Supplementary Table I. Morpholino Oligonucleotides and Primer Sequences Used in This Study
Supplementary Table I. Morpholino oligonucleotides and primer sequences used in this study
Oligonucleotide Name Accession Sequence
Morpholinos tlr5a AY389449 5'-AAAGTGTATGTAGCTGCCATTCTGG tlr5b AY389450 5'-TGAATGTATATCCCATTCTGTGAGC myd88 AY388401 5'-TAGCAAAACCTCTGTTATCCAGCGA myd88 5bp mismatch AY388401 5'-TAcCAtAACCTgTGTTATCgAGgGA standard control morpholino 5'-CCTCTTACCTCAGTTACAATTTATA qRT-PCR ppial-qP1-Fw AY391451 5’- ACACTGAAACACGGAGGCAAAG ppial-qP2-Rev 5’- CATCCACAACCTTCCCGAACAC irak3-qP1-Fw CK026195 5’- TGAGGTCTACTGTGGACGATGG irak3-qP2-Rev 5’- ATGTTAGGATGCTGGTTGAGTTGG tlr5a-qP1-Fw AY389449 5’-ATTCTGGTGGTGCTTGTTGTAG tlr5a-qP2-Rev 5’-ACGAGGTAACTTCTGTTCTCAATG tlr5b-qP3-Fw AY389450 5’-GCGTTGTTGAAGAGGCTGGAC tlr5b-qP4-Rev 5’-TTCTGGATGGCCACTTCTCATATTGG mmp9-qP3-Fw NM_213123 5’-CATTAAAGATGCCCTGATGTATCCC mmp9-qP4-Rev 5’-AGTGGTGGTCCGTGGTTGAG il1b-qP1-Fw NM_212844 5’-GAACAGAATGAAGCACATCAAACC il1b-qP2-Rev 5’-ACGGCACTGAATCCACCAC il8-qP1-Fw XM_001342570 5’-TGTGTTATTGTTTTCCTGGCATTTC il8-qP2-Rev 5’-GCGACAGCGTGGATCTACAG ifn1-qP3-Fw NM_207640 5’- TTAATACACGCAAAGATGAGAACTC ifn1-qP4-Rev 5’- GCCAAGCCATTCGCAAGTAG tnfa-qP5-Fw NM_212829 5’- AGACCTTAGACTGGAGAGATGAC tnfa-qP6-Rev 5’- CAAAGACACCTGGCTGTAGAC cxcl-C1c-qP1-Fw NM_001115060 5’- GGCATTCACACCCAAAGCG cxcl-C1c-qP2_Rev 5’- GCGAGCACGATTCACGAGAG * In situ ccl-C5a-Fw NM_001082906 5’- CATCACTAGGAAAGGATTGAAC ccl-C5a-Rev-T7 5’- TAATACGACTCACTATAGGGGATGTCAAAGACTTTATTCAC cxcl-C1c-Fw NM_001115060 5’- GTTAAACATAAATAACACCGACTC cxcl-C1c-Rev-T7 5’- TAATACGACTCACTATAGGGACACCCTATAAAACTGAGTA irak3-Fw CK026195 5’- CAGTGAGAGAGGCATGAAACATC irak3-Rev-T7 5’- TAATACGACTCACTATAGGGGCAGCTTTGGTCACCAGAGTG socs3-Fw NM_199950 5’- CACTGTTTCTCCATCATCATCAG socs3-Rev-T7 5’- TAATACGACTCACTATAGGGGTCTACGAGTTGTTTCTCAACAG
* The T7 promoter sequence was placed at the 5’ end of the in situ reverse primer and is indicated in italics.
Supplementary Table II. UniGene clusters up-regulated upon S. typhimurium wt and/or S. typhimurium Ra infection*
Gene Description UniGene Code Entrez GeneID Ra 2h Ra 2h Ra 5h Ra 5h Ra 8h Ra 8h Ra 24h Ra 24h wt 2h wt 2h wt 5h wt 5h wt 8h wt 8h wt 24h wt 24h Symbol (build # 105) Fold Change P-value Fold Change P-value Fold Change P-value Fold Change P-value Fold Change P-value Fold Change P-value Fold Change P-value Fold Change P-value 9-Sep Septin 9 Dr.121586 337243 2.156 1.25E-16 aanat2 Arylalkylamine N-acetyltransferase Dr.81299 30685 1.728 5.27E-17 aars Alanyl-tRNA synthetase Dr.75848 324940 4.080 0.00E+00 abat 4-aminobutyrate aminotransferase Dr.76989 378968 2.192 0.00E+00
ATP-binding cassette, sub-family A abca12 Dr.75341 321215 1.852 7.80E-16 (ABC1), member 12 ATP-binding cassette, sub-family B abcb3 Dr.88570 30695 4.488 3.45E-09 7.622 2.45E-39 6.005 1.93E-11 4.110 1.49E-25 12.152 2.80E-45 33.977 0.00E+00 (MDR/TAP), member 3 ATP-binding cassette, sub-family C abcc2 Dr.24063 393561 2.265 3.38E-24 (CFTR/MRP), member 2 ATP-binding cassette, sub-family D abcd1 Dr.103366 566367 2.211 7.36E-11 (ALD), member 1 ATP-binding cassette, sub-family F abcf1 Dr.32961 406467 3.295 0.00E+00 (GCN20), member 1 abhd4 Abhydrolase domain containing 4 Dr.81194 550276 4.515 0.00E+00 abi1 Abl-interactor 1 Dr.107659 393711 1.938 2.93E-07 Amiloride-sensitive cation channel accn2b Dr.98481 407671 2.813 6.56E-07 2 b
Angiotensin I converting enzyme ace2 Dr.76987 492331 3.944 7.52E-06 (peptidyl-dipeptidase A) 2 aco1 Aconitase 1, soluble Dr.40063 568448 1.962 7.24E-09 2.826 4.76E-08 1.902 2.03E-07 3.323 1.42E-24 Acyl-CoA synthetase long-chain acsl4 Dr.78711 393622 1.655 1.84E-16 family member 4 ada Adenosine deaminase Dr.120392 436919 3.743 2.49E-12 3.864 6.58E-13 A disintegrin and metalloproteinase adam8 Dr.86401 368917 1.965 0.00E+00 1.589 9.68E-23 1.606 0.00E+00 2.643 0.00E+00 6.805 0.00E+00 domain 8 adcy6 Adenylate cyclase 6 Dr.42208 570652 1.545 4.64E-07 add3 Adducin 3 (gamma) Dr.10904 556762 1.561 0.00E+00 adipor2 Adiponectin receptor 2 Dr.114625 560140 1.768 6.79E-20 adora2b Adenosine A2b receptor Dr.141253 560100 4.104 1.82E-11 agk Acylglycerol kinase Dr.80681 334270 1.557 5.00E-05 1-acylglycerol-3-phosphate O- agpat3 Dr.75961 406734 1.615 4.00E-05 1.508 6.67E-07 acyltransferase 3
1-acylglycerol-3-phosphate O- agpat4 acyltransferase 4 (lysophosphatidic Dr.78538 406265 1.668 3.10E-16 acid acyltransferase, delta) agt Angiotensinogen Dr.3585 322485 5.100 0.00E+00 Aminolevulinate, delta-, synthetase alas1 Dr.4829 64608 2.562 0.00E+00 1 Aldehyde dehydrogenase 2 family aldh2 Dr.28434 393462 3.575 3.69E-24 2.359 1.82E-08 (mitochondrial) Aldehyde dehydrogenase 3 family, aldh3d1 Dr.76675 282559 2.067 5.62E-07 member D1 aldoc Aldolase c, fructose-bisphosphate Dr.19223 369193 2.694 3.58E-16
Asparagine-linked glycosylation 2 alg2 homolog (S. cerevisiae, alpha-1,3- Dr.83082 403068 2.826 1.12E-15 mannosyltransferase)
Asparagine-linked glycosylation 5 alg5 homolog (yeast, dolichyl-phosphate Dr.75542 334646 1.611 9.74E-27 beta-glucosyltransferase) alox12 Arachidonate 12-lipoxygenase Dr.132326 322732 1.702 1.46E-14 Adenosine monophosphate ampd3 Dr.11670 333997 1.839 1.32E-12 deaminase 3 amt Aminomethyltransferase Dr.121883 450000 1.854 2.75E-10 ankh Ankylosis, progressive homolog Dr.4277 323738 1.540 1.60E-21 anxa13 Annexin A13 Dr.11764 81880 3.661 0.00E+00 anxa2a Annexin A2a Dr.75997 325557 4.645 2.16E-43 anxa4 Annexin A4 Dr.91161 353362 3.382 1.59E-17 anxa5 Annexin A5 Dr.75805 337132 1.892 5.49E-09 apaf1 Apoptotic protease activating factor Dr.78833 58131 2.157 0.00E+00
Amyloid beta (A4) precursor protein- apbb1ip binding, family B, member 1 Dr.88358 393607 1.995 1.56E-17 2.764 1.61E-13 interacting protein apoa1 Apolipoprotein A-I Dr.75775 30355 1.633 6.70E-09 arg2 Arginase, type II Dr.77297 322614 1.635 1.03E-18 16.086 0.00E+00 Rho guanine nucleotide exchange arhgef1 Dr.133654 368266 1.591 3.00E-05 3.261 1.52E-34 factor (GEF) 1 Rho/rac guanine nucleotide arhgef18 Dr.32570 407987 1.694 1.02E-10 exchange factor (GEF) 18 ADP-ribosylation factor-like 2 arl2bp Dr.110760 393976 1.696 9.50E-07 1.522 5.00E-05 binding protein arl8b ADP-ribosylation factor-like 8B Dr.78116 337424 2.045 6.97E-26 arrdc1 Arrestin domain containing 1 Dr.114902 378740 1.603 4.49E-10 arrdc2 Arrestin domain containing 2 Dr.26118 335206 4.595 1.33E-08 arrdc3 Arrestin domain containing 3 Dr.103751 324193 3.986 0.00E+00 asns Asparagine synthetase Dr.25168 394138 1.687 1.03E-10 4.061 2.97E-36 aspn Asporin (LRR class 1) Dr.81771 65228 1.506 4.33E-09 1.595 7.15E-08 1.774 3.42E-13 2.227 1.65E-11 atf3 Activating transcription factor 3 Dr.77523 393939 2.134 4.46E-20 2.501 2.00E-05 2.720 4.97E-21 2.721 0.00E+00 7.882 5.23E-20 33.665 0.00E+00 atg4c Autophagy-related 4C (yeast) Dr.121931 415193 1.803 2.00E-05 2.261 4.92E-10 atoh1a Atonal homolog 1a Dr.566 30303 1.718 1.82E-12 ATPase, Na+/K+ transporting, atp1a1 Dr.75307 64612 1.512 3.00E-05 alpha 1 polypeptide ATPase, Ca++ transporting, atp2a2a Dr.16838 393940 1.868 1.50E-15 cardiac muscle, slow twitch 2a ATPase, H+ transporting, atp6ap1 Dr.76858 195824 1.930 4.09E-40 lysosomal accessory protein 1 ATPase, H+ transporting, atp6ap2 Dr.120094 406296 1.527 1.78E-07 lysosomal accessory protein 2
ATPase, H+ transporting, atp6v0a1 Dr.114200 324307 2.315 1.80E-09 lysosomal V0 subunit a isoform 1
ATPase, H+ transporting, V0 atp6v0d1 Dr.77332 322811 1.755 4.84E-33 subunit D isoform 1 ATPase, H+ transporting, atp6v1a Dr.9240 337583 1.719 4.55E-14 lysosomal 70kDa, V1 subunit A
ATPase, H+ transporting, atp6v1b2 Dr.132618 359840 1.604 2.00E-05 2.359 3.16E-10 1.597 2.29E-06 2.432 3.25E-11 lysosomal 56/58kDa, V1 subunit B2
ATPase, H+ transporting, atp6v1c1 Dr.106389 368907 1.594 1.05E-06 lysosomal, V1 subunit C, isoform 1
ATPase, H+ transporting, atp6v1c1l lysosomal, V1 subunit C, isoform 1, Dr.14847 449655 1.530 1.39E-23 like
ATPase, Cu++ transporting, alpha atp7a Dr.21520 564924 2.114 6.27E-10 polypeptide (Menkes syndrome)
AU RNA binding protein/enoyl- auh Dr.2043 445182 1.862 5.00E-05 Coenzyme A hydratase Apoptosis, caspase activation aven Dr.21346 561418 1.521 3.80E-09 inhibitor
UDP-GlcNAc:betaGal beta-1,3-N- b3gnt5 Dr.76667 336526 1.561 3.00E-05 acetylglucosaminyltransferase 5
UDP-GlcNAc:betaGal beta-1,3-N- b3gnt7 Dr.14659 286748 3.791 1.48E-06 acetylglucosaminyltransferase 7 bag3 BCL2-associated athanogene 3 Dr.79182 445139 2.514 6.62E-24 baiap2l1a BAI1-associated protein 2-like 1a Dr.81674 387261 2.074 1.11E-39 baiap2l1b BAI1-associated protein 2-like 1b Dr.108513 550528 4.861 4.25E-12 bax Bcl2-associated X protein Dr.78968 58081 2.158 0.00E+00 Bromodomain adjacent to zinc baz1a Dr.36447 334173 1.604 1.55E-13 finger domain, 1A bbc3 BCL2 binding component 3 Dr.26003 751763 5.717 8.14E-10 Putative breast adenocarcinoma bc2 Dr.117290 406838 2.185 1.16E-36 marker bcan Brevican Dr.80617 334113 6.339 4.02E-07 B-cell receptor-associated protein bcap31 Dr.78455 368488 1.711 2.90E-36 31 Breast carcinoma amplified bcas3 Dr.27111 393594 2.181 2.60E-27 sequence 3 Branched chain aminotransferase bcat1 Dr.80309 337412 1.858 3.33E-07 5.481 0.00E+00 1, cytosolic Beta-carotene 15, 15-dioxygenase bcdo2 Dr.82050 678554 2.858 1.40E-20 2 B-cell CLL/lymphoma 6 (zinc finger bcl6 Dr.115290 393707 1.735 5.01E-09 protein 51) bdnf Brain-derived neurotrophic factor Dr.132862 58118 2.825 3.41E-16
Basic helix-loop-helix domain bhlhb2 Dr.78721 324413 2.893 4.73E-42 containing, class B, 2 Basic helix-loop-helix domain bhlhb3l Dr.85246 563771 4.433 1.31E-12 containing, class B, 3 like BH3 interacting domain death bida Dr.84878 559425 1.569 1.79E-09 3.239 5.47E-10 agonist BCL2-interacting killer (apoptosis- bik Dr.82304 564030 2.726 5.00E-05 inducing) bin1 Bridging integrator 1 Dr.132574 368232 1.713 5.00E-05 bin2l Bridging integrator 2, like Dr.79119 327387 6.873 0.00E+00 birc2 Baculoviral IAP repeat-containing 2 Dr.77093 373107 2.215 1.74E-26 birc4 Baculoviral IAP repeat-containing 4 Dr.77503 373108 1.638 1.26E-19
Baculoviral IAP repeat-containing birc5b Dr.74012 246726 1.848 6.33E-27 5B bmp2b Bone morphogenetic protein 2b Dr.568 30632 1.560 5.78E-12 1.674 4.18E-06 bmp8 Bone morphogenetic protein 8 Dr.108511 378445 1.559 1.00E-05 BCL2/adenovirus E1B interacting bnip3l Dr.78270 554650 1.513 4.00E-05 protein 3-like bokb BCL2-related ovarian killer b Dr.18807 394160 1.570 9.24E-09 bop1 Block of proliferation 1 Dr.12295 777627 1.558 6.00E-05 BRF1 homolog, subunit of RNA brf1 polymerase III transcription Dr.20342 334402 3.147 1.35E-33 4.493 4.00E-05 initiation factor IIIB btbd2 BTB (POZ) domain containing 2 Dr.107582 373096 2.333 4.10E-06 btbd9 BTB (POZ) domain containing 9 Dr.33593 431745 1.689 1.58E-29 btg1 B-cell translocation gene 1 Dr.141515 114432 2.461 1.13E-26 btg1 B-cell translocation gene 1 Dr.75505 114432 2.544 3.97E-10 btg2 B-cell translocation gene 2 Dr.76624 30079 1.846 3.00E-05 Basic leucine zipper and W2 bzw1l Dr.76873 406812 2.539 6.85E-06 domains 1, like Chromosome 10 open reading c10orf11 Dr.81850 553730 2.268 1.03E-18 frame 11 Chromosome 15 open reading c15orf15 Dr.1208 406266 1.958 2.72E-14 frame 15 (H. sapiens) Core 1 synthase, glycoprotein-N- c1galt1 acetylgalactosamine 3-beta- Dr.6223 337131 2.062 6.20E-11 galactosyltransferase, 1 c1galt1c1 C1GALT1-specific chaperone 1 Dr.117950 324052 1.828 2.51E-26 Chromosome 20 open reading c20orf149l Dr.78272 336303 2.220 3.20E-18 frame 149, like Chromosome 20 open reading c20orf45 Dr.115452 378855 2.668 6.16E-13 frame 45 (H. sapiens) Chromosome 2 open reading c2orf24 Dr.75260 334868 1.953 1.80E-09 frame 24 c3b Complement component c3b Dr.21006 30491 2.147 8.96E-08 1.848 2.00E-05 2.625 1.65E-08 c3c Complement component c3c Dr.88584 30492 2.611 4.54E-22 2.244 8.00E-05 3.889 1.44E-13 1.907 2.33E-06 2.281 2.22E-06 3.774 1.02E-12 c6 Complement component 6 Dr.16392 393611 2.330 1.00E-11 2.048 2.56E-06 1.598 4.33E-08 2.469 1.24E-08 2.771 2.88E-22 Chromosome 6 open reading c6orf83 Dr.134087 393343 1.931 9.75E-08 1.955 8.59E-16 frame 83 (H. sapiens) c7 Complement component 7 Dr.105788 282556 5.355 3.00E-05 cab39 Calcium binding protein 39 Dr.75164 406822 2.019 0.00E+00 Calcium channel, voltage- cacng1 Dr.132288 322013 1.536 3.82E-18 1.598 1.66E-10 dependent, gamma subunit 1 calm1b Calmodulin 1b Dr.132819 368217 1.670 4.25E-26 caprin2 Caprin family member 2 Dr.81341 407729 1.894 7.16E-10 cars Cysteinyl-tRNA synthetase Dr.24192 368284 2.387 6.54E-23 Caspase 6, apoptosis-related casp6l1 Dr.90030 449800 1.963 1.18E-06 cysteine peptidase, like 1 Caspase 8, apoptosis-related casp8 Dr.10334 58022 6.302 0.00E+00 cysteine peptidase caspxa Caspase Xa Dr.86735 794756 3.043 6.00E-05 cbs Cystathionine-beta-synthase Dr.76887 266987 4.019 1.74E-36 Chromobox homolog 8 (Pc class cbx8 Dr.81470 404038 1.631 2.29E-08 homolog, Drosophila) ccdc24 Coiled-coil domain containing 24 Dr.105612 541495 2.279 5.53E-09 ccdc43 Coiled-coil domain containing 43 Dr.85117 393631 1.684 1.30E-14 1.507 1.18E-11 ccdc53 Coiled-coil domain containing 53 Dr.82394 393142 2.015 3.56E-10 ccdc65 Coiled-coil domain containing 65 Dr.133171 368824 1.740 1.19E-07 ccdc80 Coiled-coil domain containing 80 Dr.80749 368419 1.780 2.12E-07 ccm2 Cerebral cavernous malformation 2 Dr.107920 436586 2.289 1.79E-06 ccng1 Cyclin G1 Dr.76134 171473 2.052 9.63E-31 cd63 Cd63 antigen Dr.76749 321461 4.606 0.00E+00 cd9l CD9 antigen, like Dr.50843 406737 1.831 8.17E-15 Cell division cycle 123 homolog (S. cdc123 Dr.134594 393694 1.710 3.94E-11 3.065 5.82E-06 cerevisiae) cdh1 Cadherin 1, epithelial Dr.78411 114424 2.751 0.00E+00 CDP-diacylglycerol--inositol 3- cdipt phosphatidyltransferase Dr.81051 404620 1.652 8.77E-23 (phosphatidylinositol synthase) Cyclin-dependent kinase inhibitor cdkn1b Dr.75267 368329 1.953 1.02E-34 1b (p27, kip1) Caudal type homeo box cdx4 Dr.11836 30330 1.536 7.27E-06 3.091 1.09E-29 transcription factor 4 CCAAT/enhancer binding protein cebpb Dr.79988 140814 1.841 2.38E-06 1.878 1.00E-14 3.285 1.61E-14 15.332 0.00E+00 (C/EBP), beta CCAAT/enhancer binding protein cebpd Dr.1280 140817 2.023 6.29E-30 1.813 6.38E-08 1.659 7.92E-11 2.844 3.01E-14 7.307 9.71E-16 (C/EBP), delta CCAAT/enhancer binding protein cebpg Dr.15663 140816 1.775 3.00E-05 4.241 0.00E+00 (C/EBP), gamma cfb Complement factor B Dr.75096 30604 1.686 1.91E-20 2.212 2.17E-07 2.681 0.00E+00 1.594 1.20E-11 2.201 3.32E-09 1.984 5.35E-14 CASP8 and FADD-like apoptosis cflar Dr.82387 373114 2.217 5.75E-14 regulator CGNL1 CGNL1 protein Dr.43999 553350 1.554 2.15E-18 CH211- Hypothetical protein LOC797776 Dr.132691 797776 2.191 4.32E-17 2.928 2.42E-14 2.741 6.89E-10 4.250 4.10E-06 4.097 1.03E-39 133N4.6 CH211- Hypothetical LOC567653 Dr.83751 567653 2.031 8.99E-10 155M12.1 CH211- Novel protein similar to sorting Dr.132718 558917 1.762 3.52E-12 203K16.4 nexin 9 ( snx9 ) CH211- Hypothetical LOC563470 Dr.79188 563470 1.949 3.00E-05 210H11.5 CH211- Novel protein containing a ChaC- Dr.119543 563855 8.751 1.15E-16 7.935 4.55E-07 244P18.4 like protein domain CH211- Novel protein similar to vertebrate Dr.14745 100005760 3.339 0.00E+00 251O16.1 importin family CH211- Similar to CC chemokine SCYA106 Dr.133987 794891 2.392 2.14E-16 2.670 2.94E-09 4.876 1.23E-41 2.522 5.40E-20 6.831 0.00E+00 11.215 0.00E+00 89F7.4 chac Chorea acanthocytosis Dr.19565 378837 1.919 4.05E-06 ChaC, cation transport regulator- chac1 Dr.76600 323237 2.764 1.65E-21 5.774 1.82E-37 like 1 chad Chondroadherin Dr.80402 394038 1.932 9.44E-07 1.541 9.03E-10 Coiled-coil-helix-coiled-coil-helix chchd2l Dr.80153 393740 2.807 4.60E-28 domain containing 2-like chmp1a Chromatin modifying protein 1A Dr.10291 393535 1.552 1.39E-15 chmp4b Chromatin modifying protein 4B Dr.16859 406766 1.823 0.00E+00 chmp5 Chromatin modifying protein 5 Dr.11471 393351 3.579 7.01E-45 chrm5 Cholinergic receptor, muscarinic 5 Dr.94295 561491 1.567 8.36E-17
