Polyphosphate-Dependent Synthesis of ATP and ADP by the Family-2 Polyphosphate Kinases in Bacteria

Total Page:16

File Type:pdf, Size:1020Kb

Polyphosphate-Dependent Synthesis of ATP and ADP by the Family-2 Polyphosphate Kinases in Bacteria Polyphosphate-dependent synthesis of ATP and ADP by the family-2 polyphosphate kinases in bacteria Boguslaw Noceka, Samvel Kochinyanb, Michael Proudfootb, Greg Brownb, Elena Evdokimovaa,b, Jerzy Osipiuka, Aled M. Edwardsa,b, Alexei Savchenkoa,b, Andrzej Joachimiaka,c,1, and Alexander F. Yakuninb,1 aMidwest Center for Structural Genomics and Structural Biology Center, Department of Biosciences, Argonne National Laboratory, 9700 South Cass Avenue, Building 202, Argonne, IL 60439; bBanting and Best Department of Medical Research, University of Toronto, Toronto, ON, Canada M5G 1L6; and cDepartment of Biochemistry and Molecular Biology, University of Chicago, 920 East 58th Street, Chicago, IL 60637 Edited by Robert Haselkorn, University of Chicago, Chicago, IL, and approved September 30, 2008 (received for review August 1, 2008) Inorganic polyphosphate (polyP) is a linear polymer of tens or hun- exopolysaccharide essential for the virulence of P. aeruginosa (12). dreds of phosphate residues linked by high-energy bonds. It is found In the social slime mold Dictyostelium discoideum, a different PPK in all organisms and has been proposed to serve as an energy source was found (DdPPK2) with sequence and properties similar to that in a pre-ATP world. This ubiquitous and abundant biopolymer plays of actin-related proteins (Arps) (14). DdPPK2 is a complex of 3 numerous and vital roles in metabolism and regulation in prokaryotes Arps (Arp1, Arp2, and Arpx) and resembles the actin family in and eukaryotes, but the underlying molecular mechanisms for most molecular weight, sequence, and filamentous structure. Remark- activities of polyP remain unknown. In prokaryotes, the synthesis and ably, DdPPK2 can polymerize into an actin-like filament concurrent utilization of polyP are catalyzed by 2 families of polyP kinases, PPK1 with the synthesis of polyP (14). Presently, there are 1,380 PPK1- and PPK2, and polyphosphatases. Here, we present structural and like and 722 PPK2-like sequences in the sequenced microbial functional characterization of the PPK2 family. Proteins with a single genome databases (InterPro database; www.ebi.ac.uk/interpro) PPK2 domain catalyze polyP-dependent phosphorylation of ADP to with many genomes containing both PPK1 and PPK2. The PPK1 ATP, whereas proteins containing 2 fused PPK2 domains phosphor- enzymes represent attractive drug targets (13), and the presence of ylate AMP to ADP. Crystal structures of 2 representative proteins, PPK2-like genes in the genomes of a wide spectrum of pathogens SMc02148 from Sinorhizobium meliloti and PA3455 from Pseudomo- coupled with their absence in the human genome suggests that nas aeruginosa, revealed a 3-layer ␣/␤/␣ sandwich fold with an PPK2s could also be targets for therapeutic intervention. ␣-helical lid similar to the structures of microbial thymidylate kinases, Here, we present the results of structural and biochemical suggesting that these proteins share a common evolutionary origin characterization of 2 groups of PPK2 proteins containing 1 or 2 and catalytic mechanism. Alanine replacement mutagenesis identi- fused PPK2 domains. We have demonstrated that the first group, fied 9 conserved