DOCSLIB.ORG

Downregulation of Phosphoglycerate Kinase 1 by Shrna Sensitizes U251 Xenografts to Radiotherapy

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Downregulation of Phosphoglycerate Kinase 1 by Shrna Sensitizes U251 Xenografts to Radiotherapy ONCOLOGY REPORTS 32: 1513-1520, 2014 Downregulation of phosphoglycerate kinase 1 by shRNA sensitizes U251 xenografts to radiotherapy YI-JUN CHENG1, HAO DING1, HUA-QING DU2, Hua YAN1, JIN-BING ZHAO1, WEN-BIN ZHANG1, YUAN-JIE ZOU1, HONG-YI LIU1 and HONG XIAO2 1Department of Neurosurgery and 2Neuro-Psychiatric Institute, Nanjing Brain Hospital Affiliated to Nanjing Medical University, Nanjing, Jiangsu, P.R. China Received April 6, 2014; Accepted July 9, 2014 DOI: 10.3892/or.2014.3353 Abstract. Phosphoglycerate kinase 1 (PGK1) has been demon- radiotherapy is one of the standard treatments for glioma. Yet, strated to be involved in radioresistance. The present study was the prognosis remains dismal due to the ability of gliomas to designed to investigate the effect of PGK1 on the radioresis- infiltrate diffusely into the normal brain parenchyma, a direct tance in vivo. U251 glioma cells were transfected with the short consequence of the transformation into genetic higher-grade hairpin RNA (shRNA)-PGK1 and pcDNA3.1-PGK1 using gliomas and recurrence (4-6). As known, radioresistance is Lipofectamine 2000. The radiosensitivity of U251 xenografts a common phenomenon in gliomas and, to date there are no was observed by tumor growth curve following radiotherapy. valid biomarkers for evaluating radiosensitivity. Quantitative PCR, western blot analysis and immunohisto- In fact, radiotherapy which relies on the generation of chemistry were performed to evaluate PGK1 expression in the oxygen super-radicals, often fails to kill tumor cells, due to xenografts from the different tumor models. The expression inadequate oxygen stress within the tumor cell mass (7,8). of PGK1 was maximally inhibited in response to shRNA4 at However, in tumor microenvironments where oxygen is scarce 24 h after the transfection in vitro. Tumor growth of the U251 and glucose consumption is high, as within the expanding xenografts was significantly inhibited following treatment tumor mass, a metabolic pathway shift occurs in order to with shRNA-PGK1 and radiotherapy. The expression of PGK1 maintain local homeostasis. This phenomenon is known as the in vivo at the mRNA and protein levels was downregulated by Warburg effect. Transcription of numerous enzymes such as the treatment of shRNA1 when compared to levels following phosphofructokinase-1 (PFK-1), lactate dehydrogenase (LDH) treatment with shNC and PBS after radiotherapy. The results and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is showed that suppression of PGK1 enhanced the radiosensi- activated in the glycolytic pathway. Among these enzymes, tivity of U251 xenografts and suggest that PGK1 may serve as PGK1, an ATP-generating glycolytic enzyme, plays a vital role. a useful target in the treatment of radioresistant glioma. It catalyzes the transfer of a high-energy phosphoryl group from the acyl phosphate of 1,3-diphosphoglycerate to ADP to Introduction produce ATP. PGK1 has also been proven to have an increased expression level in many malignant tumors (9-16). The possible The annual incidence of gliomas which account for more than role of PGK1 in radioresistance has been previously studied. 50% of all brain tumors in adults is 6/100,000 (1). Based on Data from our laboratory showed that expression of PGK1 is the histopathologic subgroups characterized by different levels significantly upregulated in radioresistant astrocytomas and of aggressiveness and malignancy, astrocytomas account for radioresistant glioma U251 cells (17,18). As an initial step toward 60-70% of gliomas. Extensive surgical resection, which corre- identification of a clinically applicable method for regulating lates with patient survival independently (2,3), followed by PGK1 for combination with radiotherapy, we investigated