Cholinergic receptor, nicotinic, chrngl Dr.21772 325080 1.676 2.20E-06 1.641 9.66E-07 3.390 3.01E-07 9.095 0.00E+00 gamma like Ceh-10 homeodomain containing chx10 Dr.75766 64606 1.600 3.00E-05 homolog (C.elegans) Cytokine induced apoptosis ciapin1 Dr.120788 445283 1.678 2.83E-07 inhibitor 1 Cirrhosis, autosomal recessive 1A cirh1a Dr.7926 406571 2.485 0.00E+00 (cirhin) clcn6 Chloride channel 6 Dr.77615 323336 1.704 2.61E-07 cldn7 Claudin 7 Dr.75457 60635 2.260 0.00E+00 cldnb Claudin b Dr.76013 81581 4.024 0.00E+00 cldnc Claudin c Dr.12596 81582 1.530 9.99E-12 3.233 0.00E+00 cldne Claudin e Dr.3454 81584 2.255 7.22E-24 cldnf Claudin f Dr.76180 81585 1.820 9.00E-05 2.623 9.24E-15 2.346 8.00E-05 cldnh Claudin h Dr.3267 81587 1.691 8.07E-32 cldni Claudin i Dr.114360 81588 1.972 3.39E-20 cldni Claudin i Dr.121667 81588 2.044 2.86E-08 clica Chloride intracellular channel a Dr.28660 84040 1.580 7.77E-07 cnn2 Calponin 2 Dr.75641 321823 1.838 3.04E-17 commd3 COMM domain containing 3 Dr.77370 494135 1.507 4.27E-06 Coatomer protein complex, subunit copb2 Dr.14625 114454 2.364 7.06E-28 2.020 7.14E-19 beta 2 Core promoter element binding copeb Dr.77265 280650 2.598 2.10E-33 protein COP9 constitutive cops8 photomorphogenic homolog Dr.78319 393198 2.170 2.72E-12 subunit 8 (Arabidopsis)
COX17 cytochrome c oxidase cox17 Dr.116425 447914 2.332 0.00E+00 assembly homolog (S. cerevisiae) cp Ceruloplasmin Dr.3613 84702 1.614 4.18E-07 cpla2 Cytosolic phospholipase a2 Dr.20961 30554 6.256 4.60E-27 cpvl Carboxypeptidase, vitellogenic-like Dr.132380 387531 1.675 4.96E-09
Cellular retinoic acid binding crabp2a Dr.104443 171480 1.592 1.00E-05 protein 2, a CAMP responsive element binding creb3l3 Dr.79921 406853 1.660 1.26E-13 2.385 0.00E+00 protein 3-like 3 Cysteine rich transmembrane BMP crim1 Dr.87739 404210 2.296 4.75E-12 regulator 1 (chordin like) cry1b Cryptochrome 1b Dr.80577 554836 2.333 2.55E-17 cry3 Cryptochrome 3 Dr.132705 83774 2.617 1.60E-41 cry-dash Cryptochrome DASH Dr.132738 402986 2.296 2.25E-23 crygm2b Crystallin, gamma M2b Dr.116427 553954 3.822 9.17E-07 crygn2 Crystallin, gamma N2 Dr.87252 445034 3.960 2.39E-07 csnk1d Casein kinase 1, delta Dr.76493 406533 1.713 2.69E-30 csrp1 Cysteine and glycine-rich protein 1 Dr.83404 378726 2.766 0.00E+00 ctgf Connective tissue growth factor Dr.42794 321449 2.022 0.00E+00
Catenin (cadherin-associated ctnna Dr.8148 30741 1.976 0.00E+00 protein), alpha ctsba Cathepsin B, a Dr.3374 406645 3.318 2.40E-07 ctsc Cathepsin C Dr.32463 368704 3.499 4.13E-12 ctsd Cathepsin D Dr.119088 65225 1.700 1.13E-08 ctsh Cathepsin H Dr.14176 324818 8.485 0.00E+00 ctsk Cathepsin K Dr.76224 550475 3.598 6.16E-09 2.750 7.32E-06 ctsl1a Cathepsin L1, a Dr.104499 321453 3.691 5.42E-15 ctssb.2 Cathepsin S, b.2 Dr.132688 337572 2.303 3.95E-20 cul1b Cullin 1b Dr.7761 406816 2.079 3.40E-17 cx39.9 Connexin 39.9 Dr.88555 404726 2.224 5.71E-07 Coxsackie virus and adenovirus cxadr Dr.132344 259305 1.503 3.36E-10 receptor Chemokine (C-X-C motif) receptor cxcr7b Dr.114187 561050 2.026 2.42E-09 7b Cytochrome b-245, alpha cyba Dr.83382 393551 4.794 0.00E+00 polypeptide Cytochrome P450, subfamily XIA, cyp11a1 Dr.80336 80374 1.657 5.00E-05 polypeptide 1 Cytochrome P450, family 17, cyp17a1 Dr.79318 399692 2.025 6.63E-15 1.779 1.46E-13 subfamily A, polypeptide 1 Cytochrome P450, subfamily cyp26a1 Dr.75754 30381 1.815 1.33E-07 XXVIA, polypeptide 1 Cytochrome P450, family 3, cyp3a65 Dr.77160 553969 3.057 1.31E-08 subfamily A, polypeptide 65 Cytochrome P450, family 3, cyp3c1 Dr.114440 324340 7.591 2.68E-22 subfamily c, polypeptide 1 Cytochrome P450, family 3, cyp3c1l2 Dr.22212 492759 14.833 4.75E-33 subfamily c, polypeptide 1 like, 2 dapk3 Death-associated protein kinase 3 Dr.132498 324306 2.714 1.45E-09 2.140 4.44E-08 dapk3 Death-associated protein kinase 3 Dr.3200 324306 1.836 1.69E-12 dazl Daz-like gene Dr.81259 58039 1.574 1.00E-05 dbx2 Developing brain homeobox 2 Dr.107144 30417 1.574 8.29E-11
Dolichyl-diphosphooligosaccharide- ddost Dr.1142 406408 1.501 1.23E-08 protein glycosyltransferase
DEAD (Asp-Glu-Ala-Asp) box ddx18 Dr.24235 321127 1.765 3.40E-06 polypeptide 18 DEAD (Asp-Glu-Ala-Asp) box ddx27 Dr.132434 378844 1.611 5.75E-10 polypeptide 27 DEAD (Asp-Glu-Ala-Asp) box ddx49 Dr.77634 386632 1.953 4.68E-18 polypeptide 49 DEAD (Asp-Glu-Ala-Asp) box ddx56 Dr.79779 445399 1.820 2.16E-13 polypeptide 56 dedd1 Death effector domain-containing 1 Dr.78368 58125 1.567 1.88E-06 desm Desmin Dr.75084 30148 2.435 0.00E+00 Dehydrodolichyl diphosphate dhdds Dr.80056 406468 2.055 4.66E-26 synthase Diaphorase (NADH) (cytochrome b- dia1 Dr.3433 336553 1.746 1.94E-24 5 reductase) dio1 Deiodinase, iodothyronine, type I Dr.116077 352936 1.549 2.64E-08
Novel protein similar to vertebrate DKEY- S100 calcium binding protein A11 Dr.92711 100005433 1.593 6.00E-05 105N5.1 (S100A11) DKEY- Similar to peroxisomal acyl-CoA Dr.12004 572757 3.067 7.18E-06 183C16.6 thioesterase 2b like 1 DKEY- Hypothetical protein LOC798102 Dr.83595 798102 2.381 1.86E-17 77F17.8 Novel protein similar to vertebrate DKEYP- ras homolog gene family, member Dr.115457 561933 2.405 5.58E-07 2.295 2.48E-06 97G3.6 T1 (RHOT1) DnaJ (Hsp40) homolog, subfamily dnaja3b Dr.79414 394242 4.362 0.00E+00 A, member 3B DNA (cytosine-5-)- dnmt3 Dr.67521 30659 1.888 1.56E-06 methyltransferase 3 Deoxyhypusine dohh Dr.2393 321732 1.919 2.00E-05 1.815 1.00E-05 hydroxylase/monooxygenase Dr.1026 Transcribed locus Dr.1026 4.368 3.70E-11 3.276 7.79E-06 Dr.103268 Transcribed locus Dr.103268 1.913 1.30E-09 Dr.1034 Transcribed locus Dr.1034 2.580 3.60E-27 Dr.104849 Transcribed locus Dr.104849 3.195 4.84E-21 2.736 1.46E-24 Dr.104894 Transcribed locus Dr.104894 1.556 1.71E-07 Dr.104912 Transcribed locus Dr.104912 4.508 8.26E-09 Dr.105207 Transcribed locus Dr.105207 1.674 1.20E-08 Dr.105658 Transcribed locus Dr.105658 2.719 3.30E-13 Dr.105847 Transcribed locus Dr.105847 2.071 4.76E-07 2.231 5.93E-08 Dr.106669 Transcribed locus Dr.106669 1.656 8.03E-12 Dr.106912 Transcribed locus Dr.106912 1.686 6.73E-06 Dr.107382 Transcribed locus Dr.107382 2.441 7.00E-05 Dr.107685 Transcribed locus Dr.107685 1.826 4.03E-07 Dr.107715 Transcribed locus Dr.107715 2.461 2.00E-05 2.865 2.91E-06 Dr.107716 Transcribed locus Dr.107716 1.942 4.72E-07 1.928 5.88E-06 Dr.107926 Transcribed locus Dr.107926 2.672 6.00E-05 2.877 5.12E-17 3.794 2.44E-16 4.116 1.68E-12 9.212 8.21E-14 Dr.108104 Transcribed locus Dr.108104 1.889 9.00E-05 1.687 5.32E-06 1.960 1.03E-12 3.213 2.88E-29 Transcribed locus, weakly similar to XP_001103359.1 Dr.10826 ectonucleotide Dr.10826 2.140 6.80E-08 1.839 2.57E-08 2.283 1.45E-11 1.903 1.32E-19 pyrophosphatase/phosphodiestera se 1 [Macaca mulatta] Dr.108263 Transcribed locus Dr.108263 1.546 4.88E-07 Dr.109938 Transcribed locus Dr.109938 1.901 4.85E-07 Dr.110716 Transcribed locus Dr.110716 1.525 2.00E-05 Dr.110766 Transcribed locus Dr.110766 3.221 1.46E-07 3.420 4.53E-28 6.804 1.46E-20 4.510 5.20E-06 Dr.111687 Transcribed locus Dr.111687 2.277 6.00E-05 Dr.111754 Transcribed locus Dr.111754 2.413 3.63E-11 Dr.111983 Transcribed locus Dr.111983 2.255 1.30E-08 Dr.112862 Transcribed locus Dr.112862 2.268 5.00E-05 Dr.114009 Transcribed locus Dr.114009 2.541 9.00E-05 2.660 8.69E-06
Transcribed locus, weakly similar to XP_001170933.1 similar to drug Dr.114244 Dr.114244 3.579 0.00E+00 resistance-related protein LRP, partial [Pan troglodytes]
Transcribed locus, strongly similar Dr.115339 to XP_001333688.1 hypothetical Dr.115339 1.777 2.00E-05 protein [Danio rerio]
Transcribed locus, weakly similar to XP_001095661.1 similar to Testis expressed sequence 264 Dr.115379 Dr.115379 4.164 3.02E-17 protein precursor (Secreted protein ZSIG11) isoform 1 [Macaca mulatta]
Transcribed locus, strongly similar Dr.115622 to NP_066407.1 histone family, Dr.115622 9.461 6.46E-16 member B [Homo sapiens]
Dr.117655 Transcribed locus Dr.117655 1.524 6.19E-06 Dr.118227 Transcribed locus Dr.118227 2.851 1.00E-05
Transcribed locus, weakly similar to XP_001096931.1 Rho- Dr.119578 Dr.119578 1.930 1.44E-13 associated, coiled-coil containing protein kinase 2 [Macaca mulatta]
Transcribed locus, weakly similar Dr.119809 to NP_001036132.1 hormone Dr.119809 1.570 5.10E-06 1.952 3.00E-05 2.104 8.56E-34 receptor [Macaca mulatta]
Dr.12002 Transcribed locus Dr.12002 1.667 4.61E-06 Transcribed locus, weakly similar to XP_001113053.1 A kinase Dr.121349 Dr.121349 2.335 8.04E-23 1.689 7.00E-05 2.540 5.79E-21 (PRKA) anchor protein 8-like [Macaca mulatta] Dr.121552 Transcribed locus Dr.121552 4.104 1.44E-08 3.352 1.70E-06 Dr.121574 Transcribed locus Dr.121574 1.530 1.13E-10 Transcribed locus, weakly similar to XP_001112288.1 similar to Dr.121588 Dr.121588 3.777 3.35E-08 actin-related protein M2 isoform 2 [Macaca mulatta] Dr.121620 Transcribed locus Dr.121620 2.291 3.70E-22 Dr.121757 Transcribed locus Dr.121757 2.255 0.00E+00 1.719 2.00E-06 Transcribed locus, weakly similar Dr.121765 to NP_065704.1 finger protein 287 Dr.121765 2.931 1.37E-14 2.827 1.48E-11 [Homo sapiens] Dr.121797 Transcribed locus Dr.121797 3.220 2.37E-18 Dr.121806 Transcribed locus Dr.121806 1.731 8.71E-07 Dr.121884 Transcribed locus Dr.121884 3.404 1.46E-11 2.831 3.97E-09 Dr.121895 Transcribed locus Dr.121895 1.578 1.04E-10 Dr.121913 Transcribed locus Dr.121913 1.621 7.00E-05 2.017 1.47E-18 Transcribed locus, moderately similar to XP_001107554.1 similar Dr.121924 Dr.121924 1.911 1.13E-25 1.842 1.18E-12 to 40S ribosomal protein S29 [Macaca mulatta] Dr.121934 Transcribed locus Dr.121934 2.557 8.00E-05 Dr.121974 Transcribed locus Dr.121974 2.049 3.84E-08 Dr.122014 Transcribed locus Dr.122014 3.512 0.00E+00 Dr.122018 Transcribed locus Dr.122018 1.501 5.49E-06 Dr.122020 Transcribed locus Dr.122020 2.595 2.41E-06 Transcribed locus, weakly similar to XP_001086221.1 similar to Dr.122023 Dr.122023 2.281 1.57E-09 uridine-cytidine kinase 2 isoform 1 [Macaca mulatta] Dr.122052 Transcribed locus Dr.122052 3.993 1.39E-35 4.122 1.22E-23 Dr.122080 Transcribed locus Dr.122080 2.382 1.10E-14 4.697 6.79E-33 3.400 4.60E-13 2.562 1.93E-17 4.744 7.02E-39 4.390 3.94E-19 Dr.122174 Transcribed locus Dr.122174 2.320 4.32E-12 Dr.122183 Transcribed locus Dr.122183 1.854 6.62E-17 Dr.122188 Transcribed locus Dr.122188 1.565 5.35E-07 Dr.122256 Transcribed locus Dr.122256 3.940 1.03E-19 Dr.122260 Transcribed locus Dr.122260 3.313 7.43E-07 Dr.122277 Transcribed locus Dr.122277 1.549 1.00E-05
Transcribed locus, strongly similar Dr.122280 to XP_708887.2 hypothetical Dr.122280 1.918 5.09E-33 1.583 2.55E-09 1.966 5.17E-11 protein isoform 5 [Danio rerio]
Dr.122295 Transcribed locus Dr.122295 1.856 2.97E-35 3.066 1.28E-12
Transcribed locus, weakly similar to XP_001103661.1 similar to zinc Dr.122300 Dr.122300 1.709 2.63E-34 finger CCCH-type containing 7B isoform 2 [Macaca mulatta]
Dr.122313 Transcribed locus Dr.122313 1.634 2.00E-05 Transcribed locus, weakly similar to XP_001096584.1 Dr.122348 heterogeneous nuclear Dr.122348 1.897 8.85E-07 2.116 8.94E-10 ribonucleoprotein C (C1/C2) isoform 7 [Macaca mulatta] Dr.122379 Transcribed locus Dr.122379 1.764 1.98E-06 Dr.122381 Transcribed locus Dr.122381 3.539 5.09E-07 2.708 2.00E-05 39.450 0.00E+00 Dr.122390 Transcribed locus Dr.122390 2.594 2.10E-11 Dr.122410 Transcribed locus Dr.122410 1.776 9.02E-08 1.561 4.65E-09 Dr.122414 Transcribed locus Dr.122414 1.762 5.19E-06 Dr.122416 Transcribed locus Dr.122416 1.925 2.50E-12 Transcribed locus, strongly similar Dr.122480 to NP_001038362.1 protein Dr.122480 6.248 1.14E-07 LOC559475 [Danio rerio] Dr.122521 Transcribed locus Dr.122521 3.994 2.22E-06 3.546 2.00E-05 Dr.122525 Transcribed locus Dr.122525 2.145 1.96E-06 Dr.122572 Transcribed locus Dr.122572 1.839 7.94E-06 Dr.122580 Transcribed locus Dr.122580 5.593 0.00E+00
Transcribed locus, strongly similar to XP_001117773.1 similar to Dr.122614 Dr.122614 1.672 2.91E-08 NMDA receptor 1 isoform NR1-1 precursor [Macaca mulatta]
Dr.122627 Transcribed locus Dr.122627 1.601 1.28E-10 Dr.122634 Transcribed locus Dr.122634 1.733 2.00E-05 Dr.122669 Transcribed locus Dr.122669 1.633 6.00E-05 Dr.122738 Transcribed locus Dr.122738 1.683 6.00E-10 1.958 3.54E-21 1.897 7.99E-19 1.887 7.68E-13 Dr.122743 Transcribed locus Dr.122743 1.706 3.44E-10 Dr.122751 Transcribed locus Dr.122751 2.856 0.00E+00
Transcribed locus, strongly similar Dr.122769 to XP_690753.2 hypothetical Dr.122769 2.069 1.81E-11 1.788 6.22E-09 2.034 7.37E-08 protein, partial [Danio rerio]
Dr.122800 Transcribed locus Dr.122800 2.842 5.22E-08 Dr.122810 Transcribed locus Dr.122810 1.919 2.69E-29 Dr.122907 Transcribed locus Dr.122907 1.695 1.62E-06 2.806 9.92E-11 Dr.122912 Transcribed locus Dr.122912 1.728 9.27E-07 Dr.122941 Transcribed locus Dr.122941 1.719 8.61E-22 Dr.122944 Transcribed locus Dr.122944 1.623 4.67E-06 Dr.122946 Transcribed locus Dr.122946 5.738 1.12E-13 3.621 5.00E-05 Transcribed locus, weakly similar to NP_001039202.1 O- Dr.122950 Dr.122950 2.055 3.93E-15 acyltransferase 1 [Xenopus tropicalis] Dr.122973 Transcribed locus Dr.122973 2.509 4.03E-11 Dr.122988 Transcribed locus Dr.122988 2.227 3.64E-22 Dr.122993 Transcribed locus Dr.122993 3.853 7.25E-10 3.965 8.46E-10 Dr.123023 Transcribed locus Dr.123023 3.927 0.00E+00 Dr.123030 Transcribed locus Dr.123030 2.220 5.03E-08 19.234 0.00E+00 Dr.123037 Transcribed locus Dr.123037 2.556 1.37E-09
Transcribed locus, moderately Dr.123044 similar to NP_001076542.1 protein Dr.123044 1.832 1.10E-17 LOC100034505 [Danio rerio]
Dr.123072 Transcribed locus Dr.123072 1.734 2.00E-05
Transcribed locus, strongly similar Dr.123073 to XP_706358.1 hypothetical Dr.123073 2.781 8.00E-05 protein XP_701266 [Danio rerio]
Dr.123093 Transcribed locus Dr.123093 2.514 1.33E-16 3.545 6.14E-11 2.266 6.00E-05 Dr.123115 Transcribed locus Dr.123115 3.600 0.00E+00 Dr.123134 Transcribed locus Dr.123134 1.918 6.47E-10 Dr.123167 Transcribed locus Dr.123167 1.627 7.97E-11 Dr.123175 Transcribed locus Dr.123175 3.460 7.81E-10 2.528 1.00E-05 Dr.123214 Transcribed locus Dr.123214 2.471 1.04E-06 Dr.123239 Transcribed locus Dr.123239 2.557 4.79E-07 3.838 5.59E-12 2.567 2.10E-06 3.313 9.94E-18 10.070 1.07E-22 16.176 2.80E-45 Dr.123253 Transcribed locus Dr.123253 2.443 5.44E-07 Dr.123270 Transcribed locus Dr.123270 1.657 4.82E-06 Transcribed locus, moderately similar to XP_001111763.1 similar Dr.123298 Dr.123298 2.258 5.00E-05 to Protein MICAL-3 [Macaca mulatta] Dr.123311 Transcribed locus Dr.123311 1.672 1.99E-13 Dr.123312 Transcribed locus Dr.123312 2.095 9.36E-10 Dr.123322 Transcribed locus Dr.123322 1.509 2.45E-12 1.875 1.04E-17 Dr.123324 Transcribed locus Dr.123324 2.031 3.00E-05 Dr.123342 Transcribed locus Dr.123342 3.346 9.81E-12 Dr.123345 Transcribed locus Dr.123345 2.434 2.00E-05 Dr.123372 Transcribed locus Dr.123372 3.808 5.54E-10 3.753 1.65E-11 Dr.123449 Transcribed locus Dr.123449 6.716 8.19E-09 Transcribed locus, moderately similar to XP_001087249.1 GTP Dr.123460 cyclohydrolase 1 (dopa-responsive Dr.123460 2.111 1.80E-07 dystonia) isoform 2 [Macaca mulatta] Dr.123479 Transcribed locus Dr.123479 4.061 0.00E+00 Dr.123505 Transcribed locus Dr.123505 3.676 0.00E+00 Dr.123509 Transcribed locus Dr.123509 2.563 3.52E-06 2.266 1.12E-08 Dr.123516 Transcribed locus Dr.123516 1.537 5.45E-08 Dr.123520 Transcribed locus Dr.123520 3.352 1.58E-15 Dr.123535 Transcribed locus Dr.123535 1.756 2.32E-14 Dr.123540 Transcribed locus Dr.123540 2.265 5.35E-18 1.885 6.41E-11 Dr.123541 Transcribed locus Dr.123541 2.244 8.93E-06 5.111 3.71E-23 14.877 6.80E-23 Transcribed locus, strongly similar Dr.123559 to XP_001331660.1 hypothetical Dr.123559 4.652 9.78E-28 3.646 4.19E-20 2.638 2.63E-18 7.366 0.00E+00 protein [Danio rerio] Dr.123575 Transcribed locus Dr.123575 1.571 3.58E-06 Dr.123589 Transcribed locus Dr.123589 2.394 3.00E-05 Transcribed locus, weakly similar Dr.123649 to NP_038679.2 factor 3a, subunit Dr.123649 5.778 6.93E-33 2 [Mus musculus] Dr.123651 Transcribed locus Dr.123651 2.559 4.34E-11
Transcribed locus, weakly similar Dr.123669 to NP_001012986.2 protein Dr.123669 1.696 1.49E-12 LOC139886 [Homo sapiens]
Dr.123677 Transcribed locus Dr.123677 1.905 6.55E-08 Dr.123681 Transcribed locus Dr.123681 3.374 4.00E-05 Dr.123742 Transcribed locus Dr.123742 2.370 3.00E-05 2.413 4.56E-06 Dr.123743 Transcribed locus Dr.123743 3.387 4.00E-05 Dr.123755 Transcribed locus Dr.123755 2.660 0.00E+00 Transcribed locus, moderately Dr.123758 similar to NP_001038759.1 protein Dr.123758 1.702 2.36E-06 6.206 2.04E-09 LOC692327 [Danio rerio] Dr.123774 Transcribed locus Dr.123774 1.887 1.70E-23 Transcribed locus, weakly similar Dr.123781 to NP_001071265.1 protein Dr.123781 4.582 1.63E-19 LOC777756 [Danio rerio] Dr.123782 Transcribed locus Dr.123782 3.402 6.39E-09
Transcribed locus, moderately similar to XP_001110578.1 similar Dr.123832 to solute carrier family 37 (glycerol- Dr.123832 1.728 1.68E-06 1.850 1.25E-07 3-phosphate transporter), member 2 [Macaca mulatta]