residues, which are required for activity and include which contains a single PPK2 domain, catalyzes the polyP- the residues from both Walker A and B motifs and the lid. Thus, the dependent phosphorylation of nucleoside diphosphates (ADP, PPK2s represent a molecular mechanism, which potentially allow GDP) to nucleoside triphosphates, whereas the proteins with 2 bacteria to use polyP as an intracellular energy reserve for the fused PPK2 domains phosphorylate nucleoside monophosphates generation of ATP and survival. (AMP, GMP) to the respective diphosphates. Crystal structures of 2 representative proteins were solved, and site-directed mutagen- crystal structure ͉ mutagenesis ͉ Walker motif ͉ AMP phosphorylation ͉ esis identified the conserved residues important for catalysis. ADP phosphorylation Results and Discussion norganic polyphosphate (polyP) is a linear polymer composed of Two Groups of PPK2 Enzymes. A BLAST search of the sequenced genomes using the sequence of the biochemically characterized Itens to hundreds of orthophosphate residues (Pi) linked by the energy-rich phosphoanhydride bonds, and it is found in all pro- PPK2 enzyme PA0141 from P. aeruginosa as a query revealed that karyotes and eukaryotes (1–3). PolyP has numerous biological many genomes encode 2 or 3 PPK2 paralogs, most of which contain functions that include substitution for ATP in kinase reactions, a single PPK2 domain Ϸ230 residues in length (1-domain PPK2). acting as an energy source or storage reservoir of Pi, chelating In addition, some genomes show the presence of a longer gene metals, and adjusting cellular physiology during growth, develop- (496–544 residues) with 2 fused PPK2 domains, perhaps produced ment, stress, starvation, and virulence (1, 4). Bacteria with low by a gene duplication event (2-domain PPK2). For example, the intracellular polyP levels show defective responses to various stress genome of P. aeruginosa encodes 2 1-domain PPK2 (PA0141 and conditions, biofilm formation, quorum sensing, motility, and other PA2428) and 1 2-domain PPK2 (PA3455) proteins, whereas Sino- virulence properties (3, 5). Depending on the physiological state of rhizobium meliloti has 3 genes encoding only 1-domain PPK2 the bacterium, the intracellular concentration of polyP is 0.1–200 proteins (SMc02148, SMa0172, and SMa0670). Sequence analysis mM. The polyP level is controlled mainly by the activity of several of 2-domain PPK2 proteins revealed that their C-terminal domain polyphosphatases and 2 families of polyP kinases, PPK1 and PPK2 is more conserved and shows higher similarity to the sequences of (1, 6–9). PPK1 (EC 2.7.4.1; InterPro IPR003414) is responsible for the Author contributions: B.N., A.M.E., A.S., and A.F.Y. designed research; B.N., S.K., M.P., G.B., synthesis of most of the cellular polyP, using the terminal phosphate E.E., J.O., and A.F.Y. performed research; B.N., S.K., M.P., G.B., E.E., J.O., A.M.E., A.S., A.J., of ATP as substrate (10, 11). The only characterized PPK2 and A.F.Y. analyzed data; and B.N., A.M.E., A.S., A.J., and A.F.Y. wrote the paper. (IPR005660) enzyme, PA0141 from Pseudomonas aeruginosa, uses The authors declare no conflict of interest. polyP as a substrate to generate GTP from GDP (12). PPK2 shows This article is a PNAS Direct Submission. no sequence similarity to PPK1 and is distinguished by much higher Data deposition: The atomic coordinates have been deposited in the Protein Data