Reference Gene Analysis and Its Use for Kinase Expression Profiling In
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Ovulation-Selective Genes: the Generation and Characterization of an Ovulatory-Selective Cdna Library
531 Ovulation-selective genes: the generation and characterization of an ovulatory-selective cDNA library A Hourvitz1,2*, E Gershon2*, J D Hennebold1, S Elizur2, E Maman2, C Brendle1, E Y Adashi1 and N Dekel2 1Division of Reproductive Sciences, Department of Obstetrics and Gynecology, University of Utah Health Sciences Center, Salt Lake City, Utah 84132, USA 2Department of Biological Regulation, Weizmann Institute of Science, Rehovot, Israel (Requests for offprints should be addressed to N Dekel; Email: [email protected]) *(A Hourvitz and E Gershon contributed equally to this paper) (J D Hennebold is now at Division of Reproductive Sciences, Oregon National Primate Research Center, Oregon Health and Science University, Beaverton, Oregon 97006, USA) Abstract Ovulation-selective/specific genes, that is, genes prefer- (FAE-1) homolog, found to be localized to the inner entially or exclusively expressed during the ovulatory periantral granulosa and to the cumulus granulosa cells of process, have been the subject of growing interest. We antral follicles. The FAE-1 gene is a -ketoacyl-CoA report herein studies on the use of suppression subtractive synthase belonging to the fatty acid elongase (ELO) hybridization (SSH) to construct a ‘forward’ ovulation- family, which catalyzes the initial step of very long-chain selective/specific cDNA library. In toto, 485 clones were fatty acid synthesis. All in all, the present study accom- sequenced and analyzed for homology to known genes plished systematic identification of those hormonally with the basic local alignment tool (BLAST). Of those, regulated genes that are expressed in the ovary in an 252 were determined to be nonredundant. -
The Effect of Temperature Adaptation on the Ubiquitin–Proteasome Pathway in Notothenioid Fishes Anne E
© 2017. Published by The Company of Biologists Ltd | Journal of Experimental Biology (2017) 220, 369-378 doi:10.1242/jeb.145946 RESEARCH ARTICLE The effect of temperature adaptation on the ubiquitin–proteasome pathway in notothenioid fishes Anne E. Todgham1,*, Timothy A. Crombie2 and Gretchen E. Hofmann3 ABSTRACT proliferation to compensate for the effects of low temperature on ’ There is an accumulating body of evidence suggesting that the sub- aerobic metabolism (Johnston, 1989; O Brien et al., 2003; zero Antarctic marine environment places physiological constraints Guderley, 2004). Recently, there has been an accumulating body – on protein homeostasis. Levels of ubiquitin (Ub)-conjugated proteins, of literature to suggest that protein homeostasis the maintenance of – 20S proteasome activity and mRNA expression of many proteins a functional protein pool has been highly impacted by evolution involved in both the Ub tagging of damaged proteins as well as the under these cold and stable conditions. different complexes of the 26S proteasome were measured to Maintaining protein homeostasis is a fundamental physiological examine whether there is thermal compensation of the Ub– process, reflecting a dynamic balance in synthetic and degradation proteasome pathway in Antarctic fishes to better understand the processes. There are numerous lines of evidence to suggest efficiency of the protein degradation machinery in polar species. Both temperature compensation of protein synthesis in Antarctic Antarctic (Trematomus bernacchii, Pagothenia borchgrevinki)and invertebrates (Whiteley et al., 1996; Marsh et al., 2001; Robertson non-Antarctic (Notothenia angustata, Bovichtus variegatus) et al., 2001; Fraser et al., 2002) and fish (Storch et al., 2005). In notothenioids were included in this study to investigate the zoarcid fishes, it has been demonstrated that Antarctic eelpouts mechanisms of cold adaptation of this pathway in polar species. -
18S Rrna Is a Reliable Normalisation Gene for Real Time PCR Based On
