DOCSLIB.ORG

Name: Chem 465 Biochemistry II Test 1 Spring 2019 Multiple Choice (4 Points Apiece): 1. in an Anaerobic Muscle Preparation, Lact

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Name: Chem 465 Biochemistry II Test 1 Spring 2019 Multiple Choice (4 Points Apiece): 1. in an Anaerobic Muscle Preparation, Lact Name: Chem 465 Biochemistry II Test 1 Spring 2019 Multiple choice (4 points apiece): 1. In an anaerobic muscle preparation, lactate formed from glucose labeled in C-3 and C-4 would be labeled in: A) all three carbon atoms. B) only the carbon atom carrying the OH. C) only the carboxyl carbon atom. D) only the methyl carbon atom. E) the methyl and carboxyl carbon atoms. 2. In an anaerobic muscle preparation, lactate formed from glucose labeled in C-2 would be labeled in: A) all three carbon atoms. B) only the carbon atom carrying the OH. C) only the carboxyl carbon atom. D) only the methyl carbon atom. E) the methyl and carboxyl carbon atoms. 3. All of the following enzymes involved in the flow of carbon from glucose to lactate (glycolysis) are also involved in the reversal of this flow (gluconeogenesis) except: A) 3-phosphoglycerate kinase. B) aldolase. C) enolase. D) phosphofructokinase-1. E) phosphoglucoisomerase. 4. Cellular isozymes of pyruvate kinase are allosterically inhibited by: A) high concentrations of AMP. B) high concentrations of ATP. C) high concentrations of citrate. D) low concentrations of acetyl-CoA. E) low concentrations of ATP. 5. Which of the following is not true of the reaction catalyzed by the pyruvate dehydrogenase complex? A) Biotin participates in the decarboxylation. B) Both NAD+ and a flavin nucleotide act as electron carriers. C) The reaction occurs in the mitochondrial matrix. D) The substrate is held by the lipoyl-lysine "swinging arm." E) Two different cofactors containing -SH groups participate. 6. (20 points) This page is blank because I want you to fill it in with the glycolytic pathway from glucose to pyruvate showing the structure of all intermediates. At each step also give the name of the enzyme and ÄG of the reaction. To help you on your way, here is a list of all then enzymes in alphabetical order: Aldolase Enolase Glyceraldehyde 3-phosphate dehydrogenase Hexokinase Phosphofructokinase-1 Phosphoglycerate kinase Phosphoglycerate mutase Phosphohexose isomerase Pyruvate kinase Triose phosphate isomerase Also show the reactions and enzymes involved in gluconeogenesis On this key I am not going to take the time to make the structures, but I will check that you have the correct structure Glucose + ATP Hexokinase Mg2+ -16.7 Glucose-6-P Phosphohexose isomerase Mg2+ +1.7 Fructose-6-P + ATP Phosphofructosekinase -1 Mg2+ -14.2 Fructose 1,6-bisphosphate aldolase +23.8 Dihydroxyacetone phosphate Glyceraldehyde 3-phosphate Triose isomerase +7.5 Glyceraldehyde 3phosphate + NAD glyceraldehyde 3-phosphate dehydrogenase + 6.3 1,3-Bisphosphoglyerate phosphoglycerate kinase Mg2+ -18.5 3-Phosphoglycerate + ATP Phosphoglyerate mutase Mg2+ +4.4 2-Phosphoglycerate Enolase Mg2+ +7.5 Phophoenolpyruvate Pyruvate kinase K+, Mg2+ or Mn2+ -31.4 Pyruvate + ATP Reverse These reactions not as well described so no ÄG’s or cofactors - Pyruvate +ATP+ HCO3 Pyruate carboxylase Oxaloacetate + GTP PEP carboxylase PEP 6 Fructoae 1,6-bisphosphate fructose 1,6-bisphosphatase-1 Glucose 6-phosphate glucose 6-phosphatase -2- 10 point questions - You may skip one! 7. What is the difference between: ‘Triphosphate and a ‘trisphosphate’ Triphosphate - 3 phosphates attached in a line at one spot Trisphosphate -3 phosphates attached at different places Metabolic control and metabolic regulation Metabolic control -mechanism that allow an organism to change with changing situation Metabolic regulation - mechanisms that try to maintain homeostasis A kinase and a phosphatase Kinases add phosphates, phosphatases remove phosphates A substrate cycle and a futile cycle A cycle of one enzyme doing the reaction of A6B, and a second enzyme doing the reaction B6A. Substrate cycling is used to refer to a low level of this cycling that seems to go on in all cells, Futile cycling refers to doing this at a high level that would waste energy and be damaging t the cell. PFK-1 and PFK-2 Phosphofructokinase 1 and 2. 1 is used in glycolysis and makes Fructose 1,6- bisphosphate, 2 us used in control and makes Fructose 1,6 bisphosphate. 