Bank, polyP utilization activity (13). The PPK2 enzyme PA0141 from P. www.pdb.org (PDB ID codes 3CZP and 3CZQ). aeruginosa preferentially phosphorylates GDP to GTP, whereas its 1To whom correspondence may be addressed. E-mail: [email protected] or a.iakounine@ affinity for ADP is 2.5 times lower (12, 13). Because the expression utoronto.ca. of PA0141 in P. aeruginosa cells is increased Ͼ100 times during the This article contains supporting information online at www.pnas.org/cgi/content/full/ stationary growth phase, it has been suggested that this enzyme 0807563105/DCSupplemental. functions in the generation of GTP for the synthesis of alginate, an © 2008 by The National Academy of Sciences of the USA 17730–17735 ͉ PNAS ͉ November 18, 2008 ͉ vol. 105 ͉ no. 46 www.pnas.org͞cgi͞doi͞10.1073͞pnas.0807563105 Downloaded by guest on September 30, 2021 Fig. 1. Structure-based sequence align- ment of the PPK2 domains of the proteins containing 1 or 2 PPK2 domains. Residues conserved in all PPK2 proteins are high- lighted in black. The secondary structure elements of the PA3455 C-terminal PPK2 domain and SMc02148 are shown above and below the alignment, respectively. The Walker A motif is designated by balls, the Walker B motif is indicated by aster- isks, and the lid module is indicated by the BIOCHEMISTRY thick line. The single PPK2 domain pro- teins (short PPK2) comprise SMc02148 (Q92SA6), PA2148 (Q9I154), PA0141 (Q9I6Z1), SMa0670 (Q92ZU4), and SMa0172 (Q930V2). The 2 PPK2 domain proteins (long PPK2) include PA3455 (Q9HYF1; PA3455-N, N-terminal PPK2 do- main; PA3455-C, C-terminal PPK2 domain), and PSPTO1640 (Q886D9; PSPTO1640-N, N- terminal domain; PSPTO1640-C, C-terminal domain). 1-domain PPK2 proteins than their N-terminal domains (Fig. 1). of protein) [supporting information (SI) Fig. S1]. In contrast, both Previous bioinformatics analysis indicated that PPK2 proteins 2-domain PPK2 proteins catalyzed the polyP-dependent phosphor- belong to the large superfamily of P-loop kinases and represent a ylation of AMP and produced ADP as a final product (39.0–40.0 distinct family of predicted kinases closely related to nucleotide ␮mol/min per mg of protein) (Fig. S1). Recently, the polyP:AMP kinases (15). P-loop kinases are characterized by the presence of 2 phosphotransferase PAP from Acinetobacter johnsonii 210A has conserved sequence motifs (Walker A and Walker B) and the lid been shown to phosphorylate AMP in a polyP-dependent reaction (16). module. The Walker A motif (or P-loop, GXXXXGK) binds the ␤- This protein shares 40% sequence identity with PA3455 and contains and ␥-phosphates of ATP, whereas the conserved Asp of the 2 fused PPK2 domains, indicating that it is a 2-domain PPK2 protein. Walker B motif coordinates a Mg2ϩ cation, which is also bound to Both groups of PPK2 proteins were also capable of phosphory- the ␤- and ␥-phosphates of ATP (15). lating GMP to GDP (PA3455 and PSPTO1640) or GDP to GTP (SMc02148, SMa0172, and SMa0670), but this activity was Ϸ3 times Enzymatic Activity of Purified PPK2 Proteins. We overexpressed in lower than that with adenosine nucleotides (Table 1, data shown for Escherichia coli and purified 2 2-domain PPK2 proteins (PA3455 PA3455 and SMc02148). Interestingly, the previously characterized from P. aeruginosa and PSPTO1640 from P. syringae pv. tomato) PA0141 has been shown to prefer GDP over ADP as a substrate and 6 1-domain PPK2 proteins (PA2428 from P.
