distinct Role of Cyclooxygenase-2 in Prostate and Bladder Carcinogenesis
You Can Check If Genes Are Captured by the Agilent Sureselect V5 Exome
Genetic Variants of Flavin-Containing Monooxygenases: Consequences for Drug Metabolism
WO 2019/018441 Al 24 January 2019 (24.01.2019) W !P O PCT
Supplemental Table S3
Marmoset Flavin-Containing Monooxygenase 3 in the Liver Is a Major Benzydamine and Sulindac Sulfide Oxygenase S
Table S1. Clinicopathological Characterization of 99 Leiomyosarcoma Cases. STT Lib.Name Location Grade
Dissecting the Cellular Specificity of Smoking Effects and Reconstructing
Detroit Rd 3600 Primary Antibo
Responsive Nuclear Proteins in Collecting Duct Cells
Association of Somatic Mutations of ADAMTS Genes with Improved Chemotherapy Sensitivity and Survival in High-Grade Serous Ovarian Carcinoma
FMO2) in Rhesus Monkey and Examination of Anhuman FMO2 Polymorphism
Probe Set Classification Gene Symbol Location Title 1438 at Basal
Human FMO2-Based Microbial Whole-Cell Catalysts for Drug
Logfc P-Value Logfc P-Value AACS 2.791 0.038 3.038 0.026 AAGAB
Differential Genes Gene ID Log2fold Change Pval Padj Gene Title Symbol Cluster-62068.91323 7.9822 6.52E-42 9.39E-37 Ankyrin Repe
Application of a Novel Haplotype-Based Scan for Local Adaptation to Study High-Altitude Adaptation in Rhesus Macaques
Associated Cardiovascular Disease
The Pennsylvania State University the Graduate School College Of
Flavin Containing Monooxygenases and Metabolism of Xenobiotics Flavin İçeren Monooksijenazlar Ve Ksenobiyotiklerin Metabolizması
Responsive Nuclear Proteins in Collecting Duct Cells
Alterations in Bile Acid Homeostasis and Drug Metabolism in Germ-Free Mice By
High Fat Diet Significantly Changed the Global Gene Expression Profile
Supplementary Table 1. a Full List of Cancer Genes
Probe List HTG Transcriptome Panel