The Pennsylvania State University
The Graduate School
College of Health and Human Development
EFFECTS OF EXERCISE A D GE ETIC STRAI O BO E STRE GTH,
MUSCULOSKELETAL GE E EXPRESSIO A D ACTIVITY LEVELS I
C57BL/6J A D DBA/2J ADULT FEMALE MICE
A Dissertation in
Kinesiology
by
Holly Marie Preston
2009 Holly Marie Preston
Submitted in Partial Fulfillment of the Requirements for the Degree of
Doctor of Philosophy
December 2009
The dissertation of Holly Marie Preston was reviewed and approved* by the following:
Teresa C. Lang Faculty Research Associate Dissertation Co Advisor Co Chair of Committee
Neil A. Sharkey Professor of Kinesiology, Orthopedics and Rehabilitation Dissertation Co Advisor Co Chair of Committee
Douglas R. Cavener Professor of Biology
Robert Eckhardt Professor of Developmental Genetics and Evolutionary Morphology
John H. Challis Professor of Kinesiology Chair of the Graduate Program in Kinesiology
*Signatures are on file in the Graduate School
ii
ABSTRACT
It is widely accepted that bones are able to adapt to changes in their loading environment by altering their structural strength. The details of this adaptation are still being explored, including elucidation of the genes involved. The main focus of this research was to further explore gene environment interactions relative to bone adaptation.
Increasing our understanding of these interactions may someday enable more individualized interventions that consider a person’s genotype when treating bone diseases such as osteoporosis. Adult female mice from two different inbred mouse strains with known differences in skeletal phenotypes, C57BL/6J (B6) and DBA/2J (D2), were exposed to two different regimens of mechanical loading: an aerobic based exercise intervention, treadmill running, and a more resistance based intervention, tower climbing.
Ninety mice from both strains were equally divided into running, climbing and non exercised groups. After five weeks of intervention, the mice were killed and the tissues were harvested from each mouse.
Morphological parameters of the right femur from each mouse were measured and the bones were scanned using micro computed tomography in order to evaluate the cross sectional geometry of the mid shaft. Mechanical properties of the femoral diaphysis were then assessed via three point bending and the femoral neck was broken in a shear test. Differences were found as a function of treatment and genetic strain providing further evidence that bone adaptation in response to physiologically plausible interventions is dependent on genetic architecture.
iii Total RNA from the gastrocnemius and from within the femoral diaphysis was extracted and gene expression was examined using Affymetrix microarrays for each strain and treatment group. Bone related genes were differentially expressed across the two mouse strains and some of these genes co located with previously identified
Quantitative Trait Loci (QTL) related to bone architecture and strength. Interestingly, a gene known to play a role in the regulation of the response of bone to mechanical loading had greater expression in tower climbers relative to the controls.
Cage activity, body weight, and food consumption were repeatedly measured during the intervention and hindlimb muscle weights were measured during dissections of the mice. The results indicated differences in activity levels relative to genetic strain.
Treadmill running was also shown to have an impact on normal home cage activity.
Treatment and genetic strain effects on body weight and food consumption were found as well. Muscle mass was affected by genetic strain, but treatment did not have an effect.
These results provide valuable data for better interpretation of experimental manipulations exploring the influence of genetic strain and exercise on bone adaptation.
Bone adaptation is a complex system that is strongly impacted by environmental demand and the genetics involved. Therefore, the gene environment interaction is an important consideration when studying bone adaptation. There are also many indirect influences on bone such as muscle force that play a significant role. Understanding the response of bone to methods of enhanced mechanical loading via exercise and the role genes play is of significant value, as is gaining a greater understanding of known confounders.
iv TABLE OF CO TE TS
List of Tables………………………………………………………………………..viii List of Figures……………………………………………………………………….x Acknowledgements………………………………………………………………….xii
Chapter 1 INTRODUCTION……………………………………………………….1 References…………………………………………………………………..8
Chapter 2 LITERATURE REVIEW………………………………………………..9 Bone Tissue………………………………………………………………….9 Exercise Studies…………………………………………………………….14 Genetics……………………………………………………………………..17 Indirect Influences…………………………………………………………..20 Summary…………………………………………………………………….22 References…………………………………………………………………...23
Chapter 3 EFFECTS OF TREADMILL RUNNING AND TOWER CLIMBING ON FEMORAL STRENGTH IN C57BL/6J AND DBA/2J ADULT FEMALE MICE……………………..……………………………………..27 Abstract……………………………………………………………………...27 Introduction………………………………………………………………….28 Materials and Methods………………………………………………………31 Results……………………………………………………………………….34 Discussion……………………………………………………………………44 References……………………………………………………………………49
v
Chapter 4 DIFFERENTIAL GENE EXPRESSION IN MECHANICALLY LOADED LONG BONE CORTICIES AND MUSCLE OF C57BL/6J AND DBA/2J ADULT FEMALE MICE……..…………………………..51 Abstract………………………………………………………………….….51 Introduction…………………………………………………………………52 Materials and Methods……………………………………………………...54 Results………………………………………………………………………60 Discussion…………………………………………………………………..82 References…………………………………………………………………..89
Chapter 5 EXERCISE INDUCED CHANGES IN CAGE ACTIVITY, BODY WEIGHT, FOOD CONSUMPTION AND MUSCLE MASS IN C57BL/6J AND DBA/2J MICE……………………………………………..92 Abstract………………………………………………………………….…...92 Introduction…………………………………………………………………..93 Materials and Methods……………………………………………………….95 Results………………………………………………………………………100 Discussion…………………………………………………………………..112 References…………………………………………………………………..117
Chapter 6 SUMMARY……………………………………………………………...118
Appendix A: Experimental Design…………………………………………………124
Appendix B: Treadmill Protocol……………………………………………………125
vi Appendix C: Tower Design…………………………………………………………128
Appendix D: MTS Biomechanical Testing Protocol……………………………….129
Appendix E: Cross Sectional Morphology…………………………………………134
Appendix F: Structural and Material Properties……………………………………135
Appendix G: Morphology and Mechanical Data …………………………………..136
Appendix H: Bone RNA Extraction Protocol………………………………………140
Appendix I: Muscle RNA Extraction Protocol …………………………………….141
Appendix J: RNA Amplification and Labeling Protocol…………………………...142
Appendix K: Additional Genes with Differential Expression within Bone Tissue as a Function of Exercise Treatment……………………………….…146
vii LIST OF FIGURES
Figure 3 1: Differences in gross and cross sectional morphology measures as a function of treatment…………………………………………………………...39
Figure 3 2: Differences in structural measures of the femoral shaft for B6 mice as a function of exercise treatment…………………………………………….41
Figure 3 3: Differences in material properties of the shaft of B6 mice as a function of exercise treatment………………………………….………………..….42
Figure 3 4: Differences in femoral neck structural measures of ultimate load for B6 and D2 mice as a function of exercise treatment…………………………....43
Figure 5 1: Body weight starting two weeks prior to and continuing over the duration of the exercise intervention and differences in the change from baseline in body weight over duration of treatment………………………………………….101
Figure 5 2: Food consumption starting two weeks prior to and continuing over the duration of the exercise intervention and differences in the change from baseline in food consumption over first four weeks of treatment……………. 103
Figure 5 3: Differences in hind limb muscle weights as a function of genetic strain…. …………………………………………………………………….105
Figure 5 4: Differences in the number of activity counts for the x, y, and z axis as a function of genetic strain…………………………………………...106
Figure 5 5: In cage floor activity differences as a function of genetic strain as measured by distance and duration…………………………………………...….107
Figure 5 6: In cage vertical activity differences as a function of genetic strain as measured by rear and grid duration for each light and dark cycle and both cycles combined. ………………………………………………………....108
Figure 5 7: Differences in tower climbing as a function of genetic strain as measured by the number of trips (up and down the tower)……………………...109
Figure 5 8: In cage activity differences as measured by activity counts for the x, y, and z axis before and during treadmill running for each mouse…….....110
Figure 5 9: In cage floor activity differences before and during treadmill running as measured by distance and duration for each genetic mouse strain……..111
viii Figure 5 10: In cage vertical activity differences as measured by rear and grid duration before and during treadmill running for each genetic mouse strain during the light cycle, dark cycle and light and dark cycles combined……..…..112
Figure A 1: Design of experiment included 90 female mice from 2 strains (B6 and D2) equally divided into 3 treatments (Treadmill, Tower, Control; n=15)…..124
Figure C 1: Design of tower used for climbing intervention………………………….128
Figure E 1: TIFF Image of Right Femur Cross Section of Mid Shaft …………….....134
Figure F 1: Load Displacement Curve……………………………… …………….....135
Figure F 2: Material Property Calculations……………………………………………135
ix LIST OF TABLES
Table 3 1: Differences in gross and cross sectional morphology of the femur as a function of genetic strain………………………………………………..35 Table 3 2: Differences in structural and material properties of the femur as a function of genetic strain……………………………………………………….37
Table 4 1: Genes with greater expression in bone tissue of B6 control mice compared to D2 control mice……………………………………………………….61 Table 4 2: Genes with greater expression in bone tissue of D2 control mice compared to B6 control mice………………………………………….……………64 Table 4 3: Bone related genes differentially expressed within bone tissue from the control mice as a function of mouse strain (B6 vs D2)……………………65 Table 4 4: Genes with differential expression between B6 controls and D2 controls that overlap with QTLs related to bone strength and architecture identified in F2 and RI progeny derived from B6 and D2 progenitor mice………...66 Table 4 5: Genes with greater expression in muscle tissue of B6 control mice compared to D2 control mice………………………………………..……………...69 Table 4 6: Genes with greater expression in muscle tissue from D2 control mice compared to B6 control mice…………………………………………………72 Table 4 7: Genes with greater expression in bone tissue of treadmill exercised mice compared to control mice…………………………………………..76 Table 4 8: Genes with differential expression in bone tissue as a result of tower exercise ………………………………………………………………………76 Table 4 9: Genes with greater expression in treadmill runners compared to controls in muscle tissue………………………………………………..…………...77 Table 4 10 : Genes with differential expression in muscle tissue relative to tower exercise………………………….……………………………………….……78 Table 4 11 : Genes with greater expression in muscle tissue from B6 mice as a result of exercise ………………………………………………………………..78 Table 4 12 : Genes with greater expression in muscle tissue from controls compared to exercised mice from the B6 strain….…………………………….……80 Table 4 13 : Genes with greater expression in muscle tissue from D2 mice as a result of treadmill running when compared to controls ………………………..80
x Table 4 14 : Genes with greater expression in muscle tissue from D2 control mice when compared to treadmill runners ………………………………….81 Table B 1: Protocol settings used during treadmill running intervention…………..127 Table E 1: Measurements taken from cross section of femoral mid shaft…………134 Table F 1: Structural Property Variables…………………………………………..135 Table G 1: Gross Morphology Data………………………………………………..136 Table G 2: Cross Sectional Morphology Data….………………………………….137 Table G 3: Structural Properties Data……………………………………………..138 Table G 4: Material Properties Data……..………………………………….……..139 Table K 1: Tower climbing mice had greater expression than control mice………146 Table K 2: Treadmill running mice had greater expression than control mice……146 Table K 3: Control mice had greater expression than tower climbing mice…….…147 Table K 4: Control mice had greater expression than treadmill running mice…….147
xi ACK OWLEDGEME TS
First and foremost I would like to thank my parents, David and Susan Preston, for their love and support throughout graduate school and my entire life. I would also like to thank my younger brother, Mark Preston, for inspiring me with a great attitude despite life’s challenges and for his ability to make me laugh so much. Without the support of my family I would have never been able to pursue or accomplish my dreams and for that I am deeply grateful.
Next I would like to thank Dr. Dena Lang and Dr. Neil Sharkey for sharing their knowledge, advice and the opportunity to be a part of this research. Dr. Lang spent countless hours giving me feedback for my entire dissertation from design, completion and presentation. Her hard work and obtaining a grant provided me with the ability to be part of a fascinating and exciting research project. Dr. Sharkey taught me a great deal about biomechanics, anatomy and scientific writing in particular. I appreciated the time and efficiency he gave me when providing feedback on my writing. He also played an essential role in my dissertation research by providing his expertise and time during the dissection process. I would also like to thank Dr. Bob Eckhardt and Dr. Doug Cavener for serving on my committee and providing me with feedback and advice. Both
Dr. Eckhardt and Dr. Cavener were understanding and helpful while serving on my committee and this was very much appreciated.
In addition, I would like to thank the late Joe Strella for designing and constructing the monitoring systems that enabled us to collect essential data and Nori
Okita who played a significant role in the design and analysis of this data. I would also
xii like to thank Denny Ripka for his role in the construction of our custom cages. Moreover,
I thank Craig Praul and Haikun Zhang from the Penn State Microarray Facility for their role in generating the microarray data as well as Naomi Altman and Christine Clement from the Penn State Statistics Department for the analysis of the microarray data.
xiii Chapter 1
Introduction
It is widely accepted that bones are able to adapt to changes in their loading environment by altering their structural strength. The details of this adaptation, specifically how mechanical loading is detected and transduced by bone cells, are still being explored, including elucidation of the genes involved. However, the structural integrity of bone involves not only the genetic interactions directly affecting the bone tissue itself, but also the indirect influences of genes and environments that affect mechanical demand, e.g., behavior, muscle force, and body weight. The main focus of this research was to further explore gene environment interactions affecting bone adaptation. Increasing our understanding of these interactions may someday enable more individualized interventions that consider a person’s genotype when treating bone diseases such as osteoporosis.
Age related osteoporosis affects the lives of millions of people. According to the
National Institute of Health’s Osteoporosis and Related Bone Diseases National Resource
Center, forty four million U.S. citizens are affected by osteoporosis; ten million have osteoporosis and another thirty four million have low bone mass and are at risk of developing osteoporosis. In 2002, hospitals and nursing homes reported between twelve and seventeen billion dollars in costs associated with osteoporosis (NIH, 2009). The human and financial costs are high and are increasing. New preventative measures and interventions are needed.
1 Numerous phenotypic traits contribute to bone health and these traits are each regulated by both polygenic and environmental conditions. Bone quality can be defined as bone’s inherent ability to resist fracture. Factors commonly associated with bone quality include age and gender. Bone loss is known to occur with age and osteoporosis develops if bone is not able to maintain sufficient mass, thereby increasing the risk of fracture. Women are more susceptible to bone loss due to decreased estrogen levels as a consequence of menopause. Ethnicity and heredity are also factors associated with the risk of developing osteoporosis and animal models have shown marked differences in bone as a result of genetic background. A change in the environmental demand placed on bone is another factor linked to bone health. Astronauts experience a decrease in bone mass as a result of being in a weightless environment; whereas, enhanced bone loading through exercise is known to result in bone gain.
Inbred mice provide a useful model for studying bone adaptation as a function of genetics and exercise. An inbred mouse strain provides essentially an infinite amount of nearly identical genetic replicates. Therefore, an inbred strain can be used to look at exercise effects without confounding genetic effects. Two different inbred strains of mice can also be compared in order to determine the effect of genetic differences. Furthermore, responses to exercise relative to genetic strain can be explored to determine the influence of genetic differences on the response of bone to its environment, i.e., gene environment interaction. This study utilized two inbred mouse strains, C57BL/6J (B6) and DBA/2J
(D2), with known differences in skeletal phenotypes. These two strains were also used in previous Quantitative Trait Loci (QTL) studies resulting in the identification of QTLs
2 involved in bone maintenance. QTLs are regions of DNA that are linked to phenotypic traits.
Various methods of loading (or unloading) have been used in the literature to study environmental effects on bone adaptation including, but not limited to, jumping, climbing, running, and swimming as well as in vivo methods. Two different methods of enhanced mechanical loading via exercise were used in this study: treadmill running and tower climbing. These methods expose bone to more naturally achievable loads, which is a strength of the study as compared to overload models that are often used in an attempt to elucidate issues related to functional adaptation. Treadmill running was chosen because it is an aerobic exercise. Tower climbing was also used because it is a more resistance based type of exercise that exposes the musculoskeletal tissues to different biomechanical forces than those imposed by running. Both treadmill running and tower climbing have been used in related studies on bone as methods of exercise interventions in rats and mice.
Ninety female mice were equally divided between a treadmill running group, a tower climbing group and non exercised controls that remained in standard cages for the duration of the intervention. The mice were 180 days of age at the start of the five week intervention. This age was chosen because mice are considered young adults at this age and have been shown to attain peak bone mass at 4 months (Beamer, 1996). Bone of young mice is generally more responsive to exercise and most studies look at exercise effects in growing mice. Studying bone in an adult age group was a specific objective of this study and one that served to both eliminate the confounding effects of growth and
3 explore the response to exercise in adults. Upon completion of the exercise intervention the mice were immediately euthanized and tissues were harvested.
The effects of genetic strain and exercise mode on bone properties were explored by looking at differences in mechanical strength. The femur was chosen because it is a major long bone of the hind limb used extensively during running and climbing. The femur is also the site of most osteoporotic fractures, which commonly occur in femoral neck and trochanteric regions, areas of high trabecular bone volume. The right femur from each mouse was used for mechanical testing of both the shaft and femoral neck using three point bending and a shear test respectively. The load and displacement required to break the bone, along with radius and moment of inertia data obtained using cross sectional images from micro computed tomography ( CT) scans of the cortical mid shaft of the femur, were used to calculate the tissue level mechanical properties of the bones, including stress and strain at yield and failure and modulus of elasticity. Gross morphological measurements of the right femur were also examined. Hind limb muscles used during running and climbing were also removed from the left leg and weighed.
Differences in gene expression as a result of genetic strain and exercise mode were explored in bone and muscle tissues. RNA was extracted from the left femur after the ends were removed and marrow flushed leaving the cortical shaft. Gene expression was then examined using Affymetrix microrrays containing more than 20,000 known mouse genes and differential expression of select genes were confirmed using Real Time
Polymerase Chain Reaction (RT PCR). A portion of the gastrocnemius muscle of the left hindlimb was also removed and RNA extracted in order to examine gene expression in the muscle. It was expected that numerous genes would be differentially expressed in
4 these tissues due to differences in genetic strain. If genes within the bone tissue co located to previously identified QTL, such genes would be considered ideal candidate genes for further exploration. It was also expected that genes with different expression as a function of exercise would be identified within both tissues and inbred mouse strains.
The results genes provide interesting candidates for further exploration of gene environment effects on musculoskeletal health.
Natural activity levels of the mice over 24 hour periods were examined using activity monitoring systems that utilized interrupted infrared light in order to determine if there were differences in baseline activity levels as a function of genetic strain and as a result of exercise. This information is valuable because differences in natural activity levels may partially explain skeletal differences between the two strains. The response of the strains to mechanical loading might also be influenced by natural activity levels in that mice with lower natural activity levels may be more responsive to mechanical loading. Body weight and food consumption were also measured on a weekly basis starting two weeks before and continuing throughout the five week intervention period to determine if there were significant differences in these parameters as a function of strain and exercise.
The overall working hypothesis for this study is that genetic and environmental influences in adult, female mice play a significant role in bone adaptation via changes in bone size, strength and gene expression. Similar effects will be found for muscle size and gene expression, body weight and behavior. The first specific aim of this study included determining the mechanical performance and morphology of femora from two genetic strains each exposed to the two exercise modes. It was hypothesized that both types of
5 exercise would increase the mechanical capacity of the skeleton, but the tower climbing mice would exhibit greater increases than treadmill running. Notomi, et al. compared treadmill running and jumping in young mice and found resistance exercise was more effective than aerobic exercise (Notomi, 2000). It was also hypothesized there would be differences based upon genetic strain with B6 mice showing a greater response. Robling, et al. found genetic variations in bone strength in young, female mice with B6 mice having greater measures of bone strength than D2 mice (Robling, 2002).
The second specific aim was to determine changes in the patterns of gene expression within bone and muscle as a function of enhanced skeletal loading (via treadmill running and tower climbing) and genetic strain using microarrays and subsequent RT PCR confirmation. It was hypothesized that exercise would alter the expression of genes related to bone quality in both strains in a positive manner. Also, pathways involved in osteoclast formation and activity would be down regulated in the exercised groups and those involved in osteoblast formation and activity would be up regulated; the genes regulating these pathways would be differentially expressed in control and exercised animals irrespective of mouse strain. In a study on the tibia of young and old mice from the B6 strain and a strain similar to D2, it was found that mechanical loading via a loading apparatus significantly down regulated genes involved with bone resorption and up regulated genes controlling bone formation. Changes in expression were also greater in the B6 mice (Kesavan, 2005). It was also hypothesized genes located within the 2 LOD support interval of some of the previously identified
QTL would be differentially expressed across strains.
6 The third specific aim was to measure activity levels of the mice before and during exercise from both strains and compare activity levels based upon strain. It was hypothesized that there would be differences in activity levels between the two strains with B6 mice being more active. Kaye, et al. found B6 were more active than the A/J strain for both males and females (Kaye, 1995). B6 mice have also been shown to be more active than D2 mice in particular (Tang, 2002). It was also hypothesized that exercise would not alter the in cage activity levels of the mice. The third aim also included the evaluation of body weight and food consumption changes. It was hypothesized that they would not be significantly different either as a function of strain or as a result of exercise.
The ability to single out specific genes involved in the diverse pathways of bone adaptation will help us begin to delineate the complex gene gene and gene environment interactions and thereby increase our understanding of bone diseases and age related bone loss.
7 References
Beamer, W.G., Donahue, L.R., Rosen, C.J., and Baylink, D.J. (1996) Genetic variability in adult bone density among inbred strains of mice. Bone, 18(5): 397 403.
Kaye, M., and Kusy, R.P. (1995) Genetic lineage, bone mass, and physical activity in mice. Bone, 17 (2): 131 135.
Kesavan, C., Mohan, S., Oberholtzer, S., Wergedal, J.E., and Baylink, D.J. (2005) Mechanical loading induced gene expression and BMD changes are different in two inbred mouse strains. Journal of Applied Physiology, 99: 1951 1957.
National Institutes of Health, Osteoporosis and Related Bone Diseases National Resource Center [Web Page] URL http://ww.osteo.org (Accessed April 2009)
Notomi, T., Okazaki, Y., Okimoto, N., Saitoh, S., Nakamura, T., and Suzuki, M. (2000) A comparison of resistance and aerobic training for mass, strength and turnover of bone in growing rats. European Journal of Applied Physiology, 83: 469 474.
Robling, A.G., and Turner, C.H. (2002) Mechanostransduction in bone: genetic effects on mechanosensitivity in mice. Bone, 31 (5): 562 569.
Tang, X., Orchard, S.M., and Sanford, L.D. (2002) Home cage activity and behavioral performance in inbred and hybrid mice. Behavioral Brain Research, 136: 555 569.
8 Chapter 2
Literature Review
Bone Tissue
Bone is a unique and dynamic tissue. It provides the body with support and mobility and is able to adapt to changes in functional demand because it has an inherent ability to resist fracture by altering its structural strength. Therefore, bone needs to balance between being rigid and flexible. It must be able to withstand mechanical loads and not break, also solid enough to provide a strong structural framework for the body, but light enough to allow for movement. The demands placed upon bone can vary greatly and bone tends to adapt accordingly. Athletes for example demand more from their bones than someone who is inactive; as such the bones in these individuals tend to be more robust and better able to resist fracture. In the 19 th century, Julius Wolff, a German surgeon, published papers on observations that bone is able to detect mechanical loads and alter its structure in response (Wolff, 1869). The functional adaptation of bone is therefore referred to as Wolff’s Law.
Bone adaptation involves bone formation as a result of increased mechanical demand and a decrease in demand causes bone removal. However, the details of how bone tissue is able to sense mechanical loads and subsequently trigger changes in its structure are still a main focus in current bone research. There are also many confounding factors when attempting to understand bone adaptation. Bone changes with age and bone adaptation is very different in growing bone than it is in mature bone. Bone exhibits a greater response to loading at a younger age as shown in a study by Hoshi, et al. on the effects of exercise on bone properties in growing, mature and aged mice (Hoshi, 1998).
9 Therefore, many bone adaptation studies are commonly conducted using a young model because they are more responsive to mechanical loading. However, understanding adaptation in the mature skeleton is equally as important because bone loss naturally occurs with age and osteoporosis is a prevalent bone disease that is age related.
There are also differences in bone based upon gender. Hormones play a large role in bone maintenance and estrogen is known to prevent bone loss. Therefore, upon experiencing menopause and subsequent decreased estrogen levels, women tend to have increased bone loss beyond the typical age related losses seen in both men and women.
There is also evidence that there are sex related differences in the response of bone to exercise. In a study of growing mice, Wallace, et. al. observed differences in the response of cortical bone to treadmill running in male and female mice. The bones of the male mice were more responsive to exercise than those of the female mice (Wallace, 2007).
One concludes from these and other studies that targeting adult females for studying bone adaptation is most important because bone loss occurs with age and hormonal changes and females may be less responsive to mechanical loading.
The type of bone and its skeletal location (e.g. long bones such the femur and tibia in the appendicular skeleton vs lumbar vertebrae in the axial skeleton) are also important factors to consider. There are many different bones that are exposed to varying mechanical loads based upon anatomical location. Even bones in a similar location experience different loads. For example, weight bearing bones in the leg such as the femur and tibia experience different mechanical loads than the non weight bearing bone in the leg, the fibula. Wallace et al. also studied differences in response to loading between the femur and tibia in growing mice and found that the tibia was more
10 responsive than the femur (Wallace, 2007). Kuruvilla et al. also found that the tibia was more responsive to in vivo loading (using a loading device) than the ulna (Kuruvilla,
2008). There is also evidence to show site specific differences within bone. For instance, the adult femur is composed of a proximal end (epiphysis; including the femoral head), the shaft (diaphysis) and a distal end (epiphysis) as well as metaphyses separating the epiphysis and diaphysis at each end of the femur (the metaphysis is the site of elongation during bone growth). Banu et al. found differences in bone properties in the distal femoral metaphysis as a result of wheel running in adult rats though no differences were found in the femoral neck (Banu, 2001). Therefore, bone type and location, even within the same bone, are important considerations when studying bone adaptation because of varying mechanical demands.
Bone tissue properties determine overall bone strength and how it changes with respect to changes in loading, e.g. exercise. The relative size and shape of bone is established upon reaching adulthood, mainly due to genetic influence. Bone tissue composition is also under genetic control, although bone tissue is altered in response to mechanical demand
(Frost, 1964). There are two main types of bone tissue: cortical (i.e. compact or haversian) and trabecular (i.e. cancelleous or spongy). Cortical bone is dense and is only
5 10% porous; whereas, trabecular bone is 75 95% porous (Martin, 1998). Cortical bone can be found as a cortex surrounding trabecular bone in bones such as in vertebrae and at the ends of long bones. The shafts of long bones are also composed of cortical bone.
Cortical bone contains bundles of bone and supportive tissues called osteons. They are composed of Haversian canals that contain nerves and capillaries which are surrounded by circular layers of bone. Trabecular bone, on the other hand, is composed of trabeculae
11 which are rod like structures that are attached to each other and form a structure resembling a web. This design allows for numerous spaces between the trabeculae which makes trabecular bone porous. The mechanical properties of cortical and trabecular bone are very different. Trabecular bone is weaker and more compliant than cortical bone
(Rho, 1993) and is located within bones such as vertebrae and at the ends of long bones near the joints. Cortical bone surrounds trabecular bone and is located in the shafts of long bones, providing greater strength.
Bone tissue can be further divided into lamellar and woven bone. Lamellar bone is slow to form but does so in a more organized fashion making it stronger than woven bone. Woven bone is made quicker than lamellar bone but in a less organized manner.
Woven bone is randomly arranged and consequently is weaker than lamellar bone.
Woven bone is also formed during growth and in response to bone injuries. Therefore, most adult bone is made of lamellar bone. Bone can also be further broken down into primary bone, bone formed on current bone surfaces during growth, and secondary bone, bone formed after removal of old bone. Adult bone is mainly composed of secondary bone.
The composition of bone also affects bone properties. Bone is mainly composed of an extracellular matrix whose principal constituents are collagen, mineral and water.
Collagen is a structural protein and bone is made of mostly type I collagen which provides tensile strength and flexibility. The osteoid, the collagenous, organic part of the matrix, is formed prior to mineralization. Bone mineral is composed of hydroxyapatite crystals (made of calcium and phosphate) that give bone compressive strength and provides stiffness. Therefore, the amount of mineralization in bone contributes to bone
12 mechanical properties. There are several types of bone cells that make up a small but significant part of bone volume. Osteoblasts are bone cells that form the osteoid. They are mono nucleated “bone forming” cells that originate from mesenchymal cells. On the other hand, osteoclasts are bone cells that are multi nucleated and originate from macrophage cells. Osteoclasts are “bone resorbing” cells that attach to the bone surface, use acid to demineralize the bone and enzymes to degrade bone collagen. Two other bone cells both originate from the bone forming osteoblasts. Osteocytes are bone cells that were previously osteoblast cells that became embedded in bone within spaces called lacunae. Lacunae are connected by canaliculi, small tunnels that aid in osteocyte communication via cellular processes that connect by gap junctions. Osteocytes potentially play a role in sensing mechanical loads experienced by bone. Bone lining cells are the other cells that were also previously osteoblasts, but are no longer active and did not become embedded within the bone. They are found on bone surfaces and are believed to aid in mechanical sensing and cellular communication.