Kuchipudi et al. Virology Journal 2012, 9:230 http://www.virologyj.com/content/9/1/230 METHODOLOGY Open Access 18S rRNA is a reliable normalisation gene for real time PCR based on influenza virus infected cells Suresh V Kuchipudi1*, Meenu Tellabati1, Rahul K Nelli1, Gavin A White2, Belinda Baquero Perez1, Sujith Sebastian1, Marek J Slomka3, Sharon M Brookes3, Ian H Brown3, Stephen P Dunham1 and Kin-Chow Chang1 Abstract Background: One requisite of quantitative reverse transcription PCR (qRT-PCR) is to normalise the data with an internal reference gene that is invariant regardless of treatment, such as virus infection. Several studies have found variability in the expression of commonly used housekeeping genes, such as beta-actin (ACTB) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), under different experimental settings. However, ACTB and GAPDH remain widely used in the studies of host gene response to virus infections, including influenza viruses. To date no detailed study has been described that compares the suitability of commonly used housekeeping genes in influenza virus infections. The present study evaluated several commonly used housekeeping genes [ACTB, GAPDH, 18S ribosomal RNA (18S rRNA), ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide (ATP5B) and ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9) (ATP5G1)] to identify the most stably expressed gene in human, pig, chicken and duck cells infected with a range of influenza A virus subtypes. Results: The relative expression stability of commonly used housekeeping genes were determined in primary human bronchial epithelial cells (HBECs), pig tracheal epithelial cells (PTECs), and chicken and duck primary lung-derived cells infected with five influenza A virus subtypes. -
Systematic Identification of Housekeeping Genes Possibly Used As References in Caenorhabditis Elegans by Large-Scale Data Integration
cells Article Systematic Identification of Housekeeping Genes Possibly Used as References in Caenorhabditis elegans by Large-Scale Data Integration 1, 1, 1 1 1 1 1 Jingxin Tao y, Youjin Hao y, Xudong Li , Huachun Yin , Xiner Nie , Jie Zhang , Boying Xu , Qiao Chen 2 and Bo Li 1,* 1 College of Life Sciences, Chongqing Normal University, Chongqing 401331, China; [email protected] (J.T.); [email protected] (Y.H.); [email protected] (X.L.); [email protected] (H.Y.); [email protected] (X.N.); [email protected] (J.Z.); [email protected] (B.X.) 2 Scientific Research Office, Chongqing Normal University, Chongqing 401331, China; [email protected] * Correspondence: [email protected]; Tel.: +86-23-6591-0315 These authors contributed equally to this work. y Received: 24 January 2020; Accepted: 11 March 2020; Published: 24 March 2020 Abstract: For accurate gene expression quantification, normalization of gene expression data against reliable reference genes is required. It is known that the expression levels of commonly used reference genes vary considerably under different experimental conditions, and therefore, their use for data normalization is limited. In this study, an unbiased identification of reference genes in Caenorhabditis elegans was performed based on 145 microarray datasets (2296 gene array samples) covering different developmental stages, different tissues, drug treatments, lifestyle, and various stresses. As a result, thirteen housekeeping genes (rps-23, rps-26, rps-27, rps-16, rps-2, rps-4, rps-17, rpl-24.1, rpl-27, rpl-33, rpl-36, rpl-35, and rpl-15) with enhanced stability were comprehensively identified by using six popular normalization algorithms and RankAggreg method. -
Analysis of the Stability of 70 Housekeeping Genes During Ips Reprogramming Yulia Panina1,2*, Arno Germond1 & Tomonobu M
