DOCSLIB.ORG

Inorganic Polyphosphates Regulate Hexokinase Activity and Reactive Oxygen Species Generation in Mito- Chondria of Rhipicephalus

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Inorganic Polyphosphates Regulate Hexokinase Activity and Reactive Oxygen Species Generation in Mito- Chondria of Rhipicephalus Int. J. Biol. Sci. 2013, Vol. 9 842 Ivyspring International Publisher International Journal of Biological Sciences 2013; 9(8):842-852. doi: 10.7150/ijbs.6628 Research Paper Inorganic Polyphosphates Regulate Hexokinase Activity and Reactive Oxygen Species Generation in Mito- chondria of Rhipicephalus (Boophilus) microplus Embryo Amanda Fraga1, Jorge Moraes1,2, José Roberto da Silva1,2, Evenilton P. Costa3, Jackson Menezes1,2, Itabajara da Silva Vaz Jr2,4, Carlos Logullo2,3, Rodrigo Nunes da Fonseca 1,2 and Eldo Campos1,2 1. Laboratório Integrado de Bioquímica—Hatisaburo Masuda, UFRJ, Polo Barreto, Av. São José do Barreto nº 764, São Jose do Barreto, CEP 27971-550, Macaé, RJ, Brazil; 2. Instituto Nacional de Ciência e Tecnologia—Entomologia Molecular, Rio de Janeiro, RJ, CEP 21941–590, Brazil; 3. Laboratório de Química e Função de Proteínas e Peptídeos and Unidade de Experimentação Animal–CBB–UENF, Avenida Alberto Lamego, 2000, Horto, Campos dos Goytacazes, RJ, CEP 28015–620, Brazil; 4. Centro de Biotecnologia e Faculdade de Veterinária, UFRGS, Avenida Bento Gonçalves, 9090, Porto Alegre, RS, C.P. 15005, CEP 91501–970, Brazil. Corresponding author: Tel.: +55-22-33993967. E-Mail address: [email protected] (E. Campos). © Ivyspring International Publisher. This is an open-access article distributed under the terms of the Creative Commons License (http://creativecommons.org/ licenses/by-nc-nd/3.0/). Reproduction is permitted for personal, noncommercial use, provided that the article is in whole, unmodified, and properly cited. Received: 2013.05.06; Accepted: 2013.08.08; Published: 2013.08.27 Abstract The physiological roles of polyphosphates (poly P) recently found in arthropod mitochondria remain obscure. Here, the possible involvement of poly P with reactive oxygen species generation in mitochondria of Rhipicephalus microplus embryos was investigated. Mitochondrial hexokinase and scavenger antioxidant enzymes, such as superoxide dismutase, catalase, and glutathione re- ductase were assayed during embryogenesis of R. microplus. The influence of poly P3 and poly P15 were analyzed during the period of higher enzymatic activity during embryogenesis. Both poly Ps inhibited hexokinase activity by up to 90% and, interestingly, the mitochondrial membrane exo- polyphosphatase activity was stimulated by the hexokinase reaction product, glucose-6-phosphate. Poly P increased hydrogen peroxide generation in mitochondria in a situation where mitochondrial hexokinase is also active. The superoxide dismutase, catalase and glutathione reductase activities were higher during embryo cellularization, at the end of embryogenesis and during embryo segmentation, respectively. All of the enzymes were stimulated by poly P3. However, superoxide dismutase was not affected by poly P15, catalase activity was stimulated only at high concentrations and glutathione reductase was the only enzyme that was stimulated in the same way by both poly Ps. Altogether, our results indicate that inorganic polyphosphate and mitochondrial membrane exopolyphosphatase regulation can be correlated with the generation of reactive oxygen species in the mitochondria of R. microplus embryos. Key words: inorganic polyphosphate; reactive oxygen species; arthropod; mitochondria; scavenger antioxidant enzymes. Introduction Inorganic polyphosphates (poly P) are long have been demonstrated to play diverse roles de- chains of a few to several hundred phosphate residues pending on the cell type and circumstances [1, 2]. The linked by phosphoanhydride bonds. Polyphosphates biological roles played by polyphosphates have been have been found in all cell