Labeled in Thecourse of Glycolysis, Since Phosphoglycerate Kinase
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
METACYC ID Description A0AR23 GO:0004842 (Ubiquitin-Protein Ligase
Electronic Supplementary Material (ESI) for Integrative Biology This journal is © The Royal Society of Chemistry 2012 Heat Stress Responsive Zostera marina Genes, Southern Population (α=0. -
In the Field of Clinical Examination, the Measurement of Creatine
J. Clin. Biochem. Nutr., 3, 17-25, 1987 Bacterial Glucokinase as an Enzymic Reagent of Good Stability for Measurement of Creatine Kinase Activity Hitoshi KONDO, * Takanari SHIRAISHI, Masao KAGEYAMA, Kazuhiko NAGATA, and Kosuke TOMITA Research and Development Center, UNITIKA Ltd., Uji 611, Japan (Received January 10, 1987) Summary An enzymic reagent, that has long-term stability even in the liquid state, was successfully employed for the measurement of serum creatine kinase (CK, EC 2.7.3.2) activity. The enzyme used was the thermostable glucokinase (GlcK, EC 2.7.1.2) obtained from the thermo- phile Bacillus stearothermophilus. The reagent was found to be stable in solution for about one month at 6•Ž and for about one week at 30•Ž. This substitution of glucokinase for the hexokinase of the most commonly used hexokinase-glucose-6-phosphate dehydrogenase (HK-G6PDH) method results in a remarkable improvement of the method. The CK activity measured by the GlcK-G6PDH method was linear up to about 2,000 U/ liter at 37•Ž. The GlcK-G6PDH method was found to give a satisfactory precision and reproducibility (coefficient of variation less than 2.17%). Over a wide range of CK activity, an excellent agreement was obtained between the GlcK-G6PDH and the HK-G6PDH methods. Furthermore several coexistents and anticoagulants were found to have little effect on the measured value of CK activity by the GlcK-G6PDH method. Key Words: creatine kinase activity, glucokinase, improved stability of reagent, creatine kinase determination, thermostable enzyme In the field of clinical examination, the measurement of creatine kinase (CK, ATP : creatine phosphotransferase, EC 2.7.3.2) activity in serum is one of the important examinations usually employed for diagnosis of cardiac diseases such as myocardial infarction or muscular diseases such as progressive muscular dystrophy. -
Indications for a Central Role of Hexokinase Activity in Natural Variation of Heat Acclimation in Arabidopsis Thaliana
Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 14 June 2020 doi:10.20944/preprints202006.0169.v1 Article Indications for a central role of hexokinase activity in natural variation of heat acclimation in Arabidopsis thaliana Vasil Atanasov §, Lisa Fürtauer § and Thomas Nägele * LMU Munich, Plant Evolutionary Cell Biology, Großhaderner Str. 2-4, 82152 Planegg, Germany § Authors contributed equally * Correspondence: [email protected] Abstract: Diurnal and seasonal changes of abiotic environmental factors shape plant performance and distribution. Changes of growth temperature and light intensity may vary significantly on a diurnal, but also on a weekly or seasonal scale. Hence, acclimation to a changing temperature and light regime is essential for plant survival and propagation. In the present study, we analyzed photosynthetic CO2 assimilation and metabolic regulation of the central carbohydrate metabolism in two natural accessions of Arabidopsis thaliana originating from Russia and south Italy during exposure to heat and a combination of heat and high light. Our findings indicate that it is hardly possible to predict photosynthetic capacities to fix CO2 under combined stress from single stress experiments. Further, capacities of hexose phosphorylation were found to be significantly lower in the Italian than in the Russian accession which could explain an inverted sucrose-to-hexose ratio. Together with the finding of significantly stronger accumulation of anthocyanins under heat/high light these observations indicate a central role of hexokinase activity in stabilization of photosynthetic capacities within a changing environment. Keywords: photosynthesis; carbohydrate metabolism; hexokinase; heat acclimation; environmental changes; natural variation; high light; combined stress. 1. Introduction Changes of growth temperature and light intensity broadly affect plant molecular, physiological and developmental processes. -
The Characterization of Human Adenylate Kinases 7 and 8