Recommended publications
  • Chuanxiong Rhizoma Compound on HIF-VEGF Pathway and Cerebral Ischemia-Reperfusion Injury’S Biological Network Based on Systematic Pharmacology
    ORIGINAL RESEARCH published: 25 June 2021 doi: 10.3389/fphar.2021.601846 Exploring the Regulatory Mechanism of Hedysarum Multijugum Maxim.-Chuanxiong Rhizoma Compound on HIF-VEGF Pathway and Cerebral Ischemia-Reperfusion Injury’s Biological Network Based on Systematic Pharmacology Kailin Yang 1†, Liuting Zeng 1†, Anqi Ge 2†, Yi Chen 1†, Shanshan Wang 1†, Xiaofei Zhu 1,3† and Jinwen Ge 1,4* Edited by: 1 Takashi Sato, Key Laboratory of Hunan Province for Integrated Traditional Chinese and Western Medicine on Prevention and Treatment of 2 Tokyo University of Pharmacy and Life Cardio-Cerebral Diseases, Hunan University of Chinese Medicine, Changsha, China, Galactophore Department, The First 3 Sciences, Japan Hospital of Hunan University of Chinese Medicine, Changsha, China, School of Graduate, Central South University, Changsha, China, 4Shaoyang University, Shaoyang, China Reviewed by: Hui Zhao, Capital Medical University, China Background: Clinical research found that Hedysarum Multijugum Maxim.-Chuanxiong Maria Luisa Del Moral, fi University of Jaén, Spain Rhizoma Compound (HCC) has de nite curative effect on cerebral ischemic diseases, *Correspondence: such as ischemic stroke and cerebral ischemia-reperfusion injury (CIR). However, its Jinwen Ge mechanism for treating cerebral ischemia is still not fully explained. [email protected] †These authors share first authorship Methods: The traditional Chinese medicine related database were utilized to obtain the components of HCC. The Pharmmapper were used to predict HCC’s potential targets. Specialty section: The CIR genes were obtained from Genecards and OMIM and the protein-protein This article was submitted to interaction (PPI) data of HCC’s targets and IS genes were obtained from String Ethnopharmacology, a section of the journal database.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Deoxythymidylate Kinase, DTYMK, Is a Novel Gene for Mitochondrial DNA
    Clinica Chimica Acta 496 (2019) 93–99 Contents lists available at ScienceDirect Clinica Chimica Acta journal homepage: www.elsevier.com/locate/cca Deoxythymidylate kinase, DTYMK, is a novel gene for mitochondrial DNA depletion syndrome T ⁎ Ching-wan Lama,c, , Wai-Lan Yeungb, Tsz-ki Linga, Ka-chung Wonga, Chun-yiu Lawa a Department of Pathology, Queen Mary Hospital, Hong Kong, China b Department of Paediatrics, Hong Kong Children Hospital, Hong Kong, China c Department of Pathology, The University of Hong Kong, Hong Kong, China ARTICLE INFO ABSTRACT Keywords: Background: Mitochondrial DNA depletion syndrome is a group of heterogeneous diseases with non-specific DTYMK presentation. The common feature is the quantitative depletion of mitochondrial DNA without qualitative de- Clinical whole-exome sequencing fects. Diagnosis of these diseases poses a challenge and whole exome sequencing is often needed for their di- Mitochondrial DNA depletion syndrome agnoses. Salvage pathway Case: Two siblings of a quartet family, presenting with hypotonia, microcephaly and severe intellectual dis- ability, have been diagnosed to harbor two heterozygous variants in trans in the DTYMK gene of the thymidine biosynthesis pathway. Mitochondrial DNA depletion has been demonstrated in silico in the more severe sibling. Conclusions: We suggest the consideration of incorporating DTYMK as one of the associated genes of mi- tochondrial DNA depletion syndrome (MDDS). DTYMK may be the missing link in the mitochondrial nucleotide salvage pathway but further characterization and additional evidence would be needed. 1. Introduction converge onto genes regulating several common pathways: mtDNA synthesis/transcription (POLG, POLG2, TWNK, TFAM, RNASEH1, Mitochondrial DNA depletion syndrome (MDDS) has been described MGME1 and DNA2), mitochondrial/cytosol nucleotide maintenance as the quantitative defects in the spectrum of mitochondrial DNA (ABAT, AGK, DGUOK, MPV17, RRM2B, SLC25A4, SUCLA2, SUCLG1, maintenance disorders [1].