www.nature.com/scientificreports OPEN Analysis of the stability of 70 housekeeping genes during iPS reprogramming Yulia Panina1,2*, Arno Germond1 & Tomonobu M. Watanabe1 Studies on induced pluripotent stem (iPS) cells highly rely on the investigation of their gene expression which requires normalization by housekeeping genes. Whether the housekeeping genes are stable during the iPS reprogramming, a transition of cell state known to be associated with profound changes, has been overlooked. In this study we analyzed the expression patterns of the most comprehensive list to date of housekeeping genes during iPS reprogramming of a mouse neural stem cell line N31. Our results show that housekeeping genes’ expression fuctuates signifcantly during the iPS reprogramming. Clustering analysis shows that ribosomal genes’ expression is rising, while the expression of cell-specifc genes, such as vimentin (Vim) or elastin (Eln), is decreasing. To ensure the robustness of the obtained data, we performed a correlative analysis of the genes. Overall, all 70 genes analyzed changed the expression more than two-fold during the reprogramming. The scale of this analysis, that takes into account 70 previously known and newly suggested genes, allowed us to choose the most stable of all genes. We highlight the fact of fuctuation of housekeeping genes during iPS reprogramming, and propose that, to ensure robustness of qPCR experiments in iPS cells, housekeeping genes should be used together in combination, and with a prior testing in a specifc line used in each study. We suggest that the longest splice variants of Rpl13a, Rplp1 and Rps18 can be used as a starting point for such initial testing as the most stable candidates. -
CD226 T Cells Expressing the Receptors TIGIT and Divergent Phenotypes of Human Regulatory
The Journal of Immunology Divergent Phenotypes of Human Regulatory T Cells Expressing the Receptors TIGIT and CD226 Christopher A. Fuhrman,*,1 Wen-I Yeh,*,1 Howard R. Seay,* Priya Saikumar Lakshmi,* Gaurav Chopra,† Lin Zhang,* Daniel J. Perry,* Stephanie A. McClymont,† Mahesh Yadav,† Maria-Cecilia Lopez,‡ Henry V. Baker,‡ Ying Zhang,x Yizheng Li,{ Maryann Whitley,{ David von Schack,x Mark A. Atkinson,* Jeffrey A. Bluestone,‡ and Todd M. Brusko* Regulatory T cells (Tregs) play a central role in counteracting inflammation and autoimmunity. A more complete understanding of cellular heterogeneity and the potential for lineage plasticity in human Treg subsets may identify markers of disease pathogenesis and facilitate the development of optimized cellular therapeutics. To better elucidate human Treg subsets, we conducted direct transcriptional profiling of CD4+FOXP3+Helios+ thymic-derived Tregs and CD4+FOXP3+Helios2 T cells, followed by comparison with CD4+FOXP32Helios2 T conventional cells. These analyses revealed that the coinhibitory receptor T cell Ig and ITIM domain (TIGIT) was highly expressed on thymic-derived Tregs. TIGIT and the costimulatory factor CD226 bind the common ligand CD155. Thus, we analyzed the cellular distribution and suppressive activity of isolated subsets of CD4+CD25+CD127lo/2 T cells expressing CD226 and/or TIGIT. We observed TIGIT is highly expressed and upregulated on Tregs after activation and in vitro expansion, and is associated with lineage stability and suppressive capacity. Conversely, the CD226+TIGIT2 population was associated with reduced Treg purity and suppressive capacity after expansion, along with a marked increase in IL-10 and effector cytokine production. These studies provide additional markers to delineate functionally distinct Treg subsets that may help direct cellular therapies and provide important phenotypic markers for assessing the role of Tregs in health and disease. -
Isolation and Characterization of Lymphocyte-Like Cells from a Lamprey