The characterization of human adenylate kinases 7 and 8 demonstrates differences in kinetic parameters and structural organization among the family of adenylate kinase isoenzymes Christakis Panayiotou, Nicola Solaroli, Yunjian Xu, Magnus Johansson, Anna Karlsson To cite this version: Christakis Panayiotou, Nicola Solaroli, Yunjian Xu, Magnus Johansson, Anna Karlsson. The char- acterization of human adenylate kinases 7 and 8 demonstrates differences in kinetic parameters and structural organization among the family of adenylate kinase isoenzymes. Biochemical Journal, Port- land Press, 2011, 433 (3), pp.527-534. 10.1042/BJ20101443. hal-00558097 HAL Id: hal-00558097 https://hal.archives-ouvertes.fr/hal-00558097 Submitted on 21 Jan 2011 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Biochemical Journal Immediate Publication. Published on 16 Nov 2010 as manuscript BJ20101443 The characterization of human adenylate kinases 7 and 8 demonstrates differences in kinetic parameters and structural organization among the family of adenylate kinase isoenzymes -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
Structures, Functions, and Mechanisms of Filament Forming Enzymes: a Renaissance of Enzyme Filamentation
Structures, Functions, and Mechanisms of Filament Forming Enzymes: A Renaissance of Enzyme Filamentation A Review By Chad K. Park & Nancy C. Horton Department of Molecular and Cellular Biology University of Arizona Tucson, AZ 85721 N. C. Horton ([email protected], ORCID: 0000-0003-2710-8284) C. K. Park ([email protected], ORCID: 0000-0003-1089-9091) Keywords: Enzyme, Regulation, DNA binding, Nuclease, Run-On Oligomerization, self-association 1 Abstract Filament formation by non-cytoskeletal enzymes has been known for decades, yet only relatively recently has its wide-spread role in enzyme regulation and biology come to be appreciated. This comprehensive review summarizes what is known for each enzyme confirmed to form filamentous structures in vitro, and for the many that are known only to form large self-assemblies within cells. For some enzymes, studies describing both the in vitro filamentous structures and cellular self-assembly formation are also known and described. Special attention is paid to the detailed structures of each type of enzyme filament, as well as the roles the structures play in enzyme regulation and in biology. Where it is known or hypothesized, the advantages conferred by enzyme filamentation are reviewed. Finally, the similarities, differences, and comparison to the SgrAI system are also highlighted. 2 Contents INTRODUCTION…………………………………………………………..4 STRUCTURALLY CHARACTERIZED ENZYME FILAMENTS…….5 Acetyl CoA Carboxylase (ACC)……………………………………………………………………5 Phosphofructokinase (PFK)……………………………………………………………………….6 -
Regulation of Adenylate Kinase and Creatine Kinase Activities In
Proc. Nat. Acad. Sci. USA Vol. 71, No. 6, pp. 2377-2381, June 1974 Regulation of Adenylate Kinase and Creatine Kinase Activities in Myogenic Cells (myogenesis/enzyme regulation) HELGI TARIKAS AND DAVID SCHUBERT Neurobiology Department, The Salk Institute, P. 0. Box 1809, San Diego, Califdr.nia 92112 Communicated by F. Jacob, March 8, 1974 ABSTRACT The regulation of the specific activities of not fuse in either situation. M3A shows a hyperpolarizing adenylate kinase (EC 2.7.4.3) and creatine kinase (EC response to iontophoretically applied acetylcholine compa- 2.7.3.2) in myogenic cell lines is independent of cell fusion. The observed increases in enzyme specific activities are cell rable to that observed in L6 myoblasts (A. J. Harris, personal density dependent, and may be further broken down into communication). The creatine kinase isozymes (8) of L6 and contributions from an increase in enzyme activity per cell M3A are indistinguishable. All cells were cultured in modified and a decrease in protein per cell. Only the former appears Eagle's medium (9) containing 10% fetal-calf serum at 360. to be affected by medium conditioning. Falcon plastic tissue culture or petri dishes were used as There is an increase in the specific activities (enzyme activity indicated. Cell number determinations and assays for creatine per unit of total cellular protein) of adenylate kinase (EC kinase and adenylate kinase were done as described (10). 2.7.4.3; ATP:AMP phosphotransferase) and creatine kinase Cells were dissociated for cell number determinations and (EC 2.7.3.2; ATP: creatine N-phosphotransferase) temporally replating with 0.25% (w/v) Viokase (Gibco). -
Review Galactokinase: Structure, Function and Role in Type II