Modeling and remodeling are cellular processes that remove and replace bone tissue. Osteoclasts and osteoblasts work at separate locations during the modeling process in order to shape bone as development occurs. However, remodeling occurs throughout a person’s lifetime in order to repair damage and increase the mechanical efficiency of bone in response to the demands it experiences. Remodeling involves osteoclasts and osteoblasts working as a team in one location. Groups of osteoclasts and osteoblasts working together are called basic multicellular units (BMUs), a term defined in the 1960s by Harold Frost, an orthopaedic surgeon, who also contributed to the ideas that bone function is primarily to respond to mechanical demand in addition to being a source of
13 calcium (Frost, 1969). There are approximately a dozen osteoclasts and hundreds of osteoblasts within a BMU that work during the three stages of a BMU’s lifetime. These stages are activation, resorption and formation (ARF). Osteoclasts are formed during the activation stage and begin to resorb bone. Then, differentiation of osteoblast cells occurs and they begin to replace bone previously resorbed by the osteoclasts. Following formation of new osteoid by the osteoblast cells, mineralization occurs and hydroxyapatite crystals are deposited within the osteoid. Remodeling occurs within cortical bone (known as osteonal remodeling) and on the surfaces of trabecular bone. The inner surface of bone (e.g. femoral shaft), known as the endosteum and the outer surface, the periosteum, are also sites of bone remodeling. Within cortical bone, resorption cavities are formed during the initial stages of remodeling which then become secondary osteons upon being filled again with bone (with the exception of the Haversian canal).
Trabecular bone does not have osteons because the trabeculae are two small so remodeling occurs on the surfaces of trabeculae and usually occurs faster than cortical bone remodeling. Small animals such as rodents do not have osteons, therefore, remodeling occurs on trabecular surfaces and the endosteal and periosteal surfaces of cortical bone.
Exercise Studies
Numerous methods of enhanced mechanical loading have been applied to rodent models to evaluate the effects on bone adaptation (e.g. running, jumping and climbing).
Although studying animals is not the same as studying humans directly, rodents provide useful models for studying bone adaptation. In addition to allowing for invasive testing
14 not possible in humans, small animals have a relatively short lifespan (mice reach peak bone mass at 4 months of age (Beamer, 1996) making it possible to examine large numbers of animals at various stages of their life span fairly quickly. Mice and rats also can be genetically manipulated through controlled matings and can be housed in a controlled environment. Rodents are tetra pedal vs bi pedal, but the bones of the vertebral skeleton are generally similar, despite the species.
Studies on the effects of exercise on bone in rodents have a great variety of aims and designs, with many including factors such as age, gender, bone health (normal vs pathologic) and genetic background. Different studies also examine different bones.
Limb bones and vertebrae are commonly studied because they are mechanically loaded with the chosen exercise interventions. Osteoporotic fractures also commonly occur in vertebrae and in the hip (femoral neck) and in areas with greater trabecular bone. Both rats and mice have often been used in closely related studies and although rats are much larger in size, mice are very similar in regards to bone structure.
The positive effects of various modes of exercise have been shown in mice and rats. The following studies mainly highlight effects on cortical bone in the femur (most specifically at the mid shaft) and parameters of the femoral neck/head. The femur is a load bearing bone in the hind limb that is exposed to considerable mechanical demand. It articulates with the pelvis to form the hip (which as mentioned above is a common fracture site). In growing mice (BALB/c), increased gravity (via centrifugation) and a high amount of litter that increased digging, resulted in greater cortical cross sectional area, moment of inertia, and anterior cortical thickness in the femur (Gordon, 1989).
Voluntary wheel running in adult, female rats (F344) also resulted in an increased in
15 cortical bone area and mineral content in the distal femur and femoral neck. There was a significant increase in trabecular bone at the distal femur metaphysis and femoral neck as well. (Banu, 2001).
Treadmill running has been shown to induce positive effects on bone parameters in rodents. In a study on “subadult” (3 months old at start of intervention), female mice
(CD 1 strain), treadmill running for 30 minutes/day (5 days/week for 4 weeks) at a speed of 12 meters/minute resulted in an increase in cortical bone at the mid shaft of the femur.
Specifically, treadmill running resulted in increased cortical area, periosteal and endosteal circumference, moment of inertia, and bone mineral content. Treadmill running also increased the femoral head diameter (Hamrick, 2006a).
In young, growing mice, treadmill running for 30 minutes/day (7 days/week for 4 weeks) at a speed of 12 meters/minute and an incline of 10 degrees also increased bone parameters in ovariectomized (OVX; causes bone loss due to removal of sex organs that produce estrogen, method commonly used to simulate the effects of menopause) animals
(ddY strain). Cross sectional area and periosteal perimeter at the femoral mid shaft were increased as well as bone mineral density of the whole femur (Wu, 2001). In a similar study, treadmill running also increased bone mineral density of the whole femur in young, OVX mice (Wu, 2004a). In another similar study though in young, male mice, treadmill running increased bone mineral density of the femur as well as periosteal bone formation (Wu, 2004b). In adult, female rats, treadmill running for 40 minutes/day (4 days/week for 3 months) at a speed of 21 meters/minute and at a 7% incline increased the bending strength of the femur, specifically ultimate load and yield displacement
(Barengolts, 1993). In another study on adult, OVX rats (Wistar), treadmill running for 1
16 hour/day (5 days/week for 12 weeks) at a speed of 12 meters/minute resulted in increased breaking strength of the femoral shaft (Iwamoto 1998).
Running is considered an aerobic exercise and is an intervention method applicable to humans, as are resistance based exercise methods that expose bone to different mechanical loads than aerobic exercise. Tower climbing is a resistance based method of exercise that has been used to study bone adaptation. Climbing exercise in growing, female mice (C57BL/6J) via a custom made mesh wire tower (100 cm tall) attached to cages with water bottles at the top of the towers to encourage climbing, resulted in increased bone mineral density (BMD) of the femur after 4 weeks of climbing.
The periosteal bone formation rate, cross sectional area and moment of inertia were also increased as a result of climbing, though there were no endosteal changes (Mori, 2003).
In a similarly designed climbing study, growing rats (Sprague Dawley) climbed 200 cm tall towers that resulted in increased cross sectional area, moment of inertia, mineralizing surface on the periosteum, mineral apposition rate and bending load of the femur after 4 weeks, though endosteal mineral apposition rate decreased (Notomi, 2001).
In adult, OVX rats (Sprague Dawley), after three months of tower climbing, femoral cross sectional morphology was improved though cortical area did not change (Notomi,
2003).
Genetics
Inbred mice are genetically identical and provide essentially an infinite amount of
“twin” mice that can be used to eliminate confounding genetic effects. They can also be used to determine if genetic strains differ in their responses to exercise, thereby implying
17 a genetic effect. C57BL/6J (B6) and DBA/2J (D2) mice are inbred mouse strains commonly used to study bone. They are known to have different skeletal phenotypes, providing evidence of genetic influence on bone tissue. The cross sectional area and moment of inertia in the mid diaphysis of the femur has been shown to be greater in B6 mice than in D2 mice (Akhter, 2000). B6 mice have also been shown to have greater cortical volume; whereas, D2 mice have greater cortical density and mineralization as well as cortical thickness in the femur despite similar body weights in adult female mice
(Beamer, 1996). The modulus of elasticity and hardness of cortical bone from the femur of adult, female mice was shown to be greater in the D2 strain than the B6 strain as well
(Akhter, 2004).
Comparing differences in gene expression in skeletal tissue between the B6 and
D2 strains also provides candidate genes related to skeletal phenotypes because there are known differences in the phenotypes between these two strains. Moreover, Quantitative
Trait Loci (QTL; regions of DNA linked to phenotypic traits) using progeny from crosses between B6 and D2 mice were identified for bone phenotypes (Lang, 2005). Therefore, genes with expression differences between the B6 and D2 strains located within the same chromosomal regions as the identified QTL can be considered candidate genes for the associated phenotypes.
B6 mice are also known to be more active than D2 mice (Kaye, 1995; Tang,
2002; Lerman, 2002). There are also differences in the treadmill running abilities with B6 mice having a greater aerobic capacity than D2 mice (Lightfoot, 2001). However, in a study of young, male mice, D2 mice had a greater performance measure while running on a treadmill than B6 (e.g. B6 mice stopped running more times) (Lerman, 2002).
18 Genetic differences in the response of bone to mechanical loading have also been shown.
In a study of adult female mice, B6 and D2 mice both had significant responses to in vivo loading in the ulna while C3H mice, another frequently utilized inbred strain, was less responsive, showing the influence of genetic background (Robling, 2002). In young, female mice, in vivo loading resulted in increased bone mineral density of the tibia in B6 mice, but not in C3H /HeJ mice (Kesavan, 2005).
Using an inbred mouse strain to compare differences in gene expression as a result of enhanced mechanical loading via exercise potentially provides candidate genes that are involved in bone adaptation. Identifying genes related to bone adaptation can aid in the search for treatments that positively affect bone and decrease fracture risk.
Differences in the expression of marker genes for bone formation and resorption were explored in young, female mice exposed to in vivo loading. Loading significantly down regulated bone resorption genes (including TRAP (thrombin receptor activating protein) and MMP 9 (matrix metalloproteinase 9)) as well as up regulated bone formation genes
(including Type 1 collagen, alkaline phosphatase sialoprotein) (Kesavan, 2005). The
FosB gene, known to stimulate bone formation, was also shown to be induced by in vivo loading in young, male mice (ICR) (Inoue, 2004). Runx2 is a transcription factor involved in osteoblast differentiation and has been shown to increase in response to mechanical loading as well (Ziros, 2002). These results support the idea that bone formation genes are up regulated with increased loading and bone resorption genes are down regulated. Therefore, further exploration of the genes and the genetic pathways involved in bone adaptation can provide insight into how bone is able to detect mechanical loads and alter its structural properties.
19 The Wnt signaling pathway has been shown to be activated in response to mechanical loading (Robinson, 2006) and this pathway includes many genes studied in relation to bone adaptation such as Lrp5 (low density lipoprotein receptor related protein
5), Beta catenin and SOST. In a study on tibia from B6 mice, loading using in vivo techniques resulted in genes related to the Wnt pathway as being differentially expressed relative to controls. In estrogen receptor KO mice exposed to loading, less genes from the Wnt pathway differed when compared to the controls. This suggests that the Wnt pathway is involved in bone adaptation and the estrogen receptor is a required component of the pathway (Armstrong, 2007).
Many hormones, in addition to estrogen, are known to play a large role in bone maintenance. Parathyroid hormone (PTH) is known to stimulate osteoclast cells (Mears,
1971; Miller, 1985) and subsequently bone resorption occurs which increases calcium levels. On the other hand, the hormone calcitonin inhibits osteoclast cells (Zaidi, 1987).
The hormone estrogen also plays an important role in both bone formation through action on osteoblasts (Eriksen, 1998) and bone formation by inhibiting osteoclast cells (Oursler,
1991). Leptin is another hormone that regulates bone mass (Karsenty, 2002). Local regulators of bone are also important and include growth factors such as BMPs (bone morphometric proteins) that stimulate bone formation (Celeste, 1992).
Indirect Influences
Bone adaptation involves a response to mechanical demand. The actual forces placed on bone originate from muscles attached to various bone sites and loading from body weight caused by gravity. Behavioral differences such as natural activity levels also
20 play a role in the amount of loading experienced by bone. Therefore, genetic effects on muscle, body weight and behavior indirectly affect bone.
Muscles produce the largest forces experienced by bone because they function at a mechanical disadvantage due to the short distance between where they attach and where the joint center is located. Mice with increased muscle mass have been shown to have a greater response to treadmill running in regards to bone strength than mice with smaller muscles (Hamrick, 2006b). In a study on young, mice, muscle weights were different between two genetic strains (B6 & A/J), showing genetic influence on muscle size (and as a result, muscle force) as well. Muscle weight has been shown to be correlated with the weight of the femur (Kaye, 1995). Therefore, exploring differences in muscle mass, relative to genetic strain and increased loading, may provide further insight as to the effects on bone. Additionally, identifying genes related to muscle differences as a function of exercise may provide candidate genes with effects indirectly related to bone.
Voluntary wheel running in young male mice (B6) resulted in increased expression of myosin heavy chain (MHC) IIa in the gastrocnemius and tibialis anterior (Allen, 2001), indicating increased muscle formation.
Body weight is the second largest source of loading on bone and has been shown to be related to bone mass in mature B6 mice (Iwaniec, 2009). Body weight is also influenced by genetics as shown in a study by Klein, et al. (Klein, 1998). Studying differences in body weight may also provide information in regards to indirect effects on bone.
Activity levels can affect bone directly or indirectly through muscle to bone. If an animal is naturally more active, their bones may be stronger as a result. Therefore,
21 animals that are less active may have a greater adaptive response to forced exercise intervention than those that are active. Although, animals with higher natural activity levels have a greater response to voluntary wheel running because they are more likely to run. This is an important consideration because the effects of exercise interventions may be confounded by natural activity level differences.
Summary
Many studies have shown the positive effects of exercise on bone homeostasis at both the phenotypic and genotypic level. However, there are many details regarding bone adaptation that still to be learned and studies typically utilize young animals and/or loading techniques that produce supra physiological loads. Osteoporosis, in particular, is an age related bone disease. Therefore, using an adult mouse model as was used in this study provides greater value towards understanding bone adaptation across the life span.
Physiologically plausible methods of loading such as the exercise modes used in this study are also more insightful because they provide information regarding methods that may have therapeutic value regarding human interventions. Finally, exploring the gene environment interaction may someday enable more individualized interventions that consider a person’s phenotype.
22 References
Akhter, M.P., Iwaniec, U.T., Covey, M.A., Cullen, D.M., Kimmel, D.B., and Recker, R.R. (2000) Genetic variations in bone density, histomorphometry, and strength in mice. Calcified Tissue International, 67: 337 344.
Akhter, M.P., Fan, Z., and Rho, J.Y. (2004) Bone intrinsic material properties in three inbred mouse strains. Calcified Tissue International, 75: 416 420.
Allen, D.L, Harrison, B.C., Maass, A., Bell, M.L., Byrnes, W.C., and Leinwand, L.A. (2001) Cardiac and skeletal muscle adaptations to voluntary wheel running in the mouse. Journal of Applied Physiology, 90: 1900 1908.
Armstrong, V.J., Muzylak, M., Sunters, A., Zaman, G., Saxon, L.K., Price, J.S., and Lanyon, L.E. (2007) Journal of Biological Chemistry, 202 (28): 20715 20727.
Banu, J., Orhii, P.B., Okafor, M.C., Wang, L., and Kalu, D.N. (2001) Analysis of the effects of growth hormone, exercise and food restriction on cancellous bone in different bone sites in middle aged female rats. Mechanisms of Ageing and Development, 122: 849 864.
Bargentolts, E.I, Curry, D.J., Bapna, M.S., and Kukreja, S.C. (1993) Effects of endurance exercise on bone mass and mechanical properties in intact and ovariectomized rats. Journal of Bone and Mineral Research, 8: 937 942.
Beamer, W.G., Donahue, L.R., Rosen, C.J., and Baylink, D.J. (1996) Genetiec variability in adult bone density among inbred strains of mice. Bone, 18(5): 397 403.
Celeste, A.J., Taylor, R., Yamaji, N., Wang, J., Ross, J., and Wozney, J.M. (1992) Molecular cloning of BMP 8: a protein present in bovine bone which is highly related to BMP5/6/7 subfamily of osteoinductive molecules. Journal of Cellular Biochemistry, 16F: 100.
Eriksen, E.F., Colvard, D.S., Berg, N.J., Graham, M.L., Mann, K.G., Spelsberg, T.C., and Riggs, B.L. (1988) Evidence of estrogen receptors in normal human osteoblast like cells. Science, 241: 84 86.
Frost, H.M. (1969) Tetracylcine based histological analysis of bone remodeling. Calcified Tissue Research, 3: 211 237.
Frost, H.M., Ferretti, J.L., and Jee, W.S. (1998) Perspectives: some roles of mechanical usage, muscle strength, and the mechanostat in skeletal physiology, disease, and research. Calcified Tissue International, 62: 1 7.
23 Gordon, K.R., Perl, M., and Levy, C. (1989) Structural alterations and breaking strength of mouse femora exposed to three activity regimens. Bone, 10: 303 312. Hamrick, M.W., Skedros, J.G., Pennington, C., and McNeil, P.I. (2006a) Increased osteogenic response to exercise in metaphyseal versus diaphyseal cortical bone. Journal of Musculoskeletal Neuronal Interactions, 6 (3): 258 263
Hamrick, M.W., Samaddar, T., Pennington, C., and McCormick, J. (2006b) Increased muscle mass with myostatin deficiency improves gains in bone strength with exercise. Journal of Bone and Mineral Research, 21 (3): 477 483.
Hoshi, A., Watanabe, H., Chiba, M., and Inaba, Y. (1998) Effects of exercise at different ages on bone density and mechanical properties of femoral bone of aged mice. Tohoku Journal of Experimental Medicine, 185: 15 24.
Inoue, D., Kido, S., and Matsumoto, T. (2004) Transcriptional induction of FosB/deltaFosB gene by mechanical stress in osteoblasts. Journal of Biological Chemistry, 279 (48): 49795 49803.
Iwamoto, J., Takeda, T., and Ichimura, S. (1998) Effects of exercise on bone mineral density in mature osteopenic rats. Journal of Bone and Mineral Research, 13 (8): 1308 1317.
Iwaniec, U.T., Dube, M.G., Boghossian, S., Song, H., Helferich, W.G., Turner, R.T., and Kalra, S.P. (2009) Bone, 44: 404 412.
Kaye, M., and Kusy, R.P. (1995) Genetic lineage, bone mass, and physical activity in mice. Bone, 17 (2): 131 135.
Kesavan, C., Mohan, S., Oberholtzer, S., Wergedal, J.E., and Baylink, D.J. (2005) Mechanical loading induced gene expression and BMD changes are different in two inbred mouse strains. Journal of Applied Physiology, 99: 1951 1957.
Klein, R.F., Mitchell, S.R., Phillips, T.J. Belknap, J.K., and Orwoll, E.S. (1998) Quantitative trait loci affecting peak bone mineral density in mice. Journal of Bone and Mineral Research, 13: 1648 1656.
Kuruvilla, S.J., Fox, S.D, Cullen, D.M., and Akhter, M.P. (2008) Site specific bone adaptation response to mechanical loading. Journal of Musculoskeletal Neuronal Interactions, 8 (1): 71 78.
Lang, D.H., Sharkey, N.A., Mack, H.A., Vogler, G.P., Vandenbergh, D.J., Blizard, D.A., Stout, J.T., and McClearn, G.E. (2005) Journal of Bone and Mineral Research, 20 (1): 88 99.
24 Lerman, I., Harrison, B.C., Freeman, K., Hewett, T.E., Allen, D.L., Robbins, J., and Leinwand, L.A. (2002) Genetic variability in forced and voluntary endurance exercise performance in seven inbred mouse strains. Journal of Applied Physiology, 92: 2245 2255.
Lightfoot, J.T., Turner, M.J., Debate, K.A., and Kleeberger, S.R. (2001) Interstrain variation in murine aerobic capacity. Medicine and Science in Sports and Exercise, 33 (12): 2053 2057.
Martin, R.B., Sharkey, N.A., and Burr, D.B. Skeletal Tissue Mechanics . 1998. New York, NY, Springer Verlag.
Mears, D.C. (1971) Effects of parathyroid hormone and thyrocalcitonin on the membrane potential of osteoclasts. Endocrinology, 88: 1021 1028.
Miller, S.C., and Kenny, A.D. (1985) Activation of avian medullary bone otseoclasts by oxidized synthetic parathyroid hormone (1 34). Proceedings of the Society for Experimental Biology and Medicine, 179: 38 43.
Mori, T., Okimoto, N., Sakai, A., Okazaki, Y., Nakura, N., Notomi, T., and Nakamura, T. (2003) Climbing exercise increases bone mass and trabecular bone turnover through transient regulation of marrow osteogenic and osteoclastogenic potentials in mice. Journal of Bone and Mineral Research, 18 (11): 2002 2009.
Notomi, T., Okimoto, N., Okazaki, Y., Tanaka, Y., Nakamura, T., and Suzuki, M. (2001) Effects of tower climbing exercise on bone mass, strength, and turnover in growing rats. Journal of Bone and Mineral Research, 16 (1): 166 174.
Notomi, T., Okimoto, N., Okazaki, Y., Nakamura, T., and Suzuki, M. (2003) Tower climbing exercise started 3 months after ovariectomy recovers bone strength of the femur and lumbar vertebrae in aged osteopenic rats. Journal of Bone and Mineral Research, 18 (1): 140 149.
Oursler, M.J., Osdoby, P., Pyfferoen, J., Riggs, B.L. and Spelsberg, T.C. (1991) Avian osteoclasts as estrogen target cells. Proceedings for the National Academy of Sciences USA, 88: 6613 6617.
Rho, J.Y., Ashman, R.B., and Turner, C.H. (1993) Young’s modulus of trabecular and cortical bone material: ultrasonic and microtensile measurements. Journal of Biomechanics, 26 (2): 111 1119.
Robling, A.G., and Turner, C.H. (2002) Mechanostransduction in bone: genetic effects on mechanosensitivity in mice. Bone, 31 (5): 562 569.
25 Tang, X., Orchard, S.M., and Sanford, L.D. (2002) Home cage activity and behavioral performance in inbred and hybrid mice. Behavioral Brain Research, 136: 555 569.
Wallace, J.M., Rajachar, R.M., Allen, M.R., Bloomfield, S.A., Robey, P.G., Young, M.F., and Kohn, D.H. (2007) Exercise induced changes in the cortical bone of growing mice are bone and gender specific. Bone, 40: 1120 1127. Wolff, J. The Law of Bone Remodeling . 1892. Translation of Wolff’s Das Gesetz der Transformaton der Knochen by P. Marquet and R. Furlong. Springer Verlag, Berlin.
Wu, J., Wang, X.X., Takasaki, M., Ohta, A., Higuchi, M., and Ishimi, Y. (2001) Cooperative effects of exercise training and genistein administration on bone mass in ovariectomized mice. Journal of Bone and Mineral Research, 16 (10): 1829 1836.
Wu, J., Wang, X., Chiba, H., Higuchi, M., Nakatani, T., Ezaki, O., Cui, H., Yamada, K., and Ishimi, Y. (2004a) Combined intervention of soy isoflavone and moderate exercise prevents body fat elevation and bone loss in ovariectomized mice. Metabolism, 53 (7): 942 948.
Wu, J., Wang, X.X., Higuchi, M., Yamada, K., and Ishimi, Y. (2004b) High bone mass gained by exercise in growing male mice is increased by subsequent reduced exercise. Journal of Applied Physiology, 97: 806 810.
Zaidi, M., Moonga, B.S., Bevis, P.J.R., Towhidul Alam., A.S.M., Legon, S., Wimalawansa, S., MacIntyre, I., and Breimer, L.H. (1991) Expression and function of the calcitonin gene products. Vitamins and Hormones, 46: 87 164.
Ziros, P.G., Gil, A.P., Georgakopoulos, T., Habeos, I., Kletsas, D., Basdra, E.K., and Papavassiliou, A.G. (2002) The bone specific transcriptional regulator Cbfa1 is a target of mechanical signals in osteoblastic cells. Journal of Biological Chemistry, 277 (26): 23934 23941.
26 Chapter 3
Effects of Treadmill Running and Tower Climbing on Femoral Strength in C57BL/6J and DBA/2J Adult Female Mice
Abstract
It is widely accepted that bones are able to adapt to changes in their loading environment by altering their structural strength. The details of this adaptation are still being explored, including elucidation of the genes involved. The main focus of this study was to further explore gene environment interactions relative to bone adaptation.
Increasing our understanding of these interactions may someday enable more individualized interventions that consider a person’s genotype when treating bone diseases such as osteoporosis. Two different inbred mouse strains with known differences in skeletal phenotypes, C57BL/6J (B6) and DBA/2J (D2), were exposed to two different regimens of mechanical loading: treadmill running, an aerobic exercise intervention, and tower climbing, an intervention more similar to resistance training. Ninety adult (180 days of age), female mice from both strains were equally divided into running, climbing and non exercised groups (n=15 per group). After five weeks of intervention, the mice were killed and the right femur was harvested from each mouse. Morphological parameters were measured and the bones were scanned using micro computed tomography in order to evaluate the cross sectional geometry of the mid shaft.
Mechanical properties of the femoral diaphysis were then assessed via three point bending and the femoral neck was broken in a shear test. We hypothesized that there would be differential skeletal responses relative to exercise type within each strain. In B6 mice, treadmill running and tower climbing increased load at yield and work to yield of
27 the femoral mid shaft; whereas, tower climbing decreased work, displacement and strain at ultimate load. There were no changes for D2 mice relative to treatment in the femoral mid shaft. Tower climbing decreased ultimate load and work of the femoral neck in D2 mice and treadmill running increased ultimate load of the femoral neck in B6 mice. The results of this study provide further evidence that bone adaptation in response to physiologically plausible interventions is dependent on genetic architecture.
Introduction
Bone is a dynamic tissue. It provides the body with support and mobility and is able to adapt to changes in functional demand because it has an inherent ability to resist fracture by altering its structural strength. The demands placed upon bone can vary greatly and bone responds accordingly, presumably to maintain metabolic efficiency. The principle behind functional bone adaptation is accredited to Julius Wolff who first published on the topic in 1892. Though it still remains rather loosely defined, “Wolff’s
Law” is a well accepted phenomenon with many investigators pursuing its mechanistic underpinnings in the hope of developing new therapeutic approaches for osteoporosis.
However, the response of bone to mechanical demand is complex and involves genetic interactions directly affecting bone tissue, as well as potential indirect influences on bone via genes that affect such things as behavior, muscle force and body weight.
A comprehensive understanding of how mechanical loading is detected and transduced by bone cells, including the genes involved, remains elusive.
Inbred mice provide a useful model for studying bone adaptation as a function of genetics and exercise. An inbred mouse strain provides essentially an infinite amount of nearly identical genetic replicates. Therefore, an inbred strain can be used to look at
28 exercise effects without confounding genetic effects. Different inbred strains of mice can also be compared in order to determine the effect of genetic differences. The two strains chosen for this study, C57BL/6J (B6) and DBA/2J (D2), are commonly utilized to study bone and are known to have different skeletal phenotypes (Beamer, 1996; Akhter, 2000;
Akhter, 2004; Lang, 2005).
Genetic differences have been shown to play a role in the variability of bone properties in mice (Beamer, 1996). Genetics has also been proven to significantly impact bone adaptation. In adult, female mice, in vivo loading of the ulna produced different responses in three different inbred strains (Robling, 2002). In vivo tibial loading also produced different responses across genetic strains (Akhter, 1998; Kesavan, 2005).
Likewise, jumping, a more natural method of enhanced mechanical loading, produced genetic strain dependent alterations in the mechanical properties of the tibia and femur of young, female mice (Kodoma, 2000).
Numerous methods of enhanced mechanical loading have been used to explore bone adaptation in rodent models. Treadmill running is a commonly used method that produces positive effects on bone properties (Iwamoto 1998; Wu, 2001; Hamrick, 2006).
Tower climbing has also been used successfully (Notomi, 2001; Notomi, 2003; Mori,
2003). Both treadmill running and tower climbing were chosen for this study because they are different in terms of the mechanical demands placed on the long bones of the hindlimb; treadmill running is an aerobic exercise and tower climbing is a more resistance based type of exercise.
29 Defining differences in bone properties as a function of genetic strain and treatment via naturally feasible methods of exercise may provide more insight into the details of bone adaptation as compared to in vivo loading techniques aimed at expediting the process of bone adaptation by using supra physiological loads of no therapeutic value. The enhanced loading methods used in this study expose bone to achievable loading environments that are practical and of more potential therapeutic value. Many studies use young animals to look at bone adaptation because there is typically a greater response to loading in growing bones (Hoshi, 1998). Therefore, using adult mice to look at bone adaptation is both a challenge and a strength of this study. A more comprehensive understanding of bone adaptation across the lifespan is essential because our bones naturally change with age and osteoporosis is a prevalent age related bone disease.
The focus of this study was to explore bone adaptation in terms of the interaction between genetics and mechanical demand using adult mice. It was hypothesized there would be differential skeletal responses relative to exercise type within each strain.
Specifically, it was hypothesized that both types of exercise would increase the mechanical capacity of the skeleton, but tower climbing would have a greater impact than treadmill running. Notomi, et al. compared treadmill running and jumping on femoral strength in young rats and found resistance exercise was more effective than aerobic exercise (Notomi, 2000). It was also hypothesized there would be differences based upon genetic strain with B6 mice showing a greater response. B6 mice were more responsive to in vivo mechanical loading than D2 mice with measures including cortical bone
30 mechanical properties as determined by three point bending in a study on the ulna of adult, female mice (Robling, 2002).
Materials and Methods
Animals and Experimental Design
Mice were raised in a barrier facility at the Center for Developmental and Health
Genetics at Penn State University and then transferred to the Penn State Noll Physiology
Laboratory two weeks prior the start of treatment. After the mice were weaned, they were placed on a reverse twelve hour light cycle which was continued throughout the duration of the experiment.
Ninety adult (180 day old) female mice equally divided between B6 and D2 inbred strains were exposed to treadmill running, tower climbing or served as controls
(15 in each group). The five week exercise intervention was conducted with five cohorts staggered over a span of nine months with 3 mice from each strain by treatment group in each cohort. The treadmill runners were put onto a rodent treadmill 5 days per week for
5 weeks and the speed, incline and duration were gradually increased until a target speed of 15 m/min at a 25 degree incline for 30 minutes was attained. The mice were encouraged to run through the use of hand prodding, puffs of air, and an electric stimulus
(impulse of 0.76mA for 2ms at 2 pulses per second) in that order. No animals were removed from the study despite strict guidelines regarding monitoring the mice and the amount of stimuli required to maintain running.