8. I told you that you didn’t have to worry about most mechanisms for most of the enzymes except one, the mechanism of phosphoglycerate mutase. What reaction does this enzyme catalyze, why was this mechanism ‘special’, and what other enzyme shares a similar mechanism? The reaction is 3-phosphoglycerate to 2-phosphoglycerate. The unique feature of the mechanism is that it does not simply mover the same phosphate from one carbon to the other. What is actually does is to take a phosphate already on a histidine of the enzyme and add it to the 3-phosphoglycerate to make 2,3-bisphosphoglycerate, and then that same histidine is used to remove the phosphate on the 3 position to make the final product and regenerate the phosphoenzyme. The enzyme with a similar mechanism is succinyl-CoA synthetase in the TCA cycle. This enzyme first puts an inorganic phosphate on a histidine on the enzyme as it releases CoA from succinyl- CoA, then this phosphate if attached to GDP to make GTP. 9. The pentose phosphate pathway is divided into two processes, the oxidation of glucose-6-phosphate to Ribose-5-phosphate, and the non-oxidative conversion of ribose-5-phosphate to Glucose-6 phosphate. Describe in general terms what is going in these two different processes and why each process is important. In the first oxidative part of the pathway glucose 6-phosphate is oxidatively decarboxylated to Ribose 5-phosphate a 5 carbon sugar. In this process 2 NADPH’s are generated the can be used in synthetic pathways. If this pathwau produces too many Ribose sugars, in the second part of the pathway six of the 5-carbon sugars are converted into five 6-carbon sugars . -3- 10. In Chapters 14 and 15 I have often shortened chemical and enzyme names to a simple three or four character code. Decode the following: (1 point each - bonus point if you get all 11 right) Example: ATP - Adenosine triphosphate Proteins Chemicals PFK-1 F26BP Phosphofructokinase-1 Fructose 2,6-bisphosphate FBPase-2 PEP Fructose bisphosphatase Phosphoenolpyruvate GLUT4 AMP Glucose Transporter-4 Adenosine monophosphate LDH NADH Lactate dehydrogenase Nicotinamide adenine dinucleotide G6P Glucose 6-phosphate DHAP Dihydroxyacettone phosphate G3P Glyceraldehyde 3-phosphate 11. Under different conditions (aerobic or anaerobic) different organisms do different things with pyruvate and the end of glycolysis. Describe the different things organisms do with pyruvate and why each of these different fate is advantageous to the organism. Aerobic organism under aerobic conditions Pyruvate enter the mitochondria and is completely oxidized to CO2 This pathway delivers the maximum energy to the organism Aerobic organism under anaerobic conditions Pyruvate is reduced to Lactictic acid This pathway is used when the TCA cycle in the miitochondria is shut down due to lack of oxygen. Under these circumstances the NADH produced during the oxidation of glyceraldehyde 3-phosphate must be changed back into NAD+ otherwise the glycolytic pathway shuts down due to lack of NAD+ and the organism has no energy sources. The lactic acid produced here can be changed back to pyruvate for further oxidate or the pyruvate can be changed back into glucose via gluconeogenesis. Anaerobic organisms Pyruvate is converted first to acetaldehyde and then to ethanol. Because the conversion of acetaldehyde to ethanol uses NADH, this is an alternate pathway to regenerate the NAD+ needed in the glycolytic pathway. Unlike lactic acid the final product of ethanol cannot be changed back to glucose via gluconeogenesis. -4- 12. Describe the controls used to regulate the conversion of glucose to glucose 6- phosphate in glycolysis and glucose 6-phosphate to glucose in gluconeogenesis. This set of enzymes, hexokinase on the ‘forward’ direction and glucose-6-phosphatase in the ‘reverse’ direction is under fairly simple control. In the ‘backward’ direction the phosphatase is only found in specific liver, kidney, and intestinal cells, where the glucose created in this reaction can be delivered to other cells by the bloodstream. This also prevents other cells that can use Glucose 6- phosphate more readily than glucose from setting up a futile cycle between the hexokinase and the phosphatase. In the ‘forward’ direction there are different tissue specific controls. Muscle cells have primarily Hexokinase I and II. In these cells the kinase is fully active at glucose concentrations just slightly above .2 mM, since the normal fasting level of glucose in the blood it 5 mM, this forward reaction is completely turned on in muscle. Hexokinase I & II are also allosterically inhibited by the product of this reaction, glucose 