the effects of shRNA-PGK1 on the in vitro radiosensitivity of human glioma U251 cells (18). Downregulation of PGK1 by shRNA combined with radiotherapy significantly decreased Correspondence to: Professor Hong-Yi Liu, Department of cell viability and reduced the ability of migration and inva- Neurosurgery, Nanjing Brain Hospital Affiliated to Nanjing Medical sion in U251 cells. This indicates that PGK1 may be closely University, 264 Guangzhou Road, Nanjing, Jiangsu, P.R. China associated with glioma radioresponse and may be a potential E-mail: [email protected] target with which to sensitize conventional radiotherapy. Professor Hong Xiao, Department of Neuro-Psychiatric Institute, However, the exact effect of PGK1 on the radiosensitivity Nanjing Brain Hospital Affiliated to Nanjing Medical University, in vivo using animal models has not yet been clarified. To 264 Guangzhou Road, Nanjing, Jiangsu, P.R. China further evaluate the potential radioresistance of PGK1, we E-mail: [email protected] extended these in vitro results to an in vivo xenograft model. Mice bearing U251 xenografts were exposed to shRNA-PGK1 Key words: glioma, U251 xenograft, PGK1, radiosensitivity and the level of PGK1 was determined. Radiation was then delivered in a single exposure, and shRNA-PGK1 treatment 1514 CHENG et al: Downregulation of PGK1 by shRNA sensitizes U251 xenografts to radiotherapy resulted in a significant enhancement in tumor response. These (3x107) which were diluted in 100 µl phosphate-buffered saline findings suggest a possible approach for the rational design of (PBS) containing 50% Matrigel (BD Biosciences, Franklin a clinical protocol combining downregulation of PGK1 and Lakes, NJ, USA) by using 0.1 ml/inoculation in the lower back radiotherapy. region of the mice. Materials and methods Statement of ethics. Animal studies were carried out in accor- dance with the US National Institutes of Health Guidelines Cell lines and culture. Human U251 cells were obtained and followed the rules of the National Animal Protection of from KeyGen Biotech (Nanjing, China), and radioresistant China. The present study was approved by the Medical Ethics U251 cells (RR-U251 cells) were established according to a Committee of Nanjing Brain Hospital Affiliated to Nanjing previously described method (18). The cells were cultured in Medical University (ethic no. 2011KY001). All efforts were Dulbecco's modified Eagle's medium (DMEM) supplemented made to minimize suffering and to reduce the number of mice with 10% fetal calf serum (both from Gibco-Invitrogen, used. Carlsbad, CA, USA), 100 U/ml of penicillin and 100 µg/ml of streptomycin in a 5% CO2 humidified incubator at 37˚C. Delivery of shRNA in vivo and radiotherapy. When the s.c. tumors of the nude mice were ~60-80 mm3 in size, shRNA- Plasmid molecules and stable transfection in vitro. The PGK1 (500 pmol/tumor, 25 µl injection volume) was slowly shRNA-PGK1 plasmid and the high expression plasmid injected into the tumors at different sites. Then, the tumors pcDNA3.1-PGK1 were synthesized commercially by were immediately electrically pulsed (electric field strength, GenePharma Co. Ltd. (Shanghai, China). shRNA1 (5'-GCAAG 180 V/cm; pulse duration, 20 msec; pulse number, 6; frequency GATGTTCTGTTCTTGA-3'), shRNA2 (5'-GCTCAACAAC of pulses, 1 Hz) using Square Wave pulse (Ningbo Scientz ATGGAGATTGG-3'), shRNA3 (5'-GGATGTCTATGTCAA Biotechnology, Ningbo, China) though 2 parallel stainless TGATGC-3') and shRNA4 (5'-GAAGATTACCTTGCCTGT steel electrodes on each side of the long diameter of the TGA-3') were designed to target the coding region of the tumor in situ. The negative control group was injected with human PGK1 sequence (gene ID: 5230). A negative control shRNA-NC and the control group with PBS. Fifty-four nude shRNA-NC (5'-GTTCTCCGAACGTGTCACGT-3') was also mice were divided randomly and equally into 9 groups, obtained from Shanghai GenePharma. U251 cells were tryp- and the groups were as follows: i) U251+shRNA-PGK1; sinized and harvested from a monolayer