The tower climbers were housed in a cage attached to a 120 cm tall mesh wire tower 17 cm wide with water bottles placed at the top of the tower. Tower climbers remained in the towers 24 hours per day for a 5 week period. To train the mice to climb,
31 the water bottles were placed at a height of 20 cm from the bottom of the tower and gradually raised 20 cm per day during the first week with a final height of 100 cm from the bottom of the tower to the tips of the water bottles. The mice climbed to the top of the towers to drink during the remaining weeks of the intervention. The mice were weighed on a weekly basis to ensure they were not losing excessive weight as a result of the treatments and both food and water for all the mice was provided ad libitum. Upon completion of the intervention, the mice were euthanized two hours after the last treadmill running session or removal from towers and the right femur was harvested and frozen at –20C until tested. All procedures complied with and were approved by the
Pennsylvania State University Institutional Care and Use Committee.
Morphological Parameters
The femurs were thawed prior to gross morphological measurements that included femoral length, coronal and sagittal width at the mid diaphysis, epiphyseal width, and neck and head diameter. Prior to mechanical testing, a cross sectional image of the mid diaphysis was obtained using micro computed tomography (Scanco Medical, Zurich,
Switzerland). The cross sectional image was evaluated using a custom written MATLAB program (Version 7.3.0.267 (R2006b), The MathWorks, Inc.) to determine cortical morphology of the mid shaft. Total area within the periosteal surface, medullary area within the endosteal surface, cortical area, cross sectional moment of inertia (CSMI) relative to the axis of bending and 90 degrees to the axis of bending, average cortical thickness and cortical thickness and radii at the anterior, lateral, posterior and medial mid diaphysis were evaluated.
32 Three Point Bending
The femur was loaded to failure in three point bending using a Materials Testing
System 858 Mini Bionix apparatus (MTS Systems, MN, USA) with an 8mm support span length. Structural properties were derived from load displacement data and included load (yield and ultimate), displacement and work (at yield, ultimate, and failure loads) and stiffness of the femur. Post yield data were also explored by looking at displacement and work between yield and maximum as well as between yield and failure.
Femoral eck Shear Test
After the femoral shaft was broken in bending, the proximal fragment of the femur was used to measure the functional strength of the inter trochanteric region and femoral neck. The femoral neck was loaded to failure using a shear test and the same materials testing equipment was used along with a 2mm diameter loading nose. The proximal femur was secured using a screw tightened base that held the proximal end of the femur at the greater trochanter. Structural properties derived included ultimate load, displacement and work.
Material Properties
Cross sectional data, together with data from the flexural tests, were used to
2 calculate the yield and ultimate stress ( σ = F L c / 4 I) and strain (ε = 12 c d /L ), and elastic modulus (E = F L 3 / d 48 I) of each diaphysis. Equations for material properties are derived using beam theory; where σ is the bending stress, F is yield or ultimate load,
L is unsupported span length, c is the distance from the cross section centroid to the tensile periosteal surface, I is the cross sectional moment of inertia, and d is the machine displacement.
33 Statistics
Statistical screening and analyses were performed using SPSS Statistics 16.0. All phenotypic measures were screened for normality and when necessary a log, square root or inverse transformation was used. In addition, all measures were adjusted for body size through regression of body weight onto each phenotype, with the residuals constituting the adjusted phenotype. Both unadjusted and body size adjusted phenotypes were then evaluated for group differences due to exercise and/or inbred strain. An ANOVA was used to evaluate the effects of genetic strain and exercise type within each strain on all structural, material and morphological measures. Post hoc multiple comparisons were made using a 2 sided Dunnett test where treadmill running and tower climbing were compared to controls. Differences at the 95% confidence level were considered significant, while those at 90% were considered suggestive.
Results
Genetic Strain Effect on Femoral Parameters
Differences in femoral parameters as a function of genetic strain were observed
(Table 1). Data adjusted for body weight yielded similar results (data not shown). Gross morphology measures including sagittal and coronal mid shaft and epiphyseal widths and head and neck diameters resulted in strain related differences (Table 3 1A). B6 mice had significantly wider diaphysis and epiphysis and larger head and neck diameters as compared to D2 mice. Genetic strain differences in cross sectional morphology were also observed (Table 3 1B). D2 mice had significantly thicker cortices than B6 mice (with the exception of anterior thickness); whereas, B6 mice had significantly greater area
(cortical, medullary and total), radii (inner and outer) and moment of inertia.
34 Table 3 1: Differences in gross and cross sectional morphology of the femur as a function of genetic strain. Means and standard errors are shown. Group differences were determined using a 1 way ANOVA for genetic strain. P value < 0.005 considered highly significant, < 0.05 considered significant and < 0.01 considered suggestive. (A) Gross morphology (B) Cross Sectional Morphology
(A) Gross Morphology of the Femur Variable Values B6 D2 Variable Values B6 D2 Length Mean 15.625 15.743 Epiphyseal Width Mean 2.779 2.726 a (mm) SE 0.041 0.057 (mm) SE 0.015 0.016 p-value0.094 p-value 0.017 Sagittal Width Mean 1.302 1.140 Neck Diameter Mean 1.115 1.007 at Mid-Shaft SE 0.010 0.011 (mm) SE 0.022 0.023 (mm) p-value< 0.005 p-value 0.001 Coronal Width Mean 1.770 1.524 Head Diameter Mean 1.492 1.442 at Mid-Shaft SE 0.018 0.014 (mm) SE 0.010 0.008 (mm) p-value0.000 p-value 0.000 (B) Cross Sectional Morphology of the Femoral Mid-Shaft Variable Values B6 D2 Variable Values B6 D2 Cortical Area Mean 0.858 0.819 Posterior Thickness Mean 0.190 0.217 (mm 2) SE 0.007 0.006 (mm) SE 0.003 0.003 p-value< 0.005 p-value < 0.005 Medullary Area Mean 0.866 0.458 Medial Inner Mean 0.606 0.429 (mm 2) SE 0.008 0.006 Radius SE 0.006 0.004 p-value< 0.005 (mm) p-value < 0.005 Total Area Mean 1.724 1.277 Anterior Inner Mean 0.406 0.306 (mm 2) SE 0.011 0.010 Radius SE 0.004 0.004 p-value< 0.005 (mm) p-value < 0.005 Moment of Inertia Mean 0.129 0.083 Lateral Inner Mean 0.485 0.485 bending axis SE 0.002 0.001 Radius SE 0.005 0.006 (mm 4) p-value< 0.005 (mm) p-value < 0.005 Moment of Inertia Mean 0.246 0.155 Posterior Inner Mean 0.333 0.333 90 deg to bending SE 0.003 0.003 Radius SE 0.004 0.004 (mm 4) p-value< 0.005 (mm) p-value < 0.005 Average Thickness Mean 0.179 0.210 Medial Outer Mean 0.853 0.733 (mm) SE 0.001 0.001 Radius SE 0.004 0.005 p-value< 0.005 (mm) p-value < 0.005 Medial Thickness Mean 0.247 0.303 Anterior Outer Mean 0.642 0.546 (mm) SE 0.004 0.003 Radius SE 0.003 0.004 p-value< 0.005 (mm) p-value < 0.005 Anterior Thickness Mean 0.237 0.241 Lateral Outer Mean 0.969 0.783 (mm) SE 0.002 0.002 Radius SE 0.005 0.005 p-value0.252 (mm) p-value < 0.005 Lateral Thickness Mean 0.241 0.297 Posterior Outer Mean 0.641 0.551 (mm) SE 0.005 0.005 Radius SE 0.003 0.003 p-value< 0.005 (mm) p-value < 0.005
35
Significant differences in genetic strain were identified for all measured structural properties of the femoral shaft (Table 3 2A). B6 mice had significantly greater stiffness, load, displacement, and work at ultimate load as well as post yield displacement and work to ultimate load. D2 mice, on the other hand, had significantly greater load, displacement and work at yield. Differences in structural properties of the femoral neck were also examined (Table 3 2B). Although no genetic strain differences were identified for displacement and work at ultimate load for the femoral neck, the ultimate load was greater in D2 mice compared with B6 mice (p=0.062). Differences in genetic strain were identified for material properties as well (Table 3 2C). The strain at ultimate load was higher in B6 mice; however, elastic modulus, stress and strain at yield, and stress at ultimate load were greater in D2 mice.
36
Table 3 2: Differences in structural and material properties of the femur as a function of genetic strain. Means and standard errors are shown. Group differences were determined using a 1 way ANOVA for genetic strain. P value < 0.05 considered significant and < 0.01 considered suggestive. (A) Structural properties of femoral shaft (B) Material properties of femoral shaft (C) Structural properties of femoral neck
(A) Structural Properties of the Femoral Shaft Variable Values B6 D2 Variable Values B6 D2 Load at Yield Mean 12.471 14.980 Work to Yield Mean 0.681 1.083 (N) SE 0.271 0.237 (Nmm) SE 0.025 0.024 p-value < 0.005 p-value < 0.005 Load at Ultimate Mean 17.739 16.255 Work to Ultimate Mean 2.434 1.668 (N) SE 0.319 0.229 (Nmm) SE 0.057 0.056 p-value < 0.005 p-value < 0.005 Displacement at Yield Mean 0.098 0.133 Post Yield Work Mean 1.752 0.585 (mm) SE 0.002 0.001 to Ultimate SE 0.060 0.052 p-value< 0.005 (Nmm) p-value < 0.005 Displacement Mean 0.213 0.170 Stiffness Mean 143.738 123.657 at Ultimate SE 0.003 0.003 (N/mm) SE 2.824 2.036 (mm) p-value < 0.005 p-value < 0.005 Post Yield Mean 0.117 0.037 Displacement SE 0.004 0.003 at Ultimate (mm) p-value < 0.005 (B) Material Properties of the Femoral Shaft Variable Values B6 D2 Variable Values B6 D2 Stress at Yield Mean 124.748 199.475 Strain at Ultimate Mean 0.026 0.018 (N/mm 2) SE 2.643 2.823 (N/mm 2) SE 0.000 0.000 p-value < 0.005 p-value < 0.005 Stress at Ultimate Mean 177.257 216.439 Modulus of Elasticity Mean 10642.718 14593.224 (N/mm 2) SE 2.710 2.651 (N/mm 2) SE 185.563 178.462 p-value < 0.005 p-value < 0.005 Strain at Yield Mean 0.012 0.014 (N/mm 2) SE 0.000 0.000 p-value < 0.005 (C) Structural Properties of the Femoral Neck Variable Values B6 D2 Variable Values B6 D2 Load at Ultimate Mean 16.259 17.041 Work to Ultimate Mean 3.255 2.752 (N) SE 0.297 0.305 (Nmm) SE 0.268 0.184 p-value 0.062 p-value 0.141 Displacement Mean 0.293 0.264 at Ultimate SE 0.019 0.015 (mm) p-value 0.229
37
Exercise Treatment Effects on Femoral Parameters
Significant differences were identified as a result of exercise treatment. Data adjusted for body weight yielded similar results (data not shown). In B6 mice tower climbers had significantly larger head diameters than controls (Figure 3 1A) and treadmill runners had a larger outer radius on the anterior surface of the mid shaft compared with controls (Figure 3 1B). In D2 mice, treadmill runners had significantly smaller medullary area (Figure 3 1C) and suggestive trend toward a smaller inner radius in the medial and anterior medullary quadrants as compared to controls (Figure 3 1D).
38 (A) (B) ns p = 0.020 p = 0.050 ns
(C) (D)
p = 0.012 p = 0.056 ns ns
p = 0.079
ns
Figure 3 1: Differences in gross and cross sectional morphology measures as a function of treatment. Means and standard errors are shown. Group differences were determined using a 1 way ANOVA for treatment and a 2 sided Dunnett test was used for post hoc comparisons between controls and treadmill runners or tower climbers. Lines connecting bars show p values for controls vs tower climbers and controls vs treadmill runners (highly significant p < 0.005, significant p < 0.05, suggestive p < 0.1 and ns = not significant). P values are from post hoc results. (A) B6 mice head diameter values for each treatment group (B) B6 mice outer radii values for each treatment group (C) D2 mice medullary area values for each treatment group (D) D2 mice medial and anterior inner radii values for each treatment group
39 Treatment effects on structural properties of the femoral shaft were identified as well with treadmill running significantly increasing load at yield (Figure 3 2A) and work to yield (Figure 3 2B) compared to controls (though it was only suggestive using data adjusted for body weight). Tower climbing significantly increased displacement and work to yield with a suggestive increase in load to yield as compared to controls (Figure
3 2A, 2B, 2C). In contrast to yield properties, tower climbing significantly decreased displacement and work at ultimate load and post yield displacement and work at ultimate load in B6 mice (Figure 3 2D, 2E). Treadmill running also significantly decreased post yield displacement to ultimate load compared with controls (Figure 3 2D).
40 (A) (B) p = 0.054 p = 0.049
p = 0.065 p = 0.014
(C) (D) ns ns p = 0.019 p = 0.002 p = 0.013
p < 0.005
(E) ns
p = 0.008 ns
p < 0.005
Figure 3 2: Differences in structural measures of the femoral shaft for B6 mice as a function of exercise treatment. Means and standard errors are shown. Group differences were determined using a 1 way ANOVA for treatment and a 2 sided Dunnett test was used for post hoc comparisons between controls and treadmill runners or tower climbers. Lines connecting bars show p values for controls vs tower climbers and controls vs treadmill runners (highly significant p < 0.005, significant p < 0.05, suggestive p < 0.1 and ns = not significant). P values are from post hoc results. (A) B6 mice load at yield for each treatment group (B) B6 mice work to yield for each treatment group (C) B6 mice displacement at load for each treatment group (D) B6 mice displacement at ultimate load for each treatment group (E) B6 mice work to ultimate load for each treatment group
41 Treatment differences were also indentified for material properties derived from three point bending mechanical measures of the femoral shaft and cross sectional mid shaft geometry. In B6 mice, tower climbing significantly increased strain at yield with a suggestive increase in stress at yield as compared to controls (Figure 3 3A). However, tower climbing also significantly decreased strain at ultimate load in B6 mice compared to controls (Figure 3 3B). Material properties of the femoral mid shaft of D2 mice were not affected by either exercise treatment.
(A) (B)
ns ns p =0.003 p = 0.096
ns
p = 0.018
Figure 3 3: Differences in material properties of the shaft of B6 mice as a function of exercise treatment. Means and standard errors are shown. Group differences were determined using a 1 way ANOVA for treatment and a 2 sided Dunnett test was used for post hoc comparisons between controls and treadmill runners or tower climbers. Lines connecting bars show p values for controls vs tower climbers and controls vs treadmill runners (highly significant p < 0.005, significant p < 0.05, suggestive p < 0.1 and ns = not significant). P values are from post hoc results. (A) Stress at yield in B6 mice for each treatment group (B) Strain at yield and ultimate load in B6 mice for each treatment group.
42 Exercise treatment differences were also identified for structural properties of the femoral neck (Figure 3 4). Treadmill running significantly increased ultimate load of the femoral neck of B6 mice (though it was only suggestive using data adjusted for body weight; Figure 3 4A); whereas, tower climbing significantly decreased work to ultimate load in the femoral neck of D2 mice (again, this differences was only suggestive when data was adjusted for body weight; Figure 3 4B).
(A) (B) ns ns p = 0.040 p =0.021 p = 0.048 ns
Figure 3 4: Differences in femoral neck structural measures at ultimate load for B6 and D2 mice as a function of exercise treatment. Means and standard errors are shown. Group differences were determined using a 1 way ANOVA for treatment and a 2 sided Dunnett test was used for post hoc comparisons between controls and treadmill runners or tower climbers. Lines connecting bars show p values for controls vs tower climbers and controls vs treadmill runners (highly significant p < 0.005, significant p < 0.05, suggestive p < 0.1 and ns = not significant). P values are from post hoc results. (A) Ultimate load of the femoral neck in B6 and D2 mice for each treatment group (B) Work to ultimate load of the femoral neck in D2 mice for each treatment group.
43 Discussion
These results provide further evidence that genetic background profoundly influences the response to mechanical stimuli. Both exercise methods used in this study increased structural and material properties of the shaft at yield in B6 mice. Treadmill running and tower climbing significantly increased work to yield and tower climbing significantly increased displacement and strain at yield. Suggestive increases in load at yield as a result of both modes of exercise were found as was a suggestive increase in stress at yield as a result of tower climbing. These results indicate a beneficial skeletal response to exercise within the B6 mice in regards to how much the femoral structure of the mid shaft can bend prior to becoming permanently altered.
Although mechanical properties at yield for the mid shaft of B6 mice were increased with treadmill running and tower climbing, displacement and post yield displacement, work and post yield work and strain at ultimate load decreased as a result of both types of exercise. These results suggest that both methods of mechanical loading, especially tower climbing, reduce maximum mechanical capacity in the shaft of B6 mice.
Structural and material properties of the shaft were not altered as a result of exercise treatment in D2 mice; however, at the femoral neck, tower climbing significantly decreased ultimate load and work to ultimate load. At the femoral neck of B6 mice, treadmill running significantly increased ultimate load indicating a beneficial effect of treadmill running at the neck, a common site for fractures in osteoporotic patients.
There was also a significant increase in head diameter as a result of tower climbing for B6 mice. This difference in femoral neck diameter with tower climbing is
44 presumably due to different mechanical requirements at the hip required for climbing as opposed to running. It’s also possible the increased head diameter may simply be due to an increase in cartilage thickness because the increase in size did not result in a corresponding functional increase in the mechanical integrity of the femoral neck with tower climbing as was evident in treadmill mice despite no apparent increases in neck size. The outer radius in the anterior quadrant of the mid shaft, which is the distance between the cross sectional centroid and periosteal surface, was also increased as a result of treadmill running in B6 mice. An increase in the periosteal perimeter has been shown to occur as a result of treadmill running in the femur of young female mice (Wu, 2001;
Hamrick, 2006). These results indicate bone formation as a result of exercise on the periosteum which has been shown to occur with in vivo loading as measured by labeling of the periosteal surface (Srinivasan, 2002).
For D2 mice, treadmill running significantly decreased medullary area with a suggestive decrease in the inner radius of the anterior and medial quadrants, which is the distance from the cross sectional centroid and endocortical surface at the mid shaft. The significant reduction in medullary area is likely due to inhibition of endocortical bone resorption, but enhanced endocortical bone formation cannot be ruled out without further exploration. Although not significant or suggestive, there was a trend toward an increase in cortical thickness with treadmill running in D2 mice (data not shown) which provides some indication that bone formation was the cause of the significant decrease in medullary area.
Based upon the numerous and various changes identified as a function of exercise treatment in B6 mice and the minimal changes identified in D2 mice, B6 mice were more
45 responsive to mechanical loading. This was as expected from previous in vivo loading studies that have shown B6 mice to be more responsive to loading than D2 mice
(Robling, 2002). Treadmill running and tower climbing expose bone to more naturally achievable loads which is a strength of this study as compared to overload models that are often used in an attempt to elucidate issues related to functional adaptation of bone.
We chose these two methods of mechanical loading in order to explore the effects of different modes of exercise (aerobic and resistance based). The idea was not to compare the two exercise methods, but to determine the effects of exercise in general on bone properties relative to genetic strain. It was predicted that both types of exercise would increase the mechanical properties of bone and that tower climbing would produce more of a response. Both treadmill running and tower climbing did produce a beneficial response for both strains used in this study. However, tower climbing did not produce a greater response as expected and actually resulted in decreased mechanical properties at ultimate load in both genetic strains and at both the femoral mid shaft and femoral neck.
This was not what was expected based upon a comparison study on the effects of aerobic and resistance exercise on bone strength in young rats (Notomi, 2000). Although, the aforementioned study was on growing animals and the mice used in our study were 180 days old at the start of the intervention. It has been shown that mice reach peak bone mass at 120 days of age (Beamer, 1996). Therefore, the mice used in this study should no longer have been growing and can be considered adults. Tower climbing may also have a greater impact on bones in the forelimb. Important future studies include similar investigations of both the ulna and humerus because of the potential for a larger response due to greater usage with climbing.
46 Both tower climbing and treadmill running increased structural and material properties at yield in B6 mice at the femoral shaft compared to controls. Treadmill running has been shown to increase load at yield and displacement at yield in the femur of adult, female rats (Barengolts, 1993). It was not surprising then that these structural properties in particular were increased in the adult female mice used in this study.
However, the main focus of this study was to explore the interaction between genetics and environment (mechanical loading) on bone. Therefore, it was noteworthy that the structural and material values at yield were increased in the femur of the B6 mice and not those of the D2 mice. Differential effects across the two inbred strains were confirmed and these results provide further support for the importance of gene environment interaction on bone adaptation. They also provide more insight into how bone responds to mechanical loading via physiologically conceivable methods within adult mice from inbred strains commonly used to study bone adaptation.
Previously identified genetic differences in the bone properties of the utilized inbred mice were confirmed in this study. B6 mice had significantly larger femoral widths, cross sectional area and moment of inertia than D2 mice, but D2 mice had significantly thicker cortices than B6 mice. These results are similar to those from a study on young, female mice by Akhter, et al. (Akhter, 2000). The structural and material properties at yield in D2 mice were also greater than in B6 mice, but these properties at ultimate load were significantly greater in the B6 mice. Therefore, the femurs of B6 mice were wider at the mid shaft with increased CSMI but had thinner cortices than D2 mice.
The material properties of D2 mice were also greater overall than B6 mice.
47 Morphological differences between genetic strains combined with differential response to physiologically plausible exercise interventions further illustrate the dependence of bone adaptation on gene environment interactions. Using an adult mouse model is important as well in regards to bone adaptation because bone response to mechanical loading changes with age (Hoshi 1998). Moreover, bone loss occurs with age and osteoporosis is an age related disease. Further understanding of bone adaptation in adult inbred mice is valuable in terms of seeking a better understanding of how mechanical loads produce changes in bone tissue as well as to discern the complex interaction between environmental and genetic influence. The main conclusions of this study provide evidence of an interaction between genetics and environment on bone adaptation in adult mice. Further understanding of the complex interactions involved in bone adaptation may help to provide better prevention and treatment of osteoporosis and other bone diseases.
48 References
Akhter , M.P., Cullen, D.M., Pedersen, E.A., Kimmel, D.B., and Recker, RR. (1998) Bone response to in vivo mechanical loading in two breeds of mice. Calcified Tissue Internationl, 63: 442 449.
Akhter, M.P., Iwaniec, U.T., Covey, M.A., Cullen, D.M., Kimmel, D.B., and Recker, R.R. (2000) Genetic variations in bone density, histomorphometry, and strength in mice. Calcified Tissue International, 67: 337 344.
Akhter, M.P., Fan, Z., and Rho, J.Y. (2004) Bone intrinsic material properties in three inbred mouse strains. Calcified Tissue International, 75: 416 420.
Bargentolts, E.I, Curry, D.J., Bapna, M.S., and Kukreja, S.C. (1993) Effects of endurance exercise on bone mass and mechanical properties in intact and ovariectomized rats. Journal of Bone and Mineral Research, 8: 937 942.
Beamer, W.G., Donahue, L.R., Rosen, C.J., and Baylink, D.J. (1996) Genetiec variability in adult bone density among inbred strains of mice. Bone, 18(5): 397 403.
Hamrick, M.W., Samaddar, T., Pennington, C., and McCormick, J. (2006) Increased muscle mass with myostatin deficiency improves gains in bone strength with exercise. Journal of Bone and Mineral Research, 21 (3): 477 483.
Hoshi, A., Watanabe, H., Chiba, M., and Inaba, Y. (1998) Effects of exercise at different ages on bone density and mechanical properties of femoral bone of aged mice. Tohoku Journal of Experimental Medicine, 185: 15 24.
Iwamoto, J., Takeda, T., and Ichimura, S. (1998) Effects of exercise on bone mineral density in mature osteopenic rats. Journal of Bone and Mineral Research, 13 (8): 1308 1317.
Kesavan, C., Mohan, S., Oberholtzer, S., Wergedal, J.E., and Baylink, D.J. (2005) Mechanical loading induced gene expression and BMD changes are different in wo inbred mouse strains. Journal of Applied Physiology, 99: 1951 1957.
Kodoma, Y., Umemura, Y., Nagasawa, S., Beamer, W.G., Donahue, L.R., Rosen, C.R., Baylink, D.J., and Farley, J.R. (2000) Exercise and mechanical loading increase periosteal bone formation and whole bone strength in C57BL/6J mice but not in C3H/Hej mice. Calcified Tissue International, 66: 298 306.
49 Lang, D.H., Sharkey, N.A., Mack, H.A., Vogler, G.P., Vandenbergh, D.J., Blizard, D.A., Stout, J.T., and McClearn, G.E. (2005) Quantitative Trait Loci Analysis of Structural and Material Skeletal Phenotypes in C57BL/6J and DBA/2 F 2 and RI Mice . Journal of Bone and Mineral Research, 20 (1): 88 99.
Mori, T., Okimoto, N., Sakai, A., Okazaki, Y., Nakura, N., Notomi, T., and Nakamura, T. (2003) Climbing exercise increases bone mass and trabecular bone turnover through transient regulation of marrow osteogenic and osteoclastogenic potentials in mice. Journal of Bone and Mineral Research, 18 (11): 2002 2009.
Notomi, T., Okazaki, Y., Okimoto, N., Saitoh, S., Nakamura, T., and Suzuki, M. (2000) A comparison of resistance and aerobic training for mass, strength and turnover of bone in growing rats. European Journal of Applied Physiology, 83: 469 474.
Notomi, T., Okimoto, N., Okazaki, Y., Tanaka, Y., Nakamura, T., and Suzuki, M. (2001) Effects of tower climbing exercise on bone mass, strength, and turnover in growing rats. Journal of Bone and Mineral Research, 16 (1): 166 174.
Notomi, T., Okimoto, N., Okazaki, Y., Nakamura, T., and Suzuki, M. (2003) Tower climbing exercise started 3 months after ovariectomy recovers bone strength of the femur and lumbar vertebrae in aged osteopenic rats. Journal of Bone and Mineral Research, 18 (1): 140 149.
Robling, A.G., and Turner, C.H. (2002) Mechanostransduction in bone: genetic effects on mechanosensitivity in mice. Bone, 31 (5): 562 569.
Srinivasan, S., Weimer, D.A., Agans, S.C., Bain, S.D., and Gross, T.S. (2002) Journal of Bone and Mineral Research, 17 (9): 1613 1620.
Wu, J., Wang, X.X., Takasaki, M., Ohta, A., Higuchi, M., and Ishimi, Y. (2001) Cooperative effects of exercise training and genistein administration on bone mass in ovariectomized mice. Journal of Bone and Mineral Research, 16 (10): 1829 1836.
50 Chapter 4
Differential Gene Expression in Mechanically Loaded Long Bone Corticies and Muscle of C57BL/6J and DBA/2J Adult Female Mice
Abstract
Age related osteoporosis affects millions of lives. Identifying genes associated with bone health across the lifespan may increase our ability to prevent and treat osteoporosis and other bone diseases. Mechanical loading has been shown to impact expression of bone related genes and positively affect bone density and strength. The aim of this study was to determine the effects of mechanical loading on gene expression in musculoskeletal tissues in adult, female inbred mice. This study examined two strains of mice, C57BL/6J (B6) and DBA/2J (D2), known to differ in their skeletal phenotypes.
Progeny derived from these two strains have been used in previous quantitative trait loci
(QTL) studies resulting in the identification of chromosomal regions harboring genes involved in bone maintenance. Mice from each strain were exposed to increased mechanical demand via tower climbing or treadmill running for 5 weeks starting at approximately 180 days of age. Non exercised control mice of each strain were concurrently housed in the same environment as the exercised mice. At the end of the intervention, a portion of the gastrocnemius muscle and the femoral diaphyseal cortex from the left hind limb of each mouse were extracted immediately after death by cervical dislocation. Total RNA from the gastrocnemius and femoral diaphysis was extracted and labeled using Qiagen and Ambion assays. Gene expression was examined using
Affymetrix Mouse 430A 2.0 microarray. Three chips containing similar samples from
51 different mice were used as biological replicates for each strain (B6 vs D2) and treatment
(controls, treadmill runners and tower climbers) group. Bone related genes were differentially expressed across the two mouse strains. These genes included Bmp2k,
Mepe and Gpnmb, which all had a 2 or 3 fold change in expression as confirmed using
Real Time PCR. Genes differentially expressed across the two strains and co located with previously identified QTL were also identified. These genes can be considered ideal candidate genes for further exploration regarding the genetic regulation of skeletal phenotypes. Interestingly, pleiotrophin (Ptn) expression, known to play a role in the regulation of the response of bone to mechanical loading, was increased 2 fold in tower climbers relative to the controls.
Introduction
Bone tissue is able to adapt to changes in mechanical demand by altering its structural strength (Wolff, 1892; Frost, 1998). The details of how bone cells are able to respond to environmental fluctuations, including the genes involved, remains elusive.
Bone adaptation has proven to be a complex process and as such remains a major focus of research in the field of bone biology. A greater understanding of bone adaptation can provide more insight into preventing and treating osteoporosis and other bone related diseases. Osteoporosis affects 44 million people in the US and is associated with a national cost of 14 billion each year (NIH, 2009). The human and financial costs are high and are increasing.
The response of bone to mechanical loading involves genetic interactions directly affecting bone tissue, as well as potential indirect influences on bone via genes that affect
52 such things as muscle force, behavior and body weight. The main focus of this study was to explore gene expression as a function of genetic strain and exercise treatment in both the femoral corticies and gastrocnemius muscle of the hind limb. Gene expression was assessed in C57BL/6 (B6) and DBA/2J (D2), two strains with known differences in skeletal phenotypes, exposed to treadmill running (aerobic exercise) and tower climbing
(resistance based exercise). Differential gene expression between non exercised controls and treadmill runners or tower climbers of different genetic backgrounds may further elucidate the mechanisms through which bone and muscle tissue are altered as a result of changing mechanical demand via physiological plausible methods of exercise. In prior work, in vivo loading of tibia in B6 and C3H/Hej inbred strains of young and old mice resulted in down regulation of genes involved with bone resorption and up regulation of genes controlling bone formation. Changes in expression were also greater in B6 mice
(Kesavan, 2005). It was hypothesized that both modes of exercise used in the present study would produce differential expression of genes related to bone adaptation. Genes related to osteoclast formation and activity would be down regulated in the exercised groups and those involved in osteoblast formation and activity would be up regulated relative to genes in non exercised controls.
