Inorganic Polyphosphates Regulate Hexokinase Activity and Reactive Oxygen Species Generation in Mito- Chondria of Rhipicephalus
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Polyphosphate-Dependent Synthesis of ATP and ADP by the Family-2 Polyphosphate Kinases in Bacteria
Polyphosphate-dependent synthesis of ATP and ADP by the family-2 polyphosphate kinases in bacteria Boguslaw Noceka, Samvel Kochinyanb, Michael Proudfootb, Greg Brownb, Elena Evdokimovaa,b, Jerzy Osipiuka, Aled M. Edwardsa,b, Alexei Savchenkoa,b, Andrzej Joachimiaka,c,1, and Alexander F. Yakuninb,1 aMidwest Center for Structural Genomics and Structural Biology Center, Department of Biosciences, Argonne National Laboratory, 9700 South Cass Avenue, Building 202, Argonne, IL 60439; bBanting and Best Department of Medical Research, University of Toronto, Toronto, ON, Canada M5G 1L6; and cDepartment of Biochemistry and Molecular Biology, University of Chicago, 920 East 58th Street, Chicago, IL 60637 Edited by Robert Haselkorn, University of Chicago, Chicago, IL, and approved September 30, 2008 (received for review August 1, 2008) Inorganic polyphosphate (polyP) is a linear polymer of tens or hun- exopolysaccharide essential for the virulence of P. aeruginosa (12). dreds of phosphate residues linked by high-energy bonds. It is found In the social slime mold Dictyostelium discoideum, a different PPK in all organisms and has been proposed to serve as an energy source was found (DdPPK2) with sequence and properties similar to that in a pre-ATP world. This ubiquitous and abundant biopolymer plays of actin-related proteins (Arps) (14). DdPPK2 is a complex of 3 numerous and vital roles in metabolism and regulation in prokaryotes Arps (Arp1, Arp2, and Arpx) and resembles the actin family in and eukaryotes, but the underlying molecular mechanisms for most molecular weight, sequence, and filamentous structure. Remark- activities of polyP remain unknown. In prokaryotes, the synthesis and ably, DdPPK2 can polymerize into an actin-like filament concurrent utilization of polyP are catalyzed by 2 families of polyP kinases, PPK1 with the synthesis of polyP (14). -
Indications for a Central Role of Hexokinase Activity in Natural Variation of Heat Acclimation in Arabidopsis Thaliana
Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 14 June 2020 doi:10.20944/preprints202006.0169.v1 Article Indications for a central role of hexokinase activity in natural variation of heat acclimation in Arabidopsis thaliana Vasil Atanasov §, Lisa Fürtauer § and Thomas Nägele * LMU Munich, Plant Evolutionary Cell Biology, Großhaderner Str. 2-4, 82152 Planegg, Germany § Authors contributed equally * Correspondence: [email protected] Abstract: Diurnal and seasonal changes of abiotic environmental factors shape plant performance and distribution. Changes of growth temperature and light intensity may vary significantly on a diurnal, but also on a weekly or seasonal scale. Hence, acclimation to a changing temperature and light regime is essential for plant survival and propagation. In the present study, we analyzed photosynthetic CO2 assimilation and metabolic regulation of the central carbohydrate metabolism in two natural accessions of Arabidopsis thaliana originating from Russia and south Italy during exposure to heat and a combination of heat and high light. Our findings indicate that it is hardly possible to predict photosynthetic capacities to fix CO2 under combined stress from single stress experiments. Further, capacities of hexose phosphorylation were found to be significantly lower in the Italian than in the Russian accession which could explain an inverted sucrose-to-hexose ratio. Together with the finding of significantly stronger accumulation of anthocyanins under heat/high light these observations indicate a central role of hexokinase activity in stabilization of photosynthetic capacities within a changing environment. Keywords: photosynthesis; carbohydrate metabolism; hexokinase; heat acclimation; environmental changes; natural variation; high light; combined stress. 1. Introduction Changes of growth temperature and light intensity broadly affect plant molecular, physiological and developmental processes. -
Molecular Mechanisms Involved Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis
Virginia Commonwealth University VCU Scholars Compass Theses and Dissertations Graduate School 2010 Molecular Mechanisms Involved Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis Ryan Fassnacht Virginia Commonwealth University Follow this and additional works at: https://scholarscompass.vcu.edu/etd Part of the Physiology Commons © The Author Downloaded from https://scholarscompass.vcu.edu/etd/2246 This Thesis is brought to you for free and open access by the Graduate School at VCU Scholars Compass. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected]. Ryan C. Fassnacht 2010 All Rights Reserved Molecular Mechanisms Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science at Virginia Commonwealth University. by Ryan Christopher Fassnacht, B.S. Hampden Sydney University, 2005 M.S. Virginia Commonwealth University, 2010 Director: Valeria Mas, Ph.D., Associate Professor of Surgery and Pathology Division of Transplant Department of Surgery Virginia Commonwealth University Richmond, Virginia July 9, 2010 Acknowledgement The Author wishes to thank his family and close friends for their support. He would also like to thank the members of the molecular transplant team for their help and advice. This project would not have been possible with out the help of Dr. Valeria Mas and her endearing -
Labeled in Thecourse of Glycolysis, Since Phosphoglycerate Kinase
THE STATE OF MAGNESIUM IN CELLS AS ESTIMATED FROM THE ADENYLATE KINASE EQUILIBRIUM* BY TRWIN A. RoSE THE INSTITUTE FOR CANCER RESEARCH, PHILADELPHIA Communicated by Thomas F. Anderson, August 30, 1968 Magnesium functions in many enzymatic reactions as a cofactor and in com- plex with nucleotides acting as substrates. Numerous examples of a possible regulatory role of Mg can be cited from studies with isolated enzymes,'- and it is known that Mg affects the structural integrity of macromolecules such as trans- fer RNA" and functional elements such as ribosomes.'0 The major problem in translating this information on isolated preparations to the functioning cell is the difficulty in determining the distribution of Mg and the nucleotides among the free and complexed forms that function in the region of the cell for which this information is desired. Nanningall based an attempt to calculate the free Mg2+ and Ca2+ ion concentrations of frog muscle on the total content of these metals and of the principal known ligands (adenosine 5'-triphosphate (ATP), creatine-P, and myosin) and the dissociation constants of the complexes. However, this method suffers from the necessity of evaluating the contribution of all ligands as well as from the assumption that all the known ligands are contributing their full complexing capacity. During studies concerned with the control of glycolysis in red cells and the control of the phosphoglycerate kinase step in particular, it became important to determine the fractions of the cell's ATP and adenosine 5'-diphosphate (ADP) that were present as Mg complexes. Just as the problem of determining the distribution of protonated and dissociated forms of an acid can be solved from a knowledge of pH and pKa of the acid, so it would be possible to determine the liganded and free forms of all rapidly established Mg complexes from a knowledge of Mg2+ ion concentration and the appropriate dissociation constants. -
Polymerase Ribozyme with Promoter Recognition
In vitro Evolution of a Processive Clamping RNA Polymerase Ribozyme with Promoter Recognition by Razvan Cojocaru BSc, Simon Fraser University, 2014 Thesis Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in the Department of Molecular Biology and Biochemistry Faculty of Science © Razvan Cojocaru 2021 SIMON FRASER UNIVERSITY Summer 2021 Copyright in this work is held by the author. Please ensure that any reproduction or re-use is done in accordance with the relevant national copyright legislation. Declaration of Committee Name: Razvan Cojocaru Degree: Doctor of Philosophy Title: In vitro Evolution of a Processive Clamping RNA Polymerase Ribozyme with Promoter Recognition Committee: Chair: Lisa Craig Professor, Molecular Biology and Biochemistry Peter Unrau Supervisor Professor, Molecular Biology and Biochemistry Dipankar Sen Committee Member Professor, Molecular Biology and Biochemistry Michel Leroux Committee Member Professor, Molecular Biology and Biochemistry Mani Larijani Internal Examiner Associate Professor, Molecular Biology and Biochemistry Gerald Joyce External Examiner Professor, Jack H. Skirball Center for Chemical Biology and Proteomics Salk Institute for Biological Studies Date Defended/Approved: August 12, 2021 ii Abstract The RNA World hypothesis proposes that the early evolution of life began with RNAs that can serve both as carriers of genetic information and as catalysts. Later in evolution, these functions were gradually replaced by DNA and enzymatic proteins in cellular biology. I start by reviewing the naturally occurring catalytic RNAs, ribozymes, as they play many important roles in biology today. These ribozymes are central to protein synthesis and the regulation of gene expression, creating a landscape that strongly supports an early RNA World. -
Yeast Genome Gazetteer P35-65