to a cell suspension in ii) U251+shNC; iii) U251+PBS; iv) RR-U251+shRNA-PGK1; DMEM containing 10% fetal bovine serum without antibiotics v) RR-U251+shNC; vi) RR-U251+PBS; vii) overexpressed- and allowed to seed overnight. When the cell confluency was PGK1 U251+shRNA-PGK1; viii) overexpressed-PGK1 70-80%, complexes of shRNAs or pcDNA3.1-PGK1 duplexes U251+shNC; and viiii) overexpressed-PGK1 U251+PBS. and Lipofectamine 2000 (Invitrogen) were prepared as Groups were administered the indicated treatment every 24 h follows: 4 µg shRNAs or pcDNA3.1-PGK1 and 8 µl of for 14 days. After the first treatment, groups were treated with Lipofectamine 2000 were diluted in 240 µl Opti-MEM I a dose of 5 Gy of radiation by a 60Co source at 0.5 Gy/min for medium (Gibco) separately, and after 5 min standing at room 10 min every 3 days until the cumulative dose of radiotherapy temperature, gentle mixing was conducted. After a 20-min reached 20 Gy. The tumor size was measured every other day incubation of this mixture, the complexes were added to each with calipers, and the tumor volume (V) was measured with well (final concentration for DNA plasmids was 2 µg/ml). The all measurements in millimeters using the following formula: medium for transfection was replaced by complete medium at V = 0.523 x length x width2. 6 h after transfection and observed under a fluorescence microscope (Axiovert 40 CFL; Carl Zeiss, Oberkochen, Real-time polymerase chain reaction (RT-PCR). Total Germany) to observe the transfection efficiency at 24 h after RNA was extracted from an equal number of cells in vitro transfection. The expression of PGK1 was analyzed, respec- and the tumor samples with the SV Total RNA Isolation tively, at 24 and 48 h after transfection. A control and a negative System (Promega, Madison, WI, USA) according to the control were also placed in the 6-well plates. In addition, manufacturer's protocol and quantified by UV absorbance complete medium with G418 (400 µg/ml) (Keygen, Nanjing, spectroscopy. RNA was reverse transcribed into cDNA with China) was used to select the stable clones which were trans- a reverse transcription system (Promega). mRNA expression fected with pcDNA3.1-PGK1. was determined by RT-PCR using GoTaq® qPCR Master Mix (Promega) under standard thermocycler conditions (Eppendorf Establishment of the nude mouse tumor xenograft models.
Load more

Recommended publications
  • • Glycolysis • Gluconeogenesis • Glycogen Synthesis
    Carbohydrate Metabolism! Wichit Suthammarak – Department of Biochemistry, Faculty of Medicine Siriraj Hospital – Aug 1st and 4th, 2014! • Glycolysis • Gluconeogenesis • Glycogen synthesis • Glycogenolysis • Pentose phosphate pathway • Metabolism of other hexoses Carbohydrate Digestion! Digestive enzymes! Polysaccharides/complex carbohydrates Salivary glands Amylase Pancreas Oligosaccharides/dextrins Dextrinase Membrane-bound Microvilli Brush border Maltose Sucrose Lactose Maltase Sucrase Lactase ‘Disaccharidase’ 2 glucose 1 glucose 1 glucose 1 fructose 1 galactose Lactose Intolerance! Cause & Pathophysiology! Normal lactose digestion Lactose intolerance Lactose Lactose Lactose Glucose Small Intestine Lactase lactase X Galactose Bacteria 1 glucose Large Fermentation 1 galactose Intestine gases, organic acid, Normal stools osmotically Lactase deficiency! active molecules • Primary lactase deficiency: อาการ! genetic defect, การสราง lactase ลด ลงเมออายมากขน, พบมากทสด! ปวดทอง, ถายเหลว, คลนไสอาเจยนภาย • Secondary lactase deficiency: หลงจากรบประทานอาหารทม lactose acquired/transient เชน small bowel เปนปรมาณมาก เชนนม! injury, gastroenteritis, inflammatory bowel disease! Absorption of Hexoses! Site: duodenum! Intestinal lumen Enterocytes Membrane Transporter! Blood SGLT1: sodium-glucose transporter Na+" Na+" •! Presents at the apical membrane ! of enterocytes! SGLT1 Glucose" Glucose" •! Co-transports Na+ and glucose/! Galactose" Galactose" galactose! GLUT2 Fructose" Fructose" GLUT5 GLUT5 •! Transports fructose from the ! intestinal lumen into enterocytes!