Genes that are expressed differently as a function of strain can also provide further information regarding genetic effects on bone and muscle. QTLs are regions of chromosomes that are linked to phenotypic traits and have been previously identified in our laboratory for measures of skeletal strength and architecture using second generation
(F 2) and recombinant inbred (RI) strains of mice generated by crossing B6 and D2 progenitor strains (Lang et al. 2005). Therefore, it was hypothesize that genes located
53 within the 1 LOD support interval of some of the previously identified bone QTL would be differentially expressed across the two strains.
Materials and Methods
Animals and Experimental Design
Ninety adult (180 day old) female mice equally divided between B6 and D2 inbred mouse strains were exposed to treadmill running, tower climbing or served as controls (15 in each group). The five week exercise intervention was conducted with five cohorts staggered over a span of nine months with 3 mice from each strain by treatment group in each cohort.
The treadmill runners were put onto a rodent treadmill 5 days per week for 5 weeks and the speed, incline and duration were gradually increased until a target speed of
15 m/min at a 25 degree incline for 30 minutes was attained. The tower climbers were housed in a cage attached to a 120 cm tall mesh wire tower 17 cm wide with water bottles placed at the top of the tower. Tower climbers had access to the towers 24 hours per day for a 5 week period. To train the mice during the first week, the water bottles were put at the bottom of the tower and gradually raised to the top. The mice then climbed to the top of the towers to drink during the remaining weeks of the intervention.
All of the mice were individually housed in the same room with monitored temperature and humidity with food and water available ad libitum. The lights were set on a reverse 12 hour light/dark cycle and treadmill mice were exercised during the dark cycle when the mice are known to be more active. All procedures complied with and were approved by the Pennsylvania State University Institutional Care and Use
Committee.
54 Tissue Harvesting
Mice were euthanized by cervical dislocation approximately two hours after the last treadmill exercise session or removal from the towers. A portion of the gastrocnemius muscle from the left hind limb was extracted, snap frozen in liquid nitrogen, and stored at 80C. The left femur was removed and cleaned of soft tissue. The diaphysis was isolated by removing the epiphyses using a Dremel rotary tool with a diamond blade and the marrow contents were vigorously flushed away using a syringe filled with phosphate buffered saline (PBS). The diaphysis was snap frozen in liquid nitrogen and stored at 80C.
R A Extraction
Total RNA was extracted from both the muscle and bone tissues of all mice (n =
90) used in the study. Total RNA from the gastrocnemius muscle was extracted using
Qiagen RNeasy Fibrous Tissue Mini Kit (cat # 74704). Buffer RLT provided with the kit was added to the muscle tissue sample (< 30mg) and homogenized using a rotor stator homogenizer. The protocol provided with the kit was followed without deviation. Total
RNA from the femoral diaphysis was extracted using Qiagen RNeasy Lipid Tissue Mini
Kit (cat # 74804). Qiazol lysis reagent provided with the kit was added to the bone tissue and homogenized using a rotor stator homogenizer. The sample was then transferred to a new tube leaving the remaining non homogenized bone pulp to be discarded. Deviation from the Qiagen kit protocol occurred during aqueous and organic separation of the homogenate and chloroform solution where the sample was centrifuged for 15 min at room temperature rather than 4 degrees C.
55 The concentration and quality of the total RNA samples were assessed by the
Penn State Microarray Facility using a Thermo Scientific Nanodrop and Agilent
Bioanalyzer. The Nanodrop was used to obtain concentrations and 260/280 ratios. Ratios between 1.8 and 2.1 were considered as an indication of good quality though a ratio up to
2.2 was considered usable (greater than 2.2 is an indication of sample degradation). The
Bioanalyzer calculates RIN (RNA Integrity Number) values which were used to evaluate the quality of the RNA as well. The RIN scale ranges from 1 to 10 with 10 being the best in terms of RNA quality or how intact the RNA is versus a value of 1 indicating sample degradation. Samples with RIN values below 7 were not used. The RIN values for bone ranged from 7 to 8.5; whereas, the RIN values for muscle ranged from 7 10. The
Bioanalyzer also provides a pseudo gel image and an electropherogram. These were used as well to evaluate the quality of the RNA samples.
R A Pooling & Labeling
Bone samples were pooled prior to labeling due to the low number of cells found within cortical bone which consequently limits the ability to obtain enough RNA to amplify and label. Muscle tissue samples were pooled as well though the RNA yield was much higher than that of bone. The RNA samples were ranked according to quantity and qualitywithin each experimental group ((6 groups total; B6 and D2 strains split into 3 treatment groups: controls, treadmill runners and tower climbers with 15 samples per group). The six best RNA samples in terms of quantity and quality were chosen from the original 15 samples in each group. These six samples were then pooled in pairs of two for a total of three pooled samples per group. The resulting 36 samples (18 bone samples
56 and 18 muscles samples) were then labeled using Ambion MessageAmp II Biotin
Enhanced Kit (cat # AM1791) and protocol. From each pooled sample, 500 ng of RNA was labeled (kit range = 50 5000ng). The amplified and labeled RNA samples were then quantified and evaluated at the Penn State Microarray Facility once again using the
Nanodrop and Bioanalyzer. The Nanodrop results provided the concentration of amplified RNA and the Bioanalyzer results were used as a visual indication that the samples amplified properly (using the pseudo gel and electropherogram images).
Amplified RNA (15 ug) was then fragmented using the buffer and protocol provided with the Ambion kit. The samples were evaluated once again using the Bioanalyzer which provided visual assurance that the samples were completely fragmented using the pseudo gel and electropherogram results.
Microarray Processing & Data Analysis
Gene expression was examined using Affymetrix Mouse 430A 2.0 microarrays and 18 chips were conducted per bone and muscle tissue. Three chips containing similar samples from different mice were used as biological replicates for each strain (B6 or D2) and treatment (control, treadmill running or tower climbing) group. Labeled and fragmented samples were processed (hybridized and scanned) at the Penn State
Microarray Facility using the Affymetrix platform.
The resulting microarray data was analyzed by the Penn State statistics department using statistical software, R, with Bioconductor and Linear Models for
Microarray Data (LIMMA) packages. The data were normalized using Robust Multichip
Average (RMA) and differential expression was deemed significant at p ≤ 0.05 after
57 appropriate adjustment for multiple comparisons using False Discovery Rate (FDR).
Differential expression was compared relative to mouse strain and exercise treatment for each tissue.
Real Time PCR
Differential expression of select genes was confirmed using Real Time PCR including genes of interest with an adjusted p value greater than 0.05. Reverse transcription of total RNA was completed using BioRad iScript cDNA synthesis kit (cat #
170 8890) and protocol. The cDNA was labeled and amplified using BioRad iQ Sybr Green Supermix (cat # 170 8882) and MyiQ thermalcycler. The protocol was recommended by the manufacturer and included an amplification program as follows: 1 cycle [95ºC (3 min)], 40 cycles [95ºC (10 sec), 55ºC (15 sec), 72ºC (30 sec)] and 1 cycle
[95ºC (1 min)]. A melting curve was obtained (81 cycles of 65ºC for 10 sec) as well and was used to determine if non specific products were present. Primers were designed using ABI Prism Primer Express 2.0 software. The following are the primer sequences used: β actin 5’ AGCTTCTTTGCAGCTCCT 3’, 5’ CCAGCGCAGCGAT AT 3’;
Gpnmb 5’ GCCTTCCAACTCACTGAGCAT 3’, 5’ CACACGCACCATACA
CAAAGC 3’; Mepe 5’ GACCCGACGGAGCACTCACT 3’, 5’ GCCACTGCCTTCA
GGTCAC 3’; Bmp2k 5’ GCTCCGACAGTGACAGACTCT 3’, 5’ AGCTCCTAGTC
CCACCACC 3’; Ptn 5’ CTCTCTCGTCCCTCCCATTCT 3’, 5’ GGAACCTGATCC
TGCCTTCA 3’; Hspa1b 5’ TGCACTTGATAGCTGCTTGG 3’, 5’ CAGTGCTGC
TCCCAACATTA 3’, Ppargc1a 5’–AATGCAGCGGTCTTAGCACT 3’, 5’ – GTGTG
AGGAGGGTCATCGTT 3’, Wnt1 5’ – GGACTCCTGAAACCACTTGC 3’,
58 5’ – CAAAGAGGGAGGGAGGTAGG 3’, Slc20a1 5’ AACACCCATATGGCT
TCTGC 3’, 5’ – CTTCCCCATGGTCTGGATAA 3’, Myh6 5’ – CAAGCTGCAGA
CAGAGAACG 3’, 5’ –CTGGGTGTAGGAGAGCTTGC 3’. The primer efficiency was tested prior to usage using BioRad iQ5 Optical System software (Version 2.0.148.60623) and testing included the use of no template controls to ensure primer dimers were not present. The primer annealing temperature was also optimized. Beta actin was used as a housekeeping gene to normalize the expression results and data was analyzed using the delta C T method.
Quantitative Trait Loci Analysis
Results from separate sex specific QTL analyses were previously reported for
QTLs influencing skeletal strength and architecture in RI and F 2 cohorts derived from B6 and D2 parental strains (Lang , 2005). QTL analyses were also performed on male and female data combined, correcting for sex differences. RI QTL analyses were performed using strain means. All phenotypes were screened for normality and when necessary a log or square root transformation was used. All phenotypic measures were adjusted for body size through multiple regression of body weight and body length onto each phenotype, with the residuals constituting the adjusted phenotype. QTL analyses were performed on the adjusted as well as the non adjusted raw measures.
All QTL analyses were conducted using QTL Cartographer (Basten, 1995; Basten
2002). Both interval mapping and composite interval mapping were executed.
Composite interval mapping allows for the control of genetic variance outside a window surrounding each test site along the genome, whereas standard interval mapping does not.
59 Five markers were included as cofactors in the composite interval model. These markers were selected as the top 5 most significant sites outside a window of 10 cM of each test site. The significance rank was based on forward step wise regression.
QTL significance levels are reported as LOD scores or base 10 logarithm of the odds in favor of linkage. The F 2 population was used to nominate QTLs and the RI cohort was used for confirmation. QTLs that were nominated in the F 2 analyses at a
LOD ≥ 4.3 and confirmed in the RI at a LOD ≥ 1.5 were considered confirmed significant linkage (Lander, 1995), whereas QTLs nominated in the F 2 analyses using a less stringent LOD score (2.8 4.2) and confirmed in the RI (LOD ≥ 1.5) were considered confirmed suggestive linkage. In addition, unconfirmed significant QTLs were reported that demonstrated significant LOD scores in either the F 2 (LOD ≥ 4.3) or RI (LOD ≥ 3.3) analysis, but did not replicate in the complementary analysis. QTLs that did not meet any of the three criteria outlined above, but were nevertheless interesting because of their genomic location, are reported as “potential QTL”. These sites either met the suggestive criterion in the F 2 analysis, or were nominated in the F 2 cohort at LOD scores of 1.9 2.7 and subsequently confirmed in the RI (LOD ≥ 1.5).
Results
Differential Expression within Bone Tissue as a Function of Genetic Mouse Strain
Numerous genes within bone tissue from non exercised control mice were shown to be differentially expressed as a function of genetic background. Two hundred gene probe sets (“genes”) had significantly greater expression in B6 mice compared to D2 mice after adjustment for multiple comparisons. Of these differentially expressed genes,
60 7 genes had a 10 fold or greater difference in expression (Table 4 1A) and 45 genes had between 3 and 9 fold differences (Table 4 1B). Two fold differences, the lowest fold change considered, were found as well (Table 4 1C).
Table 4 1: Genes with greater expression in bone tissue of B6 control mice compared to D2 control mice . Gene symbol and title are shown along with significant adjusted p values and fold change. (A) 10+ fold difference (B) 3 9 fold difference (C) 2 fold difference.
(A)
Gene Title Adj Pval Fold Change Ifi203 interferon activated gene 203 0.009 55 Ndel1 nuclear distribution gene E-like homolog 1 (A. nidulans) 0.001 13 Phgdh 3-phosphoglycerate dehydrogenase 0.009 22 Pyhin1 pyrin and HIN domain family, member 1 differentiation transcriptional activator) (IFI 16) 0.041 12 Rps9 ribosomal protein S9 0.009 10 Trim12 tripartite motif-containing 12 0.008 15 Trim34 tripartite motif-containing 34 0.010 12
61 (B)
Gene Title Adj Pval Fold Change Adi1 acireductone dioxygenase 1 0.009 9 Alg14 asparagine-linked glycosylation 14 homolog (yeast) 0.005 4 Arl8b ADP-ribosylation factor-like 8B 0.025 3 Asb15 ankyrin repeat and SOCS box-containing protein 15 0.008 6 Atp1a2 ATPase, Na+/K+ transporting, alpha 2 polypeptide 0.032 7 Bdh1 3-hydroxybutyrate dehydrogenase, type 1 0.019 5 Bdh1 3-hydroxybutyrate dehydrogenase, type 1 0.007 8 C1qdc2 C1q domain containing 2 0.044 3 Ccl19 chemokine (C-C motif) ligand 19 0.006 3 Ccrl1 chemokine (C-C motif) receptor-like 1 0.036 3 Eps8l1 EPS8-like 1 0.004 9 Etl4 enhancer trap locus 4 0.006 3 Fbxw10 F-box and WD-40 domain protein 10 0.020 3 Fggy FGGY carbohydrate kinase domain containing 0.016 3 Fmo2 flavin containing monooxygenase 2 0.002 4 Ggnbp2 gametogenetin binding protein 2 0.010 5 Gpnmb glycoprotein (transmembrane) nmb 0.042 3 Gsta2 glutathione S-transferase, alpha 2 (Yc2) 0.040 3 H2-Q10 histocompatibility 2, Q region locus 10 0.014 5 Ier5 immediate early response 5 0.017 3 Klf9 Kruppel-like factor 9 0.042 4 Klk1 kallikrein 1 0.036 3 Klrd1 killer cell lectin-like receptor, subfamily D, member 1 0.029 8 Meg3 maternally expressed 3 0.038 4 Mga MAX gene associated 0.006 5 Mrpl15 mitochondrial ribosomal protein L15 0.020 3 Mst1r macrophage stimulating 1 receptor (c-met-related tyrosine kinase) 0.038 3 Myo5a myosin Va 0.045 3 Pdxdc1 pyridoxal-dependent decarboxylase domain containing 1 0.002 9 Prdx2 peroxiredoxin 2 0.026 5 Prpf19 PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae) 0.005 3 Rab6b RAB6B, member RAS oncogene family 0.016 6 Rps4y2 ribosomal protein S4, Y-linked 2 0.034 3 Slamf8 SLAM family member 8 0.035 3 Slc20a1 solute carrier family 20, member 1 0.019 5 Smad4 MAD homolog 4 (Drosophila) 0.005 3 Snx6 sorting nexin 6 0.009 6 Sord sorbitol dehydrogenase 0.017 4 Sspn sarcospan 0.027 4 Tlr1 toll-like receptor 1 0.016 4 Trim16 tripartite motif-containing 16 0.020 3 Trim30 tripartite motif-containing 30 0.026 4 Uchl1 ubiquitin carboxy-terminal hydrolase L1 0.016 6 Wars tryptophanyl-tRNA synthetase 0.000 3 Zfp277 zinc finger protein 277 0.006 3
62 (C)
Gene Title Adj Pval Fold Change Bcl2l11 BCL2-like 11 (apoptosis facilitator) 0.015 2 Bcl2l11 BCL2-like 11 (apoptosis facilitator) 0.035 2 Cd180 CD180 antigen 0.044 2 Gadd45gip1 growth arrest and DNA-damage-inducible, gamma interacting protein 1 0.010 2 Gsto1 glutathione S-transferase omega 1 0.019 2 H2-Q7 histocompatibility 2, Q region locus 7 0.041 2 Hfe hemochromatosis 0.014 2 Mapre1 microtubule-associated protein, RP/EB family, member 1 0.038 2 Mocs1 molybdenum cofactor synthesis 1 0.043 2 Ndufa12 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 0.040 2 Pi4k2a phosphatidylinositol 4-kinase type 2 alpha 0.003 2 Snx5 sorting nexin 5 0.002 2 Tm2d2 TM2 domain containing 2 0.019 2 Tulp4 tubby like protein 4 0.002 2
One hundred and forty one genes had significantly greater expression in bone tissue of D2 controls compared to B6 controls. Of these differentially expressed genes,
12 genes had a 10 fold or greater change in expression (Table 4 2A), 27 with a 3 to 9 fold change (Table 4 2B) and 24 had a two fold greater expression in D2 bone tissue compared to B6 (Table 4 2C).
63 Table 4 2: Genes with greater expression in bone tissue of D2 control mice compared to B6 control mice . Gene symbol and title are shown along with significant adjusted p values and fold change. (A) 10+ fold difference (B) 3 9 fold difference (C) 2 fold difference.
(A)
Gene Title Adj Pval Fold Change Ccnb1ip1 cyclin B1 interacting protein 1 0.001 25 Ear11 eosinophil-associated, ribonuclease A family, member 11 0.005 22 H2-D1 histocompatibility 2, D region locus 1 0.000 90 H2-Ea histocompatibility 2, class II antigen E alpha 0.000 88 Ifi202b interferon activated gene 202B 0.000 24 Igh/Ighg immunoglobulin heavy chain complex /gamma polypeptide 0.020 11 Mela melanoma antigen 0.006 40 Msh5 mutS homolog 5 (E. coli) 0.004 10 Pdxdc1 pyridoxal-dependent decarboxylase domain containing 1 0.000 23 Serpina1a serine (or cysteine) peptidase inhibitor, clade A, member 1a 0.001 27 Serpina1b serine (or cysteine) preptidase inhibitor, clade A, member 1b 0.001 37 Sfi1 Sfi1 homolog, spindle assembly associated (yeast) 0.001 10
(B)
Gene Title Adj Pval Fold Change Alad aminolevulinate, delta-, dehydratase 0.026 3 Bmp2k BMP2 inducible kinase 0.029 3 Calml4 calmodulin-like 4 0.006 3 Cib1 Calcium and integrin binding 1 (calmyrin) 0.006 4 Dsc2 desmocollin 2 0.009 3 Eno2 enolase 2, gamma neuronal 0.011 3 H2-K1 Histocompatibility 2, D region locus 1 0.001 8 Mcpt2 mast cell protease 2 0.039 6 Mepe matrix extracellular phosphoglycoprotein with ASARM motif (bone) 0.051 4 Mesdc1 mesoderm development candidate 1 0.003 4 Npl N-acetylneuraminate pyruvate lyase 0.006 3 Ocel1 occludin/ELL domain containing 1 0.001 3 Paip1 polyadenylate binding protein-interacting protein 1 0.016 4 Pi4k2b phosphatidylinositol 4-kinase type 2 beta 0.016 5 Pnpt1 polyribonucleotide nucleotidyltransferase 1 0.004 4 Rbp7 retinol binding protein 7, cellular 0.001 5 Rpl14 ribosomal protein L14 0.002 3 Rwdd3 RWD domain containing 3 0.003 3 Scd2 stearoyl-Coenzyme A desaturase 2 0.008 3 Stc2 stanniocalcin 2 0.016 3 Tac2 tachykinin 2 0.041 6 Tg thyroglobulin 0.031 3 Tgfb2 transforming growth factor, beta 2 0.032 3 Tmem87a transmembrane protein 87A 0.001 8 Tnfrsf14 tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) 0.008 7 Tpbg trophoblast glycoprotein 0.024 5 Vcan versican 0.015 3 Wdfy1 WD repeat and FYVE domain containing 1 0.004 3
64 (C)
Gene Title Adj Pval Fold Change Atp5g2 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 2 0.004 2 Bcat2 branched chain aminotransferase 2, mitochondrial 0.014 2 Comt catechol-O-methyltransferase 0.002 2 Efcab7 EF-hand calcium binding domain 7 0.023 2 Fads3 fatty acid desaturase 3 0.042 2 Fah fumarylacetoacetate hydrolase 0.019 2 Foxj3 forkhead box J3 0.008 2 Fv1 Friend virus susceptibility 1 0.002 2 Grip1 glutamate receptor interacting protein 1 0.005 2 Hal histidine ammonia lyase 0.006 2 Hdhd3 haloacid dehalogenase-like hydrolase domain containing 3 0.019 2 Ltbp1 latent transforming growth factor beta binding protein 1 0.019 2 Lyplal1 lysophospholipase-like 1 0.017 2 Med1 mediator complex subunit 1 0.048 2 Mlycd malonyl-CoA decarboxylase 0.023 2 Mphosph10 M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein) 0.008 2 Ncam1 neural cell adhesion molecule 1 0.045 2 Npr1 natriuretic peptide receptor 1 0.025 2 Pawr PRKC, apoptosis, WT1, regulator 0.006 2 Prom1 prominin 1 0.051 2 Psma8 proteasome (prosome, macropain) subunit, alpha type, 8 0.051 2 Ptprv protein tyrosine phosphatase, receptor type, V 0.036 2 Rps19 ribosomal protein S19 0.008 2 Slc44a3 solute carrier family 44, member 3 0.050 2
Four of the above genes with differential expression as a function of genetic strain
are known to play a role in bone maintenance and were confirmed using RT PCR (Table
4 3). Bone morphogenetic protein 2 kinase (Bmp2k) and matrix extracellular
phosphoglycoprotein (Mepe) had 3 and 4 fold greater expression respectively in D2 mice;
whereas, glycoprotein (transmembrane) nmb (Gpnmb) and solute carrier family 20,
member 1 (Slc20a1) had 3 and 5 fold greater expression respectively in B6 mice.
Table 4 3: Bone related genes differentially expressed within bone tissue from control mice as a function of genetic mouse strain (B6 vs D2). These genes had a 2 fold or greater change in expression and were confirmed using RT PCR.
Gene Results Title Adj Pval Fold Change Bmp2k D2 > B6 Bone morphogenetic protein 2 kinase 0.029 3 Mepe D2 > B6 Matrix extracellular phophoglycoprotein 0.051 4 Gpnmb B6 > D2 Glycoprotein (transmembrane) nmb 0.042 3 Slc20a1 B6 > D2 Solute carrier family 20, member 1 0.019 5
65 Differentially Expressed Genes in Bone Tissue Within Previously Identified QTL
Several of the genes that were differentially expressed between B6 controls and
D2 controls overlapped with previously identified QTL related to bone strength and/or architecture (Lang et al., 2005). The overlapping QTL and genes were located on chromosomes 2, 4, 6, and 7 (Table 4 4A) and chromosomes 12, 14, 15 and 17 (Table 4
4B)
Table 4 4: Genes with differential expression between B6 controls and D2 controls that reside within QTLs related to bone strength and architecture identified in F2 and RI progeny derived from B6 and D2 progenitor mice. For each chromosome, gene symbols and centimorgan (cM) positions are shown with corresponding QTL phenotypes and F2 and RI results. Phenotypes that are shaded are significant and those not shaded are suggestive based upon logarithm of odds (LOD) scores. Shaded 1 LOD support intervals encompass gene cM positions. A gene that overlapped with either F2 and/or RI results from significant QTL or that overlapped with both F2 and RI results from suggestive QTL were considered. (A) Chromosomes 2, 4, 6, and 7; (B) Chromosomes 12, 14, 15, and 17.
66 (A) Chromosome 2 Gene QTL F2 RI Symbol Results cM Phenotype Map cM (1-LOD SI) LOD cM (1-LOD SI) LOD Mapre1 B6 > D2 84 Femur Yld Load CIM 81 (77-102) 5.5 76 (69-80) 2.3 Mapre1 B6 > D2 84 Femur Length CIM 81 (77-100) 6.1 76 (69-80) 2.2 Mapre1 B6 > D2 84 Femur Yld Load IM 81 (75-102) 4.8 78 (70-80) 2.1 Slc20a1 B6 > D2 73 Femur Ult Load IM 68 (54-79) 3.2 75 (70-81) 1.5 Slc20a1 B6 > D2 73 Femur Yld Work CIM 79 (73-83) 3.4 75 (71-76) 10.0 Slc20a1 B6 > D2 73 Femur Yld Load CIM 81 (77-102) 5.5 76 (69-80) 2.3 Slc20a1 B6 > D2 73 Femur Length CIM 81 (77-100) 6.4 76 (69-80) 2.2 Slc20a1 B6 > D2 73 Femur Yld Load IM 81 (75-102) 4.8 78 (70-80) 2.1 Snx5 B6 > D2 80 Femur Yld Load CIM 81 (77-102) 5.5 76 (69-80) 2.3 Snx5 B6 > D2 80 Femur Length CIM 81 (77-100) 6.1 76 (69-80) 2.2 Snx5 B6 > D2 80 Femur Yld Load IM 81 (75-102) 4.8 78 (70-80) 2.1 Chromosome 4 Gene QTL F2 RI Symbol Results cM Phenotype Map cM (1-LOD SI) LOD cM (1-LOD SI) LOD Alad D2 > B6 31 Femur Total Area CIM 18 (10-38) 3.4 29 (25-33) 2.0 Alad D2 > B6 31 Femur Yld Stress CIM 20 (10-38) 3.2 28 (21-32) 2.2 Alad D2 > B6 31 Femur CSMI IM 22 (12-48) 3.2 26 (26-31) 1.8 Chromosome 6 Gene QTL F2 RI Symbol Results cM Phenotype Map cM (1-LOD SI) LOD cM (1-LOD SI) LOD Eno2 D2 > B6 60 Femur Sag Wid CIM 62 (50-70) 4.7 44 (42-44) 6.1 Klrd1 B6 > D2 63 Femur Sag Wid CIM 62 (50-70) 4.7 44 (42-44) 6.1 Sspn B6 > D2 72 Femur Cor Width CIM 74 (66-74) 3.3 72 (69-72) 7.0 Chromosome 7 Gene QTL F2 RI Symbol Results cM Phenotype Map cM (1-LOD SI) LOD cM (1-LOD SI) LOD Bcat2 D2 > B6 23 Femur Yld Load CIM 15 (5-29) 5.5 0 (0-2) 2.3 Bcat2 D2 > B6 23 Femur Ult Load CIM 15 (5-31) 4.3 30 (20-41) 1.6 Bcat2 D2 > B6 23 Femur Yld Work CIM 25 (15-35) 3.0 22 (13-27) 2.0 Klk1 B6 > D2 23 Femur Yld Load CIM 15 (5-29) 5.5 0 (0-2) 2.3 Klk1 B6 > D2 23 Femur Ult Load CIM 15 (5-31) 4.3 30 (20-41) 1.6 Klk1 B6 > D2 23 Femur Yld Work CIM 25 (15-35) 3.0 22 (13-27) 2.0
67
(B) Chromosome 12 Gene QTL F2 RI Symbol Results cM Phenotype Map cM (1-LOD SI) LOD cM (1-LOD SI) LOD Meg3 B6 > D2 54 Fem Head Diam CIM 53 (47-57) 5.6 50 (50-52) 2.6 Serpina1a /b D2 > B6 51 Fem Head Diam CIM 53 (47-57) 5.6 50 (50-52) 2.6 Serpina1b D2 > B6 51 Fem Head Diam CIM 53 (47-57) 5.6 50 (50-52) 2.6 Chromosome 14 Gene QTL F2 RI Symbol Results cM Phenotype Map cM (1-LOD SI) LOD cM (1-LOD SI) LOD Mcpt2 D2 > B6 20 Femur Cor Width CIM 22 (11-28) 4.6 19 (18-23) 5.6 Mcpt2 D2 > B6 20 Femur Cor Width IM 22 (11-28) 4.6 19 (0-23) 1.7 Chromosome 15 Gene QTL F2 RI Symbol Results cM Phenotype Map cM (1-LOD SI) LOD cM (1-LOD SI) LOD Tg D2 > B6 36 Femur Ult Load CIM 52 (33-59) 4.3 49 (48-53) 3.3 Chromosome 17 Gene QTL F2 RI Symbol Results cM Phenotype Map cM (1-LOD SI) LOD cM (1-LOD SI) LOD H2-D1 D2 > B6 19 Femur Length CIM 18 (18-22) 4.6 4 (1-7) 5.2 H2-D1 D2 > B6 19 Femur Length CIM 18 (18-22) 4.6 4 (1-7) 5.2 H2-D1/H2-L D2 > B6 19 Femur Length CIM 18 (18-22) 4.6 4 (1-7) 5.2 H2-Ea D2 > B6 19 Femur Length CIM 18 (18-22) 4.6 4 (1-7) 5.2 H2-Ea D2 > B6 19 Femur Length CIM 18 (18-22) 4.6 4 (1-7) 5.2 H2-K1 D2 > B6 18 Femur Length CIM 18 (18-22) 4.6 4 (1-7) 5.2 H2-Q10 B6 > D2 19 Femur Length CIM 18 (18-22) 4.6 4 (1-7) 5.2 H2-Q7 B6 > D2 19 Femur Length CIM 18 (18-22) 4.6 4 (1-7) 5.2 Msh5 D2 > B6 19 Femur Length CIM 18 (18-22) 4.6 4 (1-7) 5.2 Tulp4 B6 > D2 3 Femur Length CIM 18 (18-22) 4.6 4 (1-7) 5.2
Of the above genes residing within QTLs for bone phenotypes, Slc20a1, is a player in bone maintenance and was shown to have significant differential expression relative to genetic strain as confirmed using RT PCR (p=0.019 adj). Slc20a1 had 5 fold greater expression in B6 controls when compared to D2 controls. This gene is located on chromosome 2 and overlapped with QTL located on chromosome 2 for femur length, ultimate load, yield load and yield work.