Dr.123950 Transcribed locus Dr.123950 1.878 2.00E-05 1.851 1.48E-06 3.127 8.86E-06 Dr.124001 Transcribed locus Dr.124001 2.113 9.76E-07 Dr.124014 Transcribed locus Dr.124014 4.632 1.00E-05 Dr.124020 Transcribed locus Dr.124020 1.901 1.00E-05 2.399 8.75E-33 Dr.124067 Transcribed locus Dr.124067 4.672 1.10E-11 Dr.124138 Transcribed locus Dr.124138 1.691 5.28E-07 Dr.124179 Transcribed locus Dr.124179 3.023 3.92E-08 Dr.124213 Transcribed locus Dr.124213 3.940 3.00E-05 Dr.124279 Transcribed locus Dr.124279 2.550 2.51E-19 Dr.124535 Transcribed locus Dr.124535 3.456 4.68E-08 2.964 1.52E-06 Dr.124651 Transcribed locus Dr.124651 1.906 1.66E-21 Dr.124767 Transcribed locus Dr.124767 1.883 1.82E-07 Dr.124796 Transcribed locus Dr.124796 5.163 2.20E-11 Dr.124799 Transcribed locus Dr.124799 1.842 5.00E-05 Dr.124864 Transcribed locus Dr.124864 1.793 9.34E-06 2.094 1.40E-07 Transcribed locus, weakly similar Dr.124888 to NP_065703.1 finger protein 286 Dr.124888 3.184 9.96E-12 2.732 4.68E-09 [Homo sapiens] Transcribed locus, weakly similar to XP_001097188.1 similar to Dr.124893 Dr.124893 2.506 2.20E-14 neurofascin isoform 3 [Macaca mulatta]
Transcribed locus, strongly similar to XP_700295.1 similar to class I Dr.124927 Dr.124927 2.754 7.17E-06 helical cytokine receptor member 13, partial [Danio rerio]
Transcribed locus, strongly similar Dr.124930 to XP_001338458.1 hypothetical Dr.124930 4.362 5.02E-09 protein [Danio rerio] Dr.124939 Transcribed locus Dr.124939 2.425 6.73E-06 Dr.124987 Transcribed locus Dr.124987 2.302 1.85E-06 Transcribed locus, strongly similar Dr.125037 to XP_683147.2 hypothetical Dr.125037 3.898 9.57E-07 8.006 2.23E-10 protein [Danio rerio] Dr.125080 Transcribed locus Dr.125080 1.932 1.18E-06
Transcribed locus, moderately Dr.125138 similar to NP_001076542.1 protein Dr.125138 1.677 2.82E-13 LOC100034505 [Danio rerio]
Transcribed locus, weakly similar Dr.125219 to NP_957349.1 protein Dr.125219 3.450 3.25E-21 LOC394030 [Danio rerio] Dr.125277 Transcribed locus Dr.125277 4.969 8.48E-09 4.431 5.61E-08 Dr.12533 Transcribed locus Dr.12533 1.748 2.36E-14 Dr.125330 Transcribed locus Dr.125330 3.394 4.00E-05 3.851 6.39E-06
Transcribed locus, strongly similar Dr.125372 to XP_698629.1 similar to MAX Dr.125372 3.550 7.42E-08 dimerization protein 1 [Danio rerio]
Dr.125458 Transcribed locus Dr.125458 2.551 6.03E-06
Transcribed locus, weakly similar Dr.125570 to XP_001338456.1 similar to CC Dr.125570 3.266 7.69E-19 6.313 8.40E-08 3.323 1.14E-06 5.097 1.01E-20 12.947 1.10E-30 chemokine-1 [Danio rerio]
Transcribed locus, strongly similar to XP_001109195.1 similar to Dr.125599 Dr.125599 2.715 3.21E-12 ribosomal protein L37 isoform 1 [Macaca mulatta] Dr.125662 Transcribed locus Dr.125662 1.700 2.72E-17 Dr.125670 Transcribed locus Dr.125670 2.010 3.00E-05 2.003 5.54E-06 Transcribed locus, weakly similar Dr.125824 to NP_065708.1 finger protein 304 Dr.125824 1.545 1.00E-05 [Homo sapiens] Transcribed locus, weakly similar Dr.126078 to NP_065602.1 Cyt19 [Mus Dr.126078 1.938 4.00E-05 musculus] Dr.126130 Transcribed locus Dr.126130 2.376 1.37E-06 2.077 7.00E-05 Dr.126183 Transcribed locus Dr.126183 4.840 0.00E+00 Transcribed locus, strongly similar Dr.126272 to XP_699270.2 similar to Dr.126272 2.410 5.50E-13 synapsin Ia [Danio rerio] Dr.126366 Transcribed locus Dr.126366 2.018 1.79E-08 Dr.126534 Transcribed locus Dr.126534 10.989 0.00E+00 Dr.126564 Transcribed locus Dr.126564 3.552 6.95E-07 11.315 2.11E-19 3.002 2.45E-06 9.914 2.19E-16 4.030 8.00E-05 Dr.126624 Transcribed locus Dr.126624 2.204 1.32E-12
Transcribed locus, weakly similar Dr.126643 to XP_001109565.1 hypothetical Dr.126643 1.587 3.86E-10 protein [Macaca mulatta]
Dr.127398 Transcribed locus Dr.127398 1.702 6.00E-05 Dr.127434 Transcribed locus Dr.127434 1.622 1.13E-10
Transcribed locus, strongly similar Dr.127930 to XP_001334076.1 hypothetical Dr.127930 3.317 5.01E-12 protein isoform 1 [Danio rerio]
Dr.128077 Transcribed locus Dr.128077 1.899 1.64E-08 Dr.128325 Transcribed locus Dr.128325 1.566 5.86E-06 Dr.128394 Transcribed locus Dr.128394 1.789 3.25E-09 Dr.128421 Transcribed locus Dr.128421 1.992 6.83E-06 1.591 2.00E-05 2.692 4.67E-36 2.194 1.71E-07 5.845 1.96E-36 Dr.128681 Transcribed locus Dr.128681 2.142 7.00E-05 1.977 7.00E-05 Dr.128692 Transcribed locus Dr.128692 1.919 3.94E-13 Dr.128938 Transcribed locus Dr.128938 6.072 3.13E-12 6.643 1.77E-13 Dr.129062 Transcribed locus Dr.129062 1.967 2.73E-10 Dr.129101 Transcribed locus Dr.129101 1.761 5.00E-05 Dr.129189 Transcribed locus Dr.129189 3.764 5.00E-05 4.130 1.97E-07 Dr.129389 Transcribed locus Dr.129389 2.071 9.37E-15 Dr.129433 Transcribed locus Dr.129433 1.515 5.00E-05 1.578 1.83E-06 Dr.129661 Transcribed locus Dr.129661 2.453 4.01E-23 2.334 2.48E-25 Dr.129741 Transcribed locus Dr.129741 2.301 1.25E-06 3.090 3.54E-07 Dr.129903 Transcribed locus Dr.129903 1.826 3.74E-31
Transcribed locus, moderately Dr.130083 similar to XP_001334931.1 similar Dr.130083 2.012 4.76E-08 to cathepsin L [Danio rerio]
Transcribed locus, weakly similar Dr.130105 to NP_065704.1 finger protein 287 Dr.130105 2.104 8.42E-15 2.315 5.62E-20 [Homo sapiens] Dr.130426 Transcribed locus Dr.130426 3.627 1.11E-11 Dr.130502 Transcribed locus Dr.130502 2.205 1.32E-34 1.895 1.79E-14 Dr.130702 Transcribed locus Dr.130702 1.779 2.25E-13 Dr.130772 Transcribed locus Dr.130772 7.323 3.02E-40 Dr.130898 Transcribed locus Dr.130898 3.569 1.07E-10 3.235 8.09E-09 Dr.130910 Transcribed locus Dr.130910 1.644 6.23E-07 Dr.131036 Transcribed locus Dr.131036 2.074 3.91E-06 Dr.131054 Transcribed locus Dr.131054 3.121 6.81E-16 3.075 1.50E-15 Dr.131145 Transcribed locus Dr.131145 1.722 1.64E-09 Transcribed locus, weakly similar to XP_001096124.1 similar to Dr.131225 catechol-O-methyltransferase Dr.131225 1.741 1.83E-08 domain containing 1 [Macaca mulatta] Dr.131226 Transcribed locus Dr.131226 3.483 2.00E-05 Dr.131275 Transcribed locus Dr.131275 1.512 1.83E-06 Dr.131316 Transcribed locus Dr.131316 1.684 6.38E-06 2.055 1.63E-13 Transcribed locus, weakly similar Dr.131335 to NP_001074221.1 protein Dr.131335 3.177 1.89E-16 2.959 2.15E-12 LOC559830 [Danio rerio] Dr.131342 Transcribed locus Dr.131342 3.126 3.49E-06 Dr.131410 Transcribed locus Dr.131410 1.840 1.98E-15 2.476 6.61E-23 4.555 1.18E-15 Dr.131719 Transcribed locus Dr.131719 1.686 3.00E-05 Dr.131746 Transcribed locus Dr.131746 1.739 2.62E-11 Transcribed locus, weakly similar Dr.131852 to XP_001098621.1 myozenin 2 Dr.131852 3.547 7.00E-18 3.098 1.70E-14 [Macaca mulatta] Dr.131919 Transcribed locus Dr.131919 1.807 3.51E-06 2.095 3.80E-12 Dr.131984 Transcribed locus Dr.131984 1.866 7.28E-16 Dr.132023 Transcribed locus Dr.132023 3.814 4.80E-18 2.284 2.00E-05 Dr.132082 Transcribed locus Dr.132082 1.529 1.08E-08 Dr.132086 Transcribed locus Dr.132086 2.077 2.94E-07 1.680 1.81E-16 3.237 6.61E-27 Dr.132109 Transcribed locus Dr.132109 8.059 2.00E-05 4.839 6.19E-09 7.957 1.37E-15 4.264 7.43E-12 10.690 1.27E-12 6.941 3.31E-08 7.090 2.63E-15 15.271 5.32E-37 Dr.132119 Transcribed locus Dr.132119 1.793 2.00E-05
Transcribed locus, weakly similar Dr.132130 to XP_527202.2 CD180 antigen Dr.132130 1.902 1.09E-11 1.999 4.74E-09 isoform 3 [Pan troglodytes]
Dr.132335 Transcribed locus Dr.132335 1.658 1.40E-15 Dr.132337 Transcribed locus Dr.132337 1.900 1.02E-06 Dr.132373 Transcribed locus Dr.132373 2.100 2.00E-05 Dr.132397 Transcribed locus Dr.132397 1.753 8.41E-45 Transcribed locus, weakly similar to XP_001098232.1 similar to ring Dr.13241 Dr.13241 1.569 1.04E-06 1.641 3.00E-05 finger protein 111 isoform 5 [Macaca mulatta]
Transcribed locus, weakly similar to XP_001114179.1 similar to Dr.132472 Dr.132472 1.581 1.44E-14 3.605 1.46E-22 oxysterol-binding protein-like protein 11 [Macaca mulatta]
Dr.132500 Transcribed locus Dr.132500 2.590 6.92E-08 Dr.132610 Transcribed locus Dr.132610 2.224 1.12E-13 Dr.132683 Transcribed locus Dr.132683 3.479 8.26E-07 4.037 4.91E-08 Dr.132748 Transcribed locus Dr.132748 1.793 2.36E-09 1.726 3.00E-05 Dr.132810 Transcribed locus Dr.132810 1.990 6.69E-06 Dr.132831 Transcribed locus Dr.132831 1.649 2.00E-05 1.664 7.05E-06 Dr.132918 Transcribed locus Dr.132918 3.186 3.00E-05 Dr.132919 Transcribed locus Dr.132919 2.175 1.47E-07 Dr.132954 Transcribed locus Dr.132954 3.120 1.59E-06 Dr.132994 Transcribed locus Dr.132994 1.871 8.21E-06 Dr.133003 Transcribed locus Dr.133003 3.733 1.59E-08 Dr.133072 Transcribed locus Dr.133072 2.253 1.00E-05 Dr.133097 Transcribed locus Dr.133097 2.739 4.55E-08 3.070 2.55E-18 Dr.133119 Transcribed locus Dr.133119 1.651 2.19E-06 1.833 4.30E-10 1.927 1.42E-06 2.630 5.46E-21 2.944 3.88E-16 Dr.133131 Transcribed locus Dr.133131 4.612 0.00E+00 Dr.133134 Transcribed locus Dr.133134 2.630 2.39E-24 Transcribed locus, weakly similar to XP_001097921.1 LIM and Dr.133174 Dr.133174 1.581 2.86E-06 cysteine-rich domains 1 [Macaca mulatta] Transcribed locus, weakly similar Dr.133195 to NP_065704.1 finger protein 287 Dr.133195 1.565 4.00E-05 3.345 2.29E-08 [Homo sapiens] Dr.133199 Transcribed locus Dr.133199 1.716 1.00E-05 Dr.133200 Transcribed locus Dr.133200 2.758 1.47E-27 Dr.133202 Transcribed locus Dr.133202 7.928 2.00E-05 Dr.133240 Transcribed locus Dr.133240 1.526 2.00E-05 Dr.133245 Transcribed locus Dr.133245 1.573 8.00E-05 Transcribed locus, weakly similar Dr.133293 to XP_001339325.1 hypothetical Dr.133293 2.134 2.68E-08 protein [Danio rerio] Dr.133303 Transcribed locus Dr.133303 2.550 6.44E-11
Transcribed locus, weakly similar to XP_001166830.1 Rho guanine Dr.133325 Dr.133325 2.734 5.35E-16 nucleotide exchange factor (GEF) 12 isoform 2 [Pan troglodytes]
Dr.133363 Transcribed locus Dr.133363 3.137 7.17E-07 Dr.133374 Transcribed locus Dr.133374 2.906 3.47E-06 Dr.133380 Transcribed locus Dr.133380 2.018 1.09E-12 Dr.133385 Transcribed locus Dr.133385 2.317 1.19E-17 Dr.133397 Transcribed locus Dr.133397 1.530 4.00E-05 1.632 7.78E-09 Dr.133399 Transcribed locus Dr.133399 1.891 5.14E-06 Dr.133400 Transcribed locus Dr.133400 1.955 1.00E-05 Dr.133403 Transcribed locus Dr.133403 3.939 5.32E-10 4.094 9.43E-10 Dr.133426 Transcribed locus Dr.133426 1.722 2.00E-05 Dr.133437 Transcribed locus Dr.133437 4.736 6.67E-07 3.931 1.00E-05 Dr.133440 Transcribed locus Dr.133440 2.287 4.46E-06 2.869 4.45E-06 Dr.133467 Transcribed locus Dr.133467 3.368 0.00E+00 Dr.133494 Transcribed locus Dr.133494 6.913 8.73E-12 4.329 7.27E-06 6.419 7.74E-17 3.344 4.69E-09 7.865 1.79E-27 5.838 3.54E-27 6.871 8.50E-18 13.443 8.01E-40 Dr.133541 Transcribed locus Dr.133541 2.757 3.77E-06 Dr.133621 Transcribed locus Dr.133621 2.703 6.19E-11 Dr.133641 Transcribed locus Dr.133641 1.556 3.24E-12 2.288 9.32E-09 Dr.133670 Transcribed locus Dr.133670 2.604 0.00E+00 Dr.133700 Transcribed locus Dr.133700 1.714 1.31E-12 Dr.133710 Transcribed locus Dr.133710 3.648 6.09E-10 Dr.133731 Transcribed locus Dr.133731 2.529 6.00E-05 2.977 7.72E-08 Dr.133746 Transcribed locus Dr.133746 2.109 3.23E-36 2.569 0.00E+00 Dr.133747 Transcribed locus Dr.133747 2.439 6.16E-08 Dr.133861 Transcribed locus Dr.133861 2.234 1.44E-10 Dr.133874 Transcribed locus Dr.133874 2.604 8.00E-05 Dr.133882 Transcribed locus Dr.133882 3.603 3.00E-05 3.613 2.00E-05 Transcribed locus, strongly similar Dr.134395 to NP_956086.1 protein Dr.134395 2.139 9.65E-18 3.350 8.93E-20 LOC327348 [Danio rerio] Dr.134510 Transcribed locus Dr.134510 5.291 1.55E-07 Dr.134725 Transcribed locus Dr.134725 2.621 9.19E-08 Dr.134747 Transcribed locus Dr.134747 1.585 2.94E-11 Dr.134771 Transcribed locus Dr.134771 2.443 9.00E-05 2.821 7.12E-06 Dr.134773 Transcribed locus Dr.134773 2.996 8.07E-08 Dr.13481 Transcribed locus Dr.13481 1.924 9.61E-09 1.751 1.35E-08 Dr.134920 Transcribed locus Dr.134920 1.838 5.02E-12 Dr.134954 Transcribed locus Dr.134954 4.140 1.00E-05 3.505 4.00E-05 Transcribed locus, weakly similar to XP_001082535.1 TNF receptor- Dr.134981 Dr.134981 5.494 3.47E-17 associated factor 3 isoform 2 [Macaca mulatta]
Transcribed locus, weakly similar to XP_001111465.1 similar to zinc Dr.135070 Dr.135070 1.664 9.96E-08 1.558 6.49E-07 2.074 5.66E-09 finger CCCH-type containing 12A isoform 1 [Macaca mulatta]
Dr.135158 Transcribed locus Dr.135158 1.543 8.00E-05 1.627 1.49E-06 Dr.135386 CDNA clone IMAGE:7148352 Dr.135386 3.625 5.93E-06 2.119 2.36E-06 5.861 4.89E-09
Transcribed locus, moderately similar to XP_001110216.1 similar Dr.13598 Dr.13598 1.630 9.37E-07 to integrator complex subunit 2 isoform 2 [Macaca mulatta]
Dr.13642 Transcribed locus Dr.13642 2.729 7.61E-17 Dr.137711 Transcribed locus Dr.137711 2.001 4.00E-05 1.927 1.98E-08 Transcribed locus, strongly similar Dr.137840 to NP_991141.1 protein [Danio Dr.137840 2.585 2.01E-09 rerio] Dr.13801 Transcribed locus Dr.13801 3.665 1.02E-09 3.551 5.27E-11 Dr.13875 Transcribed locus Dr.13875 1.801 1.66E-09 1.731 1.03E-06 2.795 2.07E-08 3.238 7.57E-07 Dr.139852 Transcribed locus Dr.139852 15.056 0.00E+00 Dr.140087 Transcribed locus Dr.140087 2.086 8.00E-05 2.165 4.00E-05 Dr.140304 CDNA clone IMAGE:7402628 Dr.140304 13.845 4.32E-31 Dr.140306 Transcribed locus Dr.140306 1.655 9.15E-08 2.195 9.04E-16 Dr.140310 Transcribed locus Dr.140310 1.923 3.83E-19 Dr.140362 Transcribed locus Dr.140362 3.152 4.21E-09 Dr.140502 Transcribed locus Dr.140502 3.575 1.16E-11 Transcribed locus, weakly similar Dr.140503 to NP_001074221.1 protein Dr.140503 5.826 2.07E-26 6.570 3.27E-10 13.096 6.80E-34 3.333 9.52E-06 6.410 3.15E-29 5.799 1.28E-08 12.410 0.00E+00 17.680 9.61E-26 LOC559830 [Danio rerio] Dr.140570 Transcribed locus Dr.140570 5.884 1.02E-14 Transcribed locus, weakly similar to XP_001095837.1 Dr.140625 calcium/calmodulin-dependent Dr.140625 2.932 0.00E+00 serine protein kinase (MAGUK family) [Macaca mulatta]
Transcribed locus, weakly similar Dr.140627 to NP_039499.1 c oxidase 1 Dr.140627 2.191 2.43E-08 [Schizosaccharomyces pombe]
Transcribed locus, weakly similar Dr.140756 Dr.140756 1.687 2.72E-18 to NP_067078.1 2 [Homo sapiens]
Dr.140771 Transcribed locus Dr.140771 1.632 5.55E-07 Transcribed locus, weakly similar to XP_001098455.1 similar to SH2 Dr.140816 Dr.140816 1.646 1.15E-15 domain containing 4B [Macaca mulatta]
Transcribed locus, weakly similar to XP_001083232.1 similar to IQ Dr.140871 Dr.140871 2.154 9.00E-05 motif containing with AAA domain isoform 1 [Macaca mulatta]
Transcribed locus, weakly similar to XP_001098226.1 similar to Dr.141108 Dr.141108 3.747 1.62E-21 neurotrypsin precursor [Macaca mulatta] Transcribed locus, moderately similar to XP_509446.2 Dr.141327 Dr.141327 1.958 3.10E-09 hypothetical protein isoform 12 [Pan troglodytes] Transcribed locus, weakly similar Dr.14471 to XP_001115050.1 hypothetical Dr.14471 1.817 6.35E-30 protein [Macaca mulatta]
Dr.14694 Transcribed locus Dr.14694 2.233 6.06E-06 Transcribed locus, strongly similar to XP_001337996.1 similar to Dr.14717 Dr.14717 4.358 1.16E-21 cytokine receptor family member B4 [Danio rerio] Dr.14977 Transcribed locus Dr.14977 2.201 6.08E-31 Dr.15033 CDNA clone IMAGE:6034066 Dr.15033 3.120 3.33E-35 Dr.15365 Transcribed locus Dr.15365 2.606 3.00E-05 2.938 5.24E-07 Dr.15519 Transcribed locus Dr.15519 2.514 1.03E-09 4.647 1.20E-14 2.498 1.27E-15 5.134 2.02E-16 Dr.16239 Transcribed locus Dr.16239 3.464 1.77E-27 Dr.16680 Transcribed locus Dr.16680 1.842 5.16E-09 Dr.17702 Transcribed locus Dr.17702 1.818 1.95E-19 Dr.17763 Transcribed locus Dr.17763 3.188 3.36E-06 Dr.18641 Transcribed locus Dr.18641 3.945 1.03E-07 Dr.18912 Transcribed locus Dr.18912 1.887 8.79E-07 2.488 2.27E-08 2.031 5.02E-09 2.917 4.21E-09 Transcribed locus, weakly similar to XP_001104248.1 similar to PDZ Dr.20556 Dr.20556 2.046 1.90E-06 domain protein GIPC2 [Macaca mulatta] Dr.21599 Transcribed locus Dr.21599 1.732 1.57E-06 1.911 4.42E-11 1.895 2.00E-05 Dr.21609 Transcribed locus Dr.21609 1.563 1.00E-05 Dr.21811 Transcribed locus Dr.21811 2.576 7.64E-10 Dr.2211 Transcribed locus Dr.2211 1.903 7.25E-06 Dr.22136 Transcribed locus Dr.22136 1.648 2.47E-07 4.336 8.65E-10 Dr.22715 Transcribed locus Dr.22715 2.023 2.49E-06 Dr.22827 Transcribed locus Dr.22827 2.147 7.21E-07 Dr.23039 Transcribed locus Dr.23039 1.843 7.91E-06 Dr.23237 Transcribed locus Dr.23237 4.295 9.56E-18 Dr.23568 Transcribed locus Dr.23568 1.603 3.00E-05 1.654 1.10E-06 1.967 4.86E-14 Dr.23571 Transcribed locus Dr.23571 2.189 4.24E-06 3.235 2.36E-11 Dr.25825 Transcribed locus Dr.25825 3.540 3.99E-13 Dr.26283 Transcribed locus Dr.26283 1.985 2.99E-09 Dr.27927 Transcribed locus Dr.27927 5.075 3.30E-12 5.163 1.06E-12 Dr.28032 Transcribed locus Dr.28032 2.810 2.00E-05 1.969 2.18E-11 3.065 3.52E-06 2.726 0.00E+00 4.479 0.00E+00 Dr.28720 Transcribed locus Dr.28720 2.223 2.00E-05 Dr.28790 Transcribed locus Dr.28790 3.817 7.55E-06 Dr.29633 Transcribed locus Dr.29633 2.218 4.20E-10 2.043 2.00E-05