    [Show full text]
  • Promiscuity in the Part-Phosphorylative Entner–Doudoroff Pathway of the Archaeon Sulfolobus Solfataricus
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector FEBS 30191 FEBS Letters 579 (2005) 6865–6869 Promiscuity in the part-phosphorylative Entner–Doudoroff pathway of the archaeon Sulfolobus solfataricus Henry J. Lamblea, Alex Theodossisb, Christine C. Milburnb, Garry L. Taylorb, Steven D. Bullc, David W. Hougha, Michael J. Dansona,* a Centre for Extremophile Research, Department of Biology and Biochemistry, University of Bath, Bath BA2 7AY, UK b Centre for Biomolecular Sciences, University of St. Andrews, North Haugh, St. Andrews, Fife KY16 9ST, UK c Department of Chemistry, University of Bath, Bath BA2 7AY, UK Received 19 September 2005; revised 3 November 2005; accepted 3 November 2005 Available online 1 December 2005 Edited by Stuart Ferguson dation of both glucose and galactose, producing gluconate or Abstract The hyperthermophilic archaeon Sulfolobus solfatari- cus metabolises glucose and galactose by a ÔpromiscuousÕ non- galactonate, respectively [6]. Gluconate dehydratase then phosphorylative variant of the Entner–Doudoroff pathway, in catalyses the dehydration of gluconate to D-2-keto-3-deoxyg- which a series of enzymes have sufficient substrate promiscuity luconate (KDG) and galactonate to D-2-keto-3-deoxygalacto- to permit the metabolism of both sugars. Recently, it has been nate (KDGal) [7]. Both these compounds are cleaved by KDG proposed that the part-phosphorylative Entner–Doudoroff path- aldolase to yield pyruvate and glyceraldehyde [6]. Glyceralde- way occurs in parallel in S. solfataricus as an alternative route hyde dehydrogenase is then thought to oxidise glyceraldehyde for glucose metabolism. In this report we demonstrate, by to glycerate, which is phosphorylated by glycerate kinase to in vitro kinetic studies of D-2-keto-3-deoxygluconate (KDG) ki- give 2-phosphoglycerate.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Yeast As a Tool to Understand the Significance of Human Disease
    G C A T T A C G G C A T genes Review Yeast as a Tool to Understand the Significance of Human Disease-Associated Gene Variants Tiziana Cervelli and Alvaro Galli * Yeast Genetics and Genomics Group, Laboratory of Functional Genetics and Genomics, Institute of Clinical Physiology CNR, Via Moruzzi 1, 56125 Pisa, Italy; [email protected] * Correspondence: [email protected] Abstract: At present, the great challenge in human genetics is to provide significance to the growing amount of human disease-associated gene variants identified by next generation DNA sequencing technologies. Increasing evidences suggest that model organisms are of pivotal importance to addressing this issue. Due to its genetic tractability, the yeast Saccharomyces cerevisiae represents a valuable model organism for understanding human genetic variability. In the present review, we show how S. cerevisiae has been used to study variants of genes involved in different diseases and in different pathways, highlighting the versatility of this model organism. Keywords: yeast; Saccharomyces cerevisiae; functional assays; Mendelian disease; cancer; human gene variants 1. Introduction The advent of next generation DNA sequences technologies allows us to identify Citation: Cervelli, T.; Galli, A. Yeast individual genetic variants, and this revolutionized the strategy for discovering the cause as a Tool to Understand the of several genetic and multifactorial diseases. The association between genetic variants Significance of Human and disease risk can potentially overturn our understanding of common disease. The Disease-Associated Gene Variants. discovery of pathways and processes that are causally involved in a disease, so far not Genes 2021, 12, 1303. https:// linked, may open the way towards the development of targeted therapies and prevention doi.org/10.3390/genes12091303 strategies.