68 Differential Expression within Muscle Tissue as a Function of Genetic Strain
Within muscle tissue, 111 genes were shown to have significantly greater expression in B6 control mice compared to D2 control mice. These differentially expressed genes included 7 with a 10 fold or greater change (Table 4 5A), 48 with a 3 to
9 fold change (Table 4 5B) and 41 with a 2 fold greater change (Table 4 5C) in expression in the muscle of B6 controls compared to D2 controls.
Table 4 5: Genes with greater expression in muscle tissue of B6 control mice compared to D2 control mice . Gene symbol and title are shown along with significant adjusted p values and fold change. (A) 10+ fold difference (B) 3 9 fold difference (C) 2 fold difference.
(A)
Gene Title Adj Pval Fold Change Adi1 acireductone dioxygenase 1 0.000 27 Fgfbp1 fibroblast growth factor binding protein 1 0.000 17 Mup major urinary protein 0.005 21 Pdxdc1 pyridoxal-dependent decarboxylase domain containing 1 0.000 18 Pttg1 pituitary tumor-transforming gene 1 0.000 28 Pttg1 pituitary tumor-transforming gene 1 0.000 36 Rab6b RAB6B, member RAS oncogene family 0.000 10
69 (B)
Gene Title Adj Pval Fold Change Adi1 acireductone dioxygenase 1 0.000 4 Alg14 asparagine-linked glycosylation 14 homolog (yeast) 0.000 6 Arl8b ADP-ribosylation factor-like 8B 0.000 5 Asb15 ankyrin repeat and SOCS box-containing 15 0.000 6 Bdh1 3-hydroxybutyrate dehydrogenase, type 1 0.000 4 Bdh1 3-hydroxybutyrate dehydrogenase, type 1 0.000 7 Chia chitinase, acidic 0.000 3 Depdc6 DEP domain containing 6 0.000 4 Eps8l1 EPS8-like 1 0.005 3 Fbxw10 /// Trim16 F-box and WD-40 domain protein 10 /// tripartite motif-containing 16 0.000 5 Fggy FGGY carbohydrate kinase domain containing 0.000 4 Golm1 golgi membrane protein 1 0.000 7 Hfe hemochromatosis 0.000 3 Hfe hemochromatosis 0.000 5 Ifi203 interferon activated gene 203 0.000 4 Ifi203 interferon activated gene 203 0.000 5 Ifi205 /// Mnda interferon activated gene 205 /// myeloid cell nuclear differentiation antigen 0.000 4 Igh immunoglobulin heavy chain complex 0.000 3 Igh-6 immunoglobulin heavy chain 6 (heavy chain of IgM) 0.001 3 Klf9 Kruppel-like factor 9 0.003 3 Klf9 Kruppel-like factor 9 0.005 3 Meg3 maternally expressed 3 0.000 3 Mga MAX gene associated 0.000 4 Mtm1 X-linked myotubular myopathy gene 1 0.000 3 Mtm1 X-linked myotubular myopathy gene 1 0.000 3 Pdxdc1 pyridoxal-dependent decarboxylase domain containing 1 0.000 3 Phgdh 3-phosphoglycerate dehydrogenase 0.000 6 Prpf19 PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae) 0.000 3 Prpf19 PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae) 0.000 3 Rasd2 RASD family, member 2 0.001 3 Rasd2 RASD family, member 2 0.000 3 Rasl11b RAS-like, family 11, member B 0.006 3 Rian RNA imprinted and accumulated in nucleus 0.032 3 Rps9 ribosomal protein S9 0.000 5 Scin scinderin 0.000 4 Snhg6 small nucleolar RNA host gene (non-protein coding) 6 0.000 3 Stk25 serine/threonine kinase 25 (yeast) 0.000 3 Tm2d2 TM2 domain containing 2 0.000 3 Tmem45b transmembrane protein 45b 0.003 4 Trim34 tripartite motif-containing 34 0.000 3 Tulp4 tubby like protein 4 0.000 3 Vps37a vacuolar protein sorting 37A (yeast) 0.000 3 Vps37c vacuolar protein sorting 37C (yeast) 0.002 3 Wars tryptophanyl-tRNA synthetase 0.000 4 Zfp277 zinc finger protein 277 0.000 3 Zfp52 zinc finger protein 52 0.000 3 Zfp790 zinc finger protein 790 0.000 3 Zyg11b zyg-ll homolog B (C. elegans) 0.000 3
70 (C)
Gene Title Adj Pval Fold Change Actc1 actin, alpha, cardiac muscle 1 0.000 2 Aldh1a1 aldehyde dehydrogenase family 1, subfamily A1 0.000 2 Atp1a2 ATPase, Na+/K+ transporting, alpha 2 polypeptide 0.000 2 Bcl2l11 BCL2-like 11 (apoptosis facilitator) 0.001 2 Car9 carbonic anhydrase 9 0.000 2 Cbx7 chromobox homolog 7 0.000 2 Dap3 death associated protein 3 0.000 2 Dusp26 dual specificity phosphatase 26 (putative) 0.000 2 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 0.000 2 Frag1 FGF receptor activating protein 1 0.000 2 Fto fat mass and obesity associated 0.000 2 Gadd45gip1 growth arrest and DNA-damage-inducible, gamma interacting protein 1 0.000 2 Gas5 growth arrest specific 5 0.000 2 Igh-6 immunoglobulin heavy chain 6 (heavy chain of IgM) 0.034 2 Itpr1 inositol 1,4,5-triphosphate receptor 1 0.000 2 Itpr1 inositol 1,4,5-triphosphate receptor 1 0.000 2 Kcnb1 potassium voltage gated channel, Shab-related subfamily, member 1 0.044 2 Lancl1 LanC (bacterial lantibiotic synthetase component C)-like 1 0.000 2 Lpin1 lipin 1 0.000 2 Mcm6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae) 0.001 2 Mrpl15 mitochondrial ribosomal protein L15 0.000 2 Mrpl35 mitochondrial ribosomal protein L35 0.000 2 Myl4 myosin, light polypeptide 4 0.019 2 Myo7a myosin VIIa 0.000 2 Nr2c1 nuclear receptor subfamily 2, group C, member 1 0.000 2 Ogg1 8-oxoguanine DNA-glycosylase 1 0.003 2 Parp3 poly (ADP-ribose) polymerase family, member 3 0.000 2 Pdxdc1 Pyridoxal-dependent decarboxylase domain containing 1 (Pdxdc1), transcript variant 1, mRNA 0.000 2 Rdh9 retinol dehydrogenase 9 0.000 2 Rian RNA imprinted and accumulated in nucleus 0.024 2 Rps6 ribosomal protein S6 0.000 2 Sc5d sterol-C5-desaturase (fungal ERG3, delta-5-desaturase) homolog (S. cerevisae) 0.000 2 Snx10 sorting nexin 10 0.000 2 Snx6 sorting nexin 6 0.000 2 Sord sorbitol dehydrogenase 0.000 2 Sspn sarcospan 0.000 2 Tbx1 T-box 1 0.001 2 Tmem63a transmembrane protein 63a 0.000 2 Tnfsf12-tnfsf13 tumor necrosis factor (ligand) superfamily, member 12-member 13 0.000 2 Trim12 tripartite motif-containing 12 0.000 2 Uap1l1 UDP-N-acteylglucosamine pyrophosphorylase 1-like 1 0.001 2
One hundred and seventeen genes were also shown to have significantly greater expression in the muscle of D2 controls compared to B6 controls. These differentially expressed genes included 9 with a 10 fold or greater change (Table 4 6A), 50 with 3 to 9 fold change (Table 4 6B) and 45 with a 2 fold greater change (Table 4 6C) in expression in the muscle of D2 mice compared to B6 mice.
71 Table 4 6: Genes with greater expression in muscle tissue of D2 control mice compared to B6 control mice . Gene symbol and title are shown along with significant adjusted p values and fold change. (A) 10+ fold difference (B) 3 9 fold difference (C) 2 fold difference.
(A)
Gene Title Adj Pval Fold Change Atp1a2 ATPase, Na+/K+ transporting, alpha 2 polypeptide 0.000 11 H2-D1 histocompatibility 2, D region locus 1 0.000 13 H2-D1 histocompatibility 2, D region locus 1 0.000 18 H2-D1 /// H2-L histocompatibility 2, D region locus 1 0.000 13 Mcpt2 mast cell protease 2 0.000 11 Opn1mw opsin 1 (cone pigments), medium-wave-sensitive (color blindness, deutan) 0.000 11 Pdxdc1 pyridoxal-dependent decarboxylase domain containing 1 0.000 28 Serpina1a /Serpina1b serine (or cysteine) peptidase inhibitor, clade A, member 1a/ member 1b 0.000 23 Serpina1b serine (or cysteine) preptidase inhibitor, clade A, member 1b 0.000 31
72 (B)
Gene Title Adj Pval Fold Change Alad aminolevulinate, delta-, dehydratase 0.000 3 Cap1 CAP, adenylate cyclase-associated protein 1 (yeast) 0.001 3 Cap1 CAP, adenylate cyclase-associated protein 1 (yeast) 0.000 3 Ccndbp1 cyclin D-type binding-protein 1 0.000 3 Ces2 carboxylesterase 2 0.027 3 Cish cytokine inducible SH2-containing protein 0.009 3 Comt1 catechol-O-methyltransferase 1 0.000 3 Cuedc1 CUE domain containing 1 0.000 6 Elovl6 ELOVL family member 6, elongation of long chain fatty acids (yeast) 0.032 3 Elovl6 ELOVL family member 6, elongation of long chain fatty acids (yeast) 0.009 5 Fgl2 fibrinogen-like protein 2 0.000 3 Fgl2 fibrinogen-like protein 2 0.000 3 Fibin fin bud initiation factor homolog (zebrafish) 0.000 3 Flywch2 FLYWCH family member 2 0.000 3 Gprc5b G protein-coupled receptor, family C, group 5, member B 0.000 3 H2-Ea histocompatibility 2, class II antigen E alpha 0.000 9 Ifi202b interferon activated gene 202B 0.000 4 Il12a interleukin 12a 0.000 3 Irx3 Iroquois related homeobox 3 (Drosophila) 0.000 3 Kcnab1 potassium voltage-gated channel, shaker-related subfamily, beta member 1 0.000 3 Klk1 kallikrein 1 0.000 4 Lgi1 leucine-rich repeat LGI family, member 1 0.037 3 Med1 mediator complex subunit 1 0.000 4 Mela melanoma antigen 0.000 4 Myh6 /// Myh7 myosin, heavy polypeptide 6, cardiac muscle, alpha /// myosin, heavy polypeptide 7, cardiac muscle, beta 0.008 3 Myh6 /// Myh7 myosin, heavy polypeptide 6, cardiac muscle, alpha /// myosin, heavy polypeptide 7, cardiac muscle, beta 0.017 3 Myh7 myosin, heavy polypeptide 7, cardiac muscle, beta 0.010 3 Nnt nicotinamide nucleotide transhydrogenase 0.000 3 Nnt nicotinamide nucleotide transhydrogenase 0.000 4 Nog noggin 0.000 3 Ocel1 occludin/ELL domain containing 1 0.000 4 Paip1 polyadenylate binding protein-interacting protein 1 0.000 5 Park2 Parkinson disease (autosomal recessive, juvenile) 2, parkin 0.000 5 Pnpt1 polyribonucleotide nucleotidyltransferase 1 0.000 5 Rbp7 retinol binding protein 7, cellular 0.000 5 Rpl14 ribosomal protein L14 0.000 4 Sfi1 Sfi1 homolog, spindle assembly associated (yeast) 0.000 3 Sfi1 Sfi1 homolog, spindle assembly associated (yeast) 0.000 4 Sln sarcolipin 0.034 5 Smarca1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 0.000 3 Tmem37 transmembrane protein 37 0.000 4 Tmem87a transmembrane protein 87A 0.000 8 Tnnc1 troponin C, cardiac/slow skeletal 0.020 3 Tnni1 troponin I, skeletal, slow 1 0.015 3 Tnnt1 troponin T1, skeletal, slow 0.018 3 Tpm3 tropomyosin 3, gamma 0.023 3 Tpm3 tropomyosin 3, gamma 0.026 3 Wdfy1 WD repeat and FYVE domain containing 1 0.000 3 Wdfy1 WD repeat and FYVE domain containing 1 0.000 4 Zfp467 zinc finger protein 467 0.000 3
73 (C)
Gene Title Adj Pval Fold Change Acly ATP citrate lyase 0.026 2 Atp2a2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 0.046 2 Atp2a2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 0.040 2 Bcat2 branched chain aminotransferase 2, mitochondrial 0.000 2 Cdh4 cadherin 4 0.014 2 Cma1 chymase 1, mast cell 0.025 2 Col14a1 collagen, type XIV, alpha 1 0.001 2 Fbln1 fibulin 1 0.000 2 Fbn1 fibrillin 1 0.027 2 Fbn1 fibrillin 1 0.032 2 Frzb frizzled-related protein 0.001 2 Higd1a HIG1 domain family, member 1A 0.000 2 Kcnab1 potassium voltage-gated channel, shaker-related subfamily, beta member 1 0.000 2 Klc1 kinesin light chain 1 0.000 2 Klk1 kallikrein 1 0.001 2 Lrp6 low density lipoprotein receptor-related protein 6 0.000 2 Lyplal1 lysophospholipase-like 1 0.000 2 Lysmd2 LysM, putative peptidoglycan-binding, domain containing 2 0.000 2 Mela melanoma antigen 0.000 2 Mrpl47 mitochondrial ribosomal protein L47 0.000 2 Mtap1b microtubule-associated protein 1B 0.004 2 Myog myogenin 0.005 2 Ndrg4 N-myc downstream regulated gene 4 0.040 2 Ndrg4 N-myc downstream regulated gene 4 0.018 2 Ntsr2 neurotensin receptor 2 0.000 2 Nup35 nucleoporin 35 0.000 2 Ociad1 OCIA domain containing 1 0.000 2 Pak1 p21 (CDKN1A)-activated kinase 1 0.000 2 Pak1 p21 (CDKN1A)-activated kinase 1 0.000 2 Phf17 PHD finger protein 17 0.012 2 Plce1 phospholipase C, epsilon 1 0.000 2 Pnpla3 patatin-like phospholipase domain containing 3 0.016 2 Psmg4 proteasome (prosome, macropain) assembly chaperone 4 0.000 2 Pygl liver glycogen phosphorylase 0.027 2 Serpina3n serine (or cysteine) peptidase inhibitor, clade A, member 3N 0.003 2 Sgcb sarcoglycan, beta (dystrophin-associated glycoprotein) 0.000 2 Socs2 suppressor of cytokine signaling 2 0.002 2 Thrap3 thyroid hormone receptor associated protein 3 0.001 2 Tmem45a transmembrane protein 45a 0.000 2 Ttc28 tetratricopeptide repeat domain 28 0.000 2 Ttyh2 tweety homolog 2 (Drosophila) 0.000 2 Ugt1 UDP glucuronosyltransferase 1 family, polypeptide 0.011 2 Vash2 vasohibin 2 0.010 2 Zfp30 zinc finger protein 30 0.000 2 Zfp64 zinc finger protein 64 0.001 2
74 Of the above genes with differential expression as a function of genetic strain , myosin, heavy polypeptide 6, Myh6, is associated with muscle development. Myh6 expression was 3 fold greater in D2 control mice when compared to B6 controls and its expression was confirmed using RT PCR .
Differential Expression in Bone Tissue as a Function of Exercise Treatment
One of the primary aims of this study was to identify differentially expressed genes as a function of exercise treatment. Unlike the abundant number of genes differentially expressed as a function of mouse strain, only one gene, heat shock protein
(Hspa1b), had significantly different expression relative to exercise treatment within bone tissue after appropriate adjustment for multiple comparisons. Expression of Hspa1b in bone tissue was 6 fold higher in treadmill runners versus controls with both strains combined (Table 4 7). The expression of this gene was confirmed using RT PCR.
Several genes of interest were differentially expressed as a function of exercise and considered for follow up analyses even though they were no longer significant after adjustment for multiple comparisons. The peroxisome proliferative activated receptor, gamma gene (Pparc1a), known to be a player in bone tissue, had 5 fold greater expression in the bone tissue of treadmill runners as compared to controls with both strains combined and confirmed using RT PCR (Table 4 7). Wnt1 (wingless related integration site 1) which is part of the Wnt receptor signaling pathway was also differentially expressed in bone tissue as a function of treadmill running within the B6 strain. B6 treadmill runners had 2 fold greater expression compared to B6 controls as confirmed with RT PCR (Table 4 7).
75 Table 4 7: Genes with greater expression in bone tissue of treadmill exercised mice compared to control mice . Gene symbol and title are shown along with significant adjusted p values and fold changes. TR = Treadmill and C = Control
Gene Results Strain Title Pval Adj Pval Fold Change Hspa1a TR > C Combined heat shock protein 1A 0.000 0.262 5 Hspa1b TR > C Combined heat shock protein 1B 0.000 0.138 6 Hspa1b TR > C Combined heat shock protein 1B 0.000 0.047 6 Hspa1b TR > C Combined heat shock protein 1B 0.000 0.134 6 Ppargc1a TR > C Combined peroxisome proliferative activated receptor, gamma, coactivator 1 alpha 0.001 0.458 5 Ppargc1a TR > C Combined peroxisome proliferative activated receptor, gamma, coactivator 1 alpha 0.000 0.188 5 Ppargc1a TR > C Combined peroxisome proliferative activated receptor, gamma, coactivator 1 alpha 0.000 0.188 5 Wnt1 TR > C B6 wingless-related MMTV integration site 1 0.009 1.000 2
Pleiotrophin (Ptn), another gene known to be involved in bone maintenance, had greater expression in the bone tissue of tower climbers when compared to controls with both strains combined and confirmed via RT PCR (Table 4 8). Though not confirmed, sclerostin (Sost), a negative regulator of the bone morphometric signaling pathway, was also differentially expressed as a function of tower climbing with a 2 fold greater level of expression in controls compared to tower climbers within D2 mice (Table 4 8).
Table 4 80: Genes with differential expression in bone tissue as a result of tower exercise . Gene symbol and title are shown along with significant p values, adjusted p values and fold changes. TO = Treadmill and C = Control
Gene Results Strain Title Pval Adj Pval Fold Change Ptn TO > C Combined pleiotrophin 0.030 0.286 2 Ptn TO > C Combined pleiotrophin 0.033 0.286 3 Sost C > TO D2 sclerostin 0.025 0.546 3
Differential Expression in Muscle Tissue as a Function of Exercise Treatment
Unlike bone tissue, numerous genes that were differential expressed within muscle tissue as a function of exercise treatment were significant after adjustment for multiple comparisons. There were 19 genes with greater expression in treadmill runners compared to controls with bone strains combined. Four of these genes, including Hspa1b,
76 found as a result of exercise treatment in bone tissue as well, had 8 to 16 fold change in
expression (Table 4 9A) and fifteen of these genes had 2 3 fold change in expression
(Table 4 9B).
Table 4 9: Genes with greater expression in muscle tissue of treadmill runners compared to control mice with both strains combined. Gene symbol and title are shown along with significant adjusted p values and fold change. (A) 8 16 fold difference. (B) 2 3 fold difference.
(A)
Gene Title Adj Pval Fold Change Hspa1a heat shock protein 1A 0.000 8 Hspa1b heat shock protein 1B 0.000 16 Hspa1b heat shock protein 1B 0.000 15 Hspa1b heat shock protein 1B 0.000 13
(B) Gene Title Adj Pval Fold Change Ctla2a /b cytotoxic T lymphocyte-associated protein 2 alpha / beta 0.000 2 Ell2 elongation factor RNA polymerase II 2 0.000 2 Foxo1 forkhead box O1 0.000 2 Foxo1 forkhead box O1 0.001 2 Hsp90aa1 heat shock protein 90, alpha (cytosolic), class A member 1 0.000 3 Hsp90aa1 heat shock protein 90, alpha (cytosolic), class A member 1 0.000 2 Ifi30 interferon gamma inducible protein 30 0.003 2 Impact imprinted and ancient 0.000 2 Irs2 insulin receptor substrate 2 0.044 2 Maff v-maf musculoaponeurotic fibrosarcoma oncogene family, protein F (avian) 0.000 2 Mt1 metallothionein 1 0.000 3 Mt2 metallothionein 2 0.000 3 Nr4a2 nuclear receptor subfamily 4, group A, member 2 0.001 3 Ppargc1a peroxisome proliferative activated receptor, gamma, coactivator 1 alpha 0.001 3 Ppargc1a peroxisome proliferative activated receptor, gamma, coactivator 1 alpha 0.000 2
Four genes were found to have 2 fold greater expression in tower climbers compared to
controls (Table 4 10A), including Hspa1b, and eight genes were found to have 2 fold
greater expression in controls compared to tower climbers irrespective of strain (Table 4
10B).
77 Table 4 10: Genes with differential expression in muscle tissue relative to tower climbing irrespective of strain. Gene symbol and title are shown along with significant adjusted p values and fold change. TO = Tower and C = Control (A) TO > C (B) C >TO.
(A)
Gene Title Adj Pval Fold Change Hspa1b heat shock protein 1B 0.010 2 Hspa1b heat shock protein 1B 0.021 2 Hspa1b heat shock protein 1B 0.034 2 Rad21 RAD21 homolog (S. pombe) 0.002 2
(B)
Gene Title Adj Pval Fold Change Caprin1 cell cycle associated protein 1 0.002 2 Dnm1l dynamin 1-like 0.002 2 Hspa9 heat shock protein 9 0.002 2 Ide insulin degrading enzyme 0.002 2 Nr1d2 nuclear receptor subfamily 1, group D, member 2 0.005 2 Serinc1 serine incorporator 1 0.013 2 Ubc ubiquitin C 0.003 2 Ywhag tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide 0.003 2
Within the B6 strain, 29 genes were found to have 2 to 9 fold greater expression
in the treadmill runners compared to controls (Table 4 11A) and 14 genes were found
have 2 to 3 fold greater expression in the tower climbers compared to controls (Table 4
11B). Of the 29 genes with greater expression in treadmill runners, there was a 2 to 5 fold
change in expression for all the genes except Hspa1b which had a 9 fold change.
Table 4 11: Genes with greater expression as a result of exercise in muscle tissue within the B6 strain . Gene symbol and title are shown along with significant adjusted p values and fold change. TR = Treadmill TO = Tower and C = Control (A) TR > C (B) TO > C.
78 (A)
Gene Title Adj Pval Fold Change Akap12 A kinase (PRKA) anchor protein (gravin) 12 0.002 2 Btg2 B-cell translocation gene 2, anti-proliferative 0.010 2 Crem cAMP responsive element modulator 0.026 2 Ctla2a cytotoxic T lymphocyte-associated protein 2 alpha 0.000 2 Ctla2a /b cytotoxic T lymphocyte-associated protein 2 alpha / beta 0.000 3 Ctla2b cytotoxic T lymphocyte-associated protein 2 beta 0.000 2 Ell2 elongation factor RNA polymerase II 2 0.001 2 Foxo1 forkhead box O1 0.011 2 Gcnt2 Glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (Gcnt2), transcript variant 2, mRNA 0.031 2 Hsp90aa1 heat shock protein 90, alpha (cytosolic), class A member 1 0.018 2 Hsp90aa1 heat shock protein 90, alpha (cytosolic), class A member 1 0.006 2 Hspa1a heat shock protein 1A 0.002 5 Hspa1b heat shock protein 1B 0.001 9 Hspa1b heat shock protein 1B 0.000 9 Hspa1b heat shock protein 1B 0.000 9 Ifi30 interferon gamma inducible protein 30 0.016 3 Impact imprinted and ancient 0.000 3 Junb Jun-B oncogene 0.021 2 Maff v-maf musculoaponeurotic fibrosarcoma oncogene family, protein F (avian) 0.001 2 Mt1 metallothionein 1 0.002 4 Mt2 metallothionein 2 0.013 3 Nr4a2 nuclear receptor subfamily 4, group A, member 2 0.037 3 Pank1 pantothenate kinase 1 0.013 2 Pdlim5 PDZ and LIM domain 5 0.000 2 Pdlim5 PDZ and LIM domain 5 0.002 2 Pdxk pyridoxal (pyridoxine, vitamin B6) kinase 0.000 2 Ppargc1a peroxisome proliferative activated receptor, gamma, coactivator 1 alpha 0.020 3 Ppargc1a peroxisome proliferative activated receptor, gamma, coactivator 1 alpha 0.009 3 Tinagl1 tubulointerstitial nephritis antigen-like 1 0.000 2
(B)
Gene Title Adj Pval Fold Change Asb15 ankyrin repeat and SOCS box-containing 15 0.022 2 Atp8a1 ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1 0.018 2 Caprin1 cell cycle associated protein 1 0.018 2 Dnm1l dynamin 1-like 0.022 2 Eif3a eukaryotic translation initiation factor 3, subunit A 0.009 2 Fgf13 fibroblast growth factor 13 0.042 2 Hspa9 heat shock protein 9 0.018 3 Ide insulin degrading enzyme 0.018 2 Immt inner membrane protein, mitochondrial 0.044 2 Mapk14 mitogen-activated protein kinase 14 0.048 2 Nedd4 neural precursor cell expressed, developmentally down-regulated 4 0.016 2 Nr1d2 nuclear receptor subfamily 1, group D, member 2 0.049 2 Ubc ubiquitin C 0.022 2 Ywhag tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide 0.028 2
79 Only 2 genes within the B6 strain were found to have 2 fold greater expression in
controls compared to tower climbers and 1 gene was found to have 2 fold greater
expression in controls compared to treadmill runners (Table 4 12).
Table 4 12: Genes with greater expression in muscle tissue of controls compared to exercised mice within the B6 strain . Gene symbol and title are shown along with significant adjusted p values and fold change. TR = Treadmill TO = Tower and C = Control
Gene Results Title Adj Pval Fold Change Atxn10 C > TO ataxin 10 0.018 2 Rad21 C > TO RAD21 homolog (S. pombe) 0.025 2 4-Sep C > TR septin 4 0.002 2
Within the D2 strain, 14 genes were found to have greater expression in the treadmill
runners compared to controls; 10 of these genes had a 2 to 3 fold change in expression
(Table 4 13A) and the 4 remaining genes had a 13 to 27 fold change in expression and
were the heat shock protein genes (Table 4 13B).
Table 4 13: Genes with greater expression as a result of treadmill running in muscle tissue within the D2 strain . Gene symbol and title are shown along with significant adjusted p values and fold change. (A) 2 3 fold difference (B) 13 27 fold difference.
(A)
Gene Title Adj Pval Fold Change Ell2 elongation factor RNA polymerase II 2 0.000 3 Foxo1 forkhead box O1 0.036 2 Foxo1 forkhead box O1 0.020 2 Foxo1 forkhead box O1 0.010 2 Hsp90aa1 heat shock protein 90, alpha (cytosolic), class A member 1 0.000 3 Hsp90aa1 heat shock protein 90, alpha (cytosolic), class A member 1 0.000 3 Mt1 metallothionein 1 0.031 3 Mt2 metallothionein 2 0.047 3 Nle1 notchless homolog 1 (Drosophila) 0.003 2 Nr4a2 nuclear receptor subfamily 4, group A, member 2 0.037 3
80 (B)
Gene Title Adj Pval Fold Change Hspa1b heat shock protein 1B 0.000 27 Hspa1b heat shock protein 1B 0.000 24 Hspa1b heat shock protein 1B 0.000 19 Hspa1a heat shock protein 1A 0.000 13
One gene within the D2 strain, Pcp4l1, was found to have 3 fold greater expression in
controls compared to treadmill runners (Table 4 14).
Table 4 14: Pcp4l1 had significantly greater expression in muscle tissue of control mice compared to treadmill runners within the D2 strain . Gene symbol and title are shown along with significant adjusted p values and fold changes. TR = Treadmill and C = Control
Gene Results Title Adj Pval Fold Change Pcp4l1 C > TR Purkinje cell protein 4-like 1 0.037 3
Of the above genes with differential expression as a function of exercise, Hspa1b and
Ppargc1a were chosen for follow up analysis. Hspa1b was repeatedly found as being
differentially expressed as a result of exercise with high fold changes and Ppargc1a is
known to play a role in the response of muscle to exercise. Both genes were confirmed
using RT PCR as having greater expression due to treadmill running when compared to
controls with bone strains combined.
81 Discussion
The primary goal of this study was to identify genes differentially expressed within femoral corticies and gastrocnemius muscle as a function of genetic strain and exercise treatment. Many genes were identified as having different expression levels relative to genetic strain within both tissues. Of the 341 genes within bone tissue that were differentially expressed, 129 genes had a 2 fold or greater change in expression.
Four of these genes, Bmp2k, Gpnmb, Mepe and Slc20a1, were confirmed via RT PCR.
These four genes were chosen for follow up analysis in particular because of their known relationship to bone maintenance. Bmp2k, bone morphogenetic 2 inducible kinase, has been shown to control the rate of bone formation through attenuation of osteoblast differentiation (Kearns, 2001). Bone morphometric proteins (BMPs) have been extensively studied in regards to osteoblast differentiation and bone formation. Bmp2 has been shown in particular to stimulate bone formation (Wang, 1990); whereas, Bmp2 inducible kinase has the inverse effect. Bmp2k expression was 3 fold greater in D2 mice compared to B6 mice in this study.
Matrix extracellular protein, Mepe, expression was also greater in D2 mice by 4 fold. Mepe has been shown to become activated during osteoblast differentiation
(Petersen, 2000). Gpnmb, glycoprotein (transmembrane) nmb (also known as osteoactivin), on the other hand, had 3 fold greater expression in B6 mice. Gpnmb is expressed in osteoblast cells during bone formation (Safadi, 2002). Slc20a1, solute carrier family, member 1, also had greater expression in the B6 mice by 5 fold. The Slc20 family of proteins have been shown to function as sodium phosphate cotransporters
(Collins, 2004) and inhibition of sodium dependent phosphate transport has been shown
82 to decrease bone resorption of osteoclasts (Khadeer, 2003). This provides evidence that in addition to known differences in the bone phenotypes and genotypes of the two genetic strains, there are differences at the expression level of genes involved in bone maintenance.