types examined to date and most extensively studied in prokaryotes and unicel- http://www.ijbs.com Int. J. Biol. Sci. 2013, Vol. 9 843 lular eukaryotes, where they have been shown to enzyme is present in the matrix (Mn-SOD) and in the regulate many biochemical processes including the intermembrane space (Zn-SOD) [29-32]. The abun- metabolism and transport of inorganic phosphate, dance of this enzyme, as well as its presence in both cation sequestration and storage [1], membrane mitochondrial compartments, attests to the im- channel formation [3, 4], cell envelope formation and portance of removing mitochondrially-generated •__ bacterial pathogenesis[5, 6], regulation of gene and O2 [33]. Catalase (CAT) acts by decomposing H2O2 enzyme activities [7] and activation of Lon proteases into H2O and O2, avoiding the production of hydroxyl [8]. radicals (HO•) in the presence of transition metals. Conversely, poly P functions have not been ex- The presence of CAT in mitochondria is of great im- tensively investigated in higher eukaryotes, although portance, as decomposition of H2O2 protects these some functions have been described such as the acti- organelles against intra- and extra-mitochondrially vation of TOR kinase [9], involvement in blood coag- generated H2O2 [34, 35]. Glutathione reductase (GR) is ulation [10], and apoptosis [11-13]. Regarding mito- the enzyme that regenerates reduced glutathione in chondrial metabolism, mammalian mitochondrial the mitochondrial matrix. Reduced glutathione can poly P production is directly linked to their energetic scavenge ROS non-enzymatically or by serving as an state [14], as the level of poly P regulates the level of electron-donating substrate to several enzymes in- cellular ATP [14] and Ca2+ accumulation [15]. The volved in ROS-detoxification [36]. interest in mitochondrial poly P is focused on two Ticks are vectors of parasites that cause hemo- aspects: poly P as a macroenergetic compound with parasitic diseases and are endemic in many cattle the same energy of hydrolysis of the phosphoanhy- production areas [37]. The present study focuses on dride bond as ATP, and the fact that, according to the Rhipicephalus microplus, which causes heavy economic endosymbiotic theory, mitochondria originated from losses to bovine herds, particularly in tropical regions; ancient prokaryotic cells; thus, it would be intriguing thus, major efforts have been directed toward devel- to discover whether or not mitochondria have pre- oping immunoprophylactic tick-control tools [38, 39]. served polyphosphate functions such as the regula- R. microplus has only one host throughout its three life tion of energy metabolism [16, 17]. Recently, we have stages, which is usually a bovine, and has a long demonstrated that electron flux and redox states may feeding period (approximately 21 days). Female ticks, exert some influence and be influenced by the activity after engorgement, drop off the host and initiate ovi- of membrane exopolyphosphatase (PPX), the enzyme position approximately three days later. Being an that splits Pi off the end of a poly P chain, suggesting oviparous animal, embryogenesis occurs in the ab- that it plays a role in energy supply during R. mi- sence of exogenous nutrients; maternal nutrients are croplus embryogenesis [18]. packaged into oocytes and stored mostly as yolk The metabolism of free hexoses begins by granules. Hatching occurs approximately 21 days phosphorylation in a reaction catalyzed by the hexo- after egg laying and the emerging larvae can survive kinase (ATP: hexose-6-phosphotransferase, E.C. for several weeks before finding a host, using the re- 2.7.1.1; HK). This enzyme has been characterized in maining yolk as their only energy source [40, 41]. several organisms [19-24]. Four distinct hexokinase The aim of this study was to investigate the pos- isozymes are reported for mammalian tissues and are sible involvement of poly P in reactive oxygen species named types I–IV. These isozymes have an internal generation in mitochondria of R. microplus embryos. repeat sequence in their N- and C- terminal halves Such findings could reveal an important role for poly that is found in mammals, insects and nematodes [20, P metabolism in arthropods. 