6-phosphate, so this reaction is slowed if the glycolytic pathway is not being used so G 6-P builds up. The liver isozyme (Hexokinase IV or glucokinase) behaves differently. This isozyme is only fractionally turned on at the fasting blood sugar level of 5 mM, and is not inhibited by G 6-P so glucose levels can build up in the liver, and this glucose can leave the liver cell, and enter the bloodstream to get transported to other cells. The liver hexokinase has an additional control in that there is a regulatory protein that binds to the hexokinase and moves it to the nucleus. This protein is activated to transport the hexokinase out of the cytosol when the levels of Fructose 6-phosphate rise (indicating the glycolytic pathway is being shut down) and the protein releases the hexokinase back into the cytosol when glucose is preset. Both the kinase and the phosphatase are subject to additional transcriptions control that were not discussed in class. 13. The Pyruvate dehydrogenase complex requires five non-protein coenzymes or cofactors to function. Name these five coenzymes, and describe briefly what chemistry they do.
Load more

Recommended publications
  • Effects of Glucagon, Glycerol, and Glucagon Plus Glycerol On
    Iowa State University Capstones, Theses and Graduate Theses and Dissertations Dissertations 2011 Effects of glucagon, glycerol, and glucagon plus glycerol on gluconeogenesis, lipogenesis, and lipolysis in periparturient Holstein cows Nimer Mehyar Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/etd Part of the Biochemistry, Biophysics, and Structural Biology Commons Recommended Citation Mehyar, Nimer, "Effects of glucagon, glycerol, and glucagon plus glycerol on gluconeogenesis, lipogenesis, and lipolysis in periparturient Holstein cows" (2011). Graduate Theses and Dissertations. 11923. https://lib.dr.iastate.edu/etd/11923 This Thesis is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Effects of glucagon, glycerol, and glucagon plus glycerol on gluconeogenesis, lipogenesis, and lipolysis in periparturient Holstein cows by Nimer Mehyar A thesis submitted to graduate faculty in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE Major: Biochemistry Program of Study Committee: Donald C. Beitz, Major Professor Ted W. Huiatt Kenneth J. Koehler Iowa State University Ames, Iowa 2011 Copyright Nimer Mehyar, 2011. All rights reserved ii To My Mother To Ghada Ali, Sarah, and Hassan
    [Show full text]
  • Indications for a Central Role of Hexokinase Activity in Natural Variation of Heat Acclimation in Arabidopsis Thaliana
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 14 June 2020 doi:10.20944/preprints202006.0169.v1 Article Indications for a central role of hexokinase activity in natural variation of heat acclimation in Arabidopsis thaliana Vasil Atanasov §, Lisa Fürtauer § and Thomas Nägele * LMU Munich, Plant Evolutionary Cell Biology, Großhaderner Str. 2-4, 82152 Planegg, Germany § Authors contributed equally * Correspondence: [email protected] Abstract: Diurnal and seasonal changes of abiotic environmental factors shape plant performance and distribution. Changes of growth temperature and light intensity may vary significantly on a diurnal, but also on a weekly or seasonal scale. Hence, acclimation to a changing temperature and light regime is essential for plant survival and propagation. In the present study, we analyzed photosynthetic CO2 assimilation and metabolic regulation of the central carbohydrate metabolism in two natural accessions of Arabidopsis thaliana originating from Russia and south Italy during exposure to heat and a combination of heat and high light. Our findings indicate that it is hardly possible to predict photosynthetic capacities to fix CO2 under combined stress from single stress experiments. Further, capacities of hexose phosphorylation were found to be significantly lower in the Italian than in the Russian accession which could explain an inverted sucrose-to-hexose ratio. Together with the finding of significantly stronger accumulation of anthocyanins under heat/high light these observations indicate a central role of hexokinase activity in stabilization of photosynthetic capacities within a changing environment. Keywords: photosynthesis; carbohydrate metabolism; hexokinase; heat acclimation; environmental changes; natural variation; high light; combined stress. 1. Introduction Changes of growth temperature and light intensity broadly affect plant molecular, physiological and developmental processes.