Additional genes with significant differential expression as a result of genetic strain worth mentioning include those with 10 fold or greater differences in expression.
Seven genes had 10 fold or greater expression in B6 mice compared to D2 mice. These genes included an interferon activated gene (203), nuclear distribution gene E like homolog, 3 phosphate dehydrogenase, a differentiation transcriptional activator, a ribosomal protein, and tripartite motifs. Twelve genes had 10 fold or greater expression in D2 mice compared to B6 mice. These genes included cyclin B1 interacting protein 1, eosinophil associated, ribonuclease, histocompatibility genes, an interferon activated gene (202B), immunoglobulin heavy chain complex, melanoma antigen, mutS homolog, pyridoxal dependent decarboxylase, serine peptidase inhibitor and Sfi1 homolog. To our knowledge, the role of these genes in bone tissue are unknown. However, in this study they had significant difference in expression relative to genetic strain in bone tissue from inbred strains with known differences in bone architecture and strength. Therefore, these results provide evidence of specific genes that may play a role in bone phenotypic differences.
To further explore the link between gene expression and phenotypic expression, genes that were differentially expressed between the two inbred strains were compared to bone QTL previously identified in our lab using F2 and RI progeny derived from the same two inbred strains. Twenty genes that were differentially expressed co located with
83 QTL identified for measures of gross and cross sectional morphology as well as measures of structural and material strength of the femur. These genes included a microtubule associated protein, solute carrier family member 1 protein as mentioned above, sorting nexin 5, aminolevulinate delta dehydratase, enolase, killer cell lectin like receptor, sarcospan, branched chain aminotransferase, kallikrein, maternally expressed 3, serine peptidase inhibitors, mast cell protease, thyroglobulin, histocompatibility genes, mutS homolog and tubby like protein 4.
In particular, Slc20a1, discussed above as being related to bone maintenance and confirmed as having differential expression relative to genetic strain overlapped with
QTL. Slc20a1 is located within the 1 LOD support interval of QTL for femoral length, load at yield and work to yield as well as ultimate load. Therefore, Slc20a1 can be considered a valuable candidate gene for the identified QTLs influencing skeletal phenotypes in addition to the other candidate genes that overlapped with the QTL data that are not necessarily known to be related to bone.
Out of the 228 genes within muscle tissue that had differential expression as a result of genetic strain, 200 had 2 fold or greater change in expression. Myh6, myosin heavy polypeptide 6, was one of these genes and was confirmed as having 3 fold greater expression within the muscle tissue of D2 mice compared to B6 mice. Myosin is a well known motor protein that interacts with actin in muscle tissue. The expression of myosin heavy chain isoforms have been studied in relation to muscle development in the hindlimb muscles of mice (Agbulut, 2003). Myh6 in particular is a cardiac myosin heavy chain gene. However, it was differentially expressed relative to strain in skeletal muscle in this study.
84 Additionally, 7 of the 111 genes with differential expression in muscle tissue had
10 fold or greater expression in B6 mice compared to D2 mice. These genes included acireductone dioxygenase, fibroblast growth factor binding protein, major urinary protein, pyridoxal dependent decarboxylase domain, pituitary tumor transforming gene and a member of the RAS oncogene family. Nine genes had greater than 10 fold greater expression in D2 mice compared to B6 mice. These genes included an ATPase sodium/potassium transporting polypeptide, histocompatiblity genes, mast cell protease, opsin, pyridoxal dependent decarboxylase domain, and a serine peptidase inhibitor. Many additional genes were identified in bone and muscle tissue as having significant differential expression relative to genetic strain. These genes can potentially provide a starting point for further exploration of genotypic differences in terms of musculoskeletal gene expression between the two inbred strains commonly used in research.
The effect of exercise treatment on gene expression within bone tissue was not as significant as expected. Although, a heat shock protein, Hspa1b (also known as Hsp70), had a significant 6 fold greater expression level as a result of treadmill running in bone tissue when compared to control mice as confirmed by RT PCR. Interestingly, Hspa1b has been shown to be differentially expressed in trabecular meshwork cells due to cyclic mechanical stress (Luna, 2009). Several additional genes had suggestive differences in expression as a function of exercise and are of interest. Ppargc1a (also known as Pgc1a), peroxisome proliferative activated receptor coactivator, was 5 fold greater in treadmill runners versus controls and was confirmed via RT PCR. Ppargc1a has been shown to be activated by parathyroid hormome (PTH) in osteoblasts and Ppargc1a was shown to coactivate Nurr1 (NR4A/NGF1 B orphan nuclear receptor), resulting in the activation of
85 genes such as osteoclacin (Nervina, 2006). PTH is known to stimulate osteoclasts (Mears,
1971; Miller, 1985) in order to resorb bone and release calcium into the bloodstream; whereas, osteocalcin is known to stimulate bone formation through inhibition of osteoclasts (Zaidi, 1987). These results suggest that treadmill running increases the expression of Ppargc1a which could indirectly result in the stimulation of bone formation through Nurr1 and osteocalcin.
Another gene of interest differentially expressed in bone tissue as a result of exercise was Ptn, pleiotrophin. Ptn had 3 fold greater expression in tower climbers when compared to controls. Ptn has been shown as a player in regulating bone’s response to mechanical loading (Xing, 2005) by increasing osteoblast recruitment (Iami, 1998). Ptn is also reported to be a negative regulator of adipognesis (Gu, 2007), through inhibitory effects on PPARγ, and is subject to regulation by estrogen receptors, thereby supporting the notion of an inverse relationship between osteogenesis and adipogenesis. In a study of tibia in 10 week old B6 mice, there was a 4 fold increase in Ptn expression due to mechanical loading via 4 pt bending (Xing, 2005). These results provide support that Ptn is upregulated in response to mechanical loading in adult mice and to the best of our knowledge, this resistance exercise effect has not been demonstrated previously. We believe that Ptn may represent a novel signaling link between skeletal and adipose tissue to exert an anti obesity effect in response to resistance exercise training. Identification of novel signaling cascades which adversely impact adipose tissue and skeletal integrity by age associated E 2 deficiency but reversed by resistance exercise could provide new mechanistic insights for the development of therapeutic strategies to optimally maintain bone and metabolic health with advancing age.
86 Another gene with differential expression as a result of exercise within bone tissue was Wnt1 (wingless related integration site). Wnt expression was increased with running by 2 fold within B6 mice as compared to controls and was confirmed using RT
PCR. The Wnt pathway is widely known to be involved in bone homestasis including stimulation of osteblast differentiation (Krishnan, 2006). Although not confirmed, another interesting gene, Sost (sclerostin) was expressed 2 fold less in tower climbers than that of controls within D2 mice. Sost is upregulated by BMPs and has been shown to inhibit the Wnt pathway, thereby negatively regulating bone formation (Kamiya, 2008).
Therefore, tower climbing could have stimulated bone formation by inhibiting the Wnt pathway indirectly through Sost.
Significant treatment effects were identified for gene expression within muscle tissue. Seventy eight genes were significantly different as a result of exercise. As in bone tissue, heat shock protein, Hspa1b (also known as Hsp70), was among the genes with greater expression in the muscle tissue of treadmill runners as confirmed with RT PCR.
Hspa1b had a 16 fold increase in expression with treadmill running in muscle tissue.
Over expression of Hspa1b has been shown to help avoid muscle damage and age related muscle problems (McArdle, 2004). Ppargc1a expression, as in bone tissue, was also increased by 3 fold in the muscle tissue of treadmill runners and was confirmed by RT
PCR. This was of particular interest because Ppargc1a expression in skeletal muscle has been shown to increase with exercise (Akimoto, 2005) and Ppargc1a has been shown to play a role in muscle adaptation to endurance exercise (Yan, 2009).
Although precautions were taken to limit cross contamination of tissues it should be noted that it’s possible muscle and bone marrow cells could have contaminated the
87 bone tissue samples. This may partially explain similarities in genes with differential expression in both tissues. However, muscle tissue was carefully removed from the bone samples and bone marrow was vigorously flushed from the bones ideally limiting any possible contamination.
Differential gene expression between the controls and treadmill runners or tower climbers provide insight into bone and muscle changes as a result of physiological plausible methods of exercise at the molecular level. The resulting differences may help explain how bone cells are able to respond to mechanical loading and consequently aid in the understanding of bone adaptation. Prevention and treatment of bone disease such as osteoporosis may then become more effective.
88 References
Agbulut, O, Noirez, P., Beaumont, F., and Butler Browne, G. (2003) Myosin heave chain isoforms in postnatal muscle development of mice. Biology of the Cell, 95 (6): 399 406.
Akimoto, T., Pohnert, S.C., Li, P., Zhang, M., Gumbs, C., Rosenberg, P.B., Williams, R.S., and Yan, Z. (2005) Exercise stimulates PGC 1α transcription in skeletal muscle through activation of p38 MAPK pathway. Journal of Biological Chemistry, 280: 19587 19593.
Basten, C.J., Weir, B.S., and Zeng, Z.B. (1995) ZMAP A QTL cartographer. Proccedings of the 5th World Congress on Genetics Applied to Livestock Production 22 : 65 66.
Basten, C.J., Weir, B.S., and Zeng, Z.B. (2002) QTL Cartographer, Version 2.0. Department of Statistics, North Carolina State University, Raleigh, NC.
Collins, J.F., Bai, L., and Ghishan, F.K. (2004) The SLC20 family of proteins: dual functions as sodium phosphate cotransporters and viral receptors. European Journal of Phsyiology, 447 (5): 647 652.
Frost, H.M., Ferretti, J.L., and Jee, W.S. (1998) Perspectives: some roles of mechanical usage, muscle strength, and the mechanostat in skeletal physiology, disease, and research. Calcified Tissue International, 62: 1 7.
Gu, D., Yu, B., Zhao, C., Ye, W., Lv, Q., Hua, Z., Ma, J., and Zhang, Y. (2007) The effect of pleiotrophin signaling on adipogenesis. FEBS Letters, 581 (3): 382 388.
Imai, S., Kaksonen, M., Raulo, E., Kinnunen, T., Fages, C., Meng, X., Lakso, M. and Rauvala, H. (1998) Osteoblast recruitment and bone formation enhanced by cell matrix associated heparin binding growth associated molecule (HB GAM). Journal of Cellular Biology, 143 (4): 1113 1128.
Kamiya, N., Ye, L., Kobayashi, T., Mochida, Y., Yamauchi, M., Kronenberg, H.M., Feng, J.Q., and Mishina, Y. (2008) BMP signaling negatively regulates bone mass through sclerostin by inhibitin the canonical Wnt pathway. Development and Disease, 135: 3801 3811.
Kearns, A.E., and Demay, M.B., (2000) BMP 2 induces the expression of activin beta and follistatin in vitro. Journal of Cellular Biochemistry, 79 (1): 80 88.
89 Kesavan, C., Baylink, D.J., Kapoor, S., and Mohan, S. (2007) Novel loci regulating bone anabolic response to loading: expression QTL analysis in C57BL/6JXC3H/HeJ mice cross. Bone, 41: 223 230.
Khadeer, M.A., Tang, Z., Tenenhouse, H.S., Eiden, MV., Murer, H., Hernando, N., Weinman, E.J., Chellaiah, M.A., and Gupta, A. (2003) Na+ dependent phosphate transporters in the murine osteoclastic cellular distribution and protein interactions. American Journal of Physiology Cell Physiology, 284 (6): C1633 1644.
Krishnan, V., Bryant, H.U., and MacDougald, O.A. (2006) Regulation of bone mass by Wnt signaling. Journal of Clinical Investigation, 116 (5): 1202 1209.
Lander, E.S. and Kruglyak, L. (1995) Genetic dissection of complex traits: guidelines for interpreting and reporting linkage results. Nat Genet 11 : 241 247.
Lang, D.H., Sharkey, N.A., Mack, H.A., Vogler, G.P., Vandenbergh, D.J., Blizard, D.A., Stout, J.T., and McClearn, G.E. (2005) Journal of Bone and Mineral Research, 20 (1): 88 99.
Luna, C., Li, G., Paloma, B.L., Epstein, D.L., and Gonzalez, P. (2009) Alterations in gene expression induced by cyclic mechanical stress in trabecular meshwork cells. Molecular Visions, 15: 534 544.
Mears, D.C. (1971) Effects of parathyroid hormone and thyrocalcitonin on the membrane potential of osteoclasts. Endocrinology, 88: 1021 1028.
Miller, S.C., and Kenny, A.D. (1985) Activation of avian medullary bone otseoclasts by oxidized synthetic parathyroid hormone (1 34). Proceedings of the Society for Experimental Biology and Medicine, 179: 38 43.
National Institutes of Health, Osteoporosis and Related Bone Diseases National Resource Center [Web Page] URL http://ww.osteo.org (Accessed April 2009)
Nervina, J.M., Magyar, C.E., Pirih, F.Q., and Tetradis, S. PGC 1α is induced byparathyroid hormone and coactivates Nurr1 mediated promotor activity in osteoblasts. Bone, 39 (5): 1018 1025.
Petersen, D., Tkalcevic, G.T., Mansolf, A.L, Rivera Gonzalez, R., and Brown, T.A. (2000) Identification of osteoblast/osteocyte factor 45 (OF45), a bone specific cDNA encoding an RGD containing protein that is highly expressed in osteoblasts and osteocytes. Journal of Biological Chemistry, 275 (6): 36172 36180.
90 Safadi, F.F., Xu, J., Smock, S.L., Rico, M.C., Owen, T.A., and Popoff, S.N. (2002) Cloning and characterization of osteoactivin, a novel cDNA expressed in osteoblasts. Journal of Cellular Biochemistry, 84: 12 26.
Wang, E., Rosen, V., D’Alessandro, J.S., Bauduy, M., Cordes, P., Harada, T., Israel, D.I., Hewick, R.M., Kerns, K.M., LaPan, P., Luxenberg, D.P., McQuaid, D., Moutsatsos, I.K., Nove, J., and Wozney, J.M. (1990) Recombinant human bone morphogenetic protein induces bone formation. Proceedings of the National Academy of Sciences USA, 87: 2220 2224.
Wolff, J. The Law of Bone Remodeling . 1892. Translation of Wolff’s Das Gesetz der Transformaton der Knochen by P. Marquet and R. Furlong. Springer Verlag, Berlin.
Xing, W., Baylink, D., Kesavan, C., Hu, Y., Kapoor, S., Chadwick, R.B., and Mohan, S. (2005) Global gene expression analysis in the bones reveals involvement of several novel genes and pathways in mediating an anabolic response of mechanical loading in mice. Journal of Cellular Biochemistry, 96 (5): 1049 1060.
Yan, Z. (2009) Exercise, PGC 1α, and metabolic adaptation in skeletal muscle. Applied Physiology, Nutrition and Metabolism, 34: 424 427.
Zaidi, M., Moonga, B.S., Bevis, P.J.R., Towhidul Alam., A.S.M., Legon, S., Wimalawansa, S., MacIntyre, I., and Breimer, L.H. (1991) Expression and function of the calcitonin gene products. Vitamins and Hormones, 46: 87 164.
91 Chapter 5
Exercise Induced Changes in Cage Activity, Body Weight, Food Consumption and Muscle Mass in C57BL/6 and DBA/2J Mice
Abstract
Proper interpretation of the physiological changes induced by experimental manipulation requires careful consideration of simultaneous actions and potential confounders. This is particularly true in studies of complex systems utilizing different inbred strains of mice that display markedly different anatomical, physiological, and behavioral phenotypes. Skeletal health as a consequence of gene environment interactions is one such system. To better interpret skeletal consequences of exercise, we repeatedly measured cage activity, body weight, and food consumption in 180 day old female C57BL/6J (B6) and DBA/2J (D2) mice exposed to forced treadmill running and voluntary tower climbing. Treadmill running is considered an aerobic exercise, whereas tower climbing is considered to be more closely related to resistance type exercise. We measured strain differences in natural and exercise influenced activity levels. Differences in body weight and food consumption were also compared relative to strain and treatment prior to and through the duration of the interventions. Muscle weights of the hind limb were measured as a function of genetic strain and exercise as well. The results indicated that B6 mice were naturally more active in home cage floor activity whereas D2 mice were more apt to rear on their hind legs and climb on the metal grid of their food holders.
B6 mice also climbed more than D2 mice when housed in a cage attached to a 1 meter tall mesh wire tower. Treadmill running was shown to decrease normal home cage activity in both strains when comparing activity levels after an average of two weeks of
92 running to baseline levels. Treadmill runners also had a decrease in body weight at the end of the intervention when compared to controls in both strains and D2 mice consumed more food than B6 mice. Lower extremity muscle mass was greater in B6 mice, and did not change due to exercise. These results provide valuable data for better interpretation of experimental manipulations exploring the influence of genetic strain and exercise on bone adaptation.
Introduction
Bone is a dynamic tissue in that it is able to adapt to changes in its loading environment by altering its structural strength. The details of this adaptation are still being explored, including elucidation of the genes involved. However, the response of bone to mechanical demand is complex and involves genetic interactions directly affecting bone tissue, as well as potential indirect influences on bone via genes that affect such things as behavior, muscle force and body weight. Exercise interventions may affect many of these parameters simultaneously. The main focus of this study was to determine the effects of genetic background and exercise on activity levels, body weight, food consumption and muscle mass in adult, female mice.
Inbred mice provide a useful experimental model because an inbred mouse strain provides essentially an infinite amount of nearly identical genetic replicates. Therefore, an inbred strain can be used to look at exercise effects without confounding genetic effects and different inbred strains of mice can also be compared in order to determine the effect of genetic differences. Two different inbred strains of mice, C57BL/6J (B6) and DBA/2J (D2), were used to study the effects of genetics and different modes of
93 exercise, treadmill running (aerobic exercise) and tower climbing (resistance based exercise), on parameters related to bone adaptation.
The amount of physical activity can affect bone either by acting directly on bone or through modulations in muscle action. It is therefore reasonable to hypothesize that more active animals may have stronger bones as a result. And it follows that animals that are less active may have a greater adaptive response to forced exercise intervention than those that are naturally more active. Contrarily, animals with higher natural activity levels have a greater response to voluntary wheel running because they are more likely to run.
This is an important consideration because the effects of exercise interventions may be confounded by differences in natural activity levels. B6 and D2 inbred strains of mice have been shown to differ in regards to their natural in cage activity, with B6 mice being more active than D2 mice (Tang, 2002). B6 mice have also been shown to be more active than D2 mice in regards to voluntary wheel running (Lerman, 2002). Therefore, it was hypothesized that the B6 mice would be more naturally active than the D2 mice in this study. It is interesting to note that Lerman et al. also reported that while B6 mice were more active they were also more resistant to forced treadmill running than D2 mice
(Lerman, 2002). It was also hypothesized that exercise would not alter the in cage activity levels of the mice.
Body weight is the second largest source of loading on bone and has been shown to be related to bone mass in mature B6 mice (Iwaniec, 2009) and bone size and strength in second generation (F2) mice derived from B6 and D2 progenitor strains (Lang, 2005)
Therefore, body weight and food consumption were also monitored throughout the duration of the experiment in order to determine if there were genetic differences as well
94 differences as a result of exercise. Body weight has not been shown to differ significantly in B6 and D2 mice (Kaye, 1995; Lerman, 2002). Therefore, it was hypothesized that body weight and food consumption would not be significantly different as a function of inbred mouse strain or as a result of the exercise methods chosen for this study.
Muscle force may be another important modulator of bone’s response to mechanical loading. Mice with increased muscle mass have been shown to have a greater response to treadmill running in regards to bone strength than mice with smaller muscles (Hamrick, 2006). Therefore, investigating differences in muscle mass as a result of genetic strain and exercise may also aid in the understanding of bone adaptation. B6 mice have been shown to have larger calf muscles (gastrocnemius, plantaris and soleus combined) than D2 mice (Lerman, 2002) and treadmill running has been shown to increase the mass of skeletal muscles from the hindlimb (extensor digitorum longus
(EDL) and soleus) in young B6 mice (Kemi, 2002). We hypothesized that B6 mice would have larger muscles than the D2 mice in this study, and that both strains would increase muscle mass in response to both treadmill running and especially tower climbing because it is a more resistance based exercise.
Materials and Methods
Animals and Experimental Design
Mice from both genetic strains were raised in a barrier facility at the Center for
Developmental and Health Genetics at Penn State University and then transferred to the
Penn State Noll Physiology Laboratory two weeks prior the start of treatment. Ninety adult (180 day old) female mice equally divided between B6 and D2 inbred strains were exposed to treadmill running, tower climbing or served as controls (15 in each group).
95 The five week exercise intervention was conducted with five cohorts staggered over a span of nine months with 3 mice from each strain by treatment group in each cohort.
The treadmill runners were exercised on a rodent treadmill 5 days per week for 5 weeks and the speed, incline and duration were gradually increased over a four week period until a target speed of 15 m/min at a 25 degree incline for 30 minutes was attained and maintained for the last week of the intervention. The mice were encouraged to run through the use of hand prodding, puffs of air, and an electric stimulus (impulse of
0.76mA for 2ms at 2 pulses per second) in that order. No animals were removed from the study despite strict guidelines regarding monitoring the mice and the amount of stimuli required to maintain running.
The tower climbers were housed in a cage attached to a 120 cm tall mesh wire tower 17 cm in diameter with water bottles placed at the top of the tower. Tower climbers remained in the tower equipped cages 24 hours per day for a 5 week period. To train the mice during the first week, the water bottles were placed at the bottom of the tower and gradually raised to the top with a final height of 100 cm from the bottom of the tower to the tips of the water bottles. The mice then climbed to the top of the towers to drink during the remaining weeks of the intervention.
All of the mice were individually housed in the same room with monitored temperature and humidity. Food and water were available ad libitum. The lights were set on a reverse 12 hour light/dark cycle. The treadmill mice were exercised during the dark cycle when the mice are known to be more active. All procedures complied with and were approved by the Pennsylvania State University Institutional Care and Use
Committee.
96
Activity Measures
The normal activity levels of all the mice were monitored for 23 hours each day for four consecutive days prior to the exercise intervention. Activity was measured by placing each 19 x 30 cm standard mouse cage into custom designed interrupted infrared light monitoring systems. Mouse activity was monitored throughout the volume of a standard mouse cage using banks of sensors in the x, y and z direction. Each sensor consisted of an emitter and detector that sensed when an infrared beam was broken. Four different monitoring systems were used with each mouse monitored for 23 hours in each system. Activity on the floor of the cage was monitored with a set of 16 sensors in the x axis, equally spaced at 1.7 cm intervals and 8 sensors in the y axis, equally spaced at 1.9 cm intervals. Sensors at this lower level were used to detect presence on the floor vs climbing on the metal food grid as well as distance traveled on the cage floor. Three additional levels of sensors in the z axis, equally spaced at 4 cm intervals, were used to detect climbing on the metal food grid as well as rearing activity. The z axis sensors were arranged as to cover the space around the v shaped metal grid food holder. The z axis sensors were arranged along the x axis only and were used to detect the level of the z axis and not the x y position due to interference of the food holder in the x axis above the first level of sensors.
Activity was assessed by recording beam breaks from sensors in the x, y, and z direction. Each beam break was considered an activity count and these were assessed in the x, y, and z direction separately. Activity on the floor consisted of all beam breaks that included the x and y sensors on the lowest level but not level three and four (in order to
97 exclude rearing from floor activity). Rearing activity consisted of beam breaks that included the lowest level x and y axis floor sensors but required additional beam breaks on levels three and/or four. Grid climbing activity consisted of all beam breaks due to activity in levels two, three, or four but no activity from the lowest level x and y axis sensors indicating no contact with the floor. Activity counts on the cage floor were also converted into distance traveled and duration of time on the floor. Rearing activity was measured in rearing events and duration of time spent rearing. Activity on the grid was measured in duration of time.
In order to assess whether the in cage activity level changed for mice in the treadmill running group the activity levels were measured for another set of four consecutive days for 23 hours per day approximately 2 weeks ± 5 days after the start of the exercise intervention using the same activity monitoring systems.
A second custom built monitoring system was used to measure the activity of the mice while in the towers. This system utilized body heat sensors to monitor the activity of the mice as they went up and down the towers. Activity measured in the towers consisted of the number of trips to the top of the tower and back down (i.e. each trip consisted of an ascent and descent in the tower). Each mouse was monitored for 48 hours each week for four consecutive weeks.
Body Weight & Food Consumption Measures
Body weight and food consumption were measured two weeks prior to the start of the intervention and on a weekly basis throughout the duration of the interventions. Food consumption was measured by weighing the food wire holder with food at the beginning and ending of each seven day period.
98
Muscle Weight Measurements
Mice were euthanized two hours after the last treadmill running session or removal from tower and the gastrocnemius (gastroc), soleus, tibialis anterior (TA), and extensor digitorum longus (EDL) muscles were harvested and weighed to the nearest hundredth of a milligram.
Data Analysis
Statistical screening and analyses were performed using SPSS Statistics 16.0. All measures were screened for normality and when necessary a log, square root or inverse transformation was used. An ANOVA was used to evaluate the effects of strain or exercise type within each strain. Post hoc multiple comparisons were made using a 2 sided Dunnett test where treadmill running and tower climbing were compared to controls. Within each strain, the change in body weight and food consumption was determined by subtracting the weights at each week during the five week intervention from baseline weight during the week prior to the start of the intervention. Body weight and food consumption as well as the amount of change from baseline at each week of the intervention was then compared between strains for control mice and between the two exercise groups and controls within each mouse strain separately. The 23 hour in cage activity measurements included 11 hours during the dark and 12 hours during the light.
In cage activity data were analyzed separately for the light and dark cycles and for the total activity (light + dark). Differences at the 95% confidence level were considered significant, while those at 90% were considered suggestive.
99
Results
Body Weight
Body weight did not significantly differ between B6 and D2 control mice except during week 4 in which D2 mice were slightly heavier than B6 mice (Figure 5 1A). D2 control mice also had a slight gain in weight over the course of the intervention whereas
B6 control mice had a gradual decrease in weight. There was a suggestive difference in change from baseline between B6 and D2 control mice at week 4 (Figure 5 1B). Within
B6 mice, exercise did not have an effect on body weight (Figure 5 1C) though there were significant differences in the change from baseline between controls and treadmill runners during weeks 3 and 4 (Figure 5 1D). During weeks 3 and 4, treadmill runners lost significantly more weight than the controls. Within D2 mice, there was a slight trend of increased body weight in controls and a decrease in treadmill runners resulting in significant or suggestive differences in body weight during weeks 2, 3 and 4 between treadmill runners compared to controls (Figure 5 1E). However, there were no differences from baseline between the amount of weight control mice gained and treadmill runners lost (Figure 5 1F).
100 (A) (B) * ^
(C) (D)
* ^ ns ns
(E) (F)
* * ^
Figure 5 1: Body weight starting two weeks prior to and continuing over the duration of the exercise intervention and differences in the change from baseline in body weight over duration of treatment. A) Body weight over time for controls as a function of mouse strain (B) Change from baseline in body weight for controls during five week intervention as a function of mouse strain (C) Body weight over time for B6 mice as a function of treatment (D) Change from baseline in body weight for B6 mice during intervention as a function of treatment (E) Body weight over time for D2 mice as a function of treatment (F) Change from baseline in body weight for D2 mice during intervention as a function of treatment. Weekly differences in body weight were determined through comparison with weight measured the week prior to the start of treatment (Week 1). Means and standard errors are shown. Group differences were determined using a 1 way ANOVA for strain or treatment within each strain separately and a 2 sided Dunnett test was used for post hoc comparisons between controls and treadmill runners or controls and tower climbers within each strain. Matching symbols on line graphs or lines connecting bars indicate comparisons for strain (B6 vs D2) or treatment (controls vs tower climbers or controls vs treadmill
101 runners). Symbols above lines indicate significance level (** highly significant p < 0.005, * significant p < 0.05, ^ suggestive p < 0.1 and ns = not significant) Significance levels are from the main effect of strain (A B) or from Dunnett post hoc comparisons for treatment (C F).
Food Consumption
Strain differences were observed for food consumption between B6 and D2 controls during weeks 1 4 (Figure 5 2A). D2 mice consumed significantly more food than B6 mice during weeks 1, 2, and 4 with a suggestive difference during week 3.
Throughout the exercise intervention there was also a slight increase in food consumption from baseline in D2 controls and a slight decrease in B6 controls and this change from baseline was suggestive during week 2 between the two strains (Figure 5 2B). Within B6 mice, tower climbers ate significantly less food than controls during week 3 and a suggestive difference during week 4 (Figure 5 2C). There were no differences in the change of food consumption from baseline as a function of exercise treatment in B6 mice
(Figure 5 2D). Within D2 mice, tower climbers also ate less food compared to controls during weeks 2 4 (Figure 5 2E). This difference in food consumption was suggestive during week 3 and significant during week 4. There was also a significant difference in the change in food consumption for both D2 treadmill runners and tower climbers compared to controls during week 4 and a suggestive difference during week 2 (Figure 5
2F). During week 4, D2 tower climbers ate less food compared to baseline whereas controls ate more food compared to baseline. Controls also had a significantly greater increase in food consumption compared to the slight increase in food consumption for treadmill runners.