CMLS, Cell. Mol. Life Sci. 61 (2004) 2471–2484 1420-682X/04/202471-14 DOI 10.1007/s00018-004-4160-6 CMLS Cellular and Molecular Life Sciences © Birkhäuser Verlag, Basel, 2004 Review Galactokinase: structure, function and role in type II galactosemia H. M. Holden a,*, J. B. Thoden a, D. J. Timson b and R. J. Reece c,* a Department of Biochemistry, University of Wisconsin, Madison, Wisconsin 53706 (USA), Fax: +1 608 262 1319, e-mail: [email protected] b School of Biology and Biochemistry, Queen’s University Belfast, Medical Biology Centre, 97 Lisburn Road, Belfast BT9 7BL, (United Kingdom) c School of Biological Sciences, The University of Manchester, The Michael Smith Building, Oxford Road, Manchester M13 9PT, (United Kingdom), Fax: +44 161 275 5317, e-mail: [email protected] Received 13 April 2004; accepted 7 June 2004 Abstract. The conversion of beta-D-galactose to glucose unnatural sugar 1-phosphates. Additionally, galactoki- 1-phosphate is accomplished by the action of four en- nase-like molecules have been shown to act as sensors for zymes that constitute the Leloir pathway. Galactokinase the intracellular concentration of galactose and, under catalyzes the second step in this pathway, namely the con- suitable conditions, to function as transcriptional regula- version of alpha-D-galactose to galactose 1-phosphate. tors. This review focuses on the recent X-ray crystallo- The enzyme has attracted significant research attention graphic analyses of galactokinase and places the molecu- because of its important metabolic role, the fact that de- lar architecture of this protein in context with the exten- fects in the human enzyme can result in the diseased state sive biochemical data that have accumulated over the last referred to as galactosemia, and most recently for its uti- 40 years regarding this fascinating small molecule ki- lization via ‘directed evolution’ to create new natural and nase. -
Supplementary Informations SI2. Supplementary Table 1
Supplementary Informations SI2. Supplementary Table 1. M9, soil, and rhizosphere media composition. LB in Compound Name Exchange Reaction LB in soil LBin M9 rhizosphere H2O EX_cpd00001_e0 -15 -15 -10 O2 EX_cpd00007_e0 -15 -15 -10 Phosphate EX_cpd00009_e0 -15 -15 -10 CO2 EX_cpd00011_e0 -15 -15 0 Ammonia EX_cpd00013_e0 -7.5 -7.5 -10 L-glutamate EX_cpd00023_e0 0 -0.0283302 0 D-glucose EX_cpd00027_e0 -0.61972444 -0.04098397 0 Mn2 EX_cpd00030_e0 -15 -15 -10 Glycine EX_cpd00033_e0 -0.0068175 -0.00693094 0 Zn2 EX_cpd00034_e0 -15 -15 -10 L-alanine EX_cpd00035_e0 -0.02780553 -0.00823049 0 Succinate EX_cpd00036_e0 -0.0056245 -0.12240603 0 L-lysine EX_cpd00039_e0 0 -10 0 L-aspartate EX_cpd00041_e0 0 -0.03205557 0 Sulfate EX_cpd00048_e0 -15 -15 -10 L-arginine EX_cpd00051_e0 -0.0068175 -0.00948672 0 L-serine EX_cpd00054_e0 0 -0.01004986 0 Cu2+ EX_cpd00058_e0 -15 -15 -10 Ca2+ EX_cpd00063_e0 -15 -100 -10 L-ornithine EX_cpd00064_e0 -0.0068175 -0.00831712 0 H+ EX_cpd00067_e0 -15 -15 -10 L-tyrosine EX_cpd00069_e0 -0.0068175 -0.00233919 0 Sucrose EX_cpd00076_e0 0 -0.02049199 0 L-cysteine EX_cpd00084_e0 -0.0068175 0 0 Cl- EX_cpd00099_e0 -15 -15 -10 Glycerol EX_cpd00100_e0 0 0 -10 Biotin EX_cpd00104_e0 -15 -15 0 D-ribose EX_cpd00105_e0 -0.01862144 0 0 L-leucine EX_cpd00107_e0 -0.03596182 -0.00303228 0 D-galactose EX_cpd00108_e0 -0.25290619 -0.18317325 0 L-histidine EX_cpd00119_e0 -0.0068175 -0.00506825 0 L-proline EX_cpd00129_e0 -0.01102953 0 0 L-malate EX_cpd00130_e0 -0.03649016 -0.79413596 0 D-mannose EX_cpd00138_e0 -0.2540567 -0.05436649 0 Co2 EX_cpd00149_e0 -
Hemolytic Anemia with Impaired Hexokinase Activity
Hemolytic anemia with impaired hexokinase activity Alan S. Keitt J Clin Invest. 1969;48(11):1997-2007. https://doi.org/10.1172/JCI106165. Research Article Analyses of key glycolytic intermediates in freshly drawn red cells from six related individuals suggest that decreased hexokinase activity underlies the hemolytic process in the two members with overt hemolysis. Low red cell glucose 6- phosphate (G6P) was observed not only in the anemic patients but in the presumptive heterozygotes as well and served as a useful marker for the presence of the trait. Hexokinase activity was labile in distilled water hemolysates but was only slightly low when protected by glucose, mercaptoethanol, and ethylenediaminetetraacetate (EDTA). Normal red cell hexokinase was demonstrated to be dependent on glucose for maintenance of activity after heating to 45°C. The cells of the proposita are unable to utilize glucose efficiently at glucose concentrations lower than 0.2 mmole/liter whereas normal cells maintain linear glucose consumption to at least 0.05 mM glucose. These qualitative