25, 26]. In arthropods the binding mechanism of HK to the outer mitochondrial membrane is not fully es- Materials and Methods tablished. Ticks and reagents The mitochondrial electron transport system (ETS) represents one of the major sources of cellular Ticks were obtained from a colony maintained at reactive oxygen species (ROS) such as superoxide the Faculdade de Veterinária, Universidade Federal __ do Rio Grande do Sul (UFRGS), Brazil as previously (O2• ) and hydrogen peroxide (H2O2), providing continuous generation of these toxic products [27]. described [39]. R. microplus (Acarina, Ixodidae) ticks The scavenger activity of antioxidant enzymes con- from the Porto Alegre strain, free of parasites, were stitutes an essential mechanism directed against the reared on calves obtained from a tick-free area. En- primary ROS generated by mitochondrial ETS. Su- gorged adult females were maintained in Petri dishes •__ at 28°C and 80% relative humidity upon completion peroxide dismutase (SOD) rapidly converts O2 to of oviposition, which starts approximately three days H2O2, protecting the mitochondrial iron-sulfur clus- •__ after adult ticks drop off calves. Animals were treated ter-containing enzymes from O2 attack [28]. This http://www.ijbs.com Int. J. Biol. Sci. 2013, Vol. 9 844 in compliance with the UFRGS review committee for 37°C. The Pi formed during the reaction was spec- animal care. The reagents were purchased from Sigma trophotometrically determined as described by[44], (USA), Amersham Biosciences (USA), Invitrogen adding a solution of 0.5% ammonium molybdate, 0.35 (USA) and Merck (Germany). M sulfuric acid, 0.5% sodium dodecyl sulfate, and 10%
Load more

Recommended publications
  • Polyphosphate-Dependent Synthesis of ATP and ADP by the Family-2 Polyphosphate Kinases in Bacteria
    Polyphosphate-dependent synthesis of ATP and ADP by the family-2 polyphosphate kinases in bacteria Boguslaw Noceka, Samvel Kochinyanb, Michael Proudfootb, Greg Brownb, Elena Evdokimovaa,b, Jerzy Osipiuka, Aled M. Edwardsa,b, Alexei Savchenkoa,b, Andrzej Joachimiaka,c,1, and Alexander F. Yakuninb,1 aMidwest Center for Structural Genomics and Structural Biology Center, Department of Biosciences, Argonne National Laboratory, 9700 South Cass Avenue, Building 202, Argonne, IL 60439; bBanting and Best Department of Medical Research, University of Toronto, Toronto, ON, Canada M5G 1L6; and cDepartment of Biochemistry and Molecular Biology, University of Chicago, 920 East 58th Street, Chicago, IL 60637 Edited by Robert Haselkorn, University of Chicago, Chicago, IL, and approved September 30, 2008 (received for review August 1, 2008) Inorganic polyphosphate (polyP) is a linear polymer of tens or hun- exopolysaccharide essential for the virulence of P. aeruginosa (12). dreds of phosphate residues linked by high-energy bonds. It is found In the social slime mold Dictyostelium discoideum, a different PPK in all organisms and has been proposed to serve as an energy source was found (DdPPK2) with sequence and properties similar to that in a pre-ATP world. This ubiquitous and abundant biopolymer plays of actin-related proteins (Arps) (14). DdPPK2 is a complex of 3 numerous and vital roles in metabolism and regulation in prokaryotes Arps (Arp1, Arp2, and Arpx) and resembles the actin family in and eukaryotes, but the underlying molecular mechanisms for most molecular weight, sequence, and filamentous structure. Remark- activities of polyP remain unknown. In prokaryotes, the synthesis and ably, DdPPK2 can polymerize into an actin-like filament concurrent utilization of polyP are catalyzed by 2 families of polyP kinases, PPK1 with the synthesis of polyP (14).