Transcribed locus, weakly similar Dr.30522 to XP_001103689.1 hypothetical Dr.30522 3.818 1.21E-27 protein isoform 1 [Macaca mulatta]
Dr.31301 Transcribed locus Dr.31301 3.922 4.60E-07 Dr.31311 Transcribed locus Dr.31311 1.820 3.11E-06 Dr.36985 Transcribed locus Dr.36985 1.598 1.84E-06 Dr.40010 Transcribed locus Dr.40010 1.542 1.48E-07 Transcribed locus, strongly similar to XP_001083731.1 similar to Dr.40048 Dr.40048 9.454 3.14E-12 germinal histone H4 gene [Macaca mulatta] Dr.40661 Transcribed locus Dr.40661 1.791 2.00E-05 Dr.41210 Transcribed locus Dr.41210 2.608 1.62E-39 Dr.42092 Transcribed locus Dr.42092 1.835 1.22E-21 Transcribed locus, strongly similar Dr.43242 to XP_001340734.1 hypothetical Dr.43242 1.817 1.61E-35 protein [Danio rerio]
Transcribed locus, weakly similar Dr.43457 to NP_055243.1 junction protein 3 Dr.43457 2.055 7.06E-15 (zona occludens 3) [Homo sapiens]
Dr.44448 Transcribed locus Dr.44448 2.152 5.15E-19 3.291 1.14E-27 2.004 7.78E-07 Dr.44747 Transcribed locus Dr.44747 1.579 7.71E-10 Dr.44986 Transcribed locus Dr.44986 2.223 4.22E-09 Dr.45458 Transcribed locus Dr.45458 2.929 2.76E-12 2.377 7.48E-13 3.437 9.00E-05 5.006 3.12E-24 Transcribed locus, moderately similar to NP_002213.1 1,4,5- Dr.47889 Dr.47889 1.783 6.00E-05 triphosphate receptor, type 1 [Homo sapiens] Dr.48109 Transcribed locus Dr.48109 10.012 0.00E+00 Dr.48126 Transcribed locus Dr.48126 1.650 6.00E-05 2.013 4.31E-09 Dr.51495 Transcribed locus Dr.51495 1.593 1.99E-06 1.760 5.34E-12 Transcribed locus, moderately similar to XP_001107685.1 Dr.51858 Dr.51858 2.411 8.74E-13 histidine ammonia-lyase [Macaca mulatta] Dr.53946 Transcribed locus Dr.53946 6.706 5.00E-05 Dr.67253 Transcribed locus Dr.67253 2.007 2.25E-12 Dr.67299 Transcribed locus Dr.67299 1.903 1.22E-17 2.071 2.48E-29 Dr.67904 Transcribed locus Dr.67904 1.693 1.36E-10 Dr.70889 Transcribed locus Dr.70889 5.698 5.58E-13 Dr.72235 Transcribed locus Dr.72235 5.185 8.32E-06 Dr.72264 Transcribed locus Dr.72264 1.732 3.73E-30 Dr.74678 Transcribed locus Dr.74678 1.553 1.66E-10 1.994 1.48E-16 2.090 4.35E-08 Dr.74689 Transcribed locus Dr.74689 1.867 7.63E-06 Dr.75128 Transcribed locus Dr.75128 1.607 3.00E-05 Dr.75197 Transcribed locus Dr.75197 3.349 1.88E-18 2.554 5.45E-09 Dr.75437 Transcribed locus Dr.75437 1.992 5.18E-17 Dr.75679 Transcribed locus Dr.75679 1.789 3.91E-18 Transcribed locus, strongly similar to XP_001346068.1 similar to Dr.75718 Dr.75718 1.925 3.00E-05 putative G protein-coupled Receptor [Danio rerio] Dr.75870 Transcribed locus Dr.75870 1.566 1.44E-10 Dr.76018 Transcribed locus Dr.76018 3.234 1.06E-19 2.843 2.45E-15 Dr.76090 Transcribed locus Dr.76090 11.690 7.45E-09 Dr.76143 Transcribed locus Dr.76143 2.255 4.78E-25 Dr.76346 Transcribed locus Dr.76346 2.346 1.00E-05 2.335 5.00E-05
Transcribed locus, weakly similar Dr.76544 to NP_031886.3 iodothyronine, Dr.76544 1.736 3.85E-08 type I [Mus musculus]
Dr.76591 Transcribed locus Dr.76591 1.610 4.00E-05 2.348 1.94E-09 Dr.76811 Transcribed locus Dr.76811 2.591 8.32E-11 Dr.76999 Transcribed locus Dr.76999 2.133 3.77E-33 Dr.77029 Transcribed locus Dr.77029 1.962 4.92E-14 Dr.77277 Transcribed locus Dr.77277 2.942 3.38E-08 2.600 4.94E-07 Dr.77607 Transcribed locus Dr.77607 1.728 5.93E-08 Dr.77749 Transcribed locus Dr.77749 7.728 4.00E-05 Dr.77751 Transcribed locus Dr.77751 1.915 5.14E-14 Dr.77755 Transcribed locus Dr.77755 2.264 2.37E-07 Transcribed locus, weakly similar to XP_001096004.1 dual Dr.77989 Dr.77989 6.385 3.27E-43 specificity phosphatase 1 [Macaca mulatta] Transcribed locus, moderately similar to XP_001062593.1 Dr.78238 Dr.78238 2.517 2.53E-06 hypothetical protein [Rattus norvegicus] Dr.78427 Transcribed locus Dr.78427 2.428 5.90E-13 Dr.78624 Transcribed locus Dr.78624 2.113 1.08E-08 Dr.7870 Transcribed locus Dr.7870 3.230 1.63E-40 Dr.78953 Transcribed locus Dr.78953 1.655 3.39E-15 Dr.78997 Transcribed locus Dr.78997 4.027 1.06E-23 2.285 1.00E-05 3.868 7.37E-22 Dr.79067 Transcribed locus Dr.79067 2.137 1.81E-23 Dr.79238 Transcribed locus Dr.79238 5.138 1.39E-06 4.932 2.33E-06 Dr.79364 Transcribed locus Dr.79364 2.789 4.72E-07 Dr.79410 Transcribed locus Dr.79410 1.624 6.83E-11 Dr.79430 Transcribed locus Dr.79430 4.194 3.98E-16 Dr.79468 Transcribed locus Dr.79468 1.736 9.00E-05 2.644 5.00E-05 Dr.79533 Transcribed locus Dr.79533 3.494 1.86E-21 Dr.79873 Transcribed locus Dr.79873 1.770 1.39E-08 Dr.79956 Transcribed locus Dr.79956 3.168 4.83E-35 3.366 3.40E-38 Dr.79991 Transcribed locus Dr.79991 1.703 1.64E-12 Dr.80023 Transcribed locus Dr.80023 1.754 2.69E-07 Dr.80026 Transcribed locus Dr.80026 3.460 6.20E-22 Dr.80139 Transcribed locus Dr.80139 1.839 8.00E-05 Dr.80215 Transcribed locus Dr.80215 1.844 2.00E-05 2.618 5.73E-15 3.282 3.87E-09 Dr.80635 Transcribed locus Dr.80635 3.272 8.49E-06 Transcribed locus, weakly similar Dr.80672 to XP_001344229.1 hypothetical Dr.80672 1.830 8.87E-06 protein [Danio rerio] Dr.80870 Transcribed locus Dr.80870 1.575 9.71E-17 Dr.80890 Transcribed locus Dr.80890 2.548 3.45E-37 Dr.80902 Transcribed locus Dr.80902 1.824 8.98E-11 Dr.81063 Transcribed locus Dr.81063 2.377 3.44E-41 2.067 8.36E-42 2.017 6.32E-17 1.825 4.47E-14 2.759 0.00E+00 Dr.8151 Transcribed locus Dr.8151 2.487 5.38E-11 Dr.81544 Transcribed locus Dr.81544 7.122 1.42E-34 Dr.81561 Transcribed locus Dr.81561 4.034 0.00E+00 Dr.81575 Transcribed locus Dr.81575 1.672 1.28E-06 Dr.81593 Transcribed locus Dr.81593 13.949 0.00E+00 Dr.81762 Transcribed locus Dr.81762 2.889 7.37E-07 2.652 2.92E-06 Dr.81811 Transcribed locus Dr.81811 2.564 2.05E-17 Dr.81866 Transcribed locus Dr.81866 10.513 0.00E+00 Dr.82005 Transcribed locus Dr.82005 3.612 5.90E-14 Dr.82058 Transcribed locus Dr.82058 2.427 1.50E-21
Transcribed locus, moderately Dr.82168 similar to XP_001233520.1 Dr.82168 2.321 0.00E+00 hypothetical protein [Gallus gallus]
Transcribed locus, weakly similar Dr.82398 to XP_001114760.1 zona pellucida Dr.82398 1.981 1.00E-05 glycoprotein 3 [Macaca mulatta]
Dr.82495 Transcribed locus Dr.82495 1.709 6.00E-05 Dr.82632 Transcribed locus Dr.82632 1.957 1.30E-18 Dr.82684 Transcribed locus Dr.82684 1.610 3.96E-06 Transcribed locus, moderately Dr.82697 similar to XP_001345745.1 Dr.82697 1.539 6.96E-12 hypothetical protein [Danio rerio] Dr.82714 Transcribed locus Dr.82714 2.343 6.40E-06 Dr.82776 Transcribed locus Dr.82776 2.845 1.27E-06 Dr.82821 Transcribed locus Dr.82821 1.562 2.00E-05 Dr.82883 Transcribed locus Dr.82883 2.203 1.41E-11 2.632 1.58E-11 Dr.82884 Transcribed locus Dr.82884 1.751 2.00E-05 Dr.82889 Transcribed locus Dr.82889 3.232 0.00E+00 Dr.82918 Transcribed locus Dr.82918 6.276 1.89E-17 Dr.82927 Transcribed locus Dr.82927 1.873 1.93E-06 Dr.83060 Transcribed locus Dr.83060 5.437 1.40E-45 Dr.83062 Transcribed locus Dr.83062 1.660 2.13E-06 Dr.83076 Transcribed locus Dr.83076 4.140 5.53E-22 Dr.83101 Transcribed locus Dr.83101 1.707 7.00E-05 Dr.83102 Transcribed locus Dr.83102 2.328 3.19E-06 Dr.83104 Transcribed locus Dr.83104 6.391 6.27E-22 5.700 4.11E-27 Dr.83108 Transcribed locus Dr.83108 5.000 1.81E-27 Dr.83137 Transcribed locus Dr.83137 2.884 1.06E-11 2.260 1.43E-06 Dr.83144 Transcribed locus Dr.83144 3.003 5.48E-13 3.378 2.81E-15 3.147 2.00E-05 Dr.83175 Transcribed locus Dr.83175 2.718 1.77E-06 Dr.83180 Transcribed locus Dr.83180 2.127 1.43E-20 Dr.83251 Transcribed locus Dr.83251 2.069 1.00E-05 1.727 5.72E-21 2.575 1.06E-08 Dr.83280 Transcribed locus Dr.83280 1.987 2.43E-12 Dr.83281 Transcribed locus Dr.83281 1.846 6.05E-17 Dr.83345 Transcribed locus Dr.83345 2.211 2.79E-14 Dr.83346 Transcribed locus Dr.83346 1.917 1.00E-05 Dr.83356 Transcribed locus Dr.83356 3.010 7.00E-05 5.953 8.01E-07 Dr.83386 Transcribed locus Dr.83386 2.225 5.69E-26 Dr.83390 Transcribed locus Dr.83390 9.028 4.40E-06 Transcribed locus, weakly similar to XP_001104166.1 similar to Dr.83411 Dr.83411 3.719 3.28E-43 spermatogenesis associated 17 [Macaca mulatta] Dr.83420 Transcribed locus Dr.83420 2.212 5.12E-07 2.433 7.93E-26 2.593 4.69E-09 5.094 7.59E-24 Dr.83434 Transcribed locus Dr.83434 4.451 5.14E-07 5.423 1.20E-12 Dr.83526 Transcribed locus Dr.83526 2.334 2.92E-09
Transcribed locus, weakly similar to XP_001106657.1 similar to Metalloproteinase inhibitor 2 Dr.83549 Dr.83549 3.426 2.01E-19 precursor (TIMP-2) (Tissue inhibitor of metalloproteinases-2) (CSC-21K) [Macaca mulatta]
Dr.83658 Transcribed locus Dr.83658 2.215 2.96E-08 Dr.83826 Transcribed locus Dr.83826 1.623 1.00E-05 1.891 7.14E-17 Dr.83842 Transcribed locus Dr.83842 2.113 1.18E-06 Dr.83855 Transcribed locus Dr.83855 2.761 8.25E-10 Dr.83922 Transcribed locus Dr.83922 2.267 1.23E-06 3.702 9.03E-21 Dr.83951 Transcribed locus Dr.83951 1.645 2.00E-05 Dr.83994 Transcribed locus Dr.83994 2.467 7.00E-05 1.894 5.00E-05 2.237 6.00E-05 Dr.84041 Transcribed locus Dr.84041 1.519 4.36E-06 1.513 4.00E-05 1.846 2.87E-07 3.652 0.00E+00 Dr.84054 Transcribed locus Dr.84054 1.561 2.73E-07
Transcribed locus, moderately similar to XP_001086947.1 Dr.84056 glycerol-3-phosphate Dr.84056 7.650 5.13E-34 dehydrogenase 2 (mitochondrial) isoform 2 [Macaca mulatta]
Dr.84327 Transcribed locus Dr.84327 2.116 1.00E-05 2.195 1.71E-06 Dr.84365 Transcribed locus Dr.84365 7.815 1.85E-10 Dr.84370 Transcribed locus Dr.84370 1.845 1.02E-08 Dr.84373 Transcribed locus Dr.84373 1.912 1.00E-05 Dr.84393 Transcribed locus Dr.84393 3.340 4.48E-11 Dr.84426 Transcribed locus Dr.84426 6.541 1.06E-06 Dr.84436 Transcribed locus Dr.84436 1.894 3.05E-08 Dr.84527 Transcribed locus Dr.84527 1.774 7.59E-19 Dr.84559 Transcribed locus Dr.84559 1.608 7.76E-06 Dr.84597 Transcribed locus Dr.84597 4.646 2.00E-05 Dr.84615 Transcribed locus Dr.84615 3.135 4.40E-06 Dr.84630 Transcribed locus Dr.84630 1.745 1.22E-11 2.492 4.97E-30 Dr.84632 Transcribed locus Dr.84632 1.531 2.09E-07 1.934 1.00E-05 Dr.84659 Transcribed locus Dr.84659 1.750 4.27E-08
Transcribed locus, weakly similar Dr.84722 to XP_001116280.1 similar to ATP Dr.84722 1.633 4.00E-05 binding domain 3 [Macaca mulatta]
Dr.84756 Transcribed locus Dr.84756 1.870 2.00E-05 Transcribed locus, moderately similar to XP_001090014.1 similar Dr.84787 to Complement C1q-like protein 3 Dr.84787 4.361 4.83E-06 precursor (Gliacolin) [Macaca mulatta] Dr.84788 Transcribed locus Dr.84788 3.054 1.09E-10 Dr.84837 Transcribed locus Dr.84837 4.274 1.00E-05 3.883 8.00E-05 Dr.84839 Transcribed locus Dr.84839 2.497 2.99E-12 2.801 2.49E-15 3.790 7.92E-08 Dr.84845 Transcribed locus Dr.84845 1.848 5.34E-06 Dr.84864 Transcribed locus Dr.84864 2.910 3.11E-06 4.219 1.17E-10 Dr.84916 Transcribed locus Dr.84916 2.798 9.39E-13 Dr.85215 Transcribed locus Dr.85215 2.220 2.38E-06 4.275 1.17E-23 Dr.85220 Transcribed locus Dr.85220 2.169 1.18E-06 Dr.85425 Transcribed locus Dr.85425 1.745 3.35E-08 Dr.85516 Transcribed locus Dr.85516 5.222 7.69E-16 Dr.85557 Transcribed locus Dr.85557 3.121 3.35E-15 Dr.85572 Transcribed locus Dr.85572 2.400 1.04E-16 Dr.85649 Transcribed locus Dr.85649 1.632 5.00E-05 1.762 1.00E-04 Dr.85684 Transcribed locus Dr.85684 3.658 5.27E-07 Dr.85690 Transcribed locus Dr.85690 1.766 1.24E-14 Dr.85729 Transcribed locus Dr.85729 2.779 1.48E-12 Dr.85849 Transcribed locus Dr.85849 5.472 0.00E+00 Dr.85903 Transcribed locus Dr.85903 5.443 1.67E-12 2.652 2.42E-06 9.719 2.19E-21 Dr.85911 Transcribed locus Dr.85911 1.679 4.00E-05 Dr.85922 Transcribed locus Dr.85922 2.847 1.28E-06 Dr.85933 Transcribed locus Dr.85933 1.715 6.60E-06 Dr.85965 Transcribed locus Dr.85965 2.894 3.98E-08 2.880 2.58E-08 Dr.86025 Transcribed locus Dr.86025 1.822 4.23E-18 Dr.86040 Transcribed locus Dr.86040 1.876 5.45E-06 Dr.86052 Transcribed locus Dr.86052 1.511 6.61E-07 1.680 1.94E-11 Dr.86079 Transcribed locus Dr.86079 2.267 5.39E-14 Dr.86081 Transcribed locus Dr.86081 2.288 2.41E-06 Dr.86115 Transcribed locus Dr.86115 1.558 1.52E-07 1.898 4.06E-23 1.739 1.96E-08 Dr.86460 Transcribed locus Dr.86460 2.623 9.25E-09 Dr.86498 Transcribed locus Dr.86498 1.651 3.00E-05 2.095 2.27E-10 1.701 6.00E-05 Dr.86510 Transcribed locus Dr.86510 3.601 2.93E-06 Dr.86520 Transcribed locus Dr.86520 4.263 1.91E-08 Dr.86565 Transcribed locus Dr.86565 2.355 1.12E-07 Dr.86575 Transcribed locus Dr.86575 4.978 8.00E-05 Dr.86709 Transcribed locus Dr.86709 1.590 2.56E-06 Dr.86973 Transcribed locus Dr.86973 3.070 3.00E-05 Dr.87053 Transcribed locus Dr.87053 3.190 2.00E-05 Dr.88798 Transcribed locus Dr.88798 6.438 7.87E-06 6.004 1.00E-05 Dr.88858 Transcribed locus Dr.88858 3.033 3.87E-06 5.682 3.64E-11 Dr.89189 Transcribed locus Dr.89189 2.544 2.54E-09 3.149 4.20E-13 Dr.89558 Transcribed locus Dr.89558 2.103 6.00E-05 Dr.89628 Transcribed locus Dr.89628 4.743 9.00E-05 Dr.89643 Transcribed locus Dr.89643 2.373 1.44E-40 Dr.89651 Transcribed locus Dr.89651 2.583 1.31E-14 2.285 5.01E-11 Dr.89757 Transcribed locus Dr.89757 2.523 1.00E-05 4.423 2.78E-19 2.150 4.76E-20 2.995 1.71E-07 7.866 2.23E-11 7.900 2.80E-12 Dr.89930 Transcribed locus Dr.89930 2.470 6.62E-08 Dr.90120 Transcribed locus Dr.90120 4.111 4.18E-15 Dr.90284 Transcribed locus Dr.90284 1.627 2.00E-05 1.865 5.90E-23 2.006 4.00E-05 Dr.90383 Transcribed locus Dr.90383 1.928 1.41E-17 1.597 2.00E-05 1.747 8.43E-10 Dr.90436 Transcribed locus Dr.90436 1.747 3.00E-05 Dr.90441 Transcribed locus Dr.90441 1.610 7.80E-06 Dr.90455 Transcribed locus Dr.90455 2.287 2.18E-09 2.051 1.26E-06 Dr.90533 Transcribed locus Dr.90533 2.919 5.08E-09 2.613 1.00E-05 Dr.90540 Transcribed locus Dr.90540 2.157 4.00E-05 Dr.90564 Transcribed locus Dr.90564 1.922 9.00E-05 2.771 3.88E-06 4.772 1.00E-05 Dr.90573 Transcribed locus Dr.90573 3.668 3.21E-07 3.180 5.71E-06 Dr.90629 Transcribed locus Dr.90629 1.995 9.00E-05 2.048 4.00E-05 Dr.90650 Transcribed locus Dr.90650 2.585 9.12E-08 Dr.90656 Transcribed locus Dr.90656 6.604 8.07E-08 Dr.90668 Transcribed locus Dr.90668 2.656 5.92E-06 Dr.90672 Transcribed locus Dr.90672 1.692 4.36E-06 Dr.90742 Transcribed locus Dr.90742 2.841 1.28E-12 Dr.90757 Transcribed locus Dr.90757 1.888 7.00E-05 Dr.90763 Transcribed locus Dr.90763 6.916 3.11E-06 Dr.90779 Transcribed locus Dr.90779 1.521 1.11E-08 Dr.90792 Transcribed locus Dr.90792 4.057 1.78E-07 3.100 5.00E-05 Dr.90818 Transcribed locus Dr.90818 2.150 3.89E-18 2.176 3.16E-16 Dr.90833 Transcribed locus Dr.90833 1.805 1.35E-08 Dr.90912 Transcribed locus Dr.90912 1.770 4.15E-07 Dr.91047 Transcribed locus Dr.91047 1.903 1.47E-13
Transcribed locus, strongly similar to NP_001007066.1 receptor Dr.91146 Dr.91146 1.563 2.37E-06 1.631 2.49E-11 potential cation channel, subfamily A, member 1a [Danio rerio]