Isolation and characterization of lymphocyte-like cells from a lamprey Werner E. Mayer*, Tatiana Uinuk-ool*, Herbert Tichy*, Lanier A. Gartland†, Jan Klein*, and Max D. Cooper†‡ *Max-Planck-Institut fu¨r Biologie, Abteilung Immungenetik, Corrensstrasse 42, D-72076 Tu¨bingen, Germany; and †Howard Hughes Medical Institute, University of Alabama, 378 Wallace Tumor Institute, Birmingham, AL 35294 Contributed by Max D. Cooper, August 30, 2002 Lymphocyte-like cells in the intestine of the sea lamprey, Petro- existence of the adaptive immune system in jawless fishes, myzon marinus, were isolated by flow cytometry under light- the identity of these cells has remained in doubt. The aim of the scatter conditions used for the purification of mouse intestinal present study was to exploit contemporary methods of cell lymphocytes. The purified lamprey cells were morphologically separation to isolate the agnathan lymphocyte-like cells to indistinguishable from mammalian lymphocytes. A cDNA library characterize them morphologically and by the genes they was prepared from the lamprey lymphocyte-like cells, and more express. than 8,000 randomly selected clones were sequenced. Homology searches comparing these ESTs with sequences deposited in the Materials and Methods databases led to the identification of numerous genes homologous Source and Preparation of Cell Suspension. Ammocoete larvae to those predominantly or characteristically expressed in mamma- (8–13 cm long) of the sea lamprey, Petromyzon marinus (from lian lymphocytes, which included genes controlling lymphopoiesis, Lake Huron, MI) were dissected along the ventral side to extract intracellular signaling, proliferation, migration, and involvement the intestine and the associated typhlosole (spiral valve). Cells of lymphocytes in innate immune responses. -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
Supplementary Table S1. Correlation Between the Mutant P53-Interacting Partners and PTTG3P, PTTG1 and PTTG2, Based on Data from Starbase V3.0 Database
Supplementary Table S1. Correlation between the mutant p53-interacting partners and PTTG3P, PTTG1 and PTTG2, based on data from StarBase v3.0 database. PTTG3P PTTG1 PTTG2 Gene ID Coefficient-R p-value Coefficient-R p-value Coefficient-R p-value NF-YA ENSG00000001167 −0.077 8.59e-2 −0.210 2.09e-6 −0.122 6.23e-3 NF-YB ENSG00000120837 0.176 7.12e-5 0.227 2.82e-7 0.094 3.59e-2 NF-YC ENSG00000066136 0.124 5.45e-3 0.124 5.40e-3 0.051 2.51e-1 Sp1 ENSG00000185591 −0.014 7.50e-1 −0.201 5.82e-6 −0.072 1.07e-1 Ets-1 ENSG00000134954 −0.096 3.14e-2 −0.257 4.83e-9 0.034 4.46e-1 VDR ENSG00000111424 −0.091 4.10e-2 −0.216 1.03e-6 0.014 7.48e-1 SREBP-2 ENSG00000198911 −0.064 1.53e-1 −0.147 9.27e-4 −0.073 1.01e-1 TopBP1 ENSG00000163781 0.067 1.36e-1 0.051 2.57e-1 −0.020 6.57e-1 Pin1 ENSG00000127445 0.250 1.40e-8 0.571 9.56e-45 0.187 2.52e-5 MRE11 ENSG00000020922 0.063 1.56e-1 −0.007 8.81e-1 −0.024 5.93e-1 PML ENSG00000140464 0.072 1.05e-1 0.217 9.36e-7 0.166 1.85e-4 p63 ENSG00000073282 −0.120 7.04e-3 −0.283 1.08e-10 −0.198 7.71e-6 p73 ENSG00000078900 0.104 2.03e-2 0.258 4.67e-9 0.097 3.02e-2 Supplementary Table S2. -
Yeast As a Tool to Understand the Significance of Human Disease
G C A T T A C G G C A T genes Review Yeast as a Tool to Understand the Significance of Human Disease-Associated Gene Variants Tiziana Cervelli and Alvaro Galli * Yeast Genetics and Genomics Group, Laboratory of Functional Genetics and Genomics, Institute of Clinical Physiology CNR, Via Moruzzi 1, 56125 Pisa, Italy; [email protected] * Correspondence: [email protected] Abstract: At present, the great challenge in human genetics is to provide significance to the growing amount of human disease-associated gene variants identified by next generation DNA sequencing technologies. Increasing evidences suggest that model organisms are of pivotal importance to addressing this issue. Due to its genetic tractability, the yeast Saccharomyces cerevisiae represents a valuable model organism for understanding human genetic variability. In the present review, we show how S. cerevisiae has been used to study variants of genes involved in different diseases and in different pathways, highlighting the versatility of this model organism. Keywords: yeast; Saccharomyces cerevisiae; functional assays; Mendelian disease; cancer; human gene variants 1. Introduction The advent of next generation DNA sequences technologies allows us to identify Citation: Cervelli, T.; Galli, A. Yeast individual genetic variants, and this revolutionized the strategy for discovering the cause as a Tool to Understand the of several genetic and multifactorial diseases. The association between genetic variants Significance of Human and disease risk can potentially overturn our understanding of common disease. The Disease-Associated Gene Variants. discovery of pathways and processes that are causally involved in a disease, so far not Genes 2021, 12, 1303. https:// linked, may open the way towards the development of targeted therapies and prevention doi.org/10.3390/genes12091303 strategies. -