    [Show full text]
  • • Glycolysis • Gluconeogenesis • Glycogen Synthesis
    Carbohydrate Metabolism! Wichit Suthammarak – Department of Biochemistry, Faculty of Medicine Siriraj Hospital – Aug 1st and 4th, 2014! • Glycolysis • Gluconeogenesis • Glycogen synthesis • Glycogenolysis • Pentose phosphate pathway • Metabolism of other hexoses Carbohydrate Digestion! Digestive enzymes! Polysaccharides/complex carbohydrates Salivary glands Amylase Pancreas Oligosaccharides/dextrins Dextrinase Membrane-bound Microvilli Brush border Maltose Sucrose Lactose Maltase Sucrase Lactase ‘Disaccharidase’ 2 glucose 1 glucose 1 glucose 1 fructose 1 galactose Lactose Intolerance! Cause & Pathophysiology! Normal lactose digestion Lactose intolerance Lactose Lactose Lactose Glucose Small Intestine Lactase lactase X Galactose Bacteria 1 glucose Large Fermentation 1 galactose Intestine gases, organic acid, Normal stools osmotically Lactase deficiency! active molecules • Primary lactase deficiency: อาการ! genetic defect, การสราง lactase ลด ลงเมออายมากขน, พบมากทสด! ปวดทอง, ถายเหลว, คลนไสอาเจยนภาย • Secondary lactase deficiency: หลงจากรบประทานอาหารทม lactose acquired/transient เชน small bowel เปนปรมาณมาก เชนนม! injury, gastroenteritis, inflammatory bowel disease! Absorption of Hexoses! Site: duodenum! Intestinal lumen Enterocytes Membrane Transporter! Blood SGLT1: sodium-glucose transporter Na+" Na+" •! Presents at the apical membrane ! of enterocytes! SGLT1 Glucose" Glucose" •! Co-transports Na+ and glucose/! Galactose" Galactose" galactose! GLUT2 Fructose" Fructose" GLUT5 GLUT5 •! Transports fructose from the ! intestinal lumen into enterocytes!
    [Show full text]
  • Energy Metabolism: Gluconeogenesis and Oxidative Phosphorylation
    International Journal for Innovation Education and Research www.ijier.net Vol:-8 No-09, 2020 Energy metabolism: gluconeogenesis and oxidative phosphorylation Luis Henrique Almeida Castro ([email protected]) PhD in the Health Sciences Graduate Program, Federal University of Grande Dourados Dourados, Mato Grosso do Sul – Brazil. Leandro Rachel Arguello Dom Bosco Catholic University Campo Grande, Mato Grosso do Sul – Brazil. Nelson Thiago Andrade Ferreira Motion Science Graduate Program, Federal University of Mato Grosso do Sul Campo Grande, Mato Grosso do Sul – Brazil. Geanlucas Mendes Monteiro Heath and Development in West Central Region Graduate Program, Federal University of Mato Grosso do Sul Campo Grande, Mato Grosso do Sul – Brazil. Jessica Alves Ribeiro Federal University of Mato Grosso do Sul Campo Grande, Mato Grosso do Sul – Brazil. Juliana Vicente de Souza Motion Science Graduate Program, Federal University of Mato Grosso do Sul Campo Grande, Mato Grosso do Sul – Brazil. Sarita Baltuilhe dos Santos Motion Science Graduate Program, Federal University of Mato Grosso do Sul Campo Grande, Mato Grosso do Sul – Brazil. Fernanda Viana de Carvalho Moreto MSc., Nutrition, Food and Health Graduate Program, Federal University of Grande Dourados Dourados, Mato Grosso do Sul – Brazil. Ygor Thiago Cerqueira de Paula Motion Science Graduate Program, Federal University of Mato Grosso do Sul Campo Grande, Mato Grosso do Sul – Brazil. International Educative Research Foundation and Publisher © 2020 pg. 359 International Journal for Innovation Education and Research ISSN 2411-2933 September 2020 Vanessa de Souza Ferraz Motion Science Graduate Program, Federal University of Mato Grosso do Sul Campo Grande, Mato Grosso do Sul – Brazil. Tayla Borges Lino Motion Science Graduate Program, Federal University of Mato Grosso do Sul Campo Grande, Mato Grosso do Sul – Brazil.