Dr.91687 Transcribed locus Dr.91687 2.987 7.99E-07 Dr.91932 Transcribed locus Dr.91932 2.972 7.73E-06 Dr.91984 Transcribed locus Dr.91984 1.529 2.25E-14 Dr.92037 Transcribed locus Dr.92037 2.020 3.69E-06 2.011 3.00E-05 2.114 5.01E-07 Dr.92084 Transcribed locus Dr.92084 1.574 2.00E-05 1.762 1.66E-08 Dr.92105 Transcribed locus Dr.92105 2.311 8.90E-06 Dr.92138 Transcribed locus Dr.92138 1.798 1.00E-05 2.254 8.65E-15 Dr.92239 Transcribed locus Dr.92239 2.742 1.00E-05 Transcribed locus, weakly similar to XP_001096246.1 similar to Dr.92246 Dr.92246 2.029 1.16E-07 slingshot homolog 1 [Macaca mulatta] Dr.92257 Transcribed locus Dr.92257 1.519 7.91E-06 Dr.92304 Transcribed locus Dr.92304 1.623 7.70E-09 Dr.92335 Transcribed locus Dr.92335 6.204 3.63E-09 Dr.92370 Transcribed locus Dr.92370 2.776 3.15E-10 Dr.92392 Transcribed locus Dr.92392 2.353 3.00E-05 Dr.92684 Transcribed locus Dr.92684 1.865 1.08E-09 Dr.92719 Transcribed locus Dr.92719 7.923 1.11E-06 Dr.92777 Transcribed locus Dr.92777 2.030 1.94E-13 Dr.92794 Transcribed locus Dr.92794 3.183 2.54E-11 Dr.93139 CDNA clone IMAGE:7140684 Dr.93139 1.520 6.92E-10 Dr.93856 Transcribed locus Dr.93856 3.889 9.92E-17 Dr.94477 CDNA clone IMAGE:7267816 Dr.94477 4.852 5.50E-09 4.482 4.17E-07 Dr.95177 Transcribed locus Dr.95177 2.161 4.38E-07 Dr.9594 Transcribed locus Dr.9594 1.792 8.00E-05 3.128 5.41E-13 Transcribed locus, moderately similar to XP_001086421.1 Dr.9683 Dr.9683 1.656 2.27E-10 hypothetical protein isoform 1 [Macaca mulatta] Dr.97432 Transcribed locus Dr.97432 2.069 1.01E-07 Dr.9851 Transcribed locus Dr.9851 2.092 1.35E-07 Dr.99274 Transcribed locus Dr.99274 2.214 1.56E-41 Dr.99729 Transcribed locus Dr.99729 2.248 3.65E-09 2.070 6.00E-05 2.710 1.90E-11 2.442 7.34E-07 drd2a Dopamine receptor D2a Dr.88537 282557 3.957 4.41E-07 dtnbp1 Dystrobrevin binding protein 1 Dr.80474 394109 2.478 1.13E-33 dub Duboraya Dr.80847 751710 1.689 4.31E-07 dusp1 Dual specificity phosphatase 1 Dr.2413 406340 2.661 1.73E-27 dusp5 Dual specificity phosphatase 5 Dr.120234 114436 6.541 1.40E-45 dusp6 Dual specificity phosphatase 6 Dr.16301 353314 2.753 0.00E+00 ebna1bp2l EBNA1 binding protein 2-like Dr.31853 335049 1.504 1.87E-10 Enhancer of mRNA decapping 3 edc3 Dr.120768 504054 1.713 2.07E-11 homolog (S. cerevisiae) ER degradation enhancer, edem1 Dr.11486 394164 1.849 7.56E-42 mannosidase alpha-like 1 eef2k Elongation factor-2 kinase Dr.32643 437013 1.916 1.00E-05 ef1 ETS-related factor1 Dr.76289 30396 2.720 1.61E-09 efna1 Ephrin A1 Dr.104284 494151 1.725 7.52E-28 efnb2b Ephrin B2b Dr.12618 114402 1.862 4.00E-05 egfr Epidermal growth factor receptor Dr.82227 378478 1.694 3.94E-22 egln3 Egl nine homolog 3 (C. elegans) Dr.9457 406602 2.592 1.63E-09 17.124 0.00E+00 egr1 Early growth response 1 Dr.10183 30498 2.517 2.58E-12 5.739 1.22E-31 egr2a Early growth response 2a Dr.86414 368241 3.994 2.62E-12 Eukaryotic translation initiation eif2b1 Dr.76300 415150 2.359 0.00E+00 factor 2B, subunit 1 alpha Eukaryotic translation initiation eif2b2 Dr.79476 405839 2.323 3.83E-25 factor 2B, subunit 2 beta Eukaryotic translation initiation eif2b4 Dr.43296 322236 3.182 1.19E-29 factor 2B, subunit 4 delta Eukaryotic translation initiation eif2b5 Dr.78677 327153 1.742 4.26E-07 factor 2B, subunit 5 epsilon Eukaryotic translation initiation eif2s1 Dr.76835 321564 1.681 2.10E-24 factor 2, subunit 1 alpha Eukaryotic translation initiation eif2s2 Dr.25507 324365 1.848 1.36E-25 factor 2, subunit 2 beta Eukaryotic translation initiation eif2s3 Dr.76044 327341 1.688 1.06E-16 factor 2, subunit 3 gamma Eukaryotic translation initiation eif3s8 Dr.117110 334234 1.807 9.18E-13 1.545 4.78E-16 factor 3, subunit 8 Eukaryotic translation initiation eif4e1a Dr.5294 79380 1.737 1.31E-07 factor 4e 1a ela2 Elastase 2 Dr.82353 403061 1.539 3.80E-06 E74-like factor 3 (ets domain elf3 transcription factor, epithelial- Dr.76707 336816 1.536 3.46E-21 1.541 2.38E-07 1.609 6.82E-12 3.289 4.10E-07 7.912 2.70E-06 specific ) Elongation factor RNA polymerase ell Dr.79235 325221 1.741 2.03E-13 II Elongation of very long chain fatty elovl1 acids (FEN1/Elo2, SUR4/Elo3, Dr.78825 327274 2.781 0.00E+00 yeast)-like 1 Elongation protein 4 homolog (S. elp4 Dr.79765 550331 2.350 6.81E-22 cerevisiae) emx3 Empty spiracles homeobox 3 Dr.75757 30536 2.409 0.00E+00 Ectodermal-neural cortex (with enc1 Dr.9565 327531 1.822 1.18E-26 BTB-like domain) eng1a Engrailed 1a Dr.75072 30244 2.176 1.14E-19 2.038 1.83E-08 eno1 Enolase 1, (alpha) Dr.4724 334116 2.432 1.04E-15 env Envelope protein Dr.132764 402813 1.515 4.57E-16 1.648 8.17E-07 2.531 1.43E-16 eps8l3 EPS8-like 3 Dr.26481 393332 1.724 7.00E-05 erm Ets related protein erm Dr.104699 30452 1.704 1.39E-24 ero1l ERO1-like (S. cerevisiae) Dr.86356 393321 9.421 0.00E+00 es1 Es1 protein Dr.1461 30237 2.268 4.00E-05 Electron-transfer-flavoprotein, etfa Dr.86220 325724 2.338 1.16E-10 alpha polypeptide V-ets erythroblastosis virus E26 ets1a Dr.98888 280651 1.656 1.92E-09 oncogene homolog 1a etv6 Ets variant gene 6 (TEL oncogene) Dr.121185 114444 1.958 2.74E-22 eva1 Epithelial V-like antigen 1 Dr.6507 336830 3.059 4.93E-40 exosc4 Exosome component 4 Dr.107456 393712 2.384 1.86E-07 1.515 2.63E-07 1.883 8.27E-06 exosc8 Exosome component 8 Dr.116761 323016 1.576 1.26E-08 1.669 4.14E-06 f11r F11 receptor Dr.28599 323696 1.785 2.38E-17 Family with sequence similarity fam107b Dr.79005 386641 1.615 1.72E-27 107, member B Family with sequence similarity 45, fam45a Dr.35585 324827 1.724 3.25E-06 member A Family with sequence similarity 45, fam45a Dr.117481 324827 2.056 6.63E-07 member A Phenylalanyl-tRNA synthetase, farsa Dr.80095 692329 2.473 1.03E-10 alpha subunit Fas (TNF receptor superfamily, fas Dr.82180 768248 3.662 1.00E-19 12.544 5.29E-18 member 6) fat FAT tumor suppressor homolog 1 Dr.87471 406172 1.677 1.39E-13
F-box and leucine-rich repeat fbxl2 Dr.81393 378737 2.093 9.29E-26 protein 2 fbxo32 F-box protein 32 Dr.11532 393891 8.054 0.00E+00 fbxo44 F-box protein 44 Dr.37880 494034 1.729 1.50E-29 Farnesyl diphosphate synthase (farnesyl pyrophosphate fdps synthetase, Dr.77233 552997 1.633 4.71E-06 dimethylallyltranstransferase, geranyltranstransferase) Fasciculation and elongation fez1 Dr.116746 406705 1.813 4.64E-09 1.649 8.62E-06 protein zeta 1 (zygin I) fgf20a Fibroblast growth factor 20a Dr.17781 559630 1.527 1.83E-07 fgf24 Fibroblast growth factor 24 Dr.82992 359831 2.503 8.63E-20 fgf8b Fibroblast growth factor 8 b Dr.20979 65089 1.987 2.04E-12 Fibroblast growth factor receptor- fgfrl1b Dr.37960 497135 1.879 1.03E-08 like 1b fgl2 Fibrinogen-like 2 Dr.81522 565637 1.769 7.92E-15 1.760 4.00E-05 fkbp5 FK506 binding protein 5 Dr.78793 368924 1.680 5.07E-08 3.318 0.00E+00 3.734 0.00E+00 fkrp Fukutin related protein Dr.11951 571426 2.360 1.38E-19 1.703 1.00E-04 2.363 1.50E-12 FLJ11273 Hypothetical protein FLJ11273 Dr.13704 407612 1.652 1.06E-15 flj13639 Flj13639 Dr.81111 336160 3.936 1.53E-35 Hypothetical protein FLJ20272 flj20272l Dr.118853 317640 2.031 2.98E-06 (human) - like flot1 Flotillin 1 Dr.140639 30069 2.672 1.17E-16 1.826 2.18E-07 2.563 4.99E-16 fn1 Fibronectin 1 Dr.97370 58034 1.892 3.60E-08 fn1b Fibronectin 1b Dr.24233 334613 1.849 1.84E-06 1.510 2.26E-06 2.227 2.67E-15 fnbp1l Formin binding protein 1-like Dr.34028 445240 1.661 7.33E-06
V-fos FBJ murine osteosarcoma fos Dr.12986 394198 1.648 3.82E-23 1.795 3.72E-08 1.866 1.05E-15 5.348 6.40E-22 25.040 2.48E-43 viral oncogene homolog foxc1a Forkhead box C1a Dr.82483 79374 1.697 3.45E-13 foxc1b Forkhead box C1b Dr.83301 79375 2.488 2.00E-05 2.606 2.78E-10 foxi1 Forkhead box I1 Dr.20969 353313 3.010 1.25E-27 foxk1 Forkhead box K1 Dr.81025 334470 1.994 6.67E-19 foxo5 Forkhead box O5 Dr.78161 30296 1.540 1.17E-18 fpgs Folylpolyglutamate synthase Dr.81920 406746 1.686 4.33E-12 4.683 0.00E+00 freqa Frequenin homolog a (Drosophila) Dr.114934 393437 1.902 4.53E-07 fst Follistatin Dr.75293 30235 1.935 7.94E-15 fstl1 Follistatin-like 1 Dr.4964 325423 1.659 1.65E-22 fuca1 Fucosidase, alpha-L- 1, tissue Dr.76172 335494 3.819 5.62E-39 Follicular lymphoma variant fvt1 Dr.12808 394114 1.523 2.09E-09 translocation 1 g12 Gastrulation specific protein Dr.75062 30600 2.334 8.83E-41 GABA(A) receptor-associated gabarap Dr.12845 326974 1.773 9.79E-17 protein Growth arrest and DNA-damage- gadd45a Dr.83410 431763 1.626 1.38E-22 1.572 5.63E-13 5.465 0.00E+00 inducible, alpha Growth arrest and DNA-damage- gadd45al Dr.27107 393548 12.002 0.00E+00 inducible, alpha like Growth arrest and DNA-damage- gadd45b Dr.76269 406304 9.928 0.00E+00 inducible, beta Growth arrest and DNA-damage- gadd45bl Dr.83988 497646 2.124 7.06E-18 10.766 0.00E+00 inducible, beta like gata6 GATA-binding protein 6 Dr.78356 58076 1.922 2.00E-05 Glycogen synthase kinase binding gbp Dr.81277 30719 1.533 1.42E-25 protein Glutaryl-Coenzyme A gcdhl Dr.14829 450003 1.765 1.25E-22 dehydrogenase, like Glutamate-cysteine ligase, catalytic gclc Dr.80394 326857 2.146 3.01E-18 subunit Glucosaminyl (N-acetyl) gcnt4 Dr.78782 324510 2.050 4.73E-14 transferase 4, core 2
Ganglioside induced differentiation gdap2 Dr.96510 447824 2.137 2.72E-11 associated protein 2 gdf7 Growth/differentiation factor 7 Dr.88610 30642 1.715 5.00E-05 gfra1a Gdnf family receptor alpha 1a Dr.119737 79376 1.577 1.00E-05
Gamma-glutamyl hydrolase ggh (conjugase, Dr.115933 406624 2.110 9.16E-08 folylpolygammaglutamyl hydrolase)
GIPC PDZ domain containing gipc2 Dr.105887 393904 2.593 8.09E-35 family, member 2 Glioma tumor suppressor gltscr1 Dr.75629 386775 1.907 2.00E-05 2.353 9.84E-11 candidate region gene 1 Guanine nucleotide binding protein gna12 Dr.36967 503589 2.001 1.07E-17 (G protein) alpha 12 Guanine nucleotide binding protein gna13b Dr.132898 336333 2.366 2.86E-23 (G protein), alpha 13b
Guanine nucleotide binding protein gnai2l (G protein), alpha inhibiting activity Dr.76694 336421 2.010 2.62E-25 polypeptide 2, like
Guanine nucleotide binding protein- gnl2 Dr.16124 406505 2.092 6.91E-20 like 2 (nucleolar) Guanine nucleotide binding protein- gnl3l Dr.3178 442932 1.590 6.08E-16 like 3 (nucleolar)-like gnmt Glycine N-methyltransferase Dr.76276 403338 3.446 3.82E-14 Glucosamine-6-phosphate gnpda1 Dr.81730 550565 1.597 7.26E-06 deaminase 1 N-acetylglucosamine-1-phosphate gnptg Dr.3328 415147 2.121 8.51E-12 transferase, gamma subunit gnrh2 Gonadotropin-releasing hormone 2 Dr.84757 353222 2.525 1.40E-45 1.989 1.40E-39 6.627 5.75E-40 2.018 4.60E-20 3.497 3.43E-35 6.429 0.00E+00 32.391 0.00E+00
Glucosamine (N-acetyl)-6-sulfatase gnsb Dr.116837 327635 4.547 1.40E-45 (Sanfilippo disease IIID), b
Golgi associated PDZ and coiled- gopc Dr.77875 326887 1.740 3.45E-26 coil motif containing Golgi SNAP receptor complex gosr2 Dr.8698 324569 1.501 2.43E-36 member 2 Glutamic-oxaloacetic transaminase got2 2, mitochondrial (aspartate Dr.17618 406688 1.646 5.90E-10 aminotransferase 2)
Glycerol-3-phosphate gpd2 Dr.89610 326670 4.640 0.00E+00 dehydrogenase 2 (mitochondrial) gpia Glucose phosphate isomerase a Dr.11244 246094 2.880 0.00E+00 gpr137bb G protein-coupled receptor 137bb Dr.79556 436964 2.478 3.49E-07 gpr19 G protein-coupled receptor 19 Dr.87847 393969 1.560 1.94E-07 gpx1b Glutathione peroxidase 1b Dr.79923 447895 3.495 0.00E+00 gpx4b Glutathione peroxidase 4b Dr.24921 352929 1.962 0.00E+00 grhl1 Grainyhead-like 1 (Drosophila) Dr.132518 324942 2.167 1.03E-19 grpel1 GrpE-like 1, mitochondrial Dr.5829 559037 1.816 1.07E-13 gtf3aa General transcription factor IIIAa Dr.78835 445389 1.867 6.70E-29 gtpbp1 GTP binding protein 1 Dr.75321 378721 12.912 0.00E+00 guca1c Guanylate cyclase activator 1C Dr.81617 373099 2.005 5.49E-07 1.514 1.43E-06 1.657 8.99E-06 h1fx H1 histone family, member X Dr.24246 322508 4.458 1.58E-20 h2afza Histone 2A family member ZA Dr.29040 403077 1.724 3.00E-05 hagh Hydroxyacylglutathione hydrolase Dr.114249 336977 4.698 1.10E-28 hamp1 Hepcidin antimicrobial peptide 1 Dr.89447 402837 4.178 0.00E+00 9.168 2.03E-23 5.002 1.09E-06 6.860 1.18E-24 6.059 3.85E-07 27.455 4.86E-38 32.041 5.49E-35 has2 Hyaluronan synthase 2 Dr.82516 260350 1.575 2.54E-08 hdac9b Histone deacetylase 9b Dr.25756 393789 2.569 0.00E+00 heatr1 HEAT repeat containing 1 Dr.81414 334446 2.062 6.45E-44 hectd1 HECT domain containing 1 Dr.132570 368729 1.720 2.64E-11 hectd3 HECT domain containing 3 Dr.132451 386884 1.742 2.18E-08 her11 Hairy-related 11 Dr.84178 445409 2.591 5.00E-05 her2 Hairy-related 2 Dr.75063 30300 1.710 1.00E-05 her3 Hairy-related 3 Dr.75064 30289 1.695 9.74E-07 her9 Hairy-related 9 Dr.78757 140613 1.555 2.58E-25 Hexosaminidase A (alpha hexa Dr.5384 323613 2.184 1.78E-08 polypeptide) hhatlb Hedgehog acyltransferase-like, b Dr.74495 553049 1.530 6.09E-08
Hematopoietically expressed hhex Dr.79053 30098 1.705 5.62E-11 homeobox Hippocampus abundant transcript hiat1b Dr.77800 406848 1.538 4.00E-05 1b hic1l Hypermethylated in cancer 1 like Dr.75439 30771 2.263 1.18E-25
Hypoxia-inducible factor 1, alpha hif1an Dr.13371 373126 1.983 4.58E-08 subunit inhibitor hig1 Hypoxia induced gene 1 Dr.76367 373084 2.579 1.46E-08 11.135 0.00E+00 hk2 Hexokinase 2 Dr.80401 406339 4.710 1.02E-42 hm:zeh0225r Hm:zeh0225r Dr.107618 503823 1.527 1.16E-08 hm:zeh0535 Hm:zeh0535 Dr.36134 321398 1.854 2.05E-06 hm:zeh1519 Hm:zeh1519 Dr.34449 321447 2.391 7.00E-05 hm:zehn087 Hm:zehn0873 Dr.105498 337727 2.014 2.08E-19 3 hmbs Hydroxymethylbilane synthase Dr.79518 394129 1.674 2.42E-09 hmox1 Heme oxygenase (decycling) 1 Dr.78853 324382 1.674 4.86E-07 2.693 0.00E+00 homez Homeodomain leucine zipper gene Dr.75344 368671 4.099 6.24E-22 hoxb1a Homeo box B1a Dr.83326 30337 2.114 1.82E-11 hoxc1a Homeo box C1a Dr.83047 58046 2.150 1.00E-05 hoxd13a Homeo box D13a Dr.85391 30407 1.670 7.78E-13 hp Haptoglobin Dr.115936 322539 1.759 1.00E-05 hrb HIV-1 Rev binding protein Dr.1483 327597 1.578 3.80E-12 Hrc Hrc protein Dr.79314 553296 1.670 1.28E-09 Hydroxysteroid (17-beta) hsd17b12a Dr.29406 327417 2.212 5.09E-08 dehydrogenase 12a Hematopoietic SH2 domain hsh2d Dr.82057 548337 4.246 0.00E+00 containing hsp70 Heat shock cognate 70-kd protein Dr.115994 30671 15.850 0.00E+00 hsp70 Heat shock cognate 70-kd protein Dr.114305 30671 16.167 0.00E+00 hsp70 Heat shock cognate 70-kd protein Dr.134277 30671 20.714 1.42E-42 hsp90a2 Heat shock protein 90-alpha 2 Dr.132281 378840 3.739 6.16E-15 Heat shock 70kDa protein 5 hspa5 Dr.67791 378848 2.070 4.41E-43 (glucose-regulated protein) hspa9 Heat shock protein 9 Dr.76128 373085 2.058 1.25E-43 hspb11 Small heat shock protein HSPB11 Dr.119808 796767 1.611 3.00E-05 2.848 3.50E-23 hspc049l HSPC049 protein-like Dr.18243 402898 1.829 4.63E-11 hyou1 Hypoxia up-regulated 1 Dr.76183 327133 1.747 7.00E-05 iars Isoleucyl-tRNA synthetase Dr.5185 334393 3.640 2.13E-40 iclp1 Invariant chain-like protein 1 Dr.7740 58113 2.091 6.62E-19 2.085 1.85E-08 2.233 1.00E-05 3.133 7.78E-09 12.725 0.00E+00 iclp2 Invariant chain-like protein 2 Dr.75719 30645 4.429 5.00E-05 id:ibd1064 Id:ibd1064 Dr.79180 338111 1.590 9.19E-14 id:ibd1374 Id:ibd1374 Dr.82459 338253 1.923 7.02E-07 id:ibd5024 Id:ibd5024 Dr.14159 338103 2.303 1.02E-11 id:ibd5036 Id:ibd5036 Dr.34948 338252 2.303 3.97E-09 id:ibd5057 Id:ibd5057 Dr.132710 58015 1.709 1.97E-10 id:ibd5104 Id:ibd5104 Dr.83324 338216 1.562 2.93E-08 ier5 Immediate early response 5 Dr.75655 359827 1.901 0.00E+00 ifn Interferon Dr.85981 360134 5.204 1.80E-19 2.550 4.00E-06 7.613 1.20E-29 36.107 0.00E+00 ift81 Intraflagellar transport 81 homolog Dr.18625 432390 2.679 1.00E-05 3.292 6.80E-08
Insulin-like growth factor 1b igf1rb Dr.76293 245702 1.948 9.79E-09 receptor Insulin-like growth factor binding igfbp1 Dr.76315 317638 2.596 1.79E-24 2.012 1.77E-08 31.241 0.00E+00 protein 1 Immunoglobulin light iota variable igiv1s5 Dr.29724 394251 2.616 5.00E-05 1, s5 ik:tdsubc_2d Ik:tdsubc_2d11 Dr.132891 337841 5.225 1.03E-08 11 Inhibitor of kappa light polypeptide ikbkg gene enhancer in B-cells, kinase Dr.132695 541530 1.775 2.84E-24 gamma Inhibitor of kappa light polypeptide ikbkg gene enhancer in B-cells, kinase Dr.69759 541530 1.808 7.78E-12 gamma il10 Interleukin 10 Dr.135567 553957 2.419 3.95E-17 3.513 5.21E-10 2.957 8.01E-08 3.474 2.47E-26 3.122 4.05E-14 il12a Interleukin 12a Dr.135199 445410 1.657 5.00E-05 7.706 1.85E-20 il17-3 Interleukin 17-3 Dr.135566 553960 1.794 5.77E-07 2.404 1.88E-06 8.200 2.81E-29 il1b Interleukin 1, beta Dr.30443 405770 6.309 0.00E+00 2.581 1.51E-14 8.457 0.00E+00 4.499 1.53E-29 10.150 0.00E+00 85.968 0.00E+00 Immunoglobulin-like domain ildr1 Dr.32853 447904 1.993 3.55E-07 containing receptor 1 ilk Integrin linked kinase Dr.77678 393543 1.829 5.21E-23 im:6893299 Im:6893299 Dr.77944 321130 1.860 2.00E-05 im:6900357 Im:6900357 Dr.116577 570351 1.539 8.11E-11 im:6905231 Im:6905231 Dr.86317 553011 2.038 1.34E-39 im:6910498 Im:6910498 Dr.22605 448891 1.733 1.02E-17 im:6910535 Im:6910535 Dr.108863 448892 4.291 1.86E-13 4.260 5.32E-09 im:6911368 Im:6911368 Dr.80514 448895 2.097 2.00E-05 3.163 3.95E-24 2.255 1.62E-06 3.617 6.85E-28 im:6912372 Im:6912372 Dr.84188 449727 1.896 3.45E-07 im:6912504 Im:6912504 Dr.113762 497304 3.769 0.00E+00 im:7136115 Im:7136115 Dr.83392 497312 2.483 1.58E-06 2.442 6.00E-05 im:7136220 Im:7136220 Dr.88154 497317 1.981 7.67E-19 im:7136639 Im:7136639 Dr.76341 497333 3.220 4.48E-44 im:7137300 Im:7137300 Dr.86623 449766 3.905 2.66E-06 9.255 1.86E-07 im:7137769 Im:7137769 Dr.132244 449860 2.617 1.13E-15 im:7138195 Im:7138195 Dr.88718 449882 1.744 1.94E-15 im:7138823 Im:7138823 Dr.38927 497383 5.656 7.00E-05 im:7139388 Im:7139388 Dr.11306 497388 1.744 9.76E-10 im:7140048 Im:7140048 Dr.108540 503899 1.939 1.73E-08 im:7140162 Im:7140162 Dr.109254 492532 2.508 6.30E-08 1.567 5.43E-10 im:7140576 Im:7140576 Dr.81377 449945 1.934 7.76E-09 im:7142825 Im:7142825 Dr.75982 449984 2.097 8.70E-09 im:7144703 Im:7144703 Dr.77866 492647 2.797 5.61E-25 im:7145101 Im:7145101 Dr.79495 492651 1.639 9.40E-06 1.601 3.93E-06 1.697 5.76E-12 im:7145328 Im:7145328 Dr.104946 497482 1.930 3.77E-17 2.009 1.68E-26 im:7145679 Im:7145679 Dr.85658 492667 2.130 5.44E-25 im:7148034 Im:7148034 Dr.41107 553066 3.721 8.51E-07 im:7148243 Im:7148243 Dr.54134 553067 2.358 1.96E-14 im:7149072 Im:7149072 Dr.91280 445153 1.561 6.08E-06 2.073 9.33E-15 2.146 8.98E-07 im:7149561 Im:7149561 Dr.124869 503989 2.713 1.01E-11 im:7150721 Im:7150721 Dr.78394 550189 1.711 1.21E-19 1.784 2.97E-23 im:7150926 Im:7150926 Dr.39232 504036 2.509 3.74E-22 im:7151068 Im:7151068 Dr.91065 492696 2.015 5.00E-05 2.330 3.58E-08 im:7151086 Im:7151086 Dr.66408 492698 2.123 3.22E-06 1.903 1.00E-05 im:7151270 Im:7151270 Dr.91068 492704 1.677 1.60E-08 im:7151586 Im:7151586 Dr.79711 504067 1.729 1.14E-15 im:7156740 Im:7156740 Dr.105408 550315 1.561 4.00E-05 im:7158008 Im:7158008 Dr.31051 606614 1.910 9.25E-07 IMDN Intermedin precursor Dr.41309 403114 2.206 1.34E-07