    [Show full text]
  • Indications for a Central Role of Hexokinase Activity in Natural Variation of Heat Acclimation in Arabidopsis Thaliana
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 14 June 2020 doi:10.20944/preprints202006.0169.v1 Article Indications for a central role of hexokinase activity in natural variation of heat acclimation in Arabidopsis thaliana Vasil Atanasov §, Lisa Fürtauer § and Thomas Nägele * LMU Munich, Plant Evolutionary Cell Biology, Großhaderner Str. 2-4, 82152 Planegg, Germany § Authors contributed equally * Correspondence: [email protected] Abstract: Diurnal and seasonal changes of abiotic environmental factors shape plant performance and distribution. Changes of growth temperature and light intensity may vary significantly on a diurnal, but also on a weekly or seasonal scale. Hence, acclimation to a changing temperature and light regime is essential for plant survival and propagation. In the present study, we analyzed photosynthetic CO2 assimilation and metabolic regulation of the central carbohydrate metabolism in two natural accessions of Arabidopsis thaliana originating from Russia and south Italy during exposure to heat and a combination of heat and high light. Our findings indicate that it is hardly possible to predict photosynthetic capacities to fix CO2 under combined stress from single stress experiments. Further, capacities of hexose phosphorylation were found to be significantly lower in the Italian than in the Russian accession which could explain an inverted sucrose-to-hexose ratio. Together with the finding of significantly stronger accumulation of anthocyanins under heat/high light these observations indicate a central role of hexokinase activity in stabilization of photosynthetic capacities within a changing environment. Keywords: photosynthesis; carbohydrate metabolism; hexokinase; heat acclimation; environmental changes; natural variation; high light; combined stress. 1. Introduction Changes of growth temperature and light intensity broadly affect plant molecular, physiological and developmental processes.
    [Show full text]
  • Molecular Mechanisms Involved Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis
    Virginia Commonwealth University VCU Scholars Compass Theses and Dissertations Graduate School 2010 Molecular Mechanisms Involved Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis Ryan Fassnacht Virginia Commonwealth University Follow this and additional works at: https://scholarscompass.vcu.edu/etd Part of the Physiology Commons © The Author Downloaded from https://scholarscompass.vcu.edu/etd/2246 This Thesis is brought to you for free and open access by the Graduate School at VCU Scholars Compass. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected]. Ryan C. Fassnacht 2010 All Rights Reserved Molecular Mechanisms Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science at Virginia Commonwealth University. by Ryan Christopher Fassnacht, B.S. Hampden Sydney University, 2005 M.S. Virginia Commonwealth University, 2010 Director: Valeria Mas, Ph.D., Associate Professor of Surgery and Pathology Division of Transplant Department of Surgery Virginia Commonwealth University Richmond, Virginia July 9, 2010 Acknowledgement The Author wishes to thank his family and close friends for their support. He would also like to thank the members of the molecular transplant team for their help and advice. This project would not have been possible with out the help of Dr. Valeria Mas and her endearing
    [Show full text]
  • Labeled in Thecourse of Glycolysis, Since Phosphoglycerate Kinase
    THE STATE OF MAGNESIUM IN CELLS AS ESTIMATED FROM THE ADENYLATE KINASE EQUILIBRIUM* BY TRWIN A. RoSE THE INSTITUTE FOR CANCER RESEARCH, PHILADELPHIA Communicated by Thomas F. Anderson, August 30, 1968 Magnesium functions in many enzymatic reactions as a cofactor and in com- plex with nucleotides acting as substrates. Numerous examples of a possible regulatory role of Mg can be cited from studies with isolated enzymes,'- and it is known that Mg affects the structural integrity of macromolecules such as trans- fer RNA" and functional elements such as ribosomes.'0 The major problem in translating this information on isolated preparations to the functioning cell is the difficulty in determining the distribution of Mg and the nucleotides among the free and complexed forms that function in the region of the cell for which this information is desired. Nanningall based an attempt to calculate the free Mg2+ and Ca2+ ion concentrations of frog muscle on the total content of these metals and of the principal known ligands (adenosine 5'-triphosphate (ATP), creatine-P, and myosin) and the dissociation constants of the complexes. However, this method suffers from the necessity of evaluating the contribution of all ligands as well as from the assumption that all the known ligands are contributing their full complexing capacity. During studies concerned with the control of glycolysis in red cells and the control of the phosphoglycerate kinase step in particular, it became important to determine the fractions of the cell's ATP and adenosine 5'-diphosphate (ADP) that were present as Mg complexes. Just as the problem of determining the distribution of protonated and dissociated forms of an acid can be solved from a knowledge of pH and pKa of the acid, so it would be possible to determine the liganded and free forms of all rapidly established Mg complexes from a knowledge of Mg2+ ion concentration and the appropriate dissociation constants.