    [Show full text]
  • Eradication of ENO1-Deleted Glioblastoma Through Collateral Lethality
    bioRxiv preprint doi: https://doi.org/10.1101/331538; this version posted May 25, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Eradication of ENO1-deleted Glioblastoma through Collateral Lethality Yu-Hsi Lin1, Nikunj Satani1,2, Naima Hammoudi1, Jeffrey J. Ackroyd1, Sunada Khadka1, Victoria C. Yan1, Dimitra K. Georgiou1, Yuting Sun3, Rafal Zielinski4, Theresa Tran1, Susana Castro Pando1, Xiaobo Wang1, David Maxwell5, Zhenghong Peng6, Federica Pisaneschi1, Pijus Mandal7, Paul G. Leonard8, Quanyu Xu,9 Qi Wu9, Yongying Jiang9, Barbara Czako10, Zhijun Kang10, John M. Asara11, Waldemar Priebe4, William Bornmann12, Joseph R. Marszalek3, Ronald A. DePinho13 and Florian L. Muller#1 1) Department of Cancer Systems Imaging, The University of Texas MD Anderson Cancer Center, Houston, TX 77054 2) Institute of Stroke and Cerebrovascular Disease, The University of Texas Health Science Center at Houston, TX 77030 3) Center for Co-Clinical Trials, The University of Texas MD Anderson Cancer Center, Houston, TX 77054 4) Department of Experimental Therapeutics, The University of Texas MD Anderson Cancer Center, Houston, TX 77054 5) Institutional Analytics & Informatics, The University of Texas MD Anderson Cancer Center, Houston, TX 77030 6) Cardtronics, Inc., Houston, TX 77042 7) Department of Genomic Medicine, The University of Texas MD Anderson Cancer Center, Houston, TX 77054 bioRxiv preprint doi: https://doi.org/10.1101/331538; this version posted May 25, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
    [Show full text]
  • Labeled in Thecourse of Glycolysis, Since Phosphoglycerate Kinase
    THE STATE OF MAGNESIUM IN CELLS AS ESTIMATED FROM THE ADENYLATE KINASE EQUILIBRIUM* BY TRWIN A. RoSE THE INSTITUTE FOR CANCER RESEARCH, PHILADELPHIA Communicated by Thomas F. Anderson, August 30, 1968 Magnesium functions in many enzymatic reactions as a cofactor and in com- plex with nucleotides acting as substrates. Numerous examples of a possible regulatory role of Mg can be cited from studies with isolated enzymes,'- and it is known that Mg affects the structural integrity of macromolecules such as trans- fer RNA" and functional elements such as ribosomes.'0 The major problem in translating this information on isolated preparations to the functioning cell is the difficulty in determining the distribution of Mg and the nucleotides among the free and complexed forms that function in the region of the cell for which this information is desired. Nanningall based an attempt to calculate the free Mg2+ and Ca2+ ion concentrations of frog muscle on the total content of these metals and of the principal known ligands (adenosine 5'-triphosphate (ATP), creatine-P, and myosin) and the dissociation constants of the complexes. However, this method suffers from the necessity of evaluating the contribution of all ligands as well as from the assumption that all the known ligands are contributing their full complexing capacity. During studies concerned with the control of glycolysis in red cells and the control of the phosphoglycerate kinase step in particular, it became important to determine the fractions of the cell's ATP and adenosine 5'-diphosphate (ADP) that were present as Mg complexes. Just as the problem of determining the distribution of protonated and dissociated forms of an acid can be solved from a knowledge of pH and pKa of the acid, so it would be possible to determine the liganded and free forms of all rapidly established Mg complexes from a knowledge of Mg2+ ion concentration and the appropriate dissociation constants.