    [Show full text]
  • Substrate Recognition and Mechanism Revealed by Ligand-Bound Polyphosphate Kinase 2 Structures
    Substrate recognition and mechanism revealed by ligand-bound polyphosphate kinase 2 structures Alice E. Parnella,1, Silja Mordhorstb,1, Florian Kemperc, Mariacarmela Giurrandinoa, Josh P. Princea, Nikola J. Schwarzerc, Alexandre Hoferd, Daniel Wohlwendc, Henning J. Jessend,e, Stefan Gerhardtc, Oliver Einslec,f, Petra C. F. Oystong,h, Jennifer N. Andexerb,2, and Peter L. Roacha,g,2 aChemistry, University of Southampton, Southampton, Hampshire SO17 1BJ, United Kingdom; bInstitute of Pharmaceutical Sciences, Albert-Ludwigs- University Freiburg, 79104 Freiburg, Germany; cInstitute of Biochemistry, Albert-Ludwigs-University Freiburg, 79104 Freiburg, Germany; dOrganic Chemistry Institute, University of Zürich, 8057 Zürich, Switzerland; eInstitute of Organic Chemistry, Albert-Ludwigs-University Freiburg, 79104 Freiburg, Germany; fBioss Centre for Biological Signalling Studies, Albert-Ludwigs-University Freiburg, 79104 Freiburg, Germany; gInstitute for Life Sciences, University of Southampton, Southampton, Hampshire SO17 1BJ, United Kingdom; and hBiomedical Sciences, Defence Science and Technology Laboratory Porton Down, SP4 0JQ Salisbury, United Kingdom Edited by David Avram Sanders, Purdue University, West Lafayette, IN, and accepted by Editorial Board Member Gregory A. Petsko February 13, 2018 (received for review June 20, 2017) Inorganic polyphosphate is a ubiquitous, linear biopolymer built of mechanism is proposed to proceed via a phosphorylated enzyme up to thousands of phosphate residues that are linked by energy- intermediate (8), which
    [Show full text]
  • Stem Cells® Original Article
    ® Stem Cells Original Article Properties of Pluripotent Human Embryonic Stem Cells BG01 and BG02 XIANMIN ZENG,a TAKUMI MIURA,b YONGQUAN LUO,b BHASKAR BHATTACHARYA,c BRIAN CONDIE,d JIA CHEN,a IRENE GINIS,b IAN LYONS,d JOSEF MEJIDO,c RAJ K. PURI,c MAHENDRA S. RAO,b WILLIAM J. FREEDa aCellular Neurobiology Research Branch, National Institute on Drug Abuse, Department of Health and Human Services (DHHS), Baltimore, Maryland, USA; bLaboratory of Neuroscience, National Institute of Aging, DHHS, Baltimore, Maryland, USA; cLaboratory of Molecular Tumor Biology, Division of Cellular and Gene Therapies, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, Maryland, USA; dBresaGen Inc., Athens, Georgia, USA Key Words. Embryonic stem cells · Differentiation · Microarray ABSTRACT Human ES (hES) cell lines have only recently been compared with pooled human RNA. Ninety-two of these generated, and differences between human and mouse genes were also highly expressed in four other hES lines ES cells have been identified. In this manuscript we (TE05, GE01, GE09, and pooled samples derived from describe the properties of two human ES cell lines, GE01, GE09, and GE07). Included in the list are genes BG01 and BG02. By immunocytochemistry and reverse involved in cell signaling and development, metabolism, transcription polymerase chain reaction, undifferenti- transcription regulation, and many hypothetical pro- ated cells expressed markers that are characteristic of teins. Two focused arrays designed to examine tran- ES cells, including SSEA-3, SSEA-4, TRA-1-60, TRA-1- scripts associated with stem cells and with the 81, and OCT-3/4. Both cell lines were readily main- transforming growth factor-β superfamily were tained in an undifferentiated state and could employed to examine differentially expressed genes.