    [Show full text]
  • Structures, Functions, and Mechanisms of Filament Forming Enzymes: a Renaissance of Enzyme Filamentation
    Structures, Functions, and Mechanisms of Filament Forming Enzymes: A Renaissance of Enzyme Filamentation A Review By Chad K. Park & Nancy C. Horton Department of Molecular and Cellular Biology University of Arizona Tucson, AZ 85721 N. C. Horton ([email protected], ORCID: 0000-0003-2710-8284) C. K. Park ([email protected], ORCID: 0000-0003-1089-9091) Keywords: Enzyme, Regulation, DNA binding, Nuclease, Run-On Oligomerization, self-association 1 Abstract Filament formation by non-cytoskeletal enzymes has been known for decades, yet only relatively recently has its wide-spread role in enzyme regulation and biology come to be appreciated. This comprehensive review summarizes what is known for each enzyme confirmed to form filamentous structures in vitro, and for the many that are known only to form large self-assemblies within cells. For some enzymes, studies describing both the in vitro filamentous structures and cellular self-assembly formation are also known and described. Special attention is paid to the detailed structures of each type of enzyme filament, as well as the roles the structures play in enzyme regulation and in biology. Where it is known or hypothesized, the advantages conferred by enzyme filamentation are reviewed. Finally, the similarities, differences, and comparison to the SgrAI system are also highlighted. 2 Contents INTRODUCTION…………………………………………………………..4 STRUCTURALLY CHARACTERIZED ENZYME FILAMENTS…….5 Acetyl CoA Carboxylase (ACC)……………………………………………………………………5 Phosphofructokinase (PFK)……………………………………………………………………….6
    [Show full text]
  • The Microbiota-Produced N-Formyl Peptide Fmlf Promotes Obesity-Induced Glucose
    Page 1 of 230 Diabetes Title: The microbiota-produced N-formyl peptide fMLF promotes obesity-induced glucose intolerance Joshua Wollam1, Matthew Riopel1, Yong-Jiang Xu1,2, Andrew M. F. Johnson1, Jachelle M. Ofrecio1, Wei Ying1, Dalila El Ouarrat1, Luisa S. Chan3, Andrew W. Han3, Nadir A. Mahmood3, Caitlin N. Ryan3, Yun Sok Lee1, Jeramie D. Watrous1,2, Mahendra D. Chordia4, Dongfeng Pan4, Mohit Jain1,2, Jerrold M. Olefsky1 * Affiliations: 1 Division of Endocrinology & Metabolism, Department of Medicine, University of California, San Diego, La Jolla, California, USA. 2 Department of Pharmacology, University of California, San Diego, La Jolla, California, USA. 3 Second Genome, Inc., South San Francisco, California, USA. 4 Department of Radiology and Medical Imaging, University of Virginia, Charlottesville, VA, USA. * Correspondence to: 858-534-2230, [email protected] Word Count: 4749 Figures: 6 Supplemental Figures: 11 Supplemental Tables: 5 1 Diabetes Publish Ahead of Print, published online April 22, 2019 Diabetes Page 2 of 230 ABSTRACT The composition of the gastrointestinal (GI) microbiota and associated metabolites changes dramatically with diet and the development of obesity. Although many correlations have been described, specific mechanistic links between these changes and glucose homeostasis remain to be defined. Here we show that blood and intestinal levels of the microbiota-produced N-formyl peptide, formyl-methionyl-leucyl-phenylalanine (fMLF), are elevated in high fat diet (HFD)- induced obese mice. Genetic or pharmacological inhibition of the N-formyl peptide receptor Fpr1 leads to increased insulin levels and improved glucose tolerance, dependent upon glucagon- like peptide-1 (GLP-1). Obese Fpr1-knockout (Fpr1-KO) mice also display an altered microbiome, exemplifying the dynamic relationship between host metabolism and microbiota.
