DOCSLIB.ORG

2 Points Chem 465 Biochemistry II Test 1 Spring 2017 Multiple Choice

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
2 Points Chem 465 Biochemistry II Test 1 Spring 2017 Multiple Choice Name: 2 points Chem 465 Biochemistry II Test 1 Spring 2017 Multiple choice (4 points apiece): 1. Which of the following statements about the oxidative decarboxylation of pyruvate in aerobic conditions in animal cells is correct? A) One of the products of the reactions of the pyruvate dehydrogenase complex is a thioester of acetate. B) The methyl (-CH3) group is eliminated as CO2. C) The process occurs in the cytosolic compartment of the cell. D) The pyruvate dehydrogenase complex uses all of the following as cofactors: NAD+, lipoic acid, pyridoxal phosphate (PLP), and FAD. E) The reaction is so important to energy production that pyruvate dehydrogenase operates at full speed under all conditions. 2. In comparison with the resting state, actively contracting human muscle tissue has a: A) higher concentration of ATP. B) higher rate of lactate formation. C) lower consumption of glucose. D) lower rate of consumption of oxygen E) lower ratio of NADH to NAD+. 3.The metabolic function of the pentose phosphate pathway is: A) act as a source of ADP biosynthesis. B) generate NADPH and pentoses for the biosynthesis of fatty acids and nucleic acids. C) participate in oxidation-reduction reactions during the formation of H2O. D) provide intermediates for the citric acid cycle. E) synthesize phosphorus pentoxide. 4. Gluconeogenesis must use "bypass reactions" to circumvent three reactions in the glycolytic pathway that are highly exergonic and essentially irreversible. Reactions carried out by which three of the enzymes listed must be bypassed in the gluconeogenic pathway? 1) Hexokinase 2) Phosphoglycerate kinase 3) Phosphofructokinase-1 4) Pyruvate kinase 5) Triosephosphate isomerase A) 1, 2, 3 B) 1, 2, 4 C) 1, 4, 5 D) 1, 3, 4 E) 2, 3, 4 5. There is reciprocal regulation of glycolytic and gluconeogenic reactions interconverting fructose-6-phosphate and fructose-1,6-bisphosphate. Which one of the following statements about this regulation is not correct? A) Fructose-2,6-bisphosphate activates phosphofructokinase-1. B) Fructose-2,6-bisphosphate inhibits fructose-1,6-bisphosphatase. C) The fructose-1,6-bisphosphatase reaction is exergonic. D) The phosphofructokinase-1 reaction is endergonic. E) This regulation allows control of the direction of net metabolite flow through the pathway. 6. Which of the following is not true of the citric acid cycle? A) All enzymes of the cycle are located in the cytoplasm, except succinate dehydrogenase, which is bound to the inner mitochondrial membrane. B) In the presence of malonate, one would expect succinate to accumulate. C) Oxaloacetate is used as a substrate but is not consumed in the cycle. D) Succinate dehydrogenase channels electrons directly into the electron transfer chain. E) The condensing enzyme is subject to allosteric regulation by ATP and NADH. 7. Conversion of 1 mol of acetyl-CoA to 2 mol of CO2 and CoA via the citric acid cycle results in the net production of: A) 1 mol of citrate. B) 1 mol of FADH2. C) 1 mol of NADH. D) 1 mol of oxaloacetate. E) 7 mol of ATP. On the next three pages are three questions dealing with glycolysis, the TCA cycle, and the electron transfer complexes of mitochondria. Each question is worth 20 points, and you must answer two of the three questions. If you answer all three I will give you the grade earned on the best two questions. -2- Alternate question 1: This page is blank because I want you to fill it in with the glycolytic pathway from glucose to pyruvate showing the structure of all intermediates. At each step also give the name of the enzyme and