IMP4, U3 small nucleolar imp4 Dr.19345 436992 2.007 3.30E-16 ribonucleoprotein, homolog (yeast)
Inhibitor of growth family, member ing5a Dr.13989 386591 2.271 1.76E-07 5a inhbaa Inhibin, beta Aa Dr.107692 30072 1.549 1.62E-06 6.595 5.18E-44 insig1 Insulin induced gene 1 Dr.115835 334189 2.281 1.85E-13 invs Inversin Dr.32732 245946 3.710 0.00E+00 ipo9 Importin 9 Dr.132506 406860 2.114 9.04E-08 2.365 1.71E-14 ipo9 Importin 9 Dr.33564 406860 2.522 2.70E-20 2.401 8.43E-19 Interleukin-1 receptor-associated irak4 Dr.81680 393132 2.845 1.35E-32 kinase 4 Interferon regulatory factor 2 irf2bp2 Dr.35325 406614 1.778 5.12E-15 binding protein 2 irx2a Iroquois homeobox protein 2, a Dr.88466 394032 1.599 1.17E-12 Integrin, alpha 5 (fibronectin itga5 Dr.80637 386787 2.306 4.94E-30 receptor, alpha polypeptide) itgb1b Integrin, beta 1b Dr.78856 570216 1.603 1.75E-06 itgb4bp4 Integrin beta 4 binding protein Dr.76244 386850 2.166 0.00E+00 itm2b Integral membrane protein 2B Dr.77196 323632 1.574 4.00E-05 itm2bl Integral membrane protein 2B, like Dr.116457 406248 1.715 4.20E-26 jak1 Janus kinase 1 Dr.74470 30280 1.784 2.55E-14 3.235 0.00E+00 jmjd6 Jumonji domain containing 6 Dr.86243 266962 2.043 1.23E-10 josd2 Josephin domain containing 2 Dr.81185 393120 2.470 3.28E-23 V-jun sarcoma virus 17 oncogene jun Dr.1064 335916 3.633 0.00E+00 homolog (avian) junb Jun B proto-oncogene Dr.10326 407086 2.509 9.98E-38 2.012 9.79E-31 4.382 0.00E+00 10.233 0.00E+00 junbl Jun B proto-oncogene, like Dr.737 336038 1.583 5.55E-10 1.537 1.00E-05 2.216 3.16E-13 1.515 2.21E-09 2.030 1.29E-16 2.739 0.00E+00 19.452 0.00E+00 kars Lysyl-tRNA synthetase Dr.75960 280647 3.279 4.20E-45 Potassium voltage-gated channel, kcnh2 subfamily H (eag-related), member Dr.93298 405763 1.925 7.00E-05 2 Potassium channel, subfamily K, kcnk5 Dr.27095 393606 1.529 3.00E-05 member 5 Potassium channel tetramerisation kctd10 Dr.76853 406787 1.526 5.73E-19 domain containing 10
Kelch-like ECH-associated protein keap1 Dr.52260 321837 1.879 2.49E-41 1 klf12 Kruppel-like factor 12 Dr.79292 117603 2.459 4.04E-24 klfd Kruppel-like factor d Dr.83678 30104 2.034 3.09E-09 krt18 Keratin 18 Dr.39128 352912 3.299 1.08E-18 Lysosomal-associated protein laptm4a Dr.2933 322305 1.846 2.70E-10 transmembrane 4 alpha LAG1 homolog, ceramide synthase lass2 Dr.12608 259251 1.558 8.12E-07 2 (S. cerevisiae) LAG1 homolog, ceramide synthase lass5 Dr.77486 323020 1.656 2.38E-06 5 (S. cerevisiae) Ladybird homeobox homolog 1 lbx1 Dr.27181 64276 2.065 2.26E-06 (Drosophila) Lectin, galactoside-binding, lgals1l3 Dr.84923 393486 2.531 1.51E-11 soluble, 1 (galectin 1)-like 3 lgmn Legumain Dr.32320 406625 1.984 1.04E-07 lhfp Lipoma HMGIC fusion partner Dr.76496 494110 1.619 2.89E-08 lhx3 LIM homeobox 3 Dr.570 30455 2.237 2.31E-08 Lens intrinsic membrane protein lim2.4 Dr.88040 436680 2.257 4.63E-07 2.4 Lethal giant larvae homolog 2 llgl2 Dr.76731 321288 1.726 4.28E-36 (Drosophila) LOC1000000 Hypothetical protein Dr.93413 100000059 8.241 8.53E-11 59 LOC100000059 LOC1000000 Similar to Solute carrier family 20, Dr.79853 100000090 1.694 6.53E-11 3.079 1.05E-42 90 member 1a LOC1000001 Similar to KIAA1797 Dr.85734 100000144 4.245 2.00E-05 44 LOC1000002 Hypothetical protein Dr.107455 100000242 2.837 8.65E-06 42 LOC100000242 Similar to Probable pancreatic LOC1000002 secretory proteinase inhibitor (PSTI Dr.134394 100000257 2.274 9.64E-16 57 type) LOC1000003 Similar to Lep d 10 protein Dr.76634 100000389 2.372 0.00E+00 89 LOC1000004 Similar to Si:dkey-220f10.6 Dr.78122 100000403 2.200 1.00E-05 03 LOC1000004 Similar to alpha3- Dr.41192 100000404 2.173 5.37E-08 04 fucosyltransferase LOC1000004 Similar to mFLJ00150 protein Dr.115115 100000455 3.080 2.37E-12 2.661 1.94E-09 55 LOC1000005 Hypothetical protein Dr.133114 100000528 6.101 5.67E-24 28 LOC100000528 LOC1000005 Similar to furinA preproprotein Dr.121018 100000553 1.929 2.00E-05 53 LOC1000006 Hypothetical protein Dr.84913 100000643 2.058 4.32E-18 2.119 3.41E-20 2.154 4.18E-21 2.560 0.00E+00 5.545 4.07E-35 43 LOC100000643 LOC1000006 Hypothetical protein Dr.114296 100000648 1.546 8.96E-07 48 LOC100000648 LOC1000008 Hypothetical protein Dr.83412 100000849 1.606 2.93E-06 49 LOC100000849 LOC1000009 Hypothetical protein Dr.48801 100000934 6.823 2.22E-13 5.497 5.61E-10 34 LOC100000934 LOC1000010 Hypothetical protein Dr.117939 100001075 3.107 3.69E-18 4.980 2.37E-30 7.934 3.45E-15 75 LOC100001075 LOC1000012 Similar to Septin 6 Dr.117997 100001243 1.676 5.16E-13 1.685 8.79E-07 43 LOC1000012 Similar to Coronin, actin binding Dr.84814 100001298 2.083 8.10E-24 98 protein, 2A LOC1000013 Similar to Prickle2 Dr.78165 100001301 1.805 2.30E-06 01 LOC1000016 Hypothetical protein Dr.90930 100001612 3.769 4.84E-10 12 LOC100001612 LOC1000017 Hypothetical protein Dr.82051 100001701 1.711 5.00E-05 1.777 9.00E-05 5.225 6.73E-09 01 LOC100001701 LOC1000017 Hypothetical protein Dr.119435 100001727 1.662 6.79E-15 27 LOC100001727 LOC1000017 Similar to cathepsin L Dr.132540 100001785 3.005 1.13E-15 3.791 5.66E-11 85 LOC1000018 Hypothetical protein Dr.86454 100001811 1.851 1.91E-08 11 LOC100001811 LOC1000019 Similar to MGC86352 protein Dr.101640 100001910 4.243 5.62E-14 10 LOC1000019 Hypothetical protein Dr.44195 100001935 1.806 1.10E-09 35 LOC100001935 LOC1000021 Similar to selenoprotein Pa Dr.9483 100002165 1.675 1.55E-07 1.579 2.00E-05 65 LOC1000022 Hypothetical protein Dr.84042 100002294 2.495 2.16E-09 11.801 3.86E-27 94 LOC100002294 LOC1000024 Hypothetical protein Dr.120617 100002439 1.633 9.44E-06 39 LOC100002439 LOC1000024 Hypothetical protein Dr.114497 100002471 1.836 7.61E-06 2.059 4.28E-16 71 LOC100002471 LOC1000025 Hypothetical protein Dr.116475 100002541 5.481 4.00E-05 41 LOC100002541 LOC1000028 Similar to zinc finger protein 326 Dr.80410 100002879 1.721 8.70E-13 79 LOC1000028 Similar to AKAP 220 Dr.115659 100002881 3.624 4.12E-37 81 LOC1000031 Hypothetical protein Dr.115051 100003146 2.471 3.11E-06 46 LOC100003146 LOC1000032 Similar to MGC115247 protein Dr.82460 100003259 4.402 3.43E-27 59 LOC1000033 Hypothetical protein Dr.116811 100003319 1.587 4.21E-08 19 LOC100003319
LOC1000033 Similar to novel potassium channel Dr.134946 100003336 2.185 1.02E-18 2.339 2.28E-10 36 tetramerisation domain protein
LOC1000033 Hypothetical protein Dr.80570 100003387 2.332 1.47E-09 87 LOC100003387 LOC1000034 Similar to VHSV-induced protein-10 Dr.116650 100003425 2.232 5.69E-08 1.645 2.00E-05 2.354 1.38E-06 3.077 1.90E-10 5.827 6.34E-34 25 LOC1000035 Hypothetical protein Dr.109665 100003516 1.621 3.59E-14 16 LOC100003516 LOC1000036 Hypothetical protein Dr.117191 100003670 1.612 5.07E-10 70 LOC100003670 LOC1000037 Hypothetical protein Dr.120214 100003732 4.898 1.00E-05 32 LOC100003732 LOC1000037 Hypothetical protein Dr.67403 100003744 2.073 2.13E-22 44 LOC100003744 LOC1000037 Hypothetical protein Dr.133934 100003780 15.257 5.82E-09 80 LOC100003780 LOC1000039 Hypothetical protein Dr.92011 100003911 1.743 1.07E-07 3.333 1.56E-13 4.181 1.09E-24 31.473 0.00E+00 11 LOC100003911 LOC1000042 Interleukin 10 family protein Dr.94073 100004224 6.245 3.61E-09 24 LOC1000042 Hypothetical protein Dr.16747 100004261 5.877 1.33E-23 61 LOC100004261 LOC1000044 Similar to solute carrier family 26 Dr.116159 100004438 3.173 4.07E-26 38 member 6 b LOC1000044 Similar to erythropoietin Dr.11767 100004455 4.074 1.04E-15 55 LOC1000045 Hypothetical protein Dr.117748 100004573 4.588 3.29E-13 5.132 2.44E-43 3.558 6.00E-05 73 LOC100004573 LOC1000046 Similar to Apoa4 protein Dr.132329 100004607 2.090 7.36E-20 07 LOC1000049 Hypothetical protein Dr.80969 100004989 1.754 1.31E-15 1.897 8.53E-09 2.490 9.98E-18 1.780 5.94E-08 1.571 5.68E-12 4.051 6.53E-13 89 LOC100004989 LOC1000050 Hypothetical protein Dr.80232 100005016 13.871 6.19E-16 16 LOC100005016 LOC1000050 Similar to alpha-tectorin Dr.65913 100005077 3.408 3.65E-07 6.749 9.25E-09 44.086 2.75E-18 77 Similar to Solute carrier family 7 LOC1000051 (cationic amino acid transporter, y+ Dr.119870 100005141 1.640 1.00E-05 5.543 1.90E-16 41 system), member 3 LOC1000052 Similar to interferon-inducible Dr.15615 100005232 7.438 5.19E-08 32 protein Gig2 LOC1000053 Similar to Josephin domain Dr.118469 100005322 2.297 0.00E+00 22 containing 2
Similar to UDP-glucuronic LOC1000053 acid/UDP-N-acetylgalactosamine Dr.115527 100005351 3.457 1.17E-12 51 dual transporter
LOC1000054 Hypothetical protein Dr.118632 100005401 1.967 1.28E-40 01 LOC100005401 LOC1000055 Hypothetical protein Dr.87663 100005536 6.074 5.02E-10 4.208 8.42E-08 36 LOC100005536 Similar to Pancreatic secretory granule membrane major LOC1000056 glycoprotein GP2 precursor Dr.117400 100005685 4.576 4.58E-20 85 (Pancreatic zymogen granule membrane protein GP-2) LOC1000057 Hypothetical protein Dr.79723 100005753 1.611 8.33E-07 53 LOC100005753 LOC1000058 Similar to B-aggressive lymphoma Dr.23573 100005858 1.501 3.00E-05 1.932 7.80E-08 58 3 LOC1000058 Hypothetical protein Dr.84710 100005885 1.856 3.28E-23 85 LOC100005885 LOC1000059 Similar to endophilin III Dr.23431 100005925 2.094 8.57E-06 25 LOC1000059 Similar to MGC85050 protein Dr.946 100005937 1.594 4.12E-13 37 LOC1000063 Hypothetical protein Dr.19485 100006354 2.091 2.00E-05 54 LOC100006354 LOC1000064 Hypothetical protein Dr.67374 100006440 1.501 8.00E-05 40 LOC100006440 LOC1000065 Hypothetical protein Dr.13947 100006524 1.556 4.00E-05 3.146 2.43E-24 24 LOC100006524 LOC1000066 Hypothetical protein Dr.117941 100006655 1.756 1.65E-06 55 LOC100006655 LOC1000068 Hypothetical protein Dr.115740 100006862 2.787 1.93E-23 62 LOC100006862 LOC1000069 Hypothetical protein Dr.82406 100006917 1.532 4.00E-05 17 LOC100006917 LOC1000069 Hypothetical protein Dr.113861 100006949 2.527 2.00E-05 49 LOC100006949 LOC1000070 Similar to Jun dimerization protein Dr.81777 100007087 7.067 0.00E+00 6.424 2.42E-21 6.042 3.53E-23 3.712 2.75E-06 40.441 1.57E-42 33.369 0.00E+00 87 1 JDP-1 LOC1000073 Hypothetical protein Dr.83664 100007304 2.212 1.46E-07 04 LOC100007304 LOC1000074 Hypothetical protein Dr.119610 100007403 1.632 7.17E-11 4.344 2.60E-16 7.988 0.00E+00 03 LOC100007403 LOC1000074 Hypothetical protein Dr.74638 100007461 23.117 8.27E-12 61 LOC100007461 LOC1000074 Similar to Dystrobrevin binding Dr.118558 100007489 1.934 8.00E-05 89 protein 1 LOC1000076 Hypothetical protein Dr.82408 100007669 1.527 1.87E-09 69 LOC100007669 LOC1000076 Hypothetical protein Dr.23033 100007681 2.110 1.02E-29 81 LOC100007681 LOC1000077 Hypothetical protein Dr.86350 100007768 1.984 7.00E-05 1.925 5.55E-06 68 LOC100007768 LOC1000077 Similar to Pdc2 protein Dr.121473 100007784 4.571 1.75E-35 84 LOC1000083 Hypothetical protein Dr.78696 100008320 2.866 1.78E-13 20 LOC100008320 LOC1000085 Hypothetical protein Dr.121323 100008526 6.402 4.14E-18 3.249 1.09E-07 4.653 1.63E-13 9.996 3.37E-26 26 LOC100008526 LOC402785 Bicaudal-C Dr.87655 402785 2.165 8.21E-11 LOC402857 Hypothetical protein LOC402857 Dr.27086 402857 13.942 0.00E+00 21.061 1.63E-36 12.637 7.34E-35 10.463 3.17E-11 LOC402880 Hypothetical protein LOC402880 Dr.5461 402880 1.757 7.81E-08 LOC407664 Hypothetical protein LOC407664 Dr.83237 407664 1.671 7.00E-05 4.231 6.02E-19 LOC407678 Hypothetical protein LOC407678 Dr.87071 407678 1.506 1.40E-06 LOC407694 Hypothetical protein LOC407694 Dr.77359 407694 2.366 5.00E-05 2.821 7.32E-07 3.516 5.01E-11 LOC553231 Hypothetical protein LOC553231 Dr.11563 553231 1.946 4.92E-21 LOC553253 Hypothetical protein LOC553253 Dr.81009 553253 2.555 9.18E-27 LOC553285 Hypothetical protein LOC553285 Dr.115906 553285 1.992 9.87E-07 1.603 5.21E-09 LOC553339 Hypothetical protein LOC553339 Dr.52445 553339 2.073 3.78E-13 LOC553395 Hypothetical protein LOC553395 Dr.84853 553395 1.777 1.22E-12 LOC553447 Hypothetical protein LOC553447 Dr.3008 553447 2.711 5.67E-12 LOC553490 Hypothetical protein LOC553490 Dr.133089 553490 2.673 1.00E-05 LOC553492 Hypothetical protein LOC553492 Dr.81616 553492 6.559 1.57E-21 LOC553515 Hypothetical protein LOC553515 Dr.80149 553515 3.317 3.22E-22 LOC553527 Hypothetical protein LOC553527 Dr.118110 553527 2.405 8.54E-10 LOC555064 Hypothetical LOC555064 Dr.114279 555064 3.032 8.59E-09 LOC555375 Hypothetical LOC555375 Dr.76442 555375 1.903 1.45E-13 LOC555382 Similar to MGC81081 protein Dr.78425 555382 2.601 5.09E-34 LOC555409 Hypothetical LOC555409 Dr.76106 555409 2.977 8.00E-05 LOC555433 Hypothetical protein LOC555433 Dr.89273 555433 1.653 9.46E-07 LOC555524 Similar to draculin Dr.115112 555524 1.680 6.10E-06 LOC555662 Hypothetical LOC555662 Dr.77045 555662 2.522 0.00E+00 LOC555713 Hypothetical LOC555713 Dr.99009 555713 2.684 2.19E-07 Similar to tumor protein p53 LOC555795 Dr.83669 555795 2.273 1.15E-12 inducible nuclear protein 2 LOC555849 Hypothetical LOC555849 Dr.77065 555849 11.045 0.00E+00 LOC555974 Similar to Mknk1 protein Dr.99488 555974 1.590 3.79E-06 4.402 0.00E+00 LOC556122 Similar to VPS13C-2A protein Dr.115773 556122 5.709 0.00E+00 LOC556210 Hypothetical LOC556210 Dr.118526 556210 2.848 0.00E+00 LOC556236 Hypothetical LOC556236 Dr.82536 556236 2.166 2.07E-16 Similar to family with sequence LOC556392 Dr.82835 556392 1.544 1.00E-05 similarity 40, member A LOC556438 Hypothetical LOC556438 Dr.107274 556438 6.215 0.00E+00
Similar to Glutaminase, kidney isoform, mitochondrial precursor LOC556445 Dr.83079 556445 2.502 6.55E-19 (GLS) (L-glutamine amidohydrolase) (K-glutaminase)
LOC556467 Hypothetical LOC556467 Dr.77730 556467 9.833 0.00E+00 LOC556502 Similar to preproadrenomedullin Dr.43797 556502 4.042 0.00E+00 LOC556505 Hypothetical LOC556505 Dr.133579 556505 2.710 4.05E-09 LOC556613 Hypothetical LOC556613 Dr.96224 556613 1.840 3.59E-21 LOC556632 Hypothetical LOC556632 Dr.72352 556632 4.614 0.00E+00 LOC556738 Hypothetical LOC556738 Dr.82250 556738 1.741 2.77E-06 LOC556826 Similar to TAP2 protein Dr.96241 556826 1.648 1.56E-06 2.074 3.04E-07 1.956 6.93E-22 3.298 2.69E-37 LOC556873 Similar to Profilin family, member 4 Dr.92876 556873 2.433 2.43E-13