102
(A) (B) ^
* * * ^
(C) (D)
* ^
(E) (F) ns ** ns * ^ ^ ns * *
103 Figure 5 2: Food consumption starting two weeks prior to and continuing over the duration of the exercise intervention and differences in the change from baseline in food consumption over first four weeks of treatment. A) Food consumption over time for controls as a function of mouse strain (B) Change from baseline in food consumption for controls during five week intervention as a function of mouse strain (C) Food consumption over time for B6 mice as a function of treatment (D) Change from baseline in food consumption for B6 mice during intervention as a function of treatment (E) Food consumption over time for D2 mice as a function of treatment (F) Change from baseline in food consumption for D2 mice during intervention as a function of treatment. Weekly differences in food consumption were determined through comparison with food consumed the week prior to the start of treatment (Week 1). Means and standard errors are shown. Group differences were determined using a 1 way ANOVA for strain or treatment within each strain separately and a 2 sided Dunnett test was used for post hoc comparisons between controls and treadmill runners or controls and tower climbers within each strain. Matching symbols on line graphs or lines connect bars indicate comparisons for strain (B6 vs D2) or treatment (controls vs tower climbers or controls vs treadmill runners). Symbols above lines indicate significance level (** highly significant p < 0.005, * significant p < 0.05, ^ suggestive p < 0.1 and ns = not significant) Significance levels are from main effect of strain (A B) or from Dunnett post hoc comparisons for treatment (C F).
Muscle Weights
Significant strain differences in muscle weight for all four muscles were observed
(Figure 5 3A, 3B, 3C, 3D). B6 mice had significantly larger muscles than D2 mice. There were no significant differences in muscle weights as a function of treatment (data not shown).
104 (A) (B)
p < 0.005 p < 0.005
(C) (D)
p < 0.005 p < 0.005
Figure 5 3: Differences in hind limb muscle weights as a function of genetic strain. Means and standard errors are shown. Group differences were determined using a 1 way ANOVA for strain. Lines connecting bars indicate strain comparisons. P values above lines are showing significance level (highly significant p < 0.005, significant p < 0.05 and suggestive p < 0.1) (A) Gastrocnemius (B) Extensor Digitorum Longus (EDL) (C) Tibialis Anterior (TA) (D) Soleus
In Cage Baseline Activity Prior to Exercise Treatment Intervention
B6 mice had a significantly greater number of activity counts in all three directions (x, y and z axis) during the light cycle (Figure 5 4A). D2 mice, on the other hand, had a significantly greater number of activity counts in the vertical direction (z) during the dark cycle (Figure 5 4B). During the entire 23 hour period, B6 mice had a significantly greater number of activity counts in the horizontal directions (x and y) and
D2 mice had a significantly greater number of activity counts in the vertical direction (z)
105 (Figure 5 4C). For the sum of activity counts (x + y + z axis), B6 mice were significantly more active than D2 mice during the light cycle (Figure 5 4D).
(A) (B)
p < 0.005 p < 0.005
p < 0.005 p < 0.005
(C) (D) p = 0.033
p = 0.040
p < 0.005 p = 0.057
Figure 5 4: Differences in the number of activity counts for the x, y and z axis as a function of genetic strain. (A) Light cycle (B) Dark cycle (C) Light and dark cycles combined (D) The x, y and z axis counts combined during the light, dark and combined cycles. Means and standard errors are shown. Group differences were determined using a 1 way ANOVA for mouse strain. Lines connecting bars indicate strain comparisons with resulting p values shown above (highly significant p < 0.005, significant p < 0.05 and suggestive p < 0.1).
Activity counts were then converted to distance traveled and duration of time on the cage floor and duration of time rearing and climbing on the food grid. Distance traveled on the cage floor was significantly greater in B6 mice than D2 mice during the light cycle and 23 hour period (light and dark cycle) (Figure 5 5A). The duration of time spent on the floor was also greater in B6 mice for all time periods (Figure 5 5B).
106
(A) (B)
p = 0 .007 p < 0.005
p < 0.005 p < 0.005 p < 0.005
Figure 5 5: In cage floor activity differences as a function of genetic strain as measured by distance and duration. (A) Total distance traveled (B) Duration of floor activity. Means and standard errors are shown. Group differences were determined using a 1 way ANOVA for strain. Lines connecting bars indicate strain comparisons with resulting p values shown above (highly significant p < 0.005, significant p < 0.05 and suggestive p < 0.1)
The duration of time spent rearing and climbing on the food grid was greater in B6 mice during the light cycle; whereas, rearing and grid duration was greater in the D2 mice during the dark cycle and combined light and dark 23 hour period (Figure 5 6).
107 p < 0.005 p < 0.005
p < 0.005 p = 0.051
p < 0.005 p < 0.005
Figure 5 6: In cage vertical activity differences as a function of genetic strain as measured by rear and grid duration for each light and dark cycle and both cycles combined. Means and standard errors are shown. Group differences were determined using a 1 way ANOVA for strain. Lines connecting bars indicate strain comparisons with resulting p values shown above (highly significant p < 0.005, significant p < 0.05 and suggestive p < 0.1)
Tower Climbing Activity
Over the course of the exercise intervention, 48 hour tower climbing activity was collected on 4 consecutive weekends. The average of the four 48 hour activity periods was assessed for differences in number of “climbs” as a function of inbred mouse strain
(Figure 5 7A). B6 mice had a significantly greater amount of tower climbing activity
(climbs) than the D2 mice. Differences as a function of strain were also evaluated over the 4 weeks (Figure 5 7B). B6 mice climbed more than D2 mice during each of the 4 weeks.
108 (A) (B) ^ p = 0.010 ** ^ *
Figure 5 7: Differences in tower climbing as a function of genetic strain as measured by the number of trips (up and down the tower. (A) Average number of trips as a function of mouse strain (B) Strain differences in climbing as measured by the number of trips over time. Means and standard errors are shown. Group differences were determined using a 1 way ANOVA for mouse strain. Lines connecting bars and symbols above lines indicate significance level (** highly significant p < 0.005, * significant p < 0.05 and ^ suggestive p < 0.1).
Changes in In Cage Activity After Two Weeks of Treadmill Running
After approximately two weeks of treadmill running, there was an increase in counts of activity in the vertical direction (z axis) during the light cycle for D2 mice
(Figure 5 8A). However, in both strains, there was a decrease in activity counts in both horizontal directions (x and y axis) during the dark cycle and 23 hour measurement period (light + dark cycles) (Figures 5 8B and 8C). There was also a decrease in the sum of activity counts in all directions for both strain during the dark cycle and 23 hour period
(Figure 5 8D).
109 (A) (B)
* ** * **
*
(C) (D) ** ** ** ** ** * * **
Figure 5 8: In cage activity differences as measured by activity counts for the x, y and z axis before and during treadmill running for each mouse strain. (A) Light Cycle (B) Dark cycle (C) Light and dark cycles combined (D) The x, y and z axis counts combined during the light, dark and combined cycles. Means and standard errors are shown. Group differences were determined using a 1 way ANOVA for before vs during treadmill running for each mouse strain separately. Lines connecting bars indicate comparisons between before vs during treadmill running and symbols above lines indicate significance level (** highly significant p < 0.005, * significant p < 0.05 and ^ suggestive p < 0.1)
Distance traveled on the cage floor significantly decreased after approximately two weeks of treadmill running in both B6 and D2 mice during the dark cycle and 23 hour light and dark cycles combined (Figure 5 9A). D2 mice also spent significantly more time on the cage floor (Figure 5 9B).
110 (A) (B)
** * * * ** *
Figure 5 9: In cage floor activity differences before and during treadmill running as measured by distance and duration for each genetic mouse strain. (A) Total distance traveled (B) Duration of floor activity. Means and standard errors are shown. Group differences were determined using a 1 way ANOVA for before vs during treadmill running for each mouse strain separately. Lines connecting bars indicate comparisons between before vs during treadmill running and symbols above lines indicate significance level (** highly significant p < 0.005, * significant p < 0.05 and ^ suggestive p < 0.1)
111 D2 mice also spent less time rearing (Figure 5 10) during the dark cycle and 23 hour light and dark cycles combined.
** ** ^
^ ^
Figure 5 10: In cage vertical activity differences as measured by rear and grid duration before and during treadmill running for each genetic mouse strain during the light cycle, dark cycle and light and dark cycles combined. Means and standard errors are shown. Group differences were determined using a 1 way ANOVA for before vs during treadmill running for each strain separately. Lines connecting bars indicate comparisons between before vs during treadmill running and symbols above lines indicate significance level (** highly significant p < 0.005, * significant p < 0.05 and ^ suggestive p < 0.1)
Discussion
These results provide further insight into changes in behaviors such as in cage activity and/or physiological changes such as body weight that could confound the interpretation of interventional studies of bone adaptation. Genetic strain differences in tower climbing and baseline in cage activity levels and changes in activity level after two weeks of treadmill running were identified. Although it was hypothesized B6 mice would
112 exhibit greater normal home cage activity than D2 mice, this was only partly shown. B6 mice were more active in the horizontal direction but not the vertical direction in a standard mouse cage. Measures of activity in the vertical direction (z axis; hind limb rearing and climbing on food and water holder) were greater in the D2 mice. A previous study by Tang et al. reported that B6 mice were more active in both horizontal and vertical axes as compared to D2 mice (Tang, 2002). However, the measures of vertical activity in the study by Tang were not as extensive and possibly not as sensitive as the measures presented here. Four levels of vertical measurement were used in our study to distinguish rearing and/or climbing activity from floor activity, as opposed to just moving vertically. The greater amount of voluntary tower climbing activity of B6 mice was as predicted based upon genetic difference in voluntary wheel running as shown by Lerman et al. (Lerman, 2002). However, this is in contrast to the greater amount of rearing and climbing on the grid for D2 mice as measured in their home cage environment.
Differences in the behavior of D2 mice compared to B6 mice when measured in their enclosed standard mouse cage in contrast to their activity in the tower could have resulted from strain differences in curiosity and/or anxiety when climbing in the more exposed space of the tower.
Differences in home cage activity due to the potential effects of treadmill running were also measured by comparing the activity measures before the exercise intervention to measures taken during the intervention after approximately two weeks of treadmill running. It was predicted that there would not be differences in normal activity due to the exercise invention, but this hypothesis was rejected. Measures of in cage activity in both horizontal and vertical directions (including rearing duration, total distance and activity
113 counts in the x, y and x y z axes) in both genetic strains decreased after two weeks of treadmill running compared with activity at baseline prior to the start of the intervention.
Although this was not predicted, these results may help to explain experimental differences in the adaptive response of bone. If normal activity decreases as a result of enhanced mechanical loading through exercise, this may serve to blunt the adaptive response.
Body weight and food consumption were not hypothesized to differ due to genetic strain or as a result of exercise. Both of these variables were repeatedly measured throughout the duration of the experiment. Body weight was not significantly different between the two genetic strains for the majority of the experiment; however the body weight of D2 control mice was slightly greater than B6 control mice though there was only a suggestive difference during the fourth week measured. Interestingly, food consumption was significantly greater in the D2 mice throughout the experiment. D2 mice were also more vertically active in the standard mouse cage with longer durations of rearing and climbing activity than B6 mice. Rearing occurs prior to climbing as the mouse reaches for the metal grid but it is also a behavior that occurs when a mouse is eating or drinking. In D2 mice, increased food consumption and climbing on the grid would both contribute to increased rearing activity.
Body weight was also not overwhelming different as a function of exercise.
Although, treadmill runners within B6 mice did show a significant or suggestive difference during weeks three and four respectively in the amount of body weight lost from baseline as compared to controls. D2 treadmill runners also had significantly less body weight compared to controls for weeks 2 4 (week 3 was suggestive), but the
114 difference in body weight compared to baseline was not significantly different than that of controls.
A decrease in body weight due to treadmill running is a potentially positive effect in regards to the beneficial effect of aerobic exercise on body weight, but decreased body weight may be a confounding factor when studying the effects of treadmill running on bone adaptation. Tower climbers had significantly lower levels of food consumption than controls for the duration of the experiment. It is possible, however, that these results are due to differences in design of the food holders in the towers. A possible limitation was the ability to accurately measure food consumption due to the tendency of shredded food particles to fall out of the holders and into the bottom of the cages of control and treadmill mice. Increased climbing activity of D2 mice could have increased the amount of food particles that fell through the metal grid.
Not unexpectantly, B6 mice had significantly greater muscle weights as compared to D2 mice (muscles included the gastroc, soleus, EDL and TA). Muscle weights did not differ, however, as a function of exercise. This was surprising, because it was thought that the treadmill running protocol (involving fairly substantial incline, speed and duration) as well as a resistance based exercise such as tower climbing would affect muscle mass. Therefore, the intervention methods used in this study may not have been substantial enough to have an effect on the muscles of mature mice. Treadmill running was previously shown to increase muscle mass by 12 18% in the EDL and soleus, two of the muscles examined in this study, in B6 mice (Kemi, 2002). However, the mice in the previous study were approximately 2 months old and still growing versus the 6 month old young adult mice used in this study. The treadmill protocol used in the Kemi study also
115 consisted of running for 2 hours per day for 11 weeks; whereas, the protocol used in this study involved five weeks of running and a maximum of only 30 minutes was reached per day along with increased incline and speed.
The adaptive response of bone is a complex system and utilization of different inbred strains of mice to study such a system can be confounded by significant differences in anatomy, physiology and behavior of the inbred mice. In order to more accurately interpret the results of studies on bone adaptation, simultaneous effects on factors with indirect effects on skeletal health should be considered. Therefore, the results of this study provide important information regarding factors that indirectly affect bone adaptation and can aid in the design of future studies exploring the details of bone response to mechanical loading.
116 References
Hamrick, M.W., Samaddar, T., Pennington, C., and McCormick, J. (2006b) Increased muscle mass with myostatin deficiency improves gains in bone strength with exercise. Journal of Bone and Mineral Research, 21 (3): 477 483.
Iwaniec, U.T., Dube, M.G., Boghossian, S., Song, H., Helferich, W.G., Turner, R.T., and Kalra, S.P. (2009) Bone, 44: 404 412.
Kaye, M., and Kusy, R.P. (1995) Genetic lineage, bone mass, and physical activity in mice. Bone, 17 (2): 131 135.
Kemi, O.J., Loennechen, J.P., Wisloff, U., and Ellingsen, O. (2002) Intensity controlled treadmill running in mice: cardiac and skeletal muscle hypertrophy. Journal of Applied Physiology, 93 (4): 1301 1309.
Lang, D.H., Sharkey, N.A., Mack, H.A., Vogler, G.P., Vandenbergh, D.J., Blizard, D.A., Stout, J.T., and McClearn, G.E. (2005) Journal of Bone and Mineral Research, 20 (1): 88 99.
Lerman, I., Harrison, B.C., Freeman, K., Hewett, T.E., Allen, D.L., Robbins, J., and Leinwand, L.A. (2002) Genetic variability in forced and voluntary endurance exercise performance in seven inbred mouse strains. Journal of Applied Physiology, 92: 2245 2255.
Tang, X., Orchard, S.M., and Sanford, L.D. (2002) Home cage activity and behavioral performance in inbred and hybrid mice. Behavioral Brain Research, 136: 555 569.
117 Chapter 6
SUMMARY
The overall working hypothesis for this research was that genetic and environmental influences in adult, female mice play a significant role in bone adaptation via changes in bone size, strength and gene expression. Similar effects for muscle size and gene expression, body weight, food consumption, and behavior was included in this as well. The first specific aim was to determine the mechanical performance and morphology of femora from two genetic strains each exposed to the two exercise modes.
It was hypothesized that both types of exercise would increase the mechanical capacity of the skeleton, but the tower climbing mice would exhibit greater increases than treadmill running. It was also hypothesized there would be differences based upon genetic strain with B6 mice showing a greater response. We chose two methods of mechanical loading, treadmill running and tower climbing, in order to explore the effects of different modes of exercise (aerobic and resistance based). The idea was not to compare the two exercise methods, but to determine the effects of exercise in general on bone properties relative to genetic strain. Both treadmill running and tower climbing did produce a beneficial response in regards to femoral morphology and strength for both strains used in this study. However, tower climbing did not produce a greater response as expected and actually resulted in decreased mechanical properties at ultimate load in both genetic strains. Although, the structural and material values at yield were increased in the femur of the B6 mice and not those of the D2 mice, as was expected. Therefore, differential
118 effects across the two inbred strains were confirmed and these results provide further support for the importance of gene environment interaction on bone adaptation.
The second specific aim was to determine changes in the patterns of gene expression within bone and muscle as a function of enhanced skeletal loading (via treadmill running and tower climbing) and genetic strain using microarrays and subsequent Real Time PCR (RT PCR) confirmation. It was hypothesized that exercise would alter the expression of genes related to bone quality in both strains in a positive manner. Differential gene expression as a function of strain can also provide further information regarding genetic effects on bone and muscle and it was expected that gene expression would differ within these tissues a function of genetic strain. It was also hypothesized genes located within the 1 LOD support interval of some of the previously identified QTL related to bone architecture and strength would be differentially expressed across strains. Many genes were identified as having different expression levels relative to genetic strain within both tissues. Bone morphometric 2 inducible kinase (Bmp2k), matrix extracellular protein (Mepe) and glycoprotein (transmembrane) nmb (Gpnmb) differed between the two genetic strains within bone tissue as confirmed using RT PCR and are known to be related to bone maintenance. Several of the genes that were differentially expressed as a function of genetic strain within the controls co located with
QTL identified for measures of gross and cross sectional morphology as well as measures of structural and material strength of the femur. The Slc20a1 gene, a member of the solute carrier family 20 was located within the 1 LOD support interval of QTL for femoral length, load at yield and work to yield as well as ultimate load. The effect of exercise treatment on gene expression within bone tissue was not as significant as
119 expected. None the less, several genes had suggestive differences in expression as a function of exercise and are of interest. These genes included, Ppargc1a, Wnt, Sost and
Ptn. Ptn in particular was up regulated in tower climbers as confirmed using RT PCR and is known to play a role in the response of bone to mechanical loading by increasing the number of osteoblasts . Significant effects on genes expression within muscle tissue as a function of both genetic strain and treatment were also observed. Ppargc1a expression was also increased in muscle tissue from treadmill runners which is interesting because Ppartgc1a expression in skeletal muscle has been shown to increase with exercise. Differential gene expression between the controls and treadmill runners or tower climbers provide insight into bone and muscle changes as a result of physiological plausible methods of exercise at the molecular level. The resulting differences may help explain how bone cells are able to response to mechanical loading and consequently aid in the understanding of bone adaptation.
The third specific aim was to measure activity levels of the mice before and during exercise from both strains and compare activity levels based upon strain. It was hypothesized that there would be differences in activity levels between the two strains with B6 mice being more active. It was also hypothesized that exercise would not alter the in cage activity levels of the mice. In addition, it was hypothesized that body weight and food consumption would not be significantly different either as a function of strain or as a result of exercise. We also hypothesized that B6 mice would have larger muscles than the D2 mice, and that both strains would increase muscle mass in response to both treadmill running and especially tower climbing because it is a more resistance based exercise. Genetic strain differences in tower climbing and baseline in cage activity levels
120 and changes in activity level after two weeks of treadmill running were identified.
Although, B6 mice were more active in the horizontal direction but not the vertical direction in a standard mouse cage and measures of activity in the vertical direction (z axis; hind limb rearing and climbing on food and water holder) were greater in the D2 mice. Measures of in cage activity in both horizontal and vertical directions in both genetic strains decreased after two weeks of treadmill running compared with activity at baseline prior to the start of the intervention. Although this was not predicted, these results may help to explain experimental differences in the adaptive response of bone. If normal activity decreases as a result of enhanced mechanical loading through exercise, this may serve to blunt the adaptive response.
Body weight was not significantly different between the two genetic strains for the majority of the experiment; however, the body weight of D2 control mice was slightly greater than B6 control mice though there was only a suggestive difference...
Interestingly, food consumption was significantly greater in the D2 mice throughout the experiment andD2 mice were more vertically active in the standard mouse cage. This included longer durations of rearing which is a behavior that occurs when a mouse is eating or drinking. Body weight was also not overwhelming different as a function of exercise. Although, treadmill runners within B6 mice did show a significant or suggestive difference toward the end of the intervention regarding the amount of body weight lost from baseline as compared to controls. D2 treadmill runners also had significantly less body weight compared to controls toward the end of the treatment, but the difference in body weight compared to baseline was not significantly different than that of controls. A decrease in body weight due to treadmill running is a potentially positive effect in regards
121 to the beneficial effect of aerobic exercise on body weight, but decreased body weight may be a confounding factor when studying the effects of treadmill running on bone adaptation. Not unexpectantly, B6 mice had significantly greater muscle weights as compared to D2 mice (muscles included the gastroc, soleus, EDL and TA). Muscle weights did not differ, however, as a function of exercise which was surprising. As a result, the intervention methods used in this study may not have been substantial enough to have an effect on the muscles of mature mice.
The results of this research provide further evidence that genetic background profoundly influences the response to mechanical stimuli in many respects. Differences between genetic strains combined with differential response to physiologically plausible exercise interventions further illustrate the dependence of bone adaptation on gene environment interactions. Many studies have shown the positive effects of exercise on bone homeostasis at both the phenotypic and genotypic level. However, there are many details regarding bone adaptation that still to be learned and studies typically utilize young animals and/or loading techniques that produce supra physiological loads. Using an adult mouse model was a strength of this research because bone loss occurs with age and osteoporosis is an age related disease. Physiologically plausible methods of loading such as the exercise modes used in this study are also more insightful because they provide information regarding methods that may have therapeutic value regarding human interventions. Finally, exploring the gene environment interaction may someday enable more individualized interventions that consider a person’s phenotype.
Further understanding of bone adaptation in adult inbred mice is valuable in terms of seeking a better understanding of how mechanical loads produce changes in bone
122 tissue as well as to discern the complex interaction between environmental and genetic influence. Moreover, the ability to single out specific genes involved in the diverse pathways of bone adaptation will help us begin to delineate the complex gene gene and gene environment interactions and thereby increase our understanding of bone diseases and age related bone loss. In addition, the adaptive response of bone is a complex system and utilization of different inbred strains of mice to study such a system can be confounded by significant differences in anatomy, physiology and behavior of the inbred mice. In order to more accurately interpret the results of studies on bone adaptation, simultaneous effects on factors with indirect effects on skeletal health should be considered. Therefore, the results of this study provide important information regarding factors that indirectly affect bone adaptation and can aid in the design of future studies exploring the details of bone response to mechanical loading.
The main conclusions of this study provide evidence of an interaction between genetics and environment on bone adaptation in adult mice. Morphological differences between genetic strains combined with differential response to physiologically plausible exercise interventions within adult mice further illustrate the dependence of bone adaptation on gene environment interactions. Further understanding of the complex interactions involved in bone adaptation may help to provide better prevention and treatment of osteoporosis and other bone diseases.
123
Appendix A
Experimental Design
Figure A 1: Design of experiment included 90 female mice from 2 strains (B6 and D2) equally divided into 3 treatments (Treadmill, Tower, Control; n=15)
124 Appendix B
Treadmill Protocol
Protocol used to monitor the mice during running on the treadmill and actual setting used throughout duration of treatment (speed, incline, duration).
Technician/Treadmill Operator: 1) Fill out log in sheet with animal ID, group, treadmill inclination, exercise intensity, and duration . 2) Verify the following treadmill settings: 0.76 mA (equivalent to 4 on the intensity dial ) and a repetition rate of 2 pulses per second (equivalent to 5 on the repetition rate dial ).
Acclimation: 3) Prior to each exercise session each mouse should be placed on the treadmill in its respective lane with the belt unmoving and shock grids off but with the belt motor on. The mice should be left undisturbed for 5 minutes .
Warm up: 4) Turn on the shock grids and start the belt. The animals should be warmed up at the beginning of each session. The belt speed should start at 10 m/min and slowly be ramped up with an acceleration of 1 m/min 2.
Exercise Training Regimen: 5) The timer should be started as soon as the belt speed reaches 10 m/min.
Treadmill Monitoring: The red lamp next to the Repetition Rate knob indicates each time there is a shock pulse present at the shocker grid.6) The technician will observe the animals during the entire exercise period. Record the following: a) Using a stop watch: record the time of each shock . b) Time between each consecutive shock . c) umber of times each animal is willing to receive 2 seconds or more of shocking rather than return to the treadmill (this is equivalent to 4 consecutive shocks ). d) If the animal remains on the bar for a period longer than 5 seconds (this is equivalent to 10 consecutive shocks ).
125 7) Once the animal has received 1 interval of 2 seconds of shock (equivalent to 1 interval of 4 consecutive shocks) the technician should gently nudge the mouse on it’s rump to encourage the mouse to run. 8) If at any time the animal becomes exhausted during the exercise session the shock grid must be deactivated for that lane. If the electric stimulus is removed the technician will note the time and whether the animal resumes running during the remainder of the session. 9) If the electric stimulus is removed, the technician should continue to nudge the mouse with their hand to encourage the mouse to run. The technician should stop nudging the animal after 5 attempts to encourage the animal to run. The stimulus consists of 200 millisecond 0.74 mA pulses that will be delivered at a rate of 2 pulses per second. Two (200 millisecond) pulses are equivalent to 0.4 seconds of shock in a 1 second period. This is equivalent to 0.8 seconds of shock in a 2 second period and 2 seconds of shock in a 5 second period.
The criteria for discontinuing shock exposure are as follows:
A) If the animal spends more than 5 consecutive seconds on the shock grid without attempting to reengage the treadmill.
(10 consecutive shocks) (equivalent to 2 seconds of shock in a 5 second consecutive period)
B) The third time a mouse is willing to sustain 2 seconds or more of shocking rather than return to the treadmill.
(3 X 4 consecutive shocks = 12 shocks) (equivalent to 3 periods of 0.8 seconds of shock in a 2 second consecutive period) (equivalent to 2.4 seconds of shock)
C) When the animal sustains a total of 20 shocks within any 5 minute period regardless of the spacing of the shocks during the 30 minute exercise period. (equivalent to 4 seconds of shock in a 5 minute period)
D) When the animal sustains a total of 50 shocks regardless of the spacing of the shocks during the 30 minute exercise period.
126 (equivalent to 10 seconds of shock)
10) Animals that repeatedly refuse to run after five attempts will be removed from the exercise intervention group. Records on each animal’s performance will be maintained and the number of shocks each animal receives during each session will be recorded by the observer.
Table B 1: Protocol settings used during treadmill running intervention
Week Day Incline Speed Duration (degrees) (m/min) (min)
1 1 5 10 10 1 2 5 10 20 1 3 5 10 20 1 4 5 10 30 1 5 10 10 20 2 8 10 10 30 2 9 10 12 30 2 10 15 12 20 2 11 15 12 30 2 12 15 13 30 3 15 20 13 20 3 16 20 13 30 3 17 20 14 30 3 18 25 14 20 3 19 25 14 30 4 22 25 14 30 4 23 25 15 30 4 24 25 15 30 4 25 25 15 30 4 26 25 15 30 5 29 25 15 30 5 30 25 15 30 5 31 25 15 30 5 32 25 15 30 5 33 25 15 30
127 Appendix C
Tower Design
Figure C 1: Design of tower used for climbing intervention.