ÄG of the reaction. To help you on your way, here is a list of all then enzymes in alphabetical order: Aldolase Enolase Glyceraldehyde 3-phosphate dehydrogenase Hexokinase Phosphofructokinase-1 Phosphoglycerate kinase Phosphoglycerate mutase Phosphohexose isomerase Pyruvate kinase Triose phosphate isomerase On this key I am not going to take the time to make the structures, but I will check that you have the correct structure Glucose + ATP Hexokinase Mg2+ -16.7 Glucose-6-P Phosphohexose isomerase Mg2+ +1.7 Fructose-6-P + ATP Phosphofructosekinase -1 Mg2+ -14.2 Fructose 1,6-bisphosphate aldolase +23.8 Dihydroxyacetone phosphate Glyceraldehyde 3-phosphate Triose isomerase +7.5 Glyceraldehyde 3phosphate + NAD glyceraldehyde 3-phosphate dehydrogenase + 6.3 1,3-Bisphosphoglyerate phosphoglycerate kinase Mg2+ -18.5 3-Phosphoglycerate + ATP Phosphoglyerate mutase Mg2+ +4.4 2-Phosphoglycerate Enolase Mg2+ +7.5 Phophoenolpyruvate Pyruvate kinase K+, Mg2+ or Mn2+ -31.4 Pyruvate + ATP -3- Alternate question 2: Sketch the pathway in which pyruvate is completely oxidized to CO2. In this pathway be sure to identify all reactions that generate ATP, GTP, NADH or FADH2. Also show the anapleotropic reaction that are used to fill in TCA intermediates when they are depleted. I would prefer structures for all intermediates, and a cycle, but this is something I can’t put in with a word processor Pyruvate pyruvate dehydrogenase CoASH,NAD, TPP,Lippoate, FAD -33.3 Acetyl CoA (Oxaloacetate) citrate syntase -32.2 Citrate aconitase Iron-sulfur center 13.3 Isocitrate + NAD 6NADH isocitrate dehydrogenase Mn2+ NAD -20.9 á-ketoglutarate + NAD 6NADH á-ketoglutarate dehydrogenase CoASH,NAD, TPP,Lippoate, FAD -33.5 Succinyl CoA + GDP or ADP 6GTP or ATP Succinyl-CoA synthetase -2.9 6 Succinate + FAD FADH2 Succinate dehydrogenase FAD, FeS clusters 0 Fumarate fumarase -3.8 L-malate + NAD 6NADH l-malate dehydrogenase 29.7 Oxaloacetate Anapleotropic: - 6 Pyruvate + HCO3 + ATP Oxaloacetate + ADP + Pi pyruvate carboxylase 6 PEP + CO2 + GDP oxaloacetate + GTP PEP carboxykinase - 6 PEP + HCO3 oxaloacetate + Pi PEP carboxylase - 6 Pyruvate + HCO3 + NADH malate + NAD malic enzyme -4- Alternate question 3: Diagram the flow of electrons from NADH or succinate all the way combining with oxygen to make water. Include all complexes, all electron carriers not located within a complex and any protons transported across the membrane. A diagram like figure 19-16 of your text is a good start Complex I NADH + H+ 6NAD+ +6 Q + 2H QH2 4 Protons inside 64 protons outside Complex II 6 Succinate + Q Fumarate + QH2 Complex III 6 QH2 + 2 cytochrome cox Q + 2cytochrome cred + 2 protons outside 2 protons inside 6 2 protons outside Complex IV 6 2 cytochrome cred 2 cytochrome cox + 6 2 H inside + ½ O2 H2O 2 protons inside 6 2 protons outside Second set of alternate questions. Each question is worth 15 points and again you must answer 2 of 3. Alternate set 2-question 1. Explain how ATP syntase works and why we don’t get an integral number of ATPs synthesized for each NADH Protons on the outside of the inner mitochondrial membrane are allowed to pass back to the inside of the membrane by passing through the a and c subunits of the FO complex. If the Fo complex has 8 c subunits as in yeast, then it takes 8 protons to make o this unit turn 360 , if it has 10 c subunits then it takes 10 protons to make the F0 o complex to a 360 turn. The turning of the FO subunit is coupled to the F1 complex by o the ã protein. A complete 360 of both the FO and F1 turn converts 3 ADP + Pi’s into 3 ATP. Thus it appears that in yeast 8 protons make 3 ATP. However to make each ATP we have to use a proton to transport inorganic phosphate into in mitochondrial matrix, so it takes 11 protons/3 ATP or 3.7 protons/ATP (NOT 3.5 which you only get if you use 9 c subunits!) So in yeast, where 1 NADH pumps a total of 10 protons across the membrane 10 protons * (1 atp/3.7 protons) = 2.7 ATP/NADH yeast If you do these calculations with 10 c subunits that are found in e coli you test 10+3 = 13 protons/3 ATP or 4.3 protons/ATP 10 protons * (1/4.3) =2.3 ATP/NADH So we will go with a nice average of 2.5! -5- Alternate set 2 question 2. Discuss the effects of insulin and glucagon on the glycolysis and gluoconeogenesis in as much detail as possible. (Ie. What specific enzymes are turned on and off or how is their activity is modulated) This first part is also used inthe answer to the next question! Insulin 1 - effect on Phosphofructokinase 1 Insuline stimulates phosphoprotein phosphatase phorphoprotein phosphatase removes phosphate from the PFK-2/FBPase-2 complex activates PFK-2 deactivates FBPase-2 F26BP levels rise F26BP in turn stimulates PFK-1 activity rises and FBPase-1 activity falls and glycolysis is turned on and gluconeogenesis is slowed Glucagon 1 - Effect on Fructose 1,6 bisphosphae phosphatase Glucogon stimulates the release of cAMP cAMP simulates cAMP dependent protein kinase cAMP protein kinase phosphorylates the PFK-2/FBPase-2 complex The phosphorylated PFK-2/FBPase-2 complex turns off the PFK-2 activity and increases the FBPase-2 activity levels of F26BP fall PFK-1 activity drops and FBPase-1 is stimulated Glycolysis is turned off and gluconeogenesis is turned on Effect 2 Glucogon stimulates the release of cAMP cAMP simulates cAMP dependent protein kinase cAMP dependent protein kinase phosphorylates the isozyme of pyruvate kinase found in the liver the phosphorylated pyruvate kinase is inhibited and glycolysis is shut down Effect 3 Finally back in chapter 14 we had a brief discussion of diabetes. In this discussion I mentioned that one of the effects of insulin, through a couple of intermediates is to make vesicles containing the GLUT4 transporter to fuse with cell membrane. As you get more transporters on the cell surface, you get more glucose in the cell, and glycolysis gets stimulated.
Load more

Recommended publications
  • • Glycolysis • Gluconeogenesis • Glycogen Synthesis
    Carbohydrate Metabolism! Wichit Suthammarak – Department of Biochemistry, Faculty of Medicine Siriraj Hospital – Aug 1st and 4th, 2014! • Glycolysis • Gluconeogenesis • Glycogen synthesis • Glycogenolysis • Pentose phosphate pathway • Metabolism of other hexoses Carbohydrate Digestion! Digestive enzymes! Polysaccharides/complex carbohydrates Salivary glands Amylase Pancreas Oligosaccharides/dextrins Dextrinase Membrane-bound Microvilli Brush border Maltose Sucrose Lactose Maltase Sucrase Lactase ‘Disaccharidase’ 2 glucose 1 glucose 1 glucose 1 fructose 1 galactose Lactose Intolerance! Cause & Pathophysiology! Normal lactose digestion Lactose intolerance Lactose Lactose Lactose Glucose Small Intestine Lactase lactase X Galactose Bacteria 1 glucose Large Fermentation 1 galactose Intestine gases, organic acid, Normal stools osmotically Lactase deficiency! active molecules • Primary lactase deficiency: อาการ! genetic defect, การสราง lactase ลด ลงเมออายมากขน, พบมากทสด! ปวดทอง, ถายเหลว, คลนไสอาเจยนภาย • Secondary lactase deficiency: หลงจากรบประทานอาหารทม lactose acquired/transient เชน small bowel เปนปรมาณมาก เชนนม! injury, gastroenteritis, inflammatory bowel disease! Absorption of Hexoses! Site: duodenum! Intestinal lumen Enterocytes Membrane Transporter! Blood SGLT1: sodium-glucose transporter Na+" Na+" •! Presents at the apical membrane ! of enterocytes! SGLT1 Glucose" Glucose" •! Co-transports Na+ and glucose/! Galactose" Galactose" galactose! GLUT2 Fructose" Fructose" GLUT5 GLUT5 •! Transports fructose from the ! intestinal lumen into enterocytes!