    [Show full text]
  • Fructose-Induced Increases in Expression of Intestinal Fructolytic and Gluconeogenic Genes Are Regulated by GLUT5 and KHK
    Fructose-induced increases in expression of intestinal fructolytic and gluconeogenic genes are regulated by GLUT5 and KHK. Chirag Patel, Véronique Douard, Shiyan Yu, Phuntila Tharabenjasin, Nan Gao, Ronaldo P Ferraris To cite this version: Chirag Patel, Véronique Douard, Shiyan Yu, Phuntila Tharabenjasin, Nan Gao, et al.. Fructose- induced increases in expression of intestinal fructolytic and gluconeogenic genes are regulated by GLUT5 and KHK.. AJP - Regulatory, Integrative and Comparative Physiology, American Physio- logical Society, 2015, 309 (5), pp.R499-509. 10.1152/ajpregu.00128.2015. hal-01607831 HAL Id: hal-01607831 https://hal.archives-ouvertes.fr/hal-01607831 Submitted on 28 May 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Copyright Am J Physiol Regul Integr Comp Physiol 309: R499–R509, 2015. First published June 17, 2015; doi:10.1152/ajpregu.00128.2015. Fructose-induced increases in expression of intestinal fructolytic and gluconeogenic genes are regulated by GLUT5 and KHK Chirag Patel,1 Veronique Douard,1 Shiyan Yu,2 Phuntila Tharabenjasin,1 Nan Gao,2 and Ronaldo P. Ferraris1 1Department of Pharmacology and Physiology, New Jersey Medical School, Rutgers University, Newark, New Jersey; and 2Department of Biological Sciences, School of Arts and Sciences, Rutgers University, Newark, New Jersey Submitted 30 March 2015; accepted in final form 16 June 2015 Patel C, Douard V, Yu S, Tharabenjasin P, Gao N, Ferraris blood fructose is directly dependent on intestinal processing of RP.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Yeast As a Tool to Understand the Significance of Human Disease
    G C A T T A C G G C A T genes Review Yeast as a Tool to Understand the Significance of Human Disease-Associated Gene Variants Tiziana Cervelli and Alvaro Galli * Yeast Genetics and Genomics Group, Laboratory of Functional Genetics and Genomics, Institute of Clinical Physiology CNR, Via Moruzzi 1, 56125 Pisa, Italy; [email protected] * Correspondence: [email protected] Abstract: At present, the great challenge in human genetics is to provide significance to the growing amount of human disease-associated gene variants identified by next generation DNA sequencing technologies. Increasing evidences suggest that model organisms are of pivotal importance to addressing this issue. Due to its genetic tractability, the yeast Saccharomyces cerevisiae represents a valuable model organism for understanding human genetic variability. In the present review, we show how S. cerevisiae has been used to study variants of genes involved in different diseases and in different pathways, highlighting the versatility of this model organism. Keywords: yeast; Saccharomyces cerevisiae; functional assays; Mendelian disease; cancer; human gene variants 1. Introduction The advent of next generation DNA sequences technologies allows us to identify Citation: Cervelli, T.; Galli, A. Yeast individual genetic variants, and this revolutionized the strategy for discovering the cause as a Tool to Understand the of several genetic and multifactorial diseases. The association between genetic variants Significance of Human and disease risk can potentially overturn our understanding of common disease. The Disease-Associated Gene Variants. discovery of pathways and processes that are causally involved in a disease, so far not Genes 2021, 12, 1303. https:// linked, may open the way towards the development of targeted therapies and prevention doi.org/10.3390/genes12091303 strategies.
    [Show full text]
  • Structures, Functions, and Mechanisms of Filament Forming Enzymes: a Renaissance of Enzyme Filamentation
    Structures, Functions, and Mechanisms of Filament Forming Enzymes: A Renaissance of Enzyme Filamentation A Review By Chad K. Park & Nancy C. Horton Department of Molecular and Cellular Biology University of Arizona Tucson, AZ 85721 N. C. Horton ([email protected], ORCID: 0000-0003-2710-8284) C. K. Park ([email protected], ORCID: 0000-0003-1089-9091) Keywords: Enzyme, Regulation, DNA binding, Nuclease, Run-On Oligomerization, self-association 1 Abstract Filament formation by non-cytoskeletal enzymes has been known for decades, yet only relatively recently has its wide-spread role in enzyme regulation and biology come to be appreciated. This comprehensive review summarizes what is known for each enzyme confirmed to form filamentous structures in vitro, and for the many that are known only to form large self-assemblies within cells. For some enzymes, studies describing both the in vitro filamentous structures and cellular self-assembly formation are also known and described. Special attention is paid to the detailed structures of each type of enzyme filament, as well as the roles the structures play in enzyme regulation and in biology. Where it is known or hypothesized, the advantages conferred by enzyme filamentation are reviewed. Finally, the similarities, differences, and comparison to the SgrAI system are also highlighted. 2 Contents INTRODUCTION…………………………………………………………..4 STRUCTURALLY CHARACTERIZED ENZYME FILAMENTS…….5 Acetyl CoA Carboxylase (ACC)……………………………………………………………………5 Phosphofructokinase (PFK)……………………………………………………………………….6