gazetteer Metabolism 35 tRNA modification mitochondrial transport amino-acid metabolism other tRNA-transcription activities vesicular transport (Golgi network, etc.) nitrogen and sulphur metabolism mRNA synthesis peroxisomal transport nucleotide metabolism mRNA processing (splicing) vacuolar transport phosphate metabolism mRNA processing (5’-end, 3’-end processing extracellular transport carbohydrate metabolism and mRNA degradation) cellular import lipid, fatty-acid and sterol metabolism other mRNA-transcription activities other intracellular-transport activities biosynthesis of vitamins, cofactors and RNA transport prosthetic groups other transcription activities Cellular organization and biogenesis 54 ionic homeostasis organization and biogenesis of cell wall and Protein synthesis 48 plasma membrane Energy 40 ribosomal proteins organization and biogenesis of glycolysis translation (initiation,elongation and cytoskeleton gluconeogenesis termination) organization and biogenesis of endoplasmic pentose-phosphate pathway translational control reticulum and Golgi tricarboxylic-acid pathway tRNA synthetases organization and biogenesis of chromosome respiration other protein-synthesis activities structure fermentation mitochondrial organization and biogenesis metabolism of energy reserves (glycogen Protein destination 49 peroxisomal organization and biogenesis and trehalose) protein folding and stabilization endosomal organization and biogenesis other energy-generation activities protein targeting, sorting and translocation vacuolar and lysosomal -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
Structure-Function Studies of Enzymes from Ribose Metabolism
Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology 939 Structure-Function Studies of Enzymes from Ribose Metabolism BY C. EVALENA ANDERSSON ACTA UNIVERSITATIS UPSALIENSIS UPPSALA 2004 !"" #$"" % & % % ' ( ) * + &( , +( !""( - . - % + / % 0 ( , ( 1#1( ( ( 2-3 1. 45 ." 2 * & & * % * &( , % . * % % ( ) % / ( 0 6 / % ,)' & % % & ( )* % 6 % 6 * ( 0 6 * * % ( - % & 7 % & % & && ( ' && ,)' % /( 2 8 * ,)' & ,'.'' ( ) * % / % * 6 & & / 6 ( 0 . . . ( - * & * % %% & ( 9 * 6 / %% % ( -: % & * . & . , /( , & % * /( ) % / % & % ( ! 6 . . & / 6 % " # $ % # %& '()# %$# # *+',-. # ; ( + , !"" 2--3 ".!#!< 2-3 1. 45 ." $ $$$ .#111 = $>> (6(> ? @ $ $$$ .#111A List of Papers This thesis is based on the following papers, which are referred to in the text by their Roman numerals: I Andersson, C. E. & Mowbray, S. L. (2002). Activation of ribokinase by monovalent cations. J. Mol. Biol. 315, 409-19 II Zhang, R., Andersson, C. E., Savchenko, -
200703 Supplemental Magnani Et Al Clean Version
Supplemental Data Sleeping Beauty-engineered CAR T cells achieve anti-leukemic activity without severe toxicities Chiara F. Magnani, Giuseppe Gaipa, Federico Lussana, Daniela Belotti, Giuseppe Gritti, Sara Napolitano, Giada Matera, Benedetta Cabiati, Chiara Buracchi, Gianmaria Borleri, Grazia Fazio, Silvia Zaninelli, Sarah Tettamanti, Stefania Cesana, Valentina Colombo, Michele Quaroni, Giovanni Cazzaniga, Attilio Rovelli, Ettore Biagi, Stefania Galimberti, Andrea Calabria, Fabrizio Benedicenti, Eugenio Montini, Silvia Ferrari, Martino Introna, Adriana Balduzzi, Maria Grazia Valsecchi, Giuseppe Dastoli, Alessandro Rambaldi, Andrea Biondi Table of Contents: Supplemental Methods ...................................................................................................... 2 Supplemental Figure 1. .................................................................................................... 13 Supplemental Figure 2. .................................................................................................... 14 Supplemental Figure 3. .................................................................................................... 15 Supplemental Figure 4. .................................................................................................... 16 Supplemental Figure 5. .................................................................................................... 17 Supplemental Figure 6. .................................................................................................... 18 Supplemental -
Substrate Recognition and Mechanism Revealed by Ligand-Bound Polyphosphate Kinase 2 Structures