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Yeast As a Tool to Understand the Significance of Human Disease
    G C A T T A C G G C A T genes Review Yeast as a Tool to Understand the Significance of Human Disease-Associated Gene Variants Tiziana Cervelli and Alvaro Galli * Yeast Genetics and Genomics Group, Laboratory of Functional Genetics and Genomics, Institute of Clinical Physiology CNR, Via Moruzzi 1, 56125 Pisa, Italy; [email protected] * Correspondence: [email protected] Abstract: At present, the great challenge in human genetics is to provide significance to the growing amount of human disease-associated gene variants identified by next generation DNA sequencing technologies. Increasing evidences suggest that model organisms are of pivotal importance to addressing this issue. Due to its genetic tractability, the yeast Saccharomyces cerevisiae represents a valuable model organism for understanding human genetic variability. In the present review, we show how S. cerevisiae has been used to study variants of genes involved in different diseases and in different pathways, highlighting the versatility of this model organism. Keywords: yeast; Saccharomyces cerevisiae; functional assays; Mendelian disease; cancer; human gene variants 1. Introduction The advent of next generation DNA sequences technologies allows us to identify Citation: Cervelli, T.; Galli, A. Yeast individual genetic variants, and this revolutionized the strategy for discovering the cause as a Tool to Understand the of several genetic and multifactorial diseases. The association between genetic variants Significance of Human and disease risk can potentially overturn our understanding of common disease. The Disease-Associated Gene Variants. discovery of pathways and processes that are causally involved in a disease, so far not Genes 2021, 12, 1303. https:// linked, may open the way towards the development of targeted therapies and prevention doi.org/10.3390/genes12091303 strategies.
    [Show full text]
  • Structures, Functions, and Mechanisms of Filament Forming Enzymes: a Renaissance of Enzyme Filamentation
    Structures, Functions, and Mechanisms of Filament Forming Enzymes: A Renaissance of Enzyme Filamentation A Review By Chad K. Park & Nancy C. Horton Department of Molecular and Cellular Biology University of Arizona Tucson, AZ 85721 N. C. Horton ([email protected], ORCID: 0000-0003-2710-8284) C. K. Park ([email protected], ORCID: 0000-0003-1089-9091) Keywords: Enzyme, Regulation, DNA binding, Nuclease, Run-On Oligomerization, self-association 1 Abstract Filament formation by non-cytoskeletal enzymes has been known for decades, yet only relatively recently has its wide-spread role in enzyme regulation and biology come to be appreciated. This comprehensive review summarizes what is known for each enzyme confirmed to form filamentous structures in vitro, and for the many that are known only to form large self-assemblies within cells. For some enzymes, studies describing both the in vitro filamentous structures and cellular self-assembly formation are also known and described. Special attention is paid to the detailed structures of each type of enzyme filament, as well as the roles the structures play in enzyme regulation and in biology. Where it is known or hypothesized, the advantages conferred by enzyme filamentation are reviewed. Finally, the similarities, differences, and comparison to the SgrAI system are also highlighted. 2 Contents INTRODUCTION…………………………………………………………..4 STRUCTURALLY CHARACTERIZED ENZYME FILAMENTS…….5 Acetyl CoA Carboxylase (ACC)……………………………………………………………………5 Phosphofructokinase (PFK)……………………………………………………………………….6
    [Show full text]
  • Annotation of Glycolysis and Gluconeogenesis Pathways