128 Appendix D
Materials Testing System (MTS) Biomechanical Testing of
Right Mouse Femur Protocol
*Note: BE SURE TO WEAR SAFETY GLASSES 1. Open TestStar (shortcut) 2. Open Station Manager 3. Open File: 50_lb_load_cell.cfg (window should open with config files) 4. Open Parameters: Station Manager > File > Open Parameters > 50lb_mouse_bending 5. Turn on pump – low (toward) let go and wait then hi (away) 6. Set up 50 lb load cell (may be on shelf, be sure it is plugged/screwed in – DO NOT put load cell under rod until after check/warmup if hit “Auto offset” (AO; axial disp = 0 & axial force = 0) and push on cell, should get a negative reading if load cell is working) 7. Attach 8 in aluminum rod (lighter rod, be sure it is screwed snuggly into rod = actuator piston) & Attach flat end (for flexural test) 8. Set up support span apparatus – use smallest (8 mm) for mouse femur – be sure to use washer (box on shelf) – put plastic over load cell and then screw apparatus onto load cell with washer – DO NOT put load cell under rod 9. Reset the interlock (tell it where ‘0’ is) (interlock is on if red) i. Hit reset first ii. If interlock still on, hit AO then hit reset again iii. If interlock still on, go to Station Setup (Station Manager > Display > Station Setup), and go to channels > axial > displacement > range, change range from small range (12.77mm – mice) to large range (127 mm), hit AO then hit reset (interlock should no longer be red) 10 . Turn on power : HPSI: click low – wait until stops blinking yellow & then click hi – green & Turn on pressure : HSM: click low – wait until stops blinking yellow & then click hi – green 11 . Adjust rod – using manual control (must push enable button & clockwise moves rod up) – align rod with range of span (dotted black line) & Hit AO (AO should be continuously reset) 12 . Go to Station Setup > detectors > limits > lower > change lower axial displacement detector limits to 46 (interlock) (upper detector limits should be set on “indicate”)
129 *13 . Go to Function Generator (icon on left side of Station Manager screen – on top) & Check Settings : Channel: axial Control mode: displacement Active mode: displacement Command Type: cyclic **Target setpoint : 0mm * Amplitude: + 40mm Frequency: 2.0 Hz Wave shape: square Compensator: none 14. AO & Click Run – run warmup for 15 20 min Hit “ Stop ” when warmup is complete. 15. Manually move rod back to dotted black line & AO Note: Remember to turn off manual control in order to avoid error when attempting next step 16. Turn pressure to low (HSM) – wait until stops blinking yellow 17. Go to Station Setup > axial > displacement 18. Quickly – turn off pressure & change range back to 12.7mm , then turn pressure back to low – wait until stops blinking yellow & then click hi – green 19. AO & go to Station Setup > detectors > limits > lower > change lower axial displacement detector limits to 6.5 (interlock) 20. Place load cell under rod (tighten screws on corners once in desired position) & Adjust rod end – place flat end parallel to support span apparatus and in the middle. May need to manually move rod up or down to align better – BE CAREFUL not to go past detector limits !! & AO 21. Open MPT (Multi Purpose Test, icon on left side of Station Manager screen – on bottom – OR – Applications>Multi Purpose Testware) 22. Open file: mouse_50_lb_cell_bending
130 23. Station Manager screen (MPT ICON): open specimen folder: exff (exercise flexural femur) Choose “Currently loaded procedure” (saved state – done) 24 . Open specimen folder on c drive : tsiis/mpt/specimen/ex ff 25. Go to MPT screen: timed data acq > dest > enter data header & user data file EXAMPLE: data header = EXFF91 & user data file = EXFF91.dat (must have .dat) – save (Note: If screen does not open automatically – click on MPT “procedure editor” icon) 26. Hit Reset (arrow next to lock) on Station Manger Screen 27. Hit lock & then unlock on Station Manger Screen 28. Be sure the user data file shows up in the specimen folder on the c drive 29. Put plastic box around setup & Load bone – femur head should be toward the right and facing front, be sure to line the left and right sides with the lines on the rod end and place the bone so the rod will hit in the middle of the bone
30. HIT AO 31. Hit Run 32. Optional: change parameter file to: 50lb mouse shear (station manager > file > open parameters – Note: cannot change parameter file if power is on, can use current parameter file (50lb mouse bend) if don’t want to turn off power) 33. Remove load cell from under rod. 34. Attach pointed end to 8 in aluminum rod (for shear test, remove flat end used for flexural test) 35. Remove support span apparatus and washer from load cell (put back into box on shelf) 36. Set up dremmel tool apparatus (dremmel tool and two sided screw holder) put plastic over load cell and then screw apparatus onto load cell – do not put load cell under rod until after bone is put into apparatus 37. Open MPT file: mouse_50_lb_cell_shear 38. Station Manager screen: open specimen folder: exsf (exercise shear femur) Choose “Currently loaded procedure” (saved state – done)
131 39. Open specimen folder on c drive : tsiis/mpt/specimen/ex sf 40. Go to MPT screen: timed data acq > dest > enter data header & user data file EXAMPLE: data header = EXSF91 & user data file = EXSF91.dat (must have .dat) – save 41. Hit Reset (arrow next to lock) on Station Manger Screen 42. Hit lock & then unlock on Station Manger Screen 43. Be sure the user data file shows up in the specimen folder on the c drive 44. Load bone – unscrew dremmel tool so the proximal end of the bone can fit between the three prongs, place bone between three prongs with femur head sticking above prongs and the lesser trochanter ideally rested on one of the prongs after the dremmel tool was screwed to fit the bone snuggly (the bone was secured enough so it didn’t move though screwing the tool too tightly could crush the bone) 45. HIT AO 46. Hit Run 47. Move copy of files from c drive to share or r drive: R:\Expt340\MTS_Files\EXFF (for femur 3 pt bending) R:\Expt340\MTS_Files\EXSF (for femur shear) 48. Switch bones from saline to 70% etoh (located in fridge ) and place bones back into fridge (be sure lids fit tightly to avoid evaporation of the etoh). 49. Clean up: a. clean bench with etoh b. clean dremmel tool apparatus with water and WD40 & place back in box on shelf c. turn off pressure & power (turn each to low first and wait until stops flashing before turn off) d. turn off pump e. shut down software & logoff (save changes) f. remove end from rod and place in box on shelf g. remove rod and place on shelf h. remove load cell and place on shelf
132 NOTES: 1. may have to remember to hit unlock to edit MPT procedure 2. may have to turn off manually control if get an error message 3. do not change buffer size (16,000) when editing MPT files (file header & user data file screen) 4. warmup – generating square wave 5. If generator won’t turn on, the emergency stop buttons may be pushed
133 Appendix E
Cross Sectional Morphology
Figure E 1: TIFF Image of Right Femur Cross Section of Mid Shaft
Measurements: Inner radius – from centroid to endosteal surface (blue) Outer radius – from centroid to periosteal surface (red) Thickness – of cortical bone (green) Moment of inertia (x and y) Left = lateral, Right = medial, Top = posterior, Bottom = anterior Cortical area Medullary area Total area
Table E 1: Measurements taken from cross section of midshaft
134 Appendix F
Structural & Material Properties
Figure F 1: Load Displacement Curve Table F 1: Structural Properties
Figure F 2: Material Property Calculations
135 Appendix G
Morphology & Mechanical Data
Table G 1: Gross Morphology
Group Means and Standard Errors Mouse Strain Differences Within Strain Exercise Treatment Group Differences Measurement Units B6 D2 D2 B6 p value CO TROL TOWER TREADMIL p value CO TROL TOWER TREADMIL p value L L Mean 15.74 15.62 15.57 15.60 15.71 15.76 15.68 15.79 Femur Length mm 0.16 0.37 0.59 (SE) 0.06 0.04 0.09 0.06 0.06 0.09 0.11 0.09 Mean 1.14 1.30 1.30 1.28 1.33 1.16 1.13 1.13 Femur Sagittal Width mm 0.00 0.09 0.64 (SE) 0.01 0.01 0.01 0.02 0.02 0.02 0.02 0.02 Mean 1.52 1.77 1.77 1.76 1.78 1.57 1.52 1.48 Femur Coronal Width mm 0.00 0.92 0.03 (SE) 0.01 0.02 0.04 0.02 0.03 0.02 0.02 0.02 Mean 2.73 2.78 2.79 2.75 2.80 2.72 2.73 2.72 Femur Epiphysial Width mm 0.10 0.29 0.93 (SE) 0.02 0.01 0.03 0.03 0.02 0.03 0.03 0.02 Mean 1.44 1.49 1.47 1.53 1.48 1.44 1.45 1.44 Femur Head Diameter mm 0.10 0.04 0.72 (SE) 0.01 0.01 0.02 0.01 0.02 0.02 0.01 0.01 Mean 1.01 1.11 1.08 1.15 1.11 0.98 1.05 0.99 Femur eck Diameter mm 0.13 0.44 0.51 (SE) 0.02 0.02 0.04 0.03 0.04 0.05 0.03 0.04
136 Table G 2: Cross Sectional Morphology
Group Means and Standard Errors
Mouse Strain Within Strain Exercise Treatment Group Differences Measurement Units Differences B6 D2 D2 B6 p value CO TROL TOWER TREADMILL p value CO TROL TOWER TREADMILL p value Mean 0.820.86 0.85 0.86 0.86 0.82 0.82 0.82 Cortical Area mm 2 0.01 0.72 0.85 (SE) 0.010.01 0.01 0.01 0.01 0.01 0.01 0.01 Mean 0.460.87 0.86 0.86 0.88 0.47 0.48 0.43 Medullary Area mm 2 0.00 0.57 0.00 (SE) 0.010.01 0.01 0.01 0.01 0.01 0.01 0.01 Mean 1.281.72 1.70 1.73 1.74 1.29 1.29 1.25 Total Area mm 2 0.00 0.51 0.24 (SE) 0.010.01 0.02 0.02 0.02 0.02 0.02 0.01 Mean 0.080.13 0.13 0.13 0.13 0.08 0.09 0.08 Cross Sectional Moment of Inertia x axis mm 4 0.00 0.45 0.24 (SE) 0.000.00 0.00 0.00 0.00 0.00 0.00 0.00 Mean 0.160.25 0.24 0.25 0.25 0.16 0.16 0.15 Cross Sectional Moment of Inertia y axis mm 4 0.00 0.31 0.73 (SE) 0.00 0.00 0.01 0.01 0.01 0.01 0.00 0.00 Mean 0.210.18 0.18 0.18 0.18 0.21 0.21 0.21 Average Cortical Thickness mm 0.00 0.80 0.05 (SE) 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 Mean 0.300.25 0.25 0.25 0.24 0.30 0.30 0.31 Cortical Thickness at medial 3 mm 0.00 0.70 0.12 (SE) 0.000.00 0.01 0.01 0.01 0.01 0.00 0.00 Mean 0.430.61 0.59 0.61 0.61 0.45 0.43 0.42 Femur inner radius at medial 3 mm 0.00 0.70 0.10 (SE) 0.010.01 0.01 0.01 0.01 0.01 0.01 0.01 Mean 0.730.85 0.84 0.86 0.86 0.75 0.73 0.73 Femur outer radius at medial 3 mm 0.00 0.43 0.20 (SE) 0.000.00 0.01 0.01 0.01 0.01 0.01 0.01 Mean 0.240.24 0.23 0.24 0.24 0.24 0.24 0.25 Cortical Thickness at anterior 6 mm 0.77 0.84 0.20 (SE) 0.000.00 0.00 0.00 0.00 0.00 0.00 0.01 Mean 0.310.41 0.39 0.41 0.41 0.31 0.32 0.29 Femur inner radius at anterior 6 mm 0.00 0.14 0.05 (SE) 0.000.00 0.01 0.01 0.00 0.01 0.01 0.01 Mean 0.550.64 0.63 0.64 0.65 0.55 0.56 0.54 Femur outer radius at anterior 6 mm 0.00 0.05 0.16 (SE) 0.000.00 0.01 0.01 0.01 0.01 0.01 0.00 Mean 0.300.24 0.23 0.25 0.24 0.30 0.29 0.30 Cortical Thickness at lateral 9 mm 0.00 0.35 0.44 (SE) 0.010.00 0.01 0.01 0.01 0.01 0.01 0.01 Mean 0.490.73 0.73 0.72 0.73 0.48 0.50 0.47 Femur inner radius at lateral 9 mm 0.00 0.48 0.25 (SE) 0.010.01 0.01 0.01 0.01 0.01 0.01 0.01 Mean 0.780.97 0.96 0.97 0.97 0.78 0.79 0.78 Femur outer radius at lateral 9 mm 0.00 0.96 0.82 (SE) 0.000.01 0.01 0.01 0.01 0.01 0.01 0.01 Mean 0.220.19 0.19 0.18 0.19 0.22 0.21 0.22 Cortical Thickness at posterior 12 mm 0.00 0.46 0.62 (SE) 0.000.00 0.01 0.01 0.00 0.00 0.00 0.00 Mean 0.330.45 0.45 0.46 0.45 0.33 0.34 0.32 Femur inner radius at posterior 12 mm 0.00 0.40 0.12 (SE) 0.000.00 0.01 0.01 0.01 0.01 0.01 0.01 Mean 0.550.64 0.64 0.64 0.64 0.55 0.56 0.54 Femur outer radius at posterior 12 mm 0.00 0.89 0.22 (SE) 0.000.00 0.00 0.00 0.01 0.00 0.01 0.00
137 Table G 3: Structural Properties
Group Means and Standard Errors
Mouse Strain Differences Within Strain Exercise Treatment Group Differences Measurement Units B6 D2 D2 B6 p value CO TROL TOWER TREADMILL p value CO TROL TOWER TREADMILL p value Mean 14.98 12.47 11.51 12.89 12.94 14.91 15.12 14.91 Flexoral Yield Load N 0.00 0.05 0.82 (SE) 0.24 0.27 0.35 0.50 0.46 0.45 0.41 0.40 Mean 0.13 0.10 0.09 0.10 0.10 0.13 0.13 0.13 Flexoral Yield Displacement mm 0.00 0.03 0.96 (SE) 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 Mean 1.08 0.68 0.58 0.74 0.71 1.08 1.10 1.07 Flexoral Work to Yield N*mm 0.00 0.02 0.86 (SE) 0.02 0.02 0.02 0.05 0.04 0.05 0.04 0.04 Mean 16.26 17.74 17.73 17.34 18.14 16.03 16.36 16.37 Flexoral Ultimate Load N 0.00 0.55 0.40 (SE) 0.23 0.32 0.60 0.44 0.63 0.37 0.45 0.38 Mean 0.17 0.21 0.22 0.20 0.21 0.17 0.17 0.17 Flexoral Ultimate Displacement mm 0.00 0.00 0.78 (SE) 0.00 0.00 0.00 0.00 0.00 0.01 0.01 0.01 Mean 1.67 2.43 2.60 2.21 2.51 1.71 1.67 1.63 Flexoral Ultimate Work N*mm 0.00 0.01 0.94 (SE) 0.06 0.06 0.09 0.08 0.10 0.11 0.10 0.09 Mean 123.66 143.74 142.42 140.68 148.03 122.62 124.99 123.36 Flexoral Stiffness N/mm 0.00 0.56 0.66 (SE) 2.04 2.82 5.25 4.71 4.87 2.48 4.19 3.89 Mean 0.17 0.32 0.38 0.30 0.29 0.18 0.17 0.16 Flexoral Failure Displacement mm 0.00 0.11 0.24 (SE) 0.01 0.02 0.04 0.04 0.03 0.01 0.01 0.01 Mean 1.89 3.98 4.44 3.75 3.81 2.03 1.87 1.79 Flexoral Work at Failure N*mm 0.00 0.23 0.59 (SE) 0.08 0.21 0.36 0.36 0.36 0.16 0.14 0.11 Mean 17.04 16.26 15.50 16.20 17.06 17.30 15.64 17.90 Shear Ultimate Load N 0.01 0.10 0.00 (SE) 0.31 0.30 0.45 0.58 0.45 0.35 0.28 0.65 Mean 0.26 0.29 0.30 0.27 0.31 0.28 0.22 0.29 Shear Ultimate Displacement mm 0.40 0.63 0.12 (SE) 0.01 0.02 0.03 0.04 0.03 0.02 0.03 0.03 Mean 2.75 3.25 3.23 2.88 3.59 2.97 2.02 3.11 Shear Ultimate Work N*mm 0.52 0.54 0.03 (SE) 0.18 0.27 0.44 0.47 0.49 0.25 0.26 0.36 Mean 0.81 3.30 3.87 3.00 3.09 0.95 0.77 0.72 Post Yield Work to Failure Nmm 0.00 0.15 0.57 (SE) 0.08 0.22 0.36 0.37 0.37 0.15 0.14 0.10 Mean 0.04 0.22 0.28 0.20 0.19 0.05 0.04 0.03 Post Yield Displacement at Failure mm 0.00 0.07 0.25 (SE) 0.00 0.02 0.04 0.04 0.03 0.01 0.01 0.01 Mean 0.59 1.75 2.02 1.46 1.79 0.63 0.57 0.55 Post Yield Work to Ultimate Load Nmm 0.00 0.00 0.86 (SE) 0.05 0.06 0.10 0.07 0.09 0.10 0.10 0.08 Mean 0.04 0.12 0.14 0.10 0.12 0.04 0.04 0.04 Post Yield Displacment at Ultimate Load mm 0.00 0.00 0.75 (SE) 0.00 0.00 0.01 0.00 0.00 0.01 0.01 0.01
138 Table G 4: Material Properties
Group Means and Standard Errors
Mouse Strain Differences Within Strain Exercise Treatment Group Differences Measurement Units B6 D2 D2 B6 p value CO TRO TOWER TREADMI p value CO TRO TOWER TREADMI p value L LL L LL Mean 199.48 124.75 116.98 129.57 127.17 197.23 197.73 203.46 Yield Stress 0.14 N/mm 2 (SE) 2.82 2.640.00 2.99 4.81 5.10 5.00 4.97 4.87 0.54 Mean 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 Yield Strain 0.04 N/mm 2 (SE) 0.00 0.000.00 0.00 0.00 0.00 0.00 0.00 0.00 0.68 Mean 14593.22 10642.72 10678.97 10481.12 10770.48 14415.60 14261.90 15102.17 Modulus of Elasticity 0.81 N/mm 2 (SE) 178.46 185.560.00 345.46 345.89 289.89 230.79 322.15 338.60 0.11 Mean 216.44 177.26 180.23 174.33 177.41 212.33 213.59 223.40 Ultimate Stress 0.65 N/mm 2 (SE) 2.65 2.710.00 5.34 4.08 4.86 4.27 4.64 4.61 0.13 Mean 0.02 0.03 0.03 0.02 0.03 0.02 0.02 0.02 Ultimate Strain 0.01 N/mm 2 (SE) 0.00 0.000.00 0.00 0.00 0.00 0.00 0.00 0.00 0.69
139
Appendix H
Bone Tissue R A Extraction Protocol using Qiangen R Aeasy Lipid Tissue Kit
(kit cat# 74704)
1. Add 1ml of Qiazol Lysis Reagent to tube containing femur (snap frozen in liquid nitrogen & stored in 80) 2. Homogenize using rotor stator homogenizer for 1 min – clean homogenizer! 3. Transfer liquid into new tube (bone “pulp” will remain in old tube) 4. RT – 5min 5. 200 ul chloroform 6. shake vigorously – 15 sec 7. RT – 3 min 8. 14rpm – 20 min (RT) 9. Transfer upper phase into new tube (~600ul) 10. Add ~600ul 70% etoh – vortex (do not centrifuge) 11. Transfer 700ul to spin column 12. 10rpm – 15 sec 13. Transfer remaining sample into column 14. 10rpm – 15 sec 15. 700ul Buffer RW1 16. 10rpm – 15 sec 17. 500ul Buffer RPE 18. 10rpm – 15 sec 19. 500ul Buffer RPE 20. 10rpm – 2 min 21. Transfer column to new collection tube 22. 14rpm – 1 min 23. Transfer column to new tube 24. 30ul H2O 25. 10rpm – 1 min 26. Reuse 30ul 27. 10rpm – 1 min
140
Appendix I
Muscle Tissue R A Extraction Protocol using Qiangen R Aeasy Fibrous Tissue Kit
(kit cat# 74704)
* Tissue < 30mg
* Add Beta ME to Buffer RLT
* Set up water bath @ 55C
1. Add 300ul (recommended vs 500ul?) of Buffer RLT to tube containing muscle (snap frozen in liquid nitrogen & stored in 80) 2. Homogenize using rotor stator homogenizer for 1 min – clean homogenizer! 3. Add 590ul RNAse free water & 10ul proteinase K – mix by pipetting 4. 55C – 10 min 5. 12rpm 3 min 6. Transfer supernatant (~900ul) to new tube 7. Add ~450ul of 100% etoh – mix by pipetting 8. Transfer 700ul to spin column 9. 10rpm – 15 sec 10. Transfer remaining sample into column 11. 10rpm – 15 sec 12. Add 700ul Buffer RW1 13. 10rpm – 15 sec 14. Add 500ul Buffer RPE 15. 10rpm – 15 sec 16. Add 500ul Buffer RPE 17. 10rpm – 2 min 18. Transfer column to new collection tube 19. 14rpm – 1 min 20. Transfer column to new tube 21. Add 30ul H2O 22. 10rpm – 1 min 23. Add 30ul H2O 24. 10rpm – 1 min
141
Appendix J
R A Amplication and Labeling Protocol
Ambion MessageAmp II Biotin Enhanced Kit Protocol (Single Round aR A Amplification Kit) *thermalcycler used for incubations * turn on water bath * 20C is a potential stopping point
Reverse Transcription –Synthesize 1 st Strand cD A 1. Mix a. Xul RNA (10ul max; 500ng) b. 1ul T7 Oligo(dT) primer c. X ul H2O – 12 ul total 2. Incubate at 70C – 10 min 3. Reverse Transcription Master Mix (RTMM) – prepare at RT & store on ice 12 samples: a. 25.2ul 10X 1 st Strand Buffer b. 50.4ul dNTP mix c. 12.6ul Rnase Inhibitor d. 12.6ul ArrayScript 100.8 total 4. Add 8ul RTMM to each sample (20ul total) 5. Incubate at 42C – 2 hours
142
Second Strand cD A Synthesis
1. Second Strand Master Mix (SSMM) – prepare & store on ice 12 samples: a. 793.8ul H2O b. 126ul 10X 2 nd Strand Buffer c. 50.4ul dNTP Mix d. 25.2ul DNA Polymerase e. 12.6ul RNase H 1008.3 total 2. Add 80ul SSMM to each sample (100ul total) 3. Incubate at 16C – 2 hours (thermalcycler) * 20C
cD A Purification * Heat water in water bath at 50 55C for at least 10min prior to use * Add 24ml 100% etoh to wash buffer * check cDNA binding buffer for precipitation 1. Add 250ul cDNA Binding Buffer 2. Add sample to cDNA filter 3. Centrifuge 10Krpm – 1min (Discard flow through) 4. Add 500ul Wash Buffer 5. Centrifuge 10Krpm – 1min (Discard flow through) 6. Centrifuge 10Krpm – 1min (Discard flow through) 7. Place cDNA filter into elution tube 8. Add 12ul H2O (50C) 9. Incubate at RT – 2 min
143 10. Centrifuge 10Krpm – 1.5min 11. Add 12ul H2O (50C) 12. Incubate at RT – 2min 13. Centrifuge 10Krpm 1.5min ~20ul final volume * 20C
In Vitro Transcription – Synthesize Biotin labeled aR A
1. IVT Master MIX (IVTMM) – prepare at RT & store on ice 12 samples: a. 151.2ul Biotin NTP Mix b. 50.4ul T7 10X Reaction Buffer c. 50.4ul T7 Enyzme Mix 252 total 2. Add 20ul IVTMM to each sample (40ul total) 3. Incubate at 37C 14 hours 4. Add 60ul H2O (100ul total) * 20C
aR A Purification * Heat water in water bath at 50 60C for at least 10min prior to use *Check samples are at 100ul 1. Add 350ul aRNA Binding Buffer 2. Add 250ul 100% etoh (pipette 3X to mix do not vortex/centrifuge) – go to next step right away 3. Add sample to aRNA filter 4. Centrifuge 10Krpm – 1min (Discard flow through) 5. Add 650ul Wash Buffer
144 6. Centrifuge 10Krpm – 1min (Discard flow through) 7. Centrifuge 10Krpm – 1min 8. Place aRNA filter into collection tube 9. Add 100ul H2O (50C) 10. Incubate at RT – 2min 11. Centrifuge 10Krpm – 1.5min 12. Store at –80C ~100ul final volume * aRNA Quantification – MF Nanodrop
Fragmentation – Biotinylated aR A
1. Mix Xul – 15ug aRNA 6ul – 5X Fragmentation Buffer Xul – H2O 30ul TOTAL 2. Incubate at 94C – 35min 3. Place on ice 4. Store at –20C (1 3 days) or –80C (longterm)
145 Appendix K
Additional Genes with Differential Expression within Bone Tissue as a Function of Exercise Treatment
Table K 1: Tower climbing mice with greater expression than control mice.
Gene Title Pval Adj Pval Fold Change Ankrd1 ankyrin repeat domain 1 (cardiac muscle) 0.033 0.286 2 Aspn asporin 0.024 0.281 2 Ccl21b chemokine (C-C motif) ligand 21 0.020 0.281 3 Chad chondroadherin 0.009 0.281 2 Col3a1 collagen, type III, alpha 1 0.036 0.287 2 Col3a1 collagen, type III, alpha 1 0.043 0.293 2 Comp cartilage oligomeric matrix protein 0.002 0.281 2 Dpt dermatopontin 0.015 0.281 2 Fmod fibromodulin 0.007 0.281 2 Fmod fibromodulin 0.006 0.281 2 Fmod fibromodulin 0.005 0.281 2 Fmod fibromodulin 0.008 0.281 2 Fmod fibromodulin 0.003 0.281 3 Hspa1l heat shock protein 1-like 0.023 0.281 2 Igfbp6 insulin-like growth factor binding protein 6 0.006 0.281 2 Itgbl1 integrin, beta-like 1 0.010 0.281 2 Kera keratocan 0.012 0.281 3 Mfap5 microfibrillar associated protein 5 0.014 0.281 2 Myh3 myosin, heavy polypeptide 3, skeletal muscle, embryonic 0.017 0.281 2 Myoc myocilin 0.002 0.281 2 Myod1 myogenic differentiation 1 0.032 0.286 2 Nov nephroblastoma overexpressed gene 0.007 0.281 2 Prg4 proteoglycan 4 (megakaryocyte stimulating factor, articular superficial zone protein) 0.036 0.287 2 Serpinh1 serine (or cysteine) peptidase inhibitor, clade H, member 1 0.004 0.281 2 Slc38a4 solute carrier family 38, member 4 0.024 0.281 2 Thbs4 thrombospondin 4 0.004 0.281 2
Table I K: Treadmill running mice with greater expression than control mice.
Gene Title Pval Adj Pval Fold Change Apod apolipoprotein D 0.007 0.626 2 Npr3 natriuretic peptide receptor 3 0.011 0.626 2 Tnnt2 troponin T2, cardiac 0.030 0.626 2 Chad chondroadherin 0.009 0.626 2 Aspn asporin 0.046 0.626 2 Myh3 myosin, heavy polypeptide 3, skeletal muscle, embryonic 0.030 0.626 2 Lmod2 leiomodin 2 (cardiac) 0.040 0.626 2 Myog myogenin 0.046 0.626 2 Atf3 activating transcription factor 3 0.003 0.608 2 Prg4 proteoglycan 4 (megakaryocyte stimulating factor, articular superficial zone protein) 0.016 0.626 3 Mela melanoma antigen 0.013 0.626 3 Mela melanoma antigen 0.010 0.626 3
146 Table K 3: Control mice with greater expression than tower climbing mice.
Gene Title Pval Adj Pval Fold Change Bex4 brain expressed gene 4 0.014 0.281 2 Cap1 CAP, adenylate cyclase-associated protein 1 (yeast) 0.002 0.281 2 Cap1 CAP, adenylate cyclase-associated protein 1 (yeast) 0.005 0.281 2 Car1 carbonic anhydrase 1 0.022 0.281 2 Ccnb1-rs1 /Ccnb1 cyclin B1, related sequence 1 / Cyclin B1 0.019 0.281 2 Cd37 CD37 antigen 0.002 0.281 2 Cenpe centromere protein E 0.004 0.281 2 Cldn13 claudin 13 0.018 0.281 2 Cox6b2 cytochrome c oxidase subunit VIb polypeptide 2 0.008 0.281 2 Dyrk3 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 0.020 0.281 2 Ear11 eosinophil-associated, ribonuclease A family, member 11 0.015 0.281 3 F5 coagulation factor V 0.013 0.281 2 Gsg2 germ cell-specific gene 2 0.005 0.281 2 Gypa glycophorin A 0.033 0.286 2 Icam4 intercellular adhesion molecule 4, Landsteiner-Wiener blood group 0.007 0.281 2 Il1a interleukin 1 alpha 0.006 0.281 2 Iqgap2 IQ motif containing GTPase activating protein 2 0.008 0.281 2 Isg20 interferon-stimulated protein 0.012 0.281 2 Klf1 Kruppel-like factor 1 (erythroid) 0.011 0.281 2 Msh5 mutS homolog 5 (E. coli) 0.008 0.281 2 Ncapg on-SMC condensin I complex, subunit G 0.006 0.281 2 Plk4 polo-like kinase 4 (Drosophila) 0.004 0.281 2 Rag1 recombination activating gene 1 0.008 0.281 2 Rbm5 RNA binding motif protein 5 0.004 0.281 2 Rhd Rh blood group, D antigen 0.016 0.281 2 Rsad2 radical S-adenosyl methionine domain containing 2 0.003 0.281 2 Selp selectin, platelet 0.007 0.281 2 Smc4 structural maintenance of chromosomes 4 0.003 0.281 2 Spna1 spectrin alpha 1 0.005 0.281 2 Tac2 tachykinin 2 0.008 0.281 2 Tnfrsf14 tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) 0.004 0.281 2 Trim10 tripartite motif-containing 10 0.010 0.281 2
Table K 4: Control mice with greater expression than treadmill running mice.
Gene Title Pval Adj Pval Fold Change Bach2 BTB and CNC homology 2 0.001 0.429 2 Igh-3 /Ighg immunoglobulin heavy chain 3 (serum IgG2b) / Immunoglobulin heavy chain (gamma polypeptide) 0.020 0.626 2 Rag1 recombination activating gene 1 0.001 0.429 3 Spib Spi-B transcription factor (Spi-1/PU.1 related) 0.002 0.591 2 Vpreb1 pre-B lymphocyte gene 1 0.018 0.626 2 Vpreb3 pre-B lymphocyte gene 3 0.001 0.462 2
147
Curriculum Vitae
Holly M. Preston
EDUCATIO
Doctor of Philosophy in Kinesiology , 2009 The Pennsylvania State University, University Park, PA Dissertation: Effects of Exercise and Genetic Strain on Bone Strength, Musculoskeletal Gene Expression and Activity Levels in C57BL/6J and DBA/2J Adult Female Mice
Master of Science in Biology , 2006 The Pennsylvania State University, University Park, PA Thesis: Effects of Exercise on Gene Expression in Long Bone Corticies and in the Hypothalamus of Male and Female C57BL/6J and DBA/2J Adult Mice
Bachelor of Science in Marine Biology , 2000 The University of North Carolina at Wilmington, Wilmington, NC Independent Study: Otolith Usage in Dietary Studies of the Spottail Pinfish
Associate of Science in Math and Science , 1998 Corning Community College, Corning, NY
REFEREED PRESE TATIO S
Preston, H.M. , Sharkey, N.A. and Lang, D.H.“Differential Gene Expression in Mechanically Loaded Long Bone Corticies of C57BL/6J and DBA/2J Adult Female Mice” Podium Presentation, American Society of Bone and Mineral Research , Denver, CO. September 2009.
Preston, H.M. , Sharkey, N.A. and Lang, D.H. “Effects of Treadmill Running and Tower Climbing on Femoral Strength in C57BL/6J and DBA/2J Adult Female Mice” Poster Presentation, American Society of Biomechanics Annual Meeting, State College, PA. August, 2009
Preston, H.M. , Sharkey, N.A. and Lang, D.H.“C57BL/6J and DBA/2J Inbred Mice Exhibit Differences in Femoral Properties as a Result of Exercise Intervention” Poster Presentation, The Orthopaedic Research Society Annual Meeting, Las Vegas, NV. February 2009
AWARDS A D HO ORS
American Society of Bone and Mineral Research Young Investigator Award , 2009