    [Show full text]
  • Annotation of Glycolysis and Gluconeogenesis Pathways
    A metabolic insight into the Asian citrus psyllid: Annotation of glycolysis and gluconeogenesis pathways Blessy Tamayo, Kyle Kercher, Tom D’Elia, Helen Wiersma-Koch, Surya Saha, Teresa Shippy, Susan J. Brown, and Prashant Hosmani Introduction Glycolysis, as in other animals, is the major metabolic pathway that insects use to extract energy from carbohydrates [1]. This process consists of ten reactions that convert one molecule of glucose into two molecules of pyruvate within the cytosol, generating a net gain of two molecules of ATP. Simple carbohydrates are acquired through the insect diet and processed through glycolysis and the central carbohydrate metabolic steps. Comparative genomic analysis of Apis mellifera, Drosophila melanogaster, and Anopheles gambiae has revealed the presence of genes for metabolic pathways that support dietary habits dependent on sugar-rich substrates ([2]; [3]; [4]; [5]). In addition to processing sugars for energy, glycolysis also serves as a central pathway that serves as both a source of important precursors and destination for key intermediates from many metabolic pathways. Gluconeogenesis is the process through which glucose is synthesized from non- carbohydrate substrates, and is closely associated with glycolysis. Eleven enzymatic reactions occur during gluconeogenesis. Eight of the enzymes involved in the steps also catalyze the reverse reactions in glycolysis and the three remaining enzymes are specific to gluconeogenesis. 1 Gluconeogenesis generated carbohydrates are required as substrate for anaerobic glycolysis, synthesis of chitin, glycoproteins, polyols and glycoside detoxication products [1]. Gluconeogenesis is essential in insects to maintain sugar homeostasis and serves as the initial process towards the generation of glucose disaccharide trehalose, which is the main circulating sugar in the insect hemolymph ([6]; [7]).
    [Show full text]
  • The Microbiota-Produced N-Formyl Peptide Fmlf Promotes Obesity-Induced Glucose
    Page 1 of 230 Diabetes Title: The microbiota-produced N-formyl peptide fMLF promotes obesity-induced glucose intolerance Joshua Wollam1, Matthew Riopel1, Yong-Jiang Xu1,2, Andrew M. F. Johnson1, Jachelle M. Ofrecio1, Wei Ying1, Dalila El Ouarrat1, Luisa S. Chan3, Andrew W. Han3, Nadir A. Mahmood3, Caitlin N. Ryan3, Yun Sok Lee1, Jeramie D. Watrous1,2, Mahendra D. Chordia4, Dongfeng Pan4, Mohit Jain1,2, Jerrold M. Olefsky1 * Affiliations: 1 Division of Endocrinology & Metabolism, Department of Medicine, University of California, San Diego, La Jolla, California, USA. 2 Department of Pharmacology, University of California, San Diego, La Jolla, California, USA. 3 Second Genome, Inc., South San Francisco, California, USA. 4 Department of Radiology and Medical Imaging, University of Virginia, Charlottesville, VA, USA. * Correspondence to: 858-534-2230, [email protected] Word Count: 4749 Figures: 6 Supplemental Figures: 11 Supplemental Tables: 5 1 Diabetes Publish Ahead of Print, published online April 22, 2019 Diabetes Page 2 of 230 ABSTRACT The composition of the gastrointestinal (GI) microbiota and associated metabolites changes dramatically with diet and the development of obesity. Although many correlations have been described, specific mechanistic links between these changes and glucose homeostasis remain to be defined. Here we show that blood and intestinal levels of the microbiota-produced N-formyl peptide, formyl-methionyl-leucyl-phenylalanine (fMLF), are elevated in high fat diet (HFD)- induced obese mice. Genetic or pharmacological inhibition of the N-formyl peptide receptor Fpr1 leads to increased insulin levels and improved glucose tolerance, dependent upon glucagon- like peptide-1 (GLP-1). Obese Fpr1-knockout (Fpr1-KO) mice also display an altered microbiome, exemplifying the dynamic relationship between host metabolism and microbiota.
    [Show full text]