abnormalities could result from the presence of a mutant hexokinase with an abnormally reactive sulfhydryl group and altered substrate affinity in the red cells of this kindred. Find the latest version: https://jci.me/106165/pdf Hemolytic Anemia with Impaired Hexokinase Activity ALAN S. KErrr From the Department of Medicine, University of Florida College of Medicine, Gainesville, Florida 32601 A B S T R A C T Analyses of key glycolytic intermediates cells of a young girl with moderately severe chronic in freshly drawn red cells from six related individuals anemia. Although hexokinase activity was only slightly suggest that decreased hexokinase activity underlies the below the range of normal, a comparison between the hemolytic process in the two members with overt he- activity of red cell hexokinase in the affected proposita molysis. -
A Review of Isozymes in Cancer1
Cancer Research VOLUME31 NOVEMBER 1971 NUMBER11 [CANCER RESEARCH 31, 1523-1542, November 1971] A Review of Isozymes in Cancer1 Wayne E. Criss Department of Obstetrics and Gynecology, University of Florida College of Medicine, Gainesville, Florida 32601 TABLE OF CONTENTS postulated role for that particular isozymic system in cellular metabolism. Summary 1523 Introduction 1523 Normal enzyme differentiation 1523 INTRODUCTION Tumor enzyme differentiation 1524 Isozymes 1524 Normal Enzyme Differentiation DNA polymerase 1524 Enzyme differentiation is the process whereby, during the Hexokinase 1525 Fructose 1,6-diphosphatase 1525 development of an organ in an animal, the organ acquires the quantitative and qualitative adult enzyme patterns (122). Key Aldolase 1526 pathway enzymes in several metabolic processes have been Pyruvate kinase 1527 found to undergo enzymatic differentiation. The enzymes Láclatedehydrogenase 1527 Isocitrate dehydrogenase 1527 involved in nitrogen metabolism, and also in urea cycle Malate dehydrogenase 1528 metabolism (180), are tyrosine aminotransferase (123, 151, Glycerol phosphate dehydrogenase 1529 330, 410), tryptophan pyrrolase (261), serine dehydratase Glutaminase 1529 (123, 410), histidine ammonia lyase (11), and aspartate Aspartate aminotransferase 1530 aminotransferase (337, 388). The enzymes involved in nucleic Adenylate kinase 1531 acid metabolism are DNA polymerase (156, 277) and RNase (52). In glycolysis the enzymes are hexokinase-glucokinase Carbamyl phosphate synthetase 1531 Lactose synthetase 1533 (98, 389), galactokinase 30, aldolase (267, 315), pyruvate Discussion 1533 kinase (73, 386), and lactate dehydrogenase (67, 69). In References 1533 mitochondrial oxidation they are NADH oxidase, succinic oxidase, a-glycero-P oxidase, ATPase, cytochrome oxidase, and flavin content (84, 296). In glycogen metabolism the SUMMARY enzymes involved are UDPG pyrophosphorylase and UDPG glucosyltransferase (19). -
Investigations on the Molecular Biology of Human Adenylate
Ulm University Medical Center Institute for Transfusion Medicine Prof. Dr. med. Hubert Schrezenmeier Investigations on the Molecular Biology of Human Adenylate Kinase 2 Deficiency (Reticular Dysgenesis) and the Establishment and Characterisation of an Adenylate Kinase 2-deficient Mouse Model Dissertation to obtain the doctoral degree of Human Biology (Dr. biol. hum.) of the Medical Faculty of Ulm University Rebekka Waldmann Ulm 2017 Amtierender Dekan: Prof. Dr. rer. nat. Thomas Wirth 1. Berichterstatter: Prof. Dr. med. Hubert Schrezenmeier 2. Berichterstatter: PD Dr. med. Manfred Hönig Tag der Promotion: 13.04.2018 Index Index INDEX OF ABBREVIATIONS ........................................................................................................................... I 1 INTRODUCTION ..................................................................................................................................... 1 1.1 SEVERE COMBINED IMMUNODEFICIENCIES (SCIDS) ........................................................................................ 1 1.2 RETICULAR DYSGENESIS ............................................................................................................................. 2 1.3 ADENYLATE KINASES ................................................................................................................................. 3 1.4 IMMUNODEFICIENT MOUSE MODELS ........................................................................................................... 7 1.5 AIM OF THE STUDY ..................................................................................................................................