    [Show full text]
  • Coupling of Creatine Kinase to Glycolytic Enzymes at the Sarcomeric I-Band of Skeletal Muscle: a Biochemical Study in Situ
    Journal of Muscle Research and Cell Motility 21: 691±703, 2000. 691 Ó 2000 Kluwer Academic Publishers. Printed in the Netherlands. Coupling of creatine kinase to glycolytic enzymes at the sarcomeric I-band of skeletal muscle: a biochemical study in situ THERESIA KRAFT2,*, T. HORNEMANN1, M. STOLZ1,à, V. NIER2, and T. WALLIMANN1 1Swiss Federal Institute of Technology, Institute of Cell Biology, ETH ZuÈrich, HoÈnggerberg, CH-8093 ZuÈrich, Switzerland; 2Medizinische Hochschule Hannover, Molekular- und Zellphysiologie, D-30625 Hannover, Germany Received 29 September 2000; accepted in revised form 3 October 2000 Abstract The speci®c interaction of muscle type creatine-kinase (MM-CK) with the myo®brillar M-line was demonstrated by exchanging endogenous MM-CK with an excess of ¯uorescently labeled MM-CK in situ, using chemically skinned skeletal muscle ®bers and confocal microscopy. No binding of labeled MM-CK was noticed at the I-band of skinned ®bers, where the enzyme is additionally located in vivo, as shown earlier by immuno¯uorescence staining of cryosections of intact muscle. However, when rhodamine-labeled MM-CK was diused into skinned ®bers that had been preincubated with phosphofructokinase (PFK), a glycolytic enzyme known to bind to actin, a striking in vivo- like interaction of Rh-MM-CK with the I-band was found, presumably mediated by binding of Rh-MM-CK to the glycolytic enzyme. Aldolase, another actin-binding glycolytic enzyme was also able to bind Rh-MM-CK to the I- band, but formation of the complex occurred preferably at long sarcomere length (>3.0 lm). Neither pyruvate kinase, although known for its binding to actin, nor phosphoglycerate kinase (PGK), not directly interacting with the I-band itself, did mediate I-band targeting of MM-CK.
    [Show full text]
  • Overexpression of a Biotic Stress-Inducible Pvgstu Gene Activates Early Protective Responses in Tobacco Under Combined Heat and Drought
    International Journal of Molecular Sciences Article Overexpression of A Biotic Stress-Inducible Pvgstu Gene Activates Early Protective Responses in Tobacco under Combined Heat and Drought Evangelia Stavridou 1,2 , Georgia Voulgari 1, Michail Michailidis 3 , Stefanos Kostas 4 , Evangelia G. Chronopoulou 5, Nikolaos E. Labrou 5 , Panagiotis Madesis 2,6 and Irini Nianiou-Obeidat 1,* 1 Laboratory of Genetics and Plant Breeding, School of Agriculture, Forestry and Natural Environment, Aristotle University of Thessaloniki, P.O. Box 261, GR-54124 Thessaloniki, Greece; [email protected] (E.S.); [email protected] (G.V.) 2 Institute of Applied Biosciences, CERTH, 6th km Charilaou-Thermis Road, Thermi, P.O. Box 361, GR-57001 Thessaloniki, Greece; [email protected] 3 Laboratory of Pomology, Department of Horticulture, School of Agriculture, Aristotle University of Thessaloniki, GR-54124 Thessaloniki, Greece; [email protected] 4 Laboratory of Floriculture, School of Agriculture, Forestry and Natural Environment, Aristotle University of Thessaloniki, GR-54124 Thessaloniki, Greece; [email protected] 5 Laboratory of Enzyme Technology, Department of Biotechnology, School of Food, Biotechnology and Development, Agricultural University of Athens, 75 Iera Odos Street, 11855 Athens, Greece; [email protected] (E.G.C.); [email protected] (N.E.L.) 6 Laboratory of Molecular Biology of Plants, School of Agricultural Sciences, University of Thessaly, Citation: Stavridou, E.; Voulgari, G.; 38446 Thessaly, Greece Michailidis, M.; Kostas, S.; * Correspondence: [email protected]; Tel.: +30-2310-998-617 Chronopoulou, E.G.; Labrou, N.E.; Madesis, P.; Nianiou-Obeidat, I. Abstract: Drought and heat stresses are major factors limiting crop growth and productivity, and Overexpression of A Biotic their effect is more devastating when occurring concurrently.