    A metabolic insight into the Asian citrus psyllid: Annotation of glycolysis and gluconeogenesis pathways Blessy Tamayo, Kyle Kercher, Tom D’Elia, Helen Wiersma-Koch, Surya Saha, Teresa Shippy, Susan J. Brown, and Prashant Hosmani Introduction Glycolysis, as in other animals, is the major metabolic pathway that insects use to extract energy from carbohydrates [1]. This process consists of ten reactions that convert one molecule of glucose into two molecules of pyruvate within the cytosol, generating a net gain of two molecules of ATP. Simple carbohydrates are acquired through the insect diet and processed through glycolysis and the central carbohydrate metabolic steps. Comparative genomic analysis of Apis mellifera, Drosophila melanogaster, and Anopheles gambiae has revealed the presence of genes for metabolic pathways that support dietary habits dependent on sugar-rich substrates ([2]; [3]; [4]; [5]). In addition to processing sugars for energy, glycolysis also serves as a central pathway that serves as both a source of important precursors and destination for key intermediates from many metabolic pathways. Gluconeogenesis is the process through which glucose is synthesized from non- carbohydrate substrates, and is closely associated with glycolysis. Eleven enzymatic reactions occur during gluconeogenesis. Eight of the enzymes involved in the steps also catalyze the reverse reactions in glycolysis and the three remaining enzymes are specific to gluconeogenesis. 1 Gluconeogenesis generated carbohydrates are required as substrate for anaerobic glycolysis, synthesis of chitin, glycoproteins, polyols and glycoside detoxication products [1]. Gluconeogenesis is essential in insects to maintain sugar homeostasis and serves as the initial process towards the generation of glucose disaccharide trehalose, which is the main circulating sugar in the insect hemolymph ([6]; [7]).
    [Show full text]
  • The Microbiota-Produced N-Formyl Peptide Fmlf Promotes Obesity-Induced Glucose
    Page 1 of 230 Diabetes Title: The microbiota-produced N-formyl peptide fMLF promotes obesity-induced glucose intolerance Joshua Wollam1, Matthew Riopel1, Yong-Jiang Xu1,2, Andrew M. F. Johnson1, Jachelle M. Ofrecio1, Wei Ying1, Dalila El Ouarrat1, Luisa S. Chan3, Andrew W. Han3, Nadir A. Mahmood3, Caitlin N. Ryan3, Yun Sok Lee1, Jeramie D. Watrous1,2, Mahendra D. Chordia4, Dongfeng Pan4, Mohit Jain1,2, Jerrold M. Olefsky1 * Affiliations: 1 Division of Endocrinology & Metabolism, Department of Medicine, University of California, San Diego, La Jolla, California, USA. 2 Department of Pharmacology, University of California, San Diego, La Jolla, California, USA. 3 Second Genome, Inc., South San Francisco, California, USA. 4 Department of Radiology and Medical Imaging, University of Virginia, Charlottesville, VA, USA. * Correspondence to: 858-534-2230, [email protected] Word Count: 4749 Figures: 6 Supplemental Figures: 11 Supplemental Tables: 5 1 Diabetes Publish Ahead of Print, published online April 22, 2019 Diabetes Page 2 of 230 ABSTRACT The composition of the gastrointestinal (GI) microbiota and associated metabolites changes dramatically with diet and the development of obesity. Although many correlations have been described, specific mechanistic links between these changes and glucose homeostasis remain to be defined. Here we show that blood and intestinal levels of the microbiota-produced N-formyl peptide, formyl-methionyl-leucyl-phenylalanine (fMLF), are elevated in high fat diet (HFD)- induced obese mice. Genetic or pharmacological inhibition of the N-formyl peptide receptor Fpr1 leads to increased insulin levels and improved glucose tolerance, dependent upon glucagon- like peptide-1 (GLP-1). Obese Fpr1-knockout (Fpr1-KO) mice also display an altered microbiome, exemplifying the dynamic relationship between host metabolism and microbiota.