LOC556989 Similar to class IIIB myosin short Dr.80399 556989 2.721 0.00E+00 Similar to Bcl-2 related proline-rich LOC557006 Dr.48854 557006 1.745 4.45E-14 protein LOC557160 Hypothetical LOC557160 Dr.81603 557160 1.663 6.64E-10 2.147 1.68E-06 LOC557286 Hypothetical LOC557286 Dr.76446 557286 1.916 1.69E-07 1.514 2.35E-12 2.023 1.00E-05 3.241 5.20E-26 Similar to cocaine and LOC557301 amphetamine regulated transcript Dr.86980 557301 1.978 5.58E-07 2.375 1.03E-06 3.680 2.12E-27 11.227 0.00E+00 protein type I LOC557419 Hypothetical LOC557419 Dr.106061 557419 1.719 1.03E-11 LOC557434 Hypothetical LOC557434 Dr.41072 557434 2.832 5.29E-15 LOC557479 Similar to CCDC74B protein Dr.119781 557479 2.538 3.41E-08 2.340 5.00E-05 LOC557591 Similar to Muc5b protein Dr.120883 557591 3.162 1.78E-12 2.929 8.56E-11 Similar to matrix metalloproteinase LOC557654 Dr.121062 557654 17.043 2.09E-15 16.566 3.14E-22 358.137 0.00E+00 13 LOC557691 Hypothetical LOC557691 Dr.72387 557691 1.888 4.00E-05 Similar to retinitis pigmentosa LOC557752 Dr.100975 557752 2.552 6.00E-05 GTPase regulator LOC557798 Hypothetical LOC557798 Dr.79086 557798 1.999 6.28E-07 LOC557898 Similar to MGC80281 protein Dr.78069 557898 1.573 3.38E-10 1.786 2.19E-07 LOC558030 Transcription factor IIIA like Dr.75664 558030 1.777 1.00E-05 1.967 1.37E-13 7.512 9.31E-26 Similar to Poly [ADP-ribose] polymerase-4 (PARP-4) (Vault poly(ADP-ribose) polymerase) LOC558045 Dr.66826 558045 2.297 1.47E-08 (VPARP) (193-kDa vault protein) (PARP-related/IalphaI-related H5/proline-rich) (PH5P) Similar to neuronal tyrosine LOC558079 Dr.133520 558079 3.453 9.33E-07 threonine phosphatase 1 LOC558391 Similar to sidekick-1 Dr.90300 558391 1.561 4.14E-06 LOC558396 Hypothetical LOC558396 Dr.11380 558396 4.476 1.28E-19 LOC558513 Hypothetical LOC558513 Dr.4251 558513 4.748 2.64E-11 4.265 2.15E-09 LOC558658 Hypothetical LOC558658 Dr.116697 558658 2.596 1.00E-05 LOC558723 Hypothetical LOC558723 Dr.116698 558723 1.676 1.03E-07 LOC558765 Hypothetical LOC558765 Dr.115519 558765 1.587 6.20E-11 LOC558777 Hypothetical LOC558777 Dr.84230 558777 3.299 6.34E-34 LOC558876 Similar to Ring finger protein 14 Dr.81823 558876 15.408 0.00E+00 LOC558956 Similar to ubquitin-like protein 1 Dr.114892 558956 1.934 6.00E-05 57.152 2.69E-06 LOC559097 Hypothetical LOC559097 Dr.85695 559097 4.211 1.57E-26 LOC559158 Similar to LOC494737 protein Dr.75518 559158 5.152 9.82E-38 LOC559247 Hypothetical LOC559247 Dr.116367 559247 1.903 1.00E-05 2.314 4.00E-05 LOC559332 Hypothetical LOC559332 Dr.83827 559332 2.805 1.00E-05 LOC559352 Hypothetical LOC559352 Dr.118737 559352 1.819 1.35E-11 Similar to B-box and SPRY domain LOC559377 Dr.23682 559377 1.649 9.11E-07 2.120 9.09E-24 containing LOC559409 Hypothetical LOC559409 Dr.76964 559409 2.282 2.46E-38 LOC559420 Similar to hCG28723 Dr.84169 559420 1.893 1.81E-06 LOC559610 Hypothetical LOC559610 Dr.80189 559610 3.339 6.83E-06 LOC559754 Hypothetical LOC559754 Dr.39738 559754 2.180 2.01E-17 LOC559807 Hypothetical LOC559807 Dr.92359 559807 1.573 2.08E-08 LOC560181 Similar to KIAA1607 protein Dr.88654 560181 2.942 8.15E-40 LOC560193 Hypothetical LOC560193 Dr.119093 560193 2.732 6.73E-06 1.882 5.00E-05 1.853 8.88E-08 10.942 1.91E-13 LOC560274 Similar to LOC495350 protein Dr.119869 560274 1.508 8.84E-06 Similar to SNF1/AMP-activated LOC560275 Dr.71665 560275 1.506 4.55E-06 3.158 3.00E-05 protein kinase LOC560276 Similar to zinc finger protein 91 Dr.120024 560276 1.577 3.00E-05 LOC560532 Hypothetical LOC560532 Dr.17331 560532 2.335 1.01E-07 2.647 5.61E-18 2.264 1.25E-13 2.770 1.94E-18 4.903 5.76E-19 LOC560548 Similar to TRAF2 binding protein Dr.115738 560548 1.923 0.00E+00 1.856 9.33E-09 1.764 7.95E-19 2.201 1.82E-10 2.449 9.07E-17 16.983 0.00E+00 LOC561001 Hypothetical LOC561001 Dr.74671 561001 4.629 0.00E+00 6.848 4.83E-43 3.604 3.42E-35 3.642 2.37E-29 60.223 0.00E+00 LOC561108 Hypothetical LOC561108 Dr.86831 561108 1.932 9.67E-09 1.796 4.88E-09 LOC561194 Hypothetical LOC561194 Dr.75312 561194 2.765 0.00E+00 LOC561247 Hypothetical LOC561247 Dr.86100 561247 1.631 3.59E-06 LOC561272 Hypothetical LOC561272 Dr.14500 561272 2.056 7.41E-06 LOC561361 Hypothetical LOC561361 Dr.80493 561361 2.357 2.39E-08 Similar to beta-1,4-N-acetyl- LOC561505 Dr.114703 561505 1.846 7.00E-05 galactosaminyl transferase 3 LOC561538 Hypothetical LOC561538 Dr.42253 561538 2.154 9.64E-23 LOC561624 Hypothetical LOC561624 Dr.46445 561624 2.101 4.56E-24 LOC561659 Hypothetical LOC561659 Dr.82380 561659 3.148 6.03E-08 5.469 7.48E-12 LOC561676 Hypothetical LOC561676 Dr.118857 561676 2.716 3.29E-09 3.372 5.08E-13 LOC561690 Hypothetical LOC561690 Dr.119909 561690 2.385 1.40E-06 24.426 0.00E+00 LOC561766 Similar to Slc16a6-prov protein Dr.107317 561766 4.706 9.05E-10 LOC561790 Similar to alpha globin type-2 Dr.87994 561790 2.174 2.83E-08 1.935 2.09E-06 LOC561960 Hypothetical LOC561960 Dr.41570 561960 1.940 1.65E-06 LOC561990 Hypothetical LOC561990 Dr.115826 561990 1.613 4.41E-10 LOC562071 Hypothetical LOC562071 Dr.82437 562071 1.665 1.00E-05 1.788 9.23E-09 1.866 5.00E-05 LOC562165 Similar to Cyclin D1 Dr.115576 562165 1.507 7.43E-09 LOC562205 Relaxin 3a Dr.84374 562205 1.865 1.03E-08 3.425 2.94E-26 8.751 5.00E-05 Similar to chemokine CXC-like LOC562246 Dr.117585 562246 1.608 1.27E-19 4.387 0.00E+00 1.662 1.99E-10 1.890 1.21E-40 5.337 0.00E+00 4.740 0.00E+00 protein LOC562343 Similar to NSP5beta3beta Dr.83172 562343 3.090 5.86E-25 LOC562445 Hypothetical LOC562445 Dr.133014 562445 4.242 0.00E+00 LOC562579 Similar to complement C4-2 Dr.12491 562579 2.048 8.08E-06 2.408 1.15E-11 2.001 7.00E-05 4.226 1.61E-12 LOC562857 Hypothetical LOC562857 Dr.115423 562857 2.301 4.63E-10 Similar to cardiac titin fetal N2BA LOC562858 Dr.116709 562858 5.588 7.00E-05 isoform middle Ig LOC562892 Hypothetical LOC562892 Dr.114418 562892 2.435 4.59E-18 LOC563152 Similar to chemokine CK-1 Dr.133624 563152 3.185 3.98E-09 11.361 1.25E-07 8.756 1.58E-08 LOC563193 Hypothetical LOC563193 Dr.117168 563193 2.239 1.06E-11 3.565 3.74E-30 Similar to ribosomal L1 domain LOC563247 Dr.105686 563247 1.974 1.09E-17 containing 1 LOC563410 Hypothetical LOC563410 Dr.121431 563410 1.533 1.69E-07 3.662 2.59E-14 LOC563448 Similar to DEAD Box Protein 5 Dr.83188 563448 2.124 1.54E-13 LOC563512 Hypothetical LOC563512 Dr.115387 563512 3.534 4.02E-12 3.227 1.22E-10 LOC563542 Hypothetical LOC563542 Dr.119430 563542 1.698 6.66E-07 LOC563546 Hypothetical LOC563546 Dr.82629 563546 2.035 1.00E-05 1.873 3.00E-05 LOC563682 Similar to KIAA1410 protein Dr.83443 563682 1.714 9.00E-05 Similar to rhamnose binding lectin LOC563686 Dr.24876 563686 3.055 8.65E-07 3.300 3.01E-13 STL2 LOC563864 Hypothetical LOC563864 Dr.81746 563864 2.601 9.00E-05 2.688 7.00E-05 LOC563874 Hypothetical LOC563874 Dr.84665 563874 3.282 1.24E-07 LOC563933 Similar to Protease, serine, 23 Dr.76414 563933 1.575 3.86E-08 LOC563976 Hypothetical LOC563976 Dr.88627 563976 2.800 4.66E-07 Similar to Adipocyte-derived leucine aminopeptidase precursor (A-LAP) (ARTS-1) (Aminopeptidase PILS) (Puromycin- LOC564068 insensitive leucyl-specific Dr.83693 564068 2.661 8.00E-05 aminopeptidase) (PILS-AP) (Type 1 tumor necrosis factor receptor shedding aminopeptidase regulator)... Similar to CCCH zinc finger protein LOC564559 Dr.106159 564559 1.719 1.92E-12 2.203 0.00E+00 C3H-1 LOC564564 Similar to MGC80162 protein Dr.107908 564564 1.656 2.94E-07 LOC564696 Similar to tubby-like protein Dr.121542 564696 1.610 8.49E-06 LOC564854 Hypothetical LOC564854 Dr.117120 564854 8.692 7.38E-16 LOC565118 Similar to MGC81063 protein Dr.75596 565118 1.600 6.00E-05 Similar to CDNA sequence LOC565172 Dr.79685 565172 2.357 5.63E-27 BC019977
Similar to putative transmembrane LOC565274 Dr.85476 565274 2.908 3.83E-10 4 superfamily member protein
Similar to BRF1 homolog, subunit LOC565547 of RNA polymerase III transcription Dr.69457 565547 17.921 0.00E+00 initiation factor IIIB LOC565550 Similar to Slc12a9 protein Dr.107630 565550 3.366 4.11E-08 LOC565603 Hypothetical LOC565603 Dr.119617 565603 2.156 1.87E-13 LOC565649 Hypothetical LOC565649 Dr.14946 565649 1.619 5.43E-06 LOC565650 Similar to MGC115642 protein Dr.27020 565650 2.840 4.65E-06 6.565 5.58E-09 9.761 1.36E-18 22.573 0.00E+00 LOC565671 Similar to MGC89155 protein Dr.50820 565671 2.251 3.47E-06 LOC565793 Similar to stromelysin-3 Dr.108314 565793 1.747 1.15E-08 LOC565811 Hypothetical LOC565811 Dr.115851 565811 2.643 2.72E-13 2.012 7.47E-08 Novel protein similar to vertebrate LOC565937 mitochondrial ribosomal protein Dr.85590 565937 1.621 2.29E-17 1.519 8.90E-30 S10 (MRSP10) Similar to interferon-inducible LOC566020 Dr.83480 566020 1.844 3.00E-05 5.680 1.95E-34 protein Gig2 LOC566030 Similar to LOC562179 protein Dr.83518 566030 4.512 1.40E-45 Similar to Mesoderm induction LOC566167 Dr.108270 566167 2.006 3.38E-06 early response 1 LOC566223 Hypothetical LOC566223 Dr.114932 566223 13.912 0.00E+00 Similar to Rap guanine nucleotide exchange factor 5 (Guanine nucleotide exchange factor for LOC566265 Dr.80931 566265 1.537 4.99E-06 Rap1) (Related to Epac) (Repac) (M-Ras-regulated Rap GEF) (MR- GEF) Similar to Regulator of G-protein LOC566268 Dr.82117 566268 3.442 0.00E+00 40.200 0.00E+00 signalling 4 LOC566307 Hypothetical LOC566307 Dr.133107 566307 1.682 2.78E-06 LOC566323 Hypothetical LOC566323 Dr.118057 566323 2.470 8.61E-09 LOC566780 Hypothetical LOC566780 Dr.81372 566780 2.680 1.61E-15 LOC566858 Hypothetical LOC566858 Dr.115409 566858 3.707 0.00E+00 LOC567078 Hypothetical LOC567078 Dr.86987 567078 2.078 3.32E-11 Similar to Centrosomal protein of LOC567090 Dr.108456 567090 1.749 1.90E-12 3.109 1.05E-13 27 kDa (Cep27 protein) LOC567202 Hypothetical LOC567202 Dr.33841 567202 1.867 3.55E-17 LOC567256 Hypothetical LOC567256 Dr.117921 567256 4.520 7.42E-10 3.703 1.11E-07 LOC567317 Hypothetical LOC567317 Dr.117073 567317 1.988 6.98E-06 Similar to transmembrane and LOC567425 Dr.114709 567425 2.135 5.00E-13 coiled-coil domains 3 Similar to Interleukin-1 receptor- associated kinase-3 (IRAK-3) (IL-1 LOC567444 Dr.90054 567444 2.471 1.00E-05 4.034 1.00E-05 receptor-associated kinase M) (IRAK-M) LOC567537 Similar to interleukin-8 Dr.111760 567537 2.292 0.00E+00 1.846 2.30E-12 1.610 4.44E-06 2.217 3.30E-42 3.049 0.00E+00 4.110 0.00E+00 LOC567650 Hypothetical LOC567650 Dr.118238 567650 2.184 2.67E-06 LOC567669 Hypothetical LOC567669 Dr.121333 567669 10.262 1.29E-06 8.286 2.00E-05 LOC567670 Hypothetical LOC567670 Dr.96687 567670 6.021 5.00E-05 LOC567726 Hypothetical LOC567726 Dr.92321 567726 2.225 2.00E-05 LOC567756 Similar to fmHP Dr.84991 567756 2.568 7.03E-13 LOC567939 Hypothetical LOC567939 Dr.133724 567939 1.807 1.04E-07 Similar to C-type natriuretic peptide LOC567953 Dr.39424 567953 1.695 7.00E-05 3
LOC568005 Similar to B-type natriuretic peptide Dr.91651 568005 2.746 1.93E-14 2.748 6.69E-28 2.259 1.76E-06 2.663 3.00E-05
Similar to v-rel reticuloendotheliosis viral oncogene homolog B, nuclear LOC568034 Dr.118176 568034 4.159 3.26E-15 factor of kappa light polypeptide gene enhancer in B-cells 3 (avian)
LOC568275 Hypothetical LOC568275 Dr.40121 568275 1.540 1.47E-07 Similar to SIL1 homolog, LOC568308 endoplasmic reticulum chaperone Dr.133933 568308 4.329 1.17E-07 (S. cerevisiae) LOC568368 Hypothetical LOC568368 Dr.83192 568368 2.281 5.70E-06 LOC568476 Hypothetical LOC568476 Dr.85087 568476 1.832 1.71E-08 11.737 0.00E+00 LOC568537 Hypothetical LOC568537 Dr.78812 568537 1.719 3.00E-05 LOC568697 Hypothetical LOC568697 Dr.84859 568697 2.456 4.89E-18 LOC568902 Similar to Ribonuclease inhibitor Dr.120089 568902 2.679 5.77E-14 LOC568926 Similar to ankyrin 2, neuronal Dr.113491 568926 2.426 6.52E-08 LOC569062 Hypothetical LOC569062 Dr.113630 569062 2.304 1.31E-09 LOC569084 Similar to claudin i Dr.1081 569084 1.815 4.35E-19 2.252 5.00E-05 LOC569148 Hypothetical LOC569148 Dr.40624 569148 1.908 3.98E-15 Similar to protein tyrosine LOC569164 Dr.82846 569164 1.603 4.52E-06 phosphatase e LOC569187 Similar to PHD finger protein 6 Dr.83423 569187 2.363 6.24E-12 2.479 4.78E-07 3.462 6.00E-05 4.278 3.40E-15 Similar to chromosome X open LOC569232 Dr.87903 569232 1.772 3.52E-12 reading frame 36 LOC569249 Hypothetical LOC569249 Dr.87470 569249 1.726 8.31E-07 2.099 1.04E-07 2.222 2.65E-10 LOC569306 Similar to Transgelin 2 Dr.2363 569306 2.566 1.94E-13 LOC569366 Hypothetical LOC569366 Dr.86256 569366 2.515 8.00E-05 4.248 2.00E-05 LOC569467 Hypothetical LOC569467 Dr.82170 569467 8.278 0.00E+00 LOC569547 Hypothetical LOC569547 Dr.17586 569547 1.634 4.00E-05 LOC569550 Similar to endothelin 1 Dr.86504 569550 1.724 5.27E-12 LOC569954 Hypothetical LOC569954 Dr.114835 569954 1.778 3.63E-06 LOC569969 Hypothetical LOC569969 Dr.41215 569969 4.615 2.23E-30 2.221 1.72E-08 2.102 5.00E-10 2.708 3.32E-12 2.241 2.09E-06 3.077 2.09E-15 4.474 4.43E-35 LOC570023 Similar to transmembrane receptor Dr.132685 570023 2.694 5.00E-05
LOC570040 Hypothetical LOC570040 Dr.114352 570040 3.186 2.21E-40 LOC570148 Hypothetical LOC570148 Dr.19520 570148 2.975 3.75E-06 11.545 6.57E-38 LOC570432 Hypothetical LOC570432 Dr.15633 570432 1.937 3.06E-15 LOC570546 Hypothetical LOC570546 Dr.83469 570546 5.612 7.00E-05 LOC570757 Hypothetical LOC570757 Dr.121002 570757 2.410 1.00E-05 1.793 3.00E-05 3.042 1.76E-09 Similar to complement protein LOC570832 Dr.107751 570832 3.364 0.00E+00 2.720 1.13E-16 3.872 0.00E+00 3.271 5.74E-11 2.574 3.38E-06 7.118 0.00E+00 component C7-1 LOC570856 Hypothetical LOC570856 Dr.80191 570856 2.916 4.06E-07 LOC570928 Hypothetical LOC570928 Dr.82708 570928 5.602 2.77E-18 Similar to N-acetylglucosamine LOC570932 Dr.115914 570932 1.936 7.00E-05 kinase LOC570979 Hypothetical LOC570979 Dr.15498 570979 6.517 1.62E-11 Similar to EF-hand domain family, LOC571184 Dr.86188 571184 2.553 1.25E-07 member B LOC571352 Hypothetical LOC571352 Dr.85114 571352 3.127 1.76E-21 Similar to caspase recruitment LOC571448 Dr.84556 571448 1.510 7.00E-05 domain protein Similar to protein phosphatase 1, LOC571470 Dr.80965 571470 21.156 2.75E-23 regulatory subunit 15B Similar to kainate receptor alpha LOC571720 Dr.3211 571720 2.206 1.91E-17 1.862 2.75E-10 subunit LOC571747 Similar to beta2-syntrophin Dr.84005 571747 1.675 6.52E-10 LOC571790 Similar to Tcte-1 peptide Dr.93173 571790 1.709 3.94E-08 2.452 4.41E-15 LOC571955 Similar to hCG1987869 Dr.839 571955 2.273 3.71E-10 LOC571991 Hypothetical LOC571991 Dr.77176 571991 8.589 0.00E+00 LOC572001 Hypothetical LOC572001 Dr.53020 572001 2.066 1.15E-07 LOC572168 Hypothetical LOC572168 Dr.110726 572168 5.817 0.00E+00 LOC572323 Hypothetical LOC572323 Dr.79819 572323 1.859 6.84E-09 LOC572466 Hypothetical LOC572466 Dr.45180 572466 2.073 2.17E-12 Similar to Homeodomain leucine LOC572921 Dr.113980 572921 3.085 0.00E+00 4.553 2.38E-09 zipper gene
Similar to Amyloid beta precursor LOC573336 Dr.115894 573336 1.949 3.88E-30 protein binding protein 1
LOC573376 Similar to Heat shock protein 8 Dr.116704 573376 3.421 7.65E-20 2.448 1.12E-10 LOC573492 Hypothetical LOC573492 Dr.118655 573492 1.934 1.55E-21 2.731 7.61E-07 LOC791474 Hypothetical protein LOC791474 Dr.6304 791474 3.350 5.37E-06 2.850 4.55E-06 LOC791911 Hypothetical protein LOC791911 Dr.117819 791911 1.562 2.87E-07 LOC791919 Hypothetical protein LOC791919 Dr.81849 791919 1.553 9.53E-06 LOC791930 Hypothetical protein LOC791930 Dr.79753 791930 1.592 4.00E-05 2.377 2.15E-07 8.122 0.00E+00
Similar to integrin, alpha 2 (CD49B, LOC792338 Dr.116619 792338 2.499 2.35E-29 alpha 2 subunit of VLA-2 receptor)
LOC792364 Similar to Cfb protein Dr.95191 792364 6.937 8.80E-11 3.832 2.85E-21 5.762 9.82E-08 3.893 1.00E-21 LOC792416 Hypothetical protein LOC792416 Dr.117460 792416 4.373 5.34E-18 LOC792428 Hypothetical protein LOC792428 Dr.118886 792428 1.682 2.13E-06 2.086 7.25E-11 LOC792453 Similar to MGC78853 protein Dr.74741 792453 2.398 2.75E-09 Similar to complement factor B/C2- LOC792472 Dr.119903 792472 2.706 5.07E-23 2.193 8.44E-15 2.126 1.10E-07 2.373 3.45E-10 A3 LOC792511 Hypothetical protein LOC792511 Dr.120411 792511 2.128 1.41E-10 2.046 7.75E-08 LOC792525 Hypothetical protein LOC792525 Dr.139178 792525 4.545 2.30E-07 LOC792591 Hypothetical protein LOC792591 Dr.80155 792591 2.560 4.48E-10 1.822 1.16E-11 26.660 0.00E+00 Similar to ovary-specific C1q-like LOC792601 Dr.17591 792601 8.968 6.74E-21 3.207 1.00E-05 4.526 8.23E-10 factor LOC792613 Hypothetical protein LOC792613 Dr.120624 792613 1.714 1.37E-09 1.562 4.44E-07 2.208 3.46E-11 LOC792638 Hypothetical protein LOC792638 Dr.85463 792638 3.244 4.95E-38 LOC792677 Hypothetical protein LOC792677 Dr.85524 792677 7.504 0.00E+00 Similar to Aldolase c, fructose- LOC792692 Dr.118183 792692 3.072 7.00E-05 bisphosphate, like
LOC792693 Similar to CD3e-associated protein Dr.107930 792693 1.880 0.00E+00
LOC792834 Hypothetical protein LOC792834 Dr.115490 792834 1.575 5.00E-05 LOC792916 Hypothetical protein LOC792916 Dr.91136 792916 1.746 2.00E-05 Similar to Endothelial differentiation- LOC793036 Dr.9707 793036 1.560 9.33E-11 related factor 1
LOC793284 Similar to beta-microseminoprotein Dr.113263 793284 1.851 1.04E-09
LOC793364 Hypothetical protein LOC793364 Dr.80714 793364 1.847 1.00E-05 LOC793576 Hypothetical protein LOC793576 Dr.86450 793576 2.804 1.00E-05 Similar to huntingtin interacting LOC793823 Dr.118181 793823 2.781 1.97E-10 3.428 1.26E-19 protein 1 LOC793872 Hypothetical protein LOC793872 Dr.78023 793872 2.445 4.20E-08 2.459 2.43E-09 LOC794024 Hypothetical protein LOC794024 Dr.83544 794024 2.050 2.74E-07 LOC794083 Hypothetical protein LOC794083 Dr.81713 794083 2.808 2.00E-05 4.185 0.00E+00 LOC794313 Hypothetical protein LOC794313 Dr.86125 794313 1.679 1.00E-05 LOC794398 Hypothetical protein LOC794398 Dr.16900 794398 2.773 6.17E-06 LOC794621 Hypothetical protein LOC794621 Dr.116461 794621 1.556 3.84E-06 1.798 6.62E-10 1.885 5.44E-07 2.199 5.17E-17 10.618 0.00E+00 LOC794708 Hypothetical protein LOC794708 Dr.83231 794708 2.949 1.33E-07 LOC794757 Hypothetical protein LOC794757 Dr.91628 794757 2.392 9.52E-09 LOC794934 Hypothetical protein LOC794934 Dr.110986 794934 1.541 6.77E-06 LOC795200 Similar to Thyroglobulin Dr.118582 795200 2.032 1.39E-36 LOC795305 Hypothetical protein LOC795305 Dr.116421 795305 3.196 2.05E-10 1.971 5.59E-06 4.937 9.38E-33 4.842 0.00E+00 3.135 2.57E-09 3.779 9.06E-35 9.352 0.00E+00 6.441 1.78E-24 Similar to RNA terminal phosphate LOC795320 Dr.114806 795320 1.884 4.42E-20 cyclase-like 1 LOC795367 Hypothetical protein LOC795367 Dr.80285 795367 1.663 1.00E-05 LOC795393 Hypothetical protein LOC795393 Dr.89230 795393 1.696 1.09E-10 LOC795469 Similar to CC chemokine SCYA113 Dr.92663 795469 13.214 2.72E-15