    [Show full text]
  • Polymerase Ribozyme with Promoter Recognition
    In vitro Evolution of a Processive Clamping RNA Polymerase Ribozyme with Promoter Recognition by Razvan Cojocaru BSc, Simon Fraser University, 2014 Thesis Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in the Department of Molecular Biology and Biochemistry Faculty of Science © Razvan Cojocaru 2021 SIMON FRASER UNIVERSITY Summer 2021 Copyright in this work is held by the author. Please ensure that any reproduction or re-use is done in accordance with the relevant national copyright legislation. Declaration of Committee Name: Razvan Cojocaru Degree: Doctor of Philosophy Title: In vitro Evolution of a Processive Clamping RNA Polymerase Ribozyme with Promoter Recognition Committee: Chair: Lisa Craig Professor, Molecular Biology and Biochemistry Peter Unrau Supervisor Professor, Molecular Biology and Biochemistry Dipankar Sen Committee Member Professor, Molecular Biology and Biochemistry Michel Leroux Committee Member Professor, Molecular Biology and Biochemistry Mani Larijani Internal Examiner Associate Professor, Molecular Biology and Biochemistry Gerald Joyce External Examiner Professor, Jack H. Skirball Center for Chemical Biology and Proteomics Salk Institute for Biological Studies Date Defended/Approved: August 12, 2021 ii Abstract The RNA World hypothesis proposes that the early evolution of life began with RNAs that can serve both as carriers of genetic information and as catalysts. Later in evolution, these functions were gradually replaced by DNA and enzymatic proteins in cellular biology. I start by reviewing the naturally occurring catalytic RNAs, ribozymes, as they play many important roles in biology today. These ribozymes are central to protein synthesis and the regulation of gene expression, creating a landscape that strongly supports an early RNA World.
    [Show full text]
  • Yeast Genome Gazetteer P35-65
    gazetteer Metabolism 35 tRNA modification mitochondrial transport amino-acid metabolism other tRNA-transcription activities vesicular transport (Golgi network, etc.) nitrogen and sulphur metabolism mRNA synthesis peroxisomal transport nucleotide metabolism mRNA processing (splicing) vacuolar transport phosphate metabolism mRNA processing (5’-end, 3’-end processing extracellular transport carbohydrate metabolism and mRNA degradation) cellular import lipid, fatty-acid and sterol metabolism other mRNA-transcription activities other intracellular-transport activities biosynthesis of vitamins, cofactors and RNA transport prosthetic groups other transcription activities Cellular organization and biogenesis 54 ionic homeostasis organization and biogenesis of cell wall and Protein synthesis 48 plasma membrane Energy 40 ribosomal proteins organization and biogenesis of glycolysis translation (initiation,elongation and cytoskeleton gluconeogenesis termination) organization and biogenesis of endoplasmic pentose-phosphate pathway translational control reticulum and Golgi tricarboxylic-acid pathway tRNA synthetases organization and biogenesis of chromosome respiration other protein-synthesis activities structure fermentation mitochondrial organization and biogenesis metabolism of energy reserves (glycogen Protein destination 49 peroxisomal organization and biogenesis and trehalose) protein folding and stabilization endosomal organization and biogenesis other energy-generation activities protein targeting, sorting and translocation vacuolar and lysosomal
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Structure-Function Studies of Enzymes from Ribose Metabolism
    Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology 939 Structure-Function Studies of Enzymes from Ribose Metabolism BY C. EVALENA ANDERSSON ACTA UNIVERSITATIS UPSALIENSIS UPPSALA 2004 !"" #$"" % & % % ' ( ) * + &( , +( !""( - . - % + / % 0 ( , ( 1#1( ( ( 2-3 1. 45 ." 2 * & & * % * &( , % . * % % ( ) % / ( 0 6 / % ,)' & % % & ( )* % 6 % 6 * ( 0 6 * * % ( - % & 7 % & % & && ( ' && ,)' % /( 2 8 * ,)' & ,'.'' ( ) * % / % * 6 & & / 6 ( 0 . . . ( - * & * % %% & ( 9 * 6 / %% % ( -: % & * . & . , /( , & % * /( ) % / % & % ( ! 6 . . & / 6 % " # $ % # %& '()# %$# # *+',-. # ; ( + , !"" 2--3 ".!#!< 2-3 1. 45 ." $ $$$ .#111 = $>> (6(> ? @ $ $$$ .#111A List of Papers This thesis is based on the following papers, which are referred to in the text by their Roman numerals: I Andersson, C. E. & Mowbray, S. L. (2002). Activation of ribokinase by monovalent cations. J. Mol. Biol. 315, 409-19 II Zhang, R., Andersson, C. E., Savchenko,
    [Show full text]
  • 200703 Supplemental Magnani Et Al Clean Version
    Supplemental Data Sleeping Beauty-engineered CAR T cells achieve anti-leukemic activity without severe toxicities Chiara F. Magnani, Giuseppe Gaipa, Federico Lussana, Daniela Belotti, Giuseppe Gritti, Sara Napolitano, Giada Matera, Benedetta Cabiati, Chiara Buracchi, Gianmaria Borleri, Grazia Fazio, Silvia Zaninelli, Sarah Tettamanti, Stefania Cesana, Valentina Colombo, Michele Quaroni, Giovanni Cazzaniga, Attilio Rovelli, Ettore Biagi, Stefania Galimberti, Andrea Calabria, Fabrizio Benedicenti, Eugenio Montini, Silvia Ferrari, Martino Introna, Adriana Balduzzi, Maria Grazia Valsecchi, Giuseppe Dastoli, Alessandro Rambaldi, Andrea Biondi Table of Contents: Supplemental Methods ...................................................................................................... 2 Supplemental Figure 1. .................................................................................................... 13 Supplemental Figure 2. .................................................................................................... 14 Supplemental Figure 3. .................................................................................................... 15 Supplemental Figure 4. .................................................................................................... 16 Supplemental Figure 5. .................................................................................................... 17 Supplemental Figure 6. .................................................................................................... 18 Supplemental
    [Show full text]
  • Substrate Recognition and Mechanism Revealed by Ligand-Bound Polyphosphate Kinase 2 Structures
    Substrate recognition and mechanism revealed by ligand-bound polyphosphate kinase 2 structures Alice E. Parnella,1, Silja Mordhorstb,1, Florian Kemperc, Mariacarmela Giurrandinoa, Josh P. Princea, Nikola J. Schwarzerc, Alexandre Hoferd, Daniel Wohlwendc, Henning J. Jessend,e, Stefan Gerhardtc, Oliver Einslec,f, Petra C. F. Oystong,h, Jennifer N. Andexerb,2, and Peter L. Roacha,g,2 aChemistry, University of Southampton, Southampton, Hampshire SO17 1BJ, United Kingdom; bInstitute of Pharmaceutical Sciences, Albert-Ludwigs- University Freiburg, 79104 Freiburg, Germany; cInstitute of Biochemistry, Albert-Ludwigs-University Freiburg, 79104 Freiburg, Germany; dOrganic Chemistry Institute, University of Zürich, 8057 Zürich, Switzerland; eInstitute of Organic Chemistry, Albert-Ludwigs-University Freiburg, 79104 Freiburg, Germany; fBioss Centre for Biological Signalling Studies, Albert-Ludwigs-University Freiburg, 79104 Freiburg, Germany; gInstitute for Life Sciences, University of Southampton, Southampton, Hampshire SO17 1BJ, United Kingdom; and hBiomedical Sciences, Defence Science and Technology Laboratory Porton Down, SP4 0JQ Salisbury, United Kingdom Edited by David Avram Sanders, Purdue University, West Lafayette, IN, and accepted by Editorial Board Member Gregory A. Petsko February 13, 2018 (received for review June 20, 2017) Inorganic polyphosphate is a ubiquitous, linear biopolymer built of mechanism is proposed to proceed via a phosphorylated enzyme up to thousands of phosphate residues that are linked by energy- intermediate (8), which