    [Show full text]
  • Phosphoglycerate Mutase Deficiency
    Phosphoglycerate mutase deficiency Description Phosphoglycerate mutase deficiency is a disorder that primarily affects muscles used for movement (skeletal muscles). Beginning in childhood or adolescence, affected individuals experience muscle aches or cramping following strenuous physical activity. Some people with this condition also have recurrent episodes of myoglobinuria. Myoglobinuria occurs when muscle tissue breaks down abnormally and releases a protein called myoglobin, which is processed by the kidneys and released in the urine. If untreated, myoglobinuria can lead to kidney failure. In some cases of phosphoglycerate mutase deficiency, microscopic tube-shaped structures called tubular aggregates are seen in muscle fibers. It is unclear how tubular aggregates are associated with the signs and symptoms of the disorder. Frequency Phosphoglycerate mutase deficiency is a rare condition; about 15 affected people have been reported in the medical literature. Most affected individuals have been African American. Causes Phosphoglycerate mutase deficiency is caused by mutations in the PGAM2 gene. This gene provides instructions for making an enzyme called phosphoglycerate mutase, which is involved in a critical energy-producing process in cells known as glycolysis. During glycolysis, the simple sugar glucose is broken down to produce energy. The version of phosphoglycerate mutase produced from the PGAM2 gene is found primarily in skeletal muscle cells. Mutations in the PGAM2 gene greatly reduce the activity of phosphoglycerate mutase, which disrupts energy production in these cells. This defect underlies the muscle cramping and myoglobinuria that occur after strenuous exercise in affected individuals. Learn more about the gene associated with Phosphoglycerate mutase deficiency • PGAM2 Reprinted from MedlinePlus Genetics (https://medlineplus.gov/genetics/) 1 I nheritance This condition is inherited in an autosomal recessive pattern, which means both copies of the PGAM2 gene in each cell have mutations.
    [Show full text]
  • Overexpression of a Biotic Stress-Inducible Pvgstu Gene Activates Early Protective Responses in Tobacco Under Combined Heat and Drought
    International Journal of Molecular Sciences Article Overexpression of A Biotic Stress-Inducible Pvgstu Gene Activates Early Protective Responses in Tobacco under Combined Heat and Drought Evangelia Stavridou 1,2 , Georgia Voulgari 1, Michail Michailidis 3 , Stefanos Kostas 4 , Evangelia G. Chronopoulou 5, Nikolaos E. Labrou 5 , Panagiotis Madesis 2,6 and Irini Nianiou-Obeidat 1,* 1 Laboratory of Genetics and Plant Breeding, School of Agriculture, Forestry and Natural Environment, Aristotle University of Thessaloniki, P.O. Box 261, GR-54124 Thessaloniki, Greece; [email protected] (E.S.); [email protected] (G.V.) 2 Institute of Applied Biosciences, CERTH, 6th km Charilaou-Thermis Road, Thermi, P.O. Box 361, GR-57001 Thessaloniki, Greece; [email protected] 3 Laboratory of Pomology, Department of Horticulture, School of Agriculture, Aristotle University of Thessaloniki, GR-54124 Thessaloniki, Greece; [email protected] 4 Laboratory of Floriculture, School of Agriculture, Forestry and Natural Environment, Aristotle University of Thessaloniki, GR-54124 Thessaloniki, Greece; [email protected] 5 Laboratory of Enzyme Technology, Department of Biotechnology, School of Food, Biotechnology and Development, Agricultural University of Athens, 75 Iera Odos Street, 11855 Athens, Greece; [email protected] (E.G.C.); [email protected] (N.E.L.) 6 Laboratory of Molecular Biology of Plants, School of Agricultural Sciences, University of Thessaly, Citation: Stavridou, E.; Voulgari, G.; 38446 Thessaly, Greece Michailidis, M.; Kostas, S.; * Correspondence: [email protected]; Tel.: +30-2310-998-617 Chronopoulou, E.G.; Labrou, N.E.; Madesis, P.; Nianiou-Obeidat, I. Abstract: Drought and heat stresses are major factors limiting crop growth and productivity, and Overexpression of A Biotic their effect is more devastating when occurring concurrently.