A Common Analgesic Enhances the Anti-Tumour Activity of 5-Aza-2’- Deoxycytidine Through Induction of Oxidative Stress
bioRxiv preprint doi: https://doi.org/10.1101/2020.03.31.017947; this version posted April 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. A common analgesic enhances the anti-tumour activity of 5-aza-2’- deoxycytidine through induction of oxidative stress Hannah J. Gleneadie1,10, Amy H. Baker1, Nikolaos Batis2, Jennifer Bryant2, Yao Jiang3, Samuel J.H. Clokie4, Hisham Mehanna2, Paloma Garcia5, Deena M.A. Gendoo6, Sally Roberts5, Alfredo A. Molinolo7, J. Silvio Gutkind8, Ben A. Scheven1, Paul R. Cooper1, Farhat L. Khanim9 and Malgorzata Wiench1, 5,*. 1School of Dentistry, Institute of Clinical Studies, College of Medical and Dental Sciences, The University of Birmingham, Birmingham, B5 7EG, UK; 2Institute of Head and Neck Studies and Education (InHANSE), The University of Birmingham, Birmingham, B15 2TT, UK; 3School of Biosciences, The University of Birmingham, Birmingham, B15 2TT, UK; 4West Midlands Regional Genetics Laboratory, Birmingham Women’s and Children’s Hospital, Birmingham, B15 2TG, UK; 5Institute of Cancer and Genomic Sciences, College of Medical and Dental Sciences, The University of Birmingham, Birmingham, B15 2TT, UK; 6Centre for Computational Biology, Institute of Cancer and Genomic Sciences, The University of Birmingham, Birmingham, B15 2TT, UK; 7Moores Cancer Center and Department of Pathology, University of California San Diego, La Jolla, CA 92093, USA; 8Department of Pharmacology and Moores Cancer -
Original Article PSMB4 Promotes Glioma Proliferation Via NF-Κb Signaling
Int J Clin Exp Med 2016;9(10):19164-19174 www.ijcem.com /ISSN:1940-5901/IJCEM0027183 Original Article PSMB4 promotes glioma proliferation via NF-κB signaling Xing Su1,2, Qi Yao2, Zhikai Gu2, Jianhong Shen2, Zhongyong Wang1, Jian Chen2, Qin Lan1 1Department of Neurosurgery, Second Affiliated Hospital of Suzhou University, 1055 Sanxiang Road, Suzhou 215004, People’s Republic of China; 2Department of Neurosurgery, Affiliated Hospital of Nantong University, 20 Xisi Road, Nantong 226001, People’s Republic of China Received March 3, 2016; Accepted September 10, 2016; Epub October 15, 2016; Published October 30, 2016 Abstract: Proteasomal subunit PSMB4 plays a dominant role in maintaining genomic stability and promoting tu- morigenesis. However, the regulatory mechanism of PSMB4 on carcinogenesis process remains unclear. In this study, we identified the expression and role of PSMB4 in glioma. We found a significant upregulation of PSMB4 both in glioma plasma and cell lines. Higher frequency of PSMB4 positive cells was detected in tumor tissues of gliomas compared to non-tumor tissues. Meanwhile the high frequency of PSMB4 expression was also remarkably associated with poor prognosis of glioma patients. Furthermore, ectopic overexpression of PSMB4 promoted the cell growth and colony forming ability of glioma cells, whereas inhibition of PSMB4 led to a decrease in such events. Our results demonstrated that the upregulation of PSMB4 enhanced cell proliferation of U251 cell line using a BrdU incorporation assay, whereas knockdown of PSMB4 markedly suppressed the cell proliferation and clone-formation. Additionally, while enforced expression of PSMB4 profoundly increased NF-κB activity and the level of PCNA and CyclinD1, PSMB4 knockdown or NF-κB inhibition restrained colony forming ability in glioma cells.