    [Show full text]
  • Chromosomal Microarray Analysis in Turkish Patients with Unexplained Developmental Delay and Intellectual Developmental Disorders
    177 Arch Neuropsychitry 2020;57:177−191 RESEARCH ARTICLE https://doi.org/10.29399/npa.24890 Chromosomal Microarray Analysis in Turkish Patients with Unexplained Developmental Delay and Intellectual Developmental Disorders Hakan GÜRKAN1 , Emine İkbal ATLI1 , Engin ATLI1 , Leyla BOZATLI2 , Mengühan ARAZ ALTAY2 , Sinem YALÇINTEPE1 , Yasemin ÖZEN1 , Damla EKER1 , Çisem AKURUT1 , Selma DEMİR1 , Işık GÖRKER2 1Faculty of Medicine, Department of Medical Genetics, Edirne, Trakya University, Edirne, Turkey 2Faculty of Medicine, Department of Child and Adolescent Psychiatry, Trakya University, Edirne, Turkey ABSTRACT Introduction: Aneuploids, copy number variations (CNVs), and single in 39 (39/123=31.7%) patients. Twelve CNV variant of unknown nucleotide variants in specific genes are the main genetic causes of significance (VUS) (9.75%) patients and 7 CNV benign (5.69%) patients developmental delay (DD) and intellectual disability disorder (IDD). were reported. In 6 patients, one or more pathogenic CNVs were These genetic changes can be detected using chromosome analysis, determined. Therefore, the diagnostic efficiency of CMA was found to chromosomal microarray (CMA), and next-generation DNA sequencing be 31.7% (39/123). techniques. Therefore; In this study, we aimed to investigate the Conclusion: Today, genetic analysis is still not part of the routine in the importance of CMA in determining the genomic etiology of unexplained evaluation of IDD patients who present to psychiatry clinics. A genetic DD and IDD in 123 patients. diagnosis from CMA can eliminate genetic question marks and thus Method: For 123 patients, chromosome analysis, DNA fragment analysis alter the clinical management of patients. Approximately one-third and microarray were performed. Conventional G-band karyotype of the positive CMA findings are clinically intervenable.
    [Show full text]
  • A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family
    Rockefeller University Digital Commons @ RU Student Theses and Dissertations 2018 A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family Linda Molla Follow this and additional works at: https://digitalcommons.rockefeller.edu/ student_theses_and_dissertations Part of the Life Sciences Commons A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY A Thesis Presented to the Faculty of The Rockefeller University in Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy by Linda Molla June 2018 © Copyright by Linda Molla 2018 A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY Linda Molla, Ph.D. The Rockefeller University 2018 APOBEC2 is a member of the AID/APOBEC cytidine deaminase family of proteins. Unlike most of AID/APOBEC, however, APOBEC2’s function remains elusive. Previous research has implicated APOBEC2 in diverse organisms and cellular processes such as muscle biology (in Mus musculus), regeneration (in Danio rerio), and development (in Xenopus laevis). APOBEC2 has also been implicated in cancer. However the enzymatic activity, substrate or physiological target(s) of APOBEC2 are unknown. For this thesis, I have combined Next Generation Sequencing (NGS) techniques with state-of-the-art molecular biology to determine the physiological targets of APOBEC2. Using a cell culture muscle differentiation system, and RNA sequencing (RNA-Seq) by polyA capture, I demonstrated that unlike the AID/APOBEC family member APOBEC1, APOBEC2 is not an RNA editor. Using the same system combined with enhanced Reduced Representation Bisulfite Sequencing (eRRBS) analyses I showed that, unlike the AID/APOBEC family member AID, APOBEC2 does not act as a 5-methyl-C deaminase.