    [Show full text]
  • Physiological and Proteomic Responses of Diploid and Tetraploid Black Locust (Robinia Pseudoacacia L.) Subjected to Salt Stress
    Int. J. Mol. Sci. 2013, 14, 20299-20325; doi:10.3390/ijms141020299 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Article Physiological and Proteomic Responses of Diploid and Tetraploid Black Locust (Robinia pseudoacacia L.) Subjected to Salt Stress Zhiming Wang 1,†, Mingyue Wang 1,†, Likun Liu2 and Fanjuan Meng 1,* 1 College of Life Science, Northeast Forestry University, Harbin 150040, China; E-Mails: [email protected] (Z.W.); [email protected] (M.W.) 2 Department of Medical Biotechnology, College of Biomedical Science, Kangwon National University, Chuncheon, Gangwon-do 200-701, Korea; E-Mail: [email protected] † These authors contributed equally to this work. * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +86-451-8219-2170; Fax: +86-451-8643-3905. Received: 17 June 2013; in revised form: 31 August 2013 / Accepted: 9 September 2013 / Published: 14 October 2013 Abstract: Tetraploid black locust (Robinia pseudoacacia L.) is adaptable to salt stress. Here, we compared morphological, physiological, ultrastructural, and proteomic traits of leaves in tetraploid black locust and its diploid relatives under salt stress. The results showed that diploid (2×) plants suffered from greater negative effects than those of tetraploid (4×) plants. After salt treatment, plant growth was inhibited, photosynthesis was reduced, reactive oxygen species, malondialdehyde content, and relative electrolyte leakage increased, and defense-related enzyme activities decreased in 2× compared to those in 4×. In addition, salt stress resulted in distorted chloroplasts, swollen thylakoid membranes, accumulation of plastoglobules, and increased starch grains in 2× compared to those in 4×.
    [Show full text]
  • MITOCW | Watch?V=Vl E7ik Vbs
    MITOCW | watch?v=vL_E7Ik_vBs The following content is provided under a Creative Commons license. Your support will help MIT OpenCourseWare continue to offer high quality educational resources for free. To make a donation or view additional materials from hundreds of MIT courses, visit MIT OpenCourseWare at ocw.mit.edu. DR. BOGDAN Hello, and welcome to 5.07 Biochemistry online. I'm Dr. Bogdan Fedeles. Let's metabolize FEDELES: some problems. Today we're discussing problem 2 of problem set 6. Here we're going to explore in more detail the mechanism of phosphoglycerate mutase, which is the eighth enzyme in glycolysis. It's the enzyme that catalyzes the conversion of 3-phosphoglycerate to 2-phosphoglycerate. Generally speaking, mutases are enzymes that catalyze the shift of a functional group between two similar positions of a molecule. In the case of phosphoglycerate mutase, this enzyme catalyzes the transfer of the phosphate group from the 3 position of glycerate to the 2 position of glycerate. In 5.07, you will encounter several mutases. Similar to phosphoglycerate mutase, there is a bisphosphoglycerate mutase, which converts 1,3-bisphosphoglycerate to 2,3-bisphosphoglycerate. Now, this reaction is very important when it happens in the red blood cells. Another mutase you will encounter is in the glycogen breakdown pathway. It's called phosphoglucomutase and converts glucose 1-phosphate to glucose 6-phosphate. Now finally, the most intriguing of them all is the methylmalonyl-coa mutase, which is a fascinating enzyme that converts methylmalonyl-coA to succinyl-coA. In this reaction, it rearranges this carbon skeleton of the molecule, and it requires adenosylcobalamin, which is a co-factor derived from vitamin B12.