    [Show full text]
  • Prefoldin-Like Bud27 Influences the Transcription of Ribosomal Components and Ribosome Biogenesis in Saccharomyces Cerevisiae
    Downloaded from rnajournal.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press Prefoldin-like Bud27 influences the transcription of ribosomal components and ribosome biogenesis in Saccharomyces cerevisiae VERÓNICA MARTÍNEZ-FERNÁNDEZ,1,7,8 ABEL CUEVAS-BERMÚDEZ,1,8 FRANCISCO GUTIÉRREZ-SANTIAGO,1,8 ANA I. GARRIDO-GODINO,1 OLGA RODRÍGUEZ-GALÁN,2,3 ANTONIO JORDÁN-PLA,4 SERGIO LOIS,5 JUAN C. TRIVIÑO,5 JESÚS DE LA CRUZ,2,3 and FRANCISCO NAVARRO1,6 1Departamento de Biología Experimental-Genética, Universidad de Jaén, Paraje de las Lagunillas, s/n, E-23071, Jaén, Spain 2Instituto de Biomedicina de Sevilla (IBiS), Hospital Universitario Virgen del Rocío/CSIC/Universidad de Sevilla, E-41013 Seville, Spain 3Departamento de Genética, Universidad de Sevilla, E-41012 Seville, Spain 4ERI Biotecmed, Facultad de Biológicas, Universitat de València, E-46100 Burjassot, Valencia, Spain 5Sistemas Genómicos. Ronda de Guglielmo Marconi, 6, 46980 Paterna, Valencia, Spain 6Centro de Estudios Avanzados en Aceite de Oliva y Olivar, Universidad de Jaén, Paraje de las Lagunillas, s/n, E-23071, Jaén, Spain ABSTRACT Understanding the functional connection that occurs for the three nuclear RNA polymerases to synthesize ribosome com- ponents during the ribosome biogenesis process has been the focal point of extensive research. To preserve correct ho- meostasis on the production of ribosomal components, cells might require the existence of proteins that target a common subunit of these RNA polymerases to impact their respective activities. This work describes how the yeast prefoldin-like Bud27 protein, which physically interacts with the Rpb5 common subunit of the three RNA polymerases, is able to mod- ulate the transcription mediated by the RNA polymerase I, likely by influencing transcription elongation, the transcription of the RNA polymerase III, and the processing of ribosomal RNA.
    [Show full text]
  • Supplementary Information
    Supplementary information (a) (b) Figure S1. Resistant (a) and sensitive (b) gene scores plotted against subsystems involved in cell regulation. The small circles represent the individual hits and the large circles represent the mean of each subsystem. Each individual score signifies the mean of 12 trials – three biological and four technical. The p-value was calculated as a two-tailed t-test and significance was determined using the Benjamini-Hochberg procedure; false discovery rate was selected to be 0.1. Plots constructed using Pathway Tools, Omics Dashboard. Figure S2. Connectivity map displaying the predicted functional associations between the silver-resistant gene hits; disconnected gene hits not shown. The thicknesses of the lines indicate the degree of confidence prediction for the given interaction, based on fusion, co-occurrence, experimental and co-expression data. Figure produced using STRING (version 10.5) and a medium confidence score (approximate probability) of 0.4. Figure S3. Connectivity map displaying the predicted functional associations between the silver-sensitive gene hits; disconnected gene hits not shown. The thicknesses of the lines indicate the degree of confidence prediction for the given interaction, based on fusion, co-occurrence, experimental and co-expression data. Figure produced using STRING (version 10.5) and a medium confidence score (approximate probability) of 0.4. Figure S4. Metabolic overview of the pathways in Escherichia coli. The pathways involved in silver-resistance are coloured according to respective normalized score. Each individual score represents the mean of 12 trials – three biological and four technical. Amino acid – upward pointing triangle, carbohydrate – square, proteins – diamond, purines – vertical ellipse, cofactor – downward pointing triangle, tRNA – tee, and other – circle.