    [Show full text]
  • Genome-Wide Analysis of Nutrient Signaling Pathways Conserved in Arbuscular Mycorrhizal Fungi
    microorganisms Article Genome-Wide Analysis of Nutrient Signaling Pathways Conserved in Arbuscular Mycorrhizal Fungi Xiaoqin Zhou 1 , Jiangyong Li 2 , Nianwu Tang 3 , Hongyun Xie 1 , Xiaoning Fan 1 , Hui Chen 1 , Ming Tang 1,* and Xianan Xie 1,* 1 State Key Laboratory of Conservation and Utilization of Subtropical Agro-Bioresources, Lingnan Guangdong Laboratory of Modern Agriculture, Guangdong Key Laboratory for Innovative Development and Utilization of Forest Plant Germplasm, College of Forestry and Landscape Architecture, South China Agricultural University, Guangzhou 510642, China; [email protected] (X.Z.); [email protected] (H.X.); [email protected] (X.F.); [email protected] (H.C.) 2 Institute for Environmental and Climate Research, Jinan University, Guangzhou 511443, China; [email protected] 3 UMR Interactions Arbres/Microorganismes, Centre INRA-Grand Est-Nancy, 54280 Champenoux, France; [email protected] * Correspondence: [email protected] (M.T.); [email protected] (X.X.); Tel.: +86-137-0922-9152 (M.T.); +86-159-1855-2425 (X.X.) Abstract: Arbuscular mycorrhizal (AM) fungi form a mutualistic symbiosis with a majority of terrestrial vascular plants. To achieve an efficient nutrient trade with their hosts, AM fungi sense external and internal nutrients, and integrate different hierarchic regulations to optimize nutrient acquisition and homeostasis during mycorrhization. However, the underlying molecular networks in AM fungi orchestrating the nutrient sensing and signaling remain elusive. Based on homology search, we here found that at least 72 gene components involved in four nutrient sensing and signaling Citation: Zhou, X.; Li, J.; Tang, N.; pathways, including cAMP-dependent protein kinase A (cAMP-PKA), sucrose non-fermenting 1 Xie, H.; Fan, X.; Chen, H.; Tang, M.; (SNF1) protein kinase, target of rapamycin kinase (TOR) and phosphate (PHO) signaling cascades, are Xie, X.
    [Show full text]
  • Consolidated List of Up-Regulated Proteins Expressed at Different Cr (VI) Concentrations at Time Points
    Electronic Supplementary Material (ESI) for Metallomics.
    [Show full text]
  • Genome-Wide Linkage Analysis of Human Auditory Cortical Activation Suggests Distinct Loci on Chromosomes 2, 3, and 8
    The Journal of Neuroscience, October 17, 2012 • 32(42):14511–14518 • 14511 Behavioral/Systems/Cognitive Genome-Wide Linkage Analysis of Human Auditory Cortical Activation Suggests Distinct Loci on Chromosomes 2, 3, and 8 Hanna Renvall,1* Elina Salmela,2,3* Minna Vihla,1 Mia Illman,1 Eira Leinonen,2,3 Juha Kere,2,3,4 and Riitta Salmelin1 1Brain Research Unit and MEG Core, O.V. Lounasmaa Laboratory, Aalto University, FI-00076 Aalto, Finland, 2Department of Medical Genetics, Haartman Institute, and Research Programs Unit, Molecular Medicine, University of Helsinki, FI-00014 Helsinki, Finland, 3Folkha¨lsan Institute of Genetics, FI-00014 Helsinki, Finland, and 4Department of Biosciences and Nutrition, and Science for Life Laboratory, Karolinska Institute, SE-14183 Stockholm, Sweden Neural processes are explored through macroscopic neuroimaging and microscopic molecular measures, but the two levels remain primarily detached. The identification of direct links between the levels would facilitate use of imaging signals as probes of genetic function and, vice versa, access to molecular correlates of imaging measures. Neuroimaging patterns have been mapped for a few isolated genes,chosenbasedontheirconnectionwithaclinicaldisorder.Hereweproposeanapproachthatallowsanunrestricteddiscoveryofthe genetic basis of a neuroimaging phenotype in the normal human brain. The essential components are a subject population that is composed of relatives and selection of a neuroimaging phenotype that is reproducible within an individual and similar between relatives but markedly variable across a population. Our present combined magnetoencephalography and genome-wide linkage study in 212 healthy siblings demonstrates that auditory cortical activation strength is highly heritable and, specifically in the right hemisphere, regulatedoligogenicallywithlinkagestochromosomes2q37,3p12,and8q24.TheidentifiedregionsdelimitascandidategenesTRAPPC9, operating in neuronal differentiation, and ROBO1, regulating projections of thalamocortical axons.