    [Show full text]
  • Supplementary Information
    Supplementary information (a) (b) Figure S1. Resistant (a) and sensitive (b) gene scores plotted against subsystems involved in cell regulation. The small circles represent the individual hits and the large circles represent the mean of each subsystem. Each individual score signifies the mean of 12 trials – three biological and four technical. The p-value was calculated as a two-tailed t-test and significance was determined using the Benjamini-Hochberg procedure; false discovery rate was selected to be 0.1. Plots constructed using Pathway Tools, Omics Dashboard. Figure S2. Connectivity map displaying the predicted functional associations between the silver-resistant gene hits; disconnected gene hits not shown. The thicknesses of the lines indicate the degree of confidence prediction for the given interaction, based on fusion, co-occurrence, experimental and co-expression data. Figure produced using STRING (version 10.5) and a medium confidence score (approximate probability) of 0.4. Figure S3. Connectivity map displaying the predicted functional associations between the silver-sensitive gene hits; disconnected gene hits not shown. The thicknesses of the lines indicate the degree of confidence prediction for the given interaction, based on fusion, co-occurrence, experimental and co-expression data. Figure produced using STRING (version 10.5) and a medium confidence score (approximate probability) of 0.4. Figure S4. Metabolic overview of the pathways in Escherichia coli. The pathways involved in silver-resistance are coloured according to respective normalized score. Each individual score represents the mean of 12 trials – three biological and four technical. Amino acid – upward pointing triangle, carbohydrate – square, proteins – diamond, purines – vertical ellipse, cofactor – downward pointing triangle, tRNA – tee, and other – circle.
    [Show full text]
  • Review Galactokinase: Structure, Function and Role in Type II
    CMLS, Cell. Mol. Life Sci. 61 (2004) 2471–2484 1420-682X/04/202471-14 DOI 10.1007/s00018-004-4160-6 CMLS Cellular and Molecular Life Sciences © Birkhäuser Verlag, Basel, 2004 Review Galactokinase: structure, function and role in type II galactosemia H. M. Holden a,*, J. B. Thoden a, D. J. Timson b and R. J. Reece c,* a Department of Biochemistry, University of Wisconsin, Madison, Wisconsin 53706 (USA), Fax: +1 608 262 1319, e-mail: [email protected] b School of Biology and Biochemistry, Queen’s University Belfast, Medical Biology Centre, 97 Lisburn Road, Belfast BT9 7BL, (United Kingdom) c School of Biological Sciences, The University of Manchester, The Michael Smith Building, Oxford Road, Manchester M13 9PT, (United Kingdom), Fax: +44 161 275 5317, e-mail: [email protected] Received 13 April 2004; accepted 7 June 2004 Abstract. The conversion of beta-D-galactose to glucose unnatural sugar 1-phosphates. Additionally, galactoki- 1-phosphate is accomplished by the action of four en- nase-like molecules have been shown to act as sensors for zymes that constitute the Leloir pathway. Galactokinase the intracellular concentration of galactose and, under catalyzes the second step in this pathway, namely the con- suitable conditions, to function as transcriptional regula- version of alpha-D-galactose to galactose 1-phosphate. tors. This review focuses on the recent X-ray crystallo- The enzyme has attracted significant research attention graphic analyses of galactokinase and places the molecu- because of its important metabolic role, the fact that de- lar architecture of this protein in context with the exten- fects in the human enzyme can result in the diseased state sive biochemical data that have accumulated over the last referred to as galactosemia, and most recently for its uti- 40 years regarding this fascinating small molecule ki- lization via ‘directed evolution’ to create new natural and nase.
    [Show full text]