    [Show full text]
  • 2 Points Chem 465 Biochemistry II Test 1 Spring 2017 Multiple Choice
    Name: 2 points Chem 465 Biochemistry II Test 1 Spring 2017 Multiple choice (4 points apiece): 1. Which of the following statements about the oxidative decarboxylation of pyruvate in aerobic conditions in animal cells is correct? A) One of the products of the reactions of the pyruvate dehydrogenase complex is a thioester of acetate. B) The methyl (-CH3) group is eliminated as CO2. C) The process occurs in the cytosolic compartment of the cell. D) The pyruvate dehydrogenase complex uses all of the following as cofactors: NAD+, lipoic acid, pyridoxal phosphate (PLP), and FAD. E) The reaction is so important to energy production that pyruvate dehydrogenase operates at full speed under all conditions. 2. In comparison with the resting state, actively contracting human muscle tissue has a: A) higher concentration of ATP. B) higher rate of lactate formation. C) lower consumption of glucose. D) lower rate of consumption of oxygen E) lower ratio of NADH to NAD+. 3.The metabolic function of the pentose phosphate pathway is: A) act as a source of ADP biosynthesis. B) generate NADPH and pentoses for the biosynthesis of fatty acids and nucleic acids. C) participate in oxidation-reduction reactions during the formation of H2O. D) provide intermediates for the citric acid cycle. E) synthesize phosphorus pentoxide. 4. Gluconeogenesis must use "bypass reactions" to circumvent three reactions in the glycolytic pathway that are highly exergonic and essentially irreversible. Reactions carried out by which three of the enzymes listed must be bypassed in the gluconeogenic pathway? 1) Hexokinase 2) Phosphoglycerate kinase 3) Phosphofructokinase-1 4) Pyruvate kinase 5) Triosephosphate isomerase A) 1, 2, 3 B) 1, 2, 4 C) 1, 4, 5 D) 1, 3, 4 E) 2, 3, 4 5.
    [Show full text]
  • Physiological and Proteomic Responses of Diploid and Tetraploid Black Locust (Robinia Pseudoacacia L.) Subjected to Salt Stress
    Int. J. Mol. Sci. 2013, 14, 20299-20325; doi:10.3390/ijms141020299 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Article Physiological and Proteomic Responses of Diploid and Tetraploid Black Locust (Robinia pseudoacacia L.) Subjected to Salt Stress Zhiming Wang 1,†, Mingyue Wang 1,†, Likun Liu2 and Fanjuan Meng 1,* 1 College of Life Science, Northeast Forestry University, Harbin 150040, China; E-Mails: [email protected] (Z.W.); [email protected] (M.W.) 2 Department of Medical Biotechnology, College of Biomedical Science, Kangwon National University, Chuncheon, Gangwon-do 200-701, Korea; E-Mail: [email protected] † These authors contributed equally to this work. * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +86-451-8219-2170; Fax: +86-451-8643-3905. Received: 17 June 2013; in revised form: 31 August 2013 / Accepted: 9 September 2013 / Published: 14 October 2013 Abstract: Tetraploid black locust (Robinia pseudoacacia L.) is adaptable to salt stress. Here, we compared morphological, physiological, ultrastructural, and proteomic traits of leaves in tetraploid black locust and its diploid relatives under salt stress. The results showed that diploid (2×) plants suffered from greater negative effects than those of tetraploid (4×) plants. After salt treatment, plant growth was inhibited, photosynthesis was reduced, reactive oxygen species, malondialdehyde content, and relative electrolyte leakage increased, and defense-related enzyme activities decreased in 2× compared to those in 4×. In addition, salt stress resulted in distorted chloroplasts, swollen thylakoid membranes, accumulation of plastoglobules, and increased starch grains in 2× compared to those in 4×.
    [Show full text]