    [Show full text]
  • New Insights on Human Essential Genes Based on Integrated Multi
    bioRxiv preprint doi: https://doi.org/10.1101/260224; this version posted February 5, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. New insights on human essential genes based on integrated multi- omics analysis Hebing Chen1,2, Zhuo Zhang1,2, Shuai Jiang 1,2, Ruijiang Li1, Wanying Li1, Hao Li1,* and Xiaochen Bo1,* 1Beijing Institute of Radiation Medicine, Beijing 100850, China. 2 Co-first author *Correspondence: [email protected]; [email protected] Abstract Essential genes are those whose functions govern critical processes that sustain life in the organism. Comprehensive understanding of human essential genes could enable breakthroughs in biology and medicine. Recently, there has been a rapid proliferation of technologies for identifying and investigating the functions of human essential genes. Here, according to gene essentiality, we present a global analysis for comprehensively and systematically elucidating the genetic and regulatory characteristics of human essential genes. We explain why these genes are essential from the genomic, epigenomic, and proteomic perspectives, and we discuss their evolutionary and embryonic developmental properties. Importantly, we find that essential human genes can be used as markers to guide cancer treatment. We have developed an interactive web server, the Human Essential Genes Interactive Analysis Platform (HEGIAP) (http://sysomics.com/HEGIAP/), which integrates abundant analytical tools to give a global, multidimensional interpretation of gene essentiality. bioRxiv preprint doi: https://doi.org/10.1101/260224; this version posted February 5, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • Carboxylase Activation Under Aerobic Conditions.Pdf
    IN VIVO AND IN VITRO FMN PRENYLATION AND (DE)CARBOXYLASE ACTIVATION UNDER AEROBIC CONDITIONS Khorcheska A. Batyrova, University of Toronto, Canada [email protected] Anna Khusnutdinova, University of Toronto, Canada Peter Stogios, University of Toronto, Canada Tatiana Skarina, University of Toronto, Canada Alexei Savchenko, University of Toronto, Canada Alexander Yakunin, University of Toronto, Canada Key Words: prenylated FMN, FMN prenyltransferase, UbiX, UbiD, ferulic acid decarboxylase, cofactor regeneration Prenylated FMN (prFMN) is a newly discovered redox cofactor required for activity of the large family of reversible UbiD (de)carboxylases involved in biotransformation of aromatic, heteroaromatic, and unsaturated aliphatic acids (White et al., 2015). Despite the growing demand for decarboxylases in the pulp/paper industry and in forest biorefineries, the vast majority of UbiD-like decarboxylases remain uncharacterized. Functional characterization of the novel UbiD decarboxylases is hindered by the lack of prFMN generating system. prFMN cofactor is synthesized by the UbiX family of FMN prenyltransferases, which use reduced FMN as substrate under anaerobic conditions and dimethylallyl-monophosphate (DMAP) as the prenyl group donor. Here, we report the in vivo and in vitro biosynthesis of prFMN and UbiD activation under aerobic conditions. For in vivo biosynthesis, we used newly discovered UbiX proteins from Salmonella typhimurium and Klebsiella pneumonia, which activated ferulic acid UbiD decarboxylase Fdc1 from Aspergillus niger under aerobic conditions (0.5-1.5 U/mg). For in vitro biosynthesis of prFMN and UbiD activation, we established a one-pot enzyme cascade system that uses prenol, polyphosphate, formate, and riboflavin as starting substrates and (re)generates DMAP, ATP, FMN and NADH.
    [Show full text]