Substrate recognition and mechanism revealed by ligand-bound polyphosphate kinase 2 structures Alice E. Parnella,1, Silja Mordhorstb,1, Florian Kemperc, Mariacarmela Giurrandinoa, Josh P. Princea, Nikola J. Schwarzerc, Alexandre Hoferd, Daniel Wohlwendc, Henning J. Jessend,e, Stefan Gerhardtc, Oliver Einslec,f, Petra C. F. Oystong,h, Jennifer N. Andexerb,2, and Peter L. Roacha,g,2 aChemistry, University of Southampton, Southampton, Hampshire SO17 1BJ, United Kingdom; bInstitute of Pharmaceutical Sciences, Albert-Ludwigs- University Freiburg, 79104 Freiburg, Germany; cInstitute of Biochemistry, Albert-Ludwigs-University Freiburg, 79104 Freiburg, Germany; dOrganic Chemistry Institute, University of Zürich, 8057 Zürich, Switzerland; eInstitute of Organic Chemistry, Albert-Ludwigs-University Freiburg, 79104 Freiburg, Germany; fBioss Centre for Biological Signalling Studies, Albert-Ludwigs-University Freiburg, 79104 Freiburg, Germany; gInstitute for Life Sciences, University of Southampton, Southampton, Hampshire SO17 1BJ, United Kingdom; and hBiomedical Sciences, Defence Science and Technology Laboratory Porton Down, SP4 0JQ Salisbury, United Kingdom Edited by David Avram Sanders, Purdue University, West Lafayette, IN, and accepted by Editorial Board Member Gregory A. Petsko February 13, 2018 (received for review June 20, 2017) Inorganic polyphosphate is a ubiquitous, linear biopolymer built of mechanism is proposed to proceed via a phosphorylated enzyme up to thousands of phosphate residues that are linked by energy- intermediate (8), which -
Supplementary Information
Supplementary information (a) (b) Figure S1. Resistant (a) and sensitive (b) gene scores plotted against subsystems involved in cell regulation. The small circles represent the individual hits and the large circles represent the mean of each subsystem. Each individual score signifies the mean of 12 trials – three biological and four technical. The p-value was calculated as a two-tailed t-test and significance was determined using the Benjamini-Hochberg procedure; false discovery rate was selected to be 0.1. Plots constructed using Pathway Tools, Omics Dashboard. Figure S2. Connectivity map displaying the predicted functional associations between the silver-resistant gene hits; disconnected gene hits not shown. The thicknesses of the lines indicate the degree of confidence prediction for the given interaction, based on fusion, co-occurrence, experimental and co-expression data. Figure produced using STRING (version 10.5) and a medium confidence score (approximate probability) of 0.4. Figure S3. Connectivity map displaying the predicted functional associations between the silver-sensitive gene hits; disconnected gene hits not shown. The thicknesses of the lines indicate the degree of confidence prediction for the given interaction, based on fusion, co-occurrence, experimental and co-expression data. Figure produced using STRING (version 10.5) and a medium confidence score (approximate probability) of 0.4. Figure S4. Metabolic overview of the pathways in Escherichia coli. The pathways involved in silver-resistance are coloured according to respective normalized score. Each individual score represents the mean of 12 trials – three biological and four technical. Amino acid – upward pointing triangle, carbohydrate – square, proteins – diamond, purines – vertical ellipse, cofactor – downward pointing triangle, tRNA – tee, and other – circle. -
Review Galactokinase: Structure, Function and Role in Type II
CMLS, Cell. Mol. Life Sci. 61 (2004) 2471–2484 1420-682X/04/202471-14 DOI 10.1007/s00018-004-4160-6 CMLS Cellular and Molecular Life Sciences © Birkhäuser Verlag, Basel, 2004 Review Galactokinase: structure, function and role in type II galactosemia H. M. Holden a,*, J. B. Thoden a, D. J. Timson b and R. J. Reece c,* a Department of Biochemistry, University of Wisconsin, Madison, Wisconsin 53706 (USA), Fax: +1 608 262 1319, e-mail: [email protected] b School of Biology and Biochemistry, Queen’s University Belfast, Medical Biology Centre, 97 Lisburn Road, Belfast BT9 7BL, (United Kingdom) c School of Biological Sciences, The University of Manchester, The Michael Smith Building, Oxford Road, Manchester M13 9PT, (United Kingdom), Fax: +44 161 275 5317, e-mail: [email protected] Received 13 April 2004; accepted 7 June 2004 Abstract. The conversion of beta-D-galactose to glucose unnatural sugar 1-phosphates. Additionally, galactoki- 1-phosphate is accomplished by the action of four en- nase-like molecules have been shown to act as sensors for zymes that constitute the Leloir pathway. Galactokinase the intracellular concentration of galactose and, under catalyzes the second step in this pathway, namely the con- suitable conditions, to function as transcriptional regula- version of alpha-D-galactose to galactose 1-phosphate. tors. This review focuses on the recent X-ray crystallo- The enzyme has attracted significant research attention graphic analyses of galactokinase and places the molecu- because of its important metabolic role, the fact that de- lar architecture of this protein in context with the exten- fects in the human enzyme can result in the diseased state sive biochemical data that have accumulated over the last referred to as galactosemia, and most recently for its uti- 40 years regarding this fascinating small molecule ki- lization via ‘directed evolution’ to create new natural and nase.