    [Show full text]
  • Mechanisms of Interaction Between Haemophilus Parainfluenzae and Streptococcus Mitis
    University of Rhode Island DigitalCommons@URI Open Access Dissertations 2021 MECHANISMS OF INTERACTION BETWEEN HAEMOPHILUS PARAINFLUENZAE AND STREPTOCOCCUS MITIS Dasith Perera Follow this and additional works at: https://digitalcommons.uri.edu/oa_diss MECHANISMS OF INTERACTION BETWEEN HAEMOPHILUS PARAINFLUENZAE AND STREPTOCOCCUS MITIS BY DASITH PERERA A DISSERTATION SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY IN CELL & MOLECULAR BIOLOGY UNIVERSITY OF RHODE ISLAND 2021 DOCTOR OF PHILOSOPHY DISSERTATION OF DASITH PERERA APPROVED: Thesis Committee: Matthew Ramsey, Major professor David Nelson David Rowley Brenton DeBoef DEAN OF THE GRADUATE SCHOOL UNIVERSITY OF RHODE ISLAND 2021 ABSTRACT The human oral cavity is a complex polymicrobial environment, home to an array of microbes that play roles in health and disease. Oral bacteria have been shown to cause an array of systemic diseases and are particularly concerning to type II diabetics (T2D) with numerous predispositions that exacerbate bacterial infection. In this dissertation, we investigated the serum of healthy subjects and T2D subjects to determine whether we see greater translocation of oral bacteria into the bloodstream of T2D indiviDuals. We didn’t observe any significant enrichment of oral taxa, however we detected the presence of an emerging pathogen, Acinetobacter baumannii that is also associated with impaired inflammation in T2D. While some are associated with disease, many oral taxa are important in the pre- vention of disease. In this dissertation we investigated the interactions between two abundant health-associated commensal microbes, Haemophilus parainfluenzae and Streptococcus mitis. We demonstrated that H. parainfluenzae typically exists adjacent to Mitis group streptococci in vivo in healthy subjects.
    [Show full text]
  • Supplementary Informations SI2. Supplementary Table 1
    Supplementary Informations SI2. Supplementary Table 1. M9, soil, and rhizosphere media composition. LB in Compound Name Exchange Reaction LB in soil LBin M9 rhizosphere H2O EX_cpd00001_e0 -15 -15 -10 O2 EX_cpd00007_e0 -15 -15 -10 Phosphate EX_cpd00009_e0 -15 -15 -10 CO2 EX_cpd00011_e0 -15 -15 0 Ammonia EX_cpd00013_e0 -7.5 -7.5 -10 L-glutamate EX_cpd00023_e0 0 -0.0283302 0 D-glucose EX_cpd00027_e0 -0.61972444 -0.04098397 0 Mn2 EX_cpd00030_e0 -15 -15 -10 Glycine EX_cpd00033_e0 -0.0068175 -0.00693094 0 Zn2 EX_cpd00034_e0 -15 -15 -10 L-alanine EX_cpd00035_e0 -0.02780553 -0.00823049 0 Succinate EX_cpd00036_e0 -0.0056245 -0.12240603 0 L-lysine EX_cpd00039_e0 0 -10 0 L-aspartate EX_cpd00041_e0 0 -0.03205557 0 Sulfate EX_cpd00048_e0 -15 -15 -10 L-arginine EX_cpd00051_e0 -0.0068175 -0.00948672 0 L-serine EX_cpd00054_e0 0 -0.01004986 0 Cu2+ EX_cpd00058_e0 -15 -15 -10 Ca2+ EX_cpd00063_e0 -15 -100 -10 L-ornithine EX_cpd00064_e0 -0.0068175 -0.00831712 0 H+ EX_cpd00067_e0 -15 -15 -10 L-tyrosine EX_cpd00069_e0 -0.0068175 -0.00233919 0 Sucrose EX_cpd00076_e0 0 -0.02049199 0 L-cysteine EX_cpd00084_e0 -0.0068175 0 0 Cl- EX_cpd00099_e0 -15 -15 -10 Glycerol EX_cpd00100_e0 0 0 -10 Biotin EX_cpd00104_e0 -15 -15 0 D-ribose EX_cpd00105_e0 -0.01862144 0 0 L-leucine EX_cpd00107_e0 -0.03596182 -0.00303228 0 D-galactose EX_cpd00108_e0 -0.25290619 -0.18317325 0 L-histidine EX_cpd00119_e0 -0.0068175 -0.00506825 0 L-proline EX_cpd00129_e0 -0.01102953 0 0 L-malate EX_cpd00130_e0 -0.03649016 -0.79413596 0 D-mannose EX_cpd00138_e0 -0.2540567 -0.05436649 0 Co2 EX_cpd00149_e0
    [Show full text]