LOC795529 Hypothetical protein LOC795529 Dr.80961 795529 2.417 4.73E-40 2.092 1.98E-12 1.594 2.78E-09 8.812 0.00E+00 LOC795597 Hypothetical protein LOC795597 Dr.89872 795597 2.754 1.57E-06 LOC795607 Hypothetical protein LOC795607 Dr.14436 795607 1.826 1.81E-15 Similar to BCL2/adenovirus E1B LOC795732 Dr.81652 795732 1.735 8.32E-07 19kDa interacting protein 1 LOC795785 Hypothetical protein LOC795785 Dr.113696 795785 3.754 9.05E-10 3.104 7.65E-10 4.461 6.49E-14 4.262 0.00E+00 7.748 1.39E-39 33.687 0.00E+00 Similar to green sensitive cone LOC795803 Dr.25438 795803 6.271 8.00E-05 opsin LOC795894 Similar to cohesin subunit XSA2 Dr.80545 795894 2.953 1.46E-08 LOC796163 Similar to Chx10 protein Dr.118938 796163 1.954 2.00E-05 1.765 5.54E-06 LOC796233 Hypothetical protein LOC796233 Dr.120930 796233 2.010 1.21E-09 LOC796256 Hypothetical protein LOC796256 Dr.132815 796256 1.616 4.88E-08 LOC796302 Hypothetical protein LOC796302 Dr.16549 796302 1.710 9.56E-14 LOC796684 Hypothetical protein LOC796684 Dr.5715 796684 2.230 1.05E-19 LOC796750 Similar to LOC495955 protein Dr.40212 796750 2.569 7.00E-05 2.590 1.98E-06 LOC796798 Hypothetical protein LOC796798 Dr.90648 796798 1.578 7.00E-05 2.977 8.41E-12 LOC796878 Hypothetical protein LOC796878 Dr.113515 796878 2.312 2.00E-05 2.550 8.05E-14
Similar to LOC797020 Dr.118318 797020 1.780 1.38E-08 2.344 3.19E-16 replicase/helicase/endonuclease
LOC797140 Similar to Bridging integrator 2, like Dr.115412 797140 7.571 4.49E-23
Similar to J domain containing LOC797196 Dr.14456 797196 1.946 1.59E-14 protein 1 LOC797198 Hypothetical protein LOC797198 Dr.118190 797198 1.630 7.78E-15 LOC797220 Hypothetical protein LOC797220 Dr.117106 797220 2.390 9.36E-34 LOC797263 Hypothetical protein LOC797263 Dr.115884 797263 2.508 3.53E-15 2.389 1.03E-12 LOC797351 Similar to Krt5 protein Dr.120340 797351 1.915 2.14E-08 LOC797508 Hypothetical protein LOC797508 Dr.117285 797508 1.702 4.00E-05 LOC797650 Hypothetical protein LOC797650 Dr.75166 797650 3.806 5.26E-21 LOC797695 Hypothetical protein LOC797695 Dr.108030 797695 1.999 4.20E-45 LOC797787 Similar to crystallin gamma EM2-7 Dr.104305 797787 1.902 2.19E-06
LOC797875 Hypothetical protein LOC797875 Dr.87960 797875 4.610 2.96E-38 LOC797946 Hypothetical protein LOC797946 Dr.107953 797946 4.078 1.32E-08 2.913 1.00E-05 LOC797996 Similar to tyrosyl-tRNA synthetase Dr.121060 797996 2.581 1.27E-24
LOC798012 Similar to Uncoupling protein 2 Dr.121079 798012 1.705 3.61E-11 LOC798067 Hypothetical protein LOC798067 Dr.117730 798067 2.273 4.25E-10 LOC798073 Similar to Acyl-CoA thioesterase 9 Dr.120561 798073 2.096 4.55E-15 2.196 3.73E-12
LOC798122 Hypothetical protein LOC798122 Dr.114702 798122 2.587 7.49E-10 2.332 3.30E-08 LOC798123 Hypothetical protein LOC798123 Dr.107566 798123 1.587 7.51E-06 LOC798216 Similar to ubiquitin Dr.121223 798216 1.848 8.18E-07 LOC798254 Hypothetical protein LOC798254 Dr.90762 798254 3.067 1.06E-27
Similar to Coiled-coil-helix-coiled- LOC798525 Dr.118087 798525 2.889 9.97E-42 coil-helix domain containing 2-like
Similar to SI:dZ72B14.2 (novel protein similar to human LOC798618 Dr.85558 798618 2.284 8.55E-12 postmeiotic segregation increased 1-like protein (PMSL1)) LOC798623 Similar to LOC495244 protein Dr.79926 798623 5.933 4.39E-08 4.465 1.74E-10 7.638 4.95E-13 8.290 2.99E-19 21.132 0.00E+00 LOC798660 Hypothetical protein LOC798660 Dr.120608 798660 1.761 4.10E-13 LOC798848 Similar to Igfbp5 protein Dr.116546 798848 3.423 2.00E-05 Similar to Cell division cycle 123 LOC798885 Dr.82833 798885 3.147 8.18E-18 homolog (S. cerevisiae) LOC798921 Hypothetical protein LOC798921 Dr.66624 798921 4.188 1.21E-31 LOC798960 Hypothetical protein LOC798960 Dr.114401 798960 2.339 1.00E-05 2.886 4.07E-20 LOC798989 Hypothetical protein LOC798989 Dr.80186 798989 1.733 2.00E-05 LOC799188 Hypothetical protein LOC799188 Dr.69146 799188 1.771 3.87E-11 LOC799214 Similar to Profilin family, member 4 Dr.118945 799214 2.950 3.00E-05
LOC799253 Hypothetical protein LOC799253 Dr.119564 799253 3.685 4.40E-09 LOC799377 Similar to dickkopf1 Dr.117628 799377 1.730 6.00E-05 4.103 0.00E+00 LOC799395 Hypothetical protein LOC799395 Dr.29970 799395 1.537 7.70E-10 Similar to Poly [ADP-ribose] LOC799434 polymerase 14 (PARP-14) (B Dr.40164 799434 1.596 1.83E-06 4.381 1.63E-08 aggressive lymphoma protein 2) LOC799503 Hypothetical protein LOC799503 Dr.18788 799503 1.574 5.00E-05 LOC799605 Hypothetical protein LOC799605 Dr.120565 799605 3.583 5.44E-06 4.655 1.01E-09 LOC799633 Hypothetical protein LOC799633 Dr.119239 799633 5.338 0.00E+00 LOC799699 Similar to serine protease Dr.134965 799699 2.549 3.61E-08 LOC799739 Similar to LOC733367 protein Dr.118944 799739 4.334 0.00E+00 LOC799802 Hypothetical protein LOC799802 Dr.114490 799802 1.561 2.26E-07 LOC799812 Similar to Si:busm1-6a2.1 protein Dr.26143 799812 7.421 5.24E-07 4.978 1.38E-06
LOC799825 Hypothetical protein LOC799825 Dr.77701 799825 1.937 1.34E-07 LOC799834 Similar to serine protease Dr.119715 799834 2.086 4.04E-11 2.953 1.94E-28 LOC799929 Hypothetical protein LOC799929 Dr.115318 799929 2.020 1.68E-19 LOC799999 Hypothetical protein LOC799999 Dr.89871 799999 1.686 2.00E-05 lonp2 Lon peptidase 2, peroxisomal Dr.78984 494030 1.785 6.43E-10 lpin1 Lipin 1 Dr.118920 556810 2.349 1.07E-08 lrrc50 Leucine rich repeat containing 50 Dr.84941 386722 1.931 5.75E-10 ltv1 LTV1 homolog (S. cerevisiae) Dr.84279 436587 2.168 9.83E-10 lypla3 Lysophospholipase 3 Dr.360 335008 1.563 3.00E-05 1.806 3.67E-14 lyrm1 LYR motif containing 1 Dr.108113 436779 2.896 0.00E+00 Mannose-6-phosphate receptor m6pr Dr.77980 406486 1.817 1.01E-07 (cation dependent) V-maf musculoaponeurotic maff fibrosarcoma oncogene homolog f Dr.84159 393307 3.514 5.01E-37 (avian) V-maf musculoaponeurotic mafg1 fibrosarcoma oncogene family, Dr.92225 415134 3.630 4.53E-13 protein g (avian), 1 V-maf musculoaponeurotic mafg2 fibrosarcoma oncogene homolog g Dr.30373 405877 2.099 1.79E-06 (avian), 2 V-maf musculoaponeurotic mafk fibrosarcoma oncogene homolog K Dr.92224 415133 3.196 3.43E-18 (avian)
Mucosa associated lymphoid tissue malt1 Dr.77507 259196 2.120 4.38E-25 lymphoma translocation gene 1 manba Mannosidase, beta A, lysosomal Dr.117522 393128 2.623 1.68E-06
Mitogen-activated protein kinase map3k7ip1 kinase kinase 7 interacting protein Dr.86078 403084 2.080 4.48E-25 1 Mitogen-activated protein kinase mapk14a Dr.72252 65237 2.007 5.89E-12 14a Mitogen-activated protein kinase- mapkapk2 Dr.76847 327321 2.804 0.00E+00 activated protein kinase 2 Membrane-associated ring finger march5l Dr.77219 326067 2.021 1.37E-06 (C3HC4) 5, like marcksl1 MARCKS-like 1 Dr.75946 406407 1.780 7.83E-07 mars Methionine-tRNA synthetase Dr.77842 338183 3.589 7.87E-18 matn4 Matrilin 4 Dr.78017 497348 1.612 3.00E-05 Methyl-CpG binding domain protein mbd2 Dr.23525 337105 3.305 0.00E+00 2 mcee Methylmalonyl CoA epimerase Dr.82958 553804 1.944 3.12E-06 mcl1a Myeloid cell leukemia sequence 1a Dr.33208 58122 3.224 3.78E-44 mcl1b Myeloid cell leukemia sequence 1b Dr.26893 373102 3.878 0.00E+00 mcoln2 Mucolipin 2 Dr.21037 394123 4.303 1.94E-07 mdm2 Murine double minute 2 homolog Dr.75764 30637 1.533 4.49E-10 4.474 1.18E-37 mef2d Myocyte enhancer factor 2d Dr.132977 30580 1.745 4.68E-09
Met proto-oncogene (hepatocyte met Dr.120756 492292 1.532 4.00E-05 growth factor receptor) mg:cb01g02 Mg:cb01g02 Dr.55608 326963 1.537 1.88E-13 1.612 6.34E-08
Similar to T-cell activation kelch MGC152950 Dr.116934 561198 3.866 4.39E-42 repeat protein Similar to alanine aminotransferase MGC165657 Dr.82787 799963 2.112 5.91E-06 2 Meningioma expressed antigen 5 mgea5 Dr.104967 324487 2.180 3.33E-40 (hyaluronidase) mgp Matrix Gla protein Dr.82696 402937 1.648 2.00E-05 Major histocompatibility complex mhc1uea Dr.11010 64885 2.284 2.87E-10 class I UEA gene Major histocompatibility complex mhc1ufa Dr.33261 64886 2.929 1.06E-08 4.773 0.00E+00 class I UFA gene Mki67 (FHA domain) interacting mki67ipl nucleolar phosphoprotein (human) - Dr.76897 317644 1.557 4.59E-30 like MAP kinase-interacting mknk2 Dr.116082 373121 10.676 0.00E+00 serine/threonine kinase 2 mmp13 Matrix metalloproteinase 13 Dr.81475 387293 2.139 1.17E-41 7.511 2.50E-30 9.502 0.00E+00 131.716 0.00E+00 mmp9 Matrix metalloproteinase 9 Dr.76275 406397 4.751 0.00E+00 2.592 0.00E+00 6.487 0.00E+00 14.743 0.00E+00 3.756 0.00E+00 4.439 0.00E+00 22.527 0.00E+00 278.658 0.00E+00 MOB1, Mps One Binder kinase mobk1b Dr.76685 334574 1.757 7.66E-10 activator-like 1B (yeast) V-mos Moloney murine sarcoma mos Dr.118177 402817 1.607 4.38E-08 12.561 4.59E-16 viral oncogene homolog mpp1 Membrane protein, palmitoylated 1 Dr.118764 325542 3.747 1.18E-32
Membrane protein, palmitoylated 5 mpp5 Dr.18838 252845 1.687 1.26E-07 (MAGUK p55 subfamily member 5)
Membrane-spanning 4-domains, ms4a4a Dr.40434 550363 1.795 5.25E-18 2.326 8.22E-23 subfamily A, member 4 msgn1 Mesogenin 1 Dr.123304 360135 3.411 2.95E-21 mt2 Metallothionein 2 Dr.132573 325449 2.004 5.97E-22 Metal-regulatory transcription factor mtf1 Dr.118403 195821 1.657 7.00E-05 1 Methylenetetrahydrofolate dehydrogenase (NADP+ mthfd2 dependent) 2, Dr.105864 431728 1.867 3.31E-06 3.703 6.25E-43 methenyltetrahydrofolate cyclohydrolase mtmr8 Myotubularin related protein 8 Dr.83197 393365 2.372 6.00E-05
5-methyltetrahydrofolate- mtr Dr.75737 378847 1.746 2.79E-07 homocysteine methyltransferase mvp Major vault protein Dr.114231 373081 1.696 1.00E-05 3.796 0.00E+00 mxa Myxovirus (influenza) resistance A Dr.80859 360142 2.128 8.53E-11 1.612 4.00E-05 3.979 1.57E-26
Myxovirus (influenza virus) mxc Dr.26920 360145 2.514 5.41E-06 6.706 2.00E-05 resistance C mybbp1a MYB binding protein (P160) 1a Dr.34606 321277 1.870 0.00E+00 myca Myelocytomatosis oncogene a Dr.1 30686 1.672 0.00E+00 mycb Myelocytomatosis oncogene b Dr.78260 393141 1.729 5.53E-17 Myelocytomatosis oncogene mych Dr.56441 338151 3.536 2.52E-11 homolog V-myc myelocytomatosis viral mycn related oncogene, neuroblastoma Dr.75499 252851 1.752 3.69E-25 derived (avian) Myeloid differentiation primary myd88 Dr.134592 403145 2.564 0.00E+00 response gene (88) myf5 Myogenic factor 5 Dr.83041 58097 2.474 2.93E-27 Myosin, heavy polypeptide 6, myh6 Dr.29034 386711 1.715 3.00E-05 cardiac muscle, alpha Myosin, heavy polypeptide 2, fast myhz2 Dr.132261 246275 1.676 1.62E-24 muscle specific myo6a Myosin VIa Dr.33953 445473 1.813 1.89E-08 myo9b Myosin IXb Dr.4876 322219 1.896 1.18E-19 myod Myogenic differentiation Dr.36017 30513 1.886 2.00E-05 nav3 Neuron navigator 3 Dr.75272 282668 1.718 7.82E-06 Nonspecific cytotoxic cell receptor nccrp1 Dr.76380 30078 2.910 0.00E+00 protein 1 ncf1 Neutrophil cytosolic factor 1 Dr.2973 378966 2.690 2.11E-36 1.767 5.48E-41 2.299 0.00E+00 2.088 0.00E+00 1.866 4.21E-21 3.660 0.00E+00 NudE nuclear distribution gene E ndel1b Dr.7294 333957 1.629 1.20E-06 2.769 1.82E-23 homolog like 1 (A. nidulans) B N-myc downstream regulated gene ndrg1 Dr.12107 373106 4.575 7.46E-09 1 NIMA (never in mitosis gene a)- nek8 Dr.12587 171094 1.587 2.48E-09 related kinase 8 neu1 Neuraminidase 1 Dr.79166 559850 2.217 2.28E-11 Nuclear factor, erythroid derived 2,- nfe2l1 Dr.79857 405781 3.359 3.91E-07 9.328 0.00E+00 like 1 Nuclear factor (erythroid-derived 2)- nfe2l2 Dr.7230 360149 2.178 2.00E-05 like 2 Nuclear factor of kappa light nfkb2 polypeptide gene enhancer in B- Dr.117553 415100 2.281 1.07E-06 2.091 2.71E-08 1.902 2.06E-11 5.524 2.51E-37 cells 2, p49/p100 Nuclear factor of kappa light nfkbiaa polypeptide gene enhancer in B- Dr.79912 406463 2.119 5.00E-05 1.905 3.66E-08 8.675 0.00E+00 cells inhibitor, alpha a Nuclear factor of kappa light nfkbiab polypeptide gene enhancer in B- Dr.77409 323099 2.116 7.96E-27 1.623 1.37E-11 2.007 7.34E-21 5.500 0.00E+00 cells inhibitor, alpha b nitr2b Novel immune-type receptor 2b Dr.83336 60647 1.947 3.07E-07 nkx2.7 NK2 transcription factor related 7 Dr.272 30694 2.544 0.00E+00
Neurolin-like cell adhesion nlcam Dr.105054 323048 1.778 5.38E-06 molecule nmi N-myc (and STAT) interactor Dr.80228 335331 2.150 5.10E-07 2.211 2.90E-22 2.056 1.25E-06 2.611 6.18E-31 5.323 4.12E-41
Nucleotide-binding oligomerization nod2 Dr.93177 777696 2.437 4.68E-17 domain containing 2 noxo1 NADPH oxidase organizer 1 Dr.42641 321039 2.879 1.09E-30 27.796 0.00E+00 npc1 Niemann-Pick disease, type C1 Dr.108239 324441 1.611 1.70E-09
N-acetylneuraminate pyruvate npl Dr.116093 322207 2.098 1.52E-15 lyase (dihydrodipicolinate synthase) npm1 Nucleophosmin 1 Dr.111309 266985 1.541 9.83E-16 nppa Natriuretic peptide precursor A Dr.72101 321442 2.010 1.29E-16 Nuclear receptor subfamily 0, nr0b1 Dr.74816 100008590 1.823 9.51E-08 group B, member 1 Similar to nuclear receptor Nr0b2 Dr.13394 403010 2.182 2.44E-08 subfamily 0, group B, member 2 nrg1 Neuregulin 1 Dr.108127 503813 4.735 4.49E-09 nrp1a Neuropilin 1a Dr.133652 353246 1.895 4.75E-31 2.562 0.00E+00 1.680 3.71E-06 ntl No tail Dr.1468 30399 2.061 3.66E-06 Nucleotide binding protein 1 (MinD nubp1 Dr.88416 503919 2.048 4.00E-05 2.160 1.44E-07 homolog, E. coli) Nudix (nucleoside diphosphate nudt1 Dr.76941 406727 2.547 1.11E-19 linked moiety X)-type motif 1 Nudix (nucleoside diphosphate nudt4 Dr.89113 378990 2.126 2.61E-13 linked moiety X)-type motif 4 Nudix (nucleoside diphosphate nudt5 Dr.78064 415176 2.612 0.00E+00 linked moiety X)-type motif 5 numbl Numb homolog (Drosophila)-like Dr.37961 497616 1.945 5.80E-13 nupr1 Nuclear protein 1 Dr.106489 325928 1.665 7.80E-11 9.490 0.00E+00 Ornithine decarboxylase antizyme oaz2l Dr.82817 790945 4.245 6.16E-19 2, like odc1 Ornithine decarboxylase 1 Dr.78653 114426 1.667 9.54E-10 Oligodendrocyte transcription olig3 Dr.117660 324857 3.935 3.34E-11 factor 3 omp Olfactory marker protein Dr.85654 317636 3.532 1.42E-07 oprd1b Opioid receptor, delta 1b Dr.30361 336529 2.678 3.71E-16 Odorant receptor, family 2, or2.4 Dr.75771 80367 3.287 2.16E-07 member 4 ormdl1 ORM1-like 1 (S. cerevisiae) Dr.27136 368632 1.745 3.00E-05 2.038 6.34E-25 osbpl6 Oxysterol binding protein-like 6 Dr.81634 449656 1.516 8.63E-07 Purinergic receptor P2X, ligand- p2rx4a Dr.80370 259258 2.772 0.00E+00 gated ion channel, 4a Purinergic receptor P2X, ligand- p2rx8 Dr.89526 387299 2.202 2.00E-05 gated ion channel, 8
Procollagen-proline, 2-oxoglutarate p4ha1 4-dioxygenase (proline 4- Dr.118888 325364 3.334 1.13E-19 hydroxylase), alpha polypeptide I
Procollagen-proline, 2-oxoglutarate p4ha2 4-dioxygenase (proline 4- Dr.19144 373132 1.690 7.39E-15 hydroxylase), alpha polypeptide 2 pah Phenylalanine hydroxylase Dr.76274 378962 3.386 0.00E+00 Par-6 partitioning defective 6 pard6gb Dr.27686 80959 1.549 1.73E-22 homolog gamma B (C. elegans) Poly (ADP-ribose) polymerase parp3 Dr.78126 335495 1.889 7.10E-06 family, member 3 Propionyl-Coenzyme A pcca Dr.105309 437019 1.902 3.00E-05 1.877 1.09E-06 carboxylase, alpha polypeptide pdap1 Pdgfa associated protein 1 Dr.1791 393179 4.118 0.00E+00 pdc2 Phosducin 2 Dr.82686 386614 3.968 9.05E-19 pdcd11 Programmed cell death 11 Dr.76104 325351 1.601 6.06E-06 pdcd6 Programmed cell death 6 Dr.84415 393925 2.992 0.00E+00 Programmed cell death 6 pdcd6ip Dr.132339 406669 2.071 2.17E-06 interacting protein pdcd7 Programmed cell death 7 Dr.82365 445020 2.332 1.10E-21 2.253 3.15E-30 pde10a Phosphodiesterase 10A Dr.117457 394077 2.784 3.42E-16 Pyruvate dehydrogenase kinase, pdk2 Dr.9528 393971 18.718 0.00E+00 isoenzyme 2
Prenyl (decaprenyl) diphosphate pdss1 Dr.78018 325705 1.507 9.92E-22 synthase, subunit 1 pdzk1ip1l PDZK1 interacting protein 1, like Dr.41116 368722 1.637 9.00E-05 2.445 3.00E-05 ETS-domain transcription factor pea3 Dr.75840 30700 1.744 3.77E-39 pea3
6-phosphofructo-2-kinase/fructose- pfkfb1 Dr.132747 327453 1.622 1.00E-05 2,6-biphosphatase 1
6-phosphofructo-2-kinase/fructose- pfkfb3 Dr.78868 554477 17.244 2.14E-10 2,6-biphosphatase 3 pgam1 Phosphoglycerate mutase 1 Dr.945 323107 2.479 1.30E-25 pgk1 Phosphoglycerate kinase 1 Dr.76033 406696 1.669 8.42E-28 pgm3 Phosphoglucomutase 3 Dr.37649 474321 3.550 3.42E-12 3.161 3.61E-10 phb Prohibitin Dr.114246 321346 1.733 3.29E-31 phb2 Prohibitin 2 Dr.5033 324421 1.557 6.27E-09 phf23a PHD finger protein 23a Dr.39087 541372 2.326 2.18E-27 Pleckstrin homology-like domain, phlda3 Dr.120320 368779 1.964 6.00E-05 5.338 1.59E-20 family A, member 3 Phosphatidylinositol 4-kinase II pi4kII alpha Dr.79494 554275 6.298 2.22E-08 6.243 3.59E-08 alpha Phosphatidylinositol glycan, class pigc Dr.78451 323994 3.446 1.56E-18 3.155 2.98E-14 C Phosphatidylinositol glycan, class pigq Dr.11595 321218 1.541 8.00E-05 Q pim1 Pim-1 oncogene Dr.78102 58054 1.751 1.13E-17 1.773 0.00E+00 3.238 0.00E+00 pinx1 Pin2/trf1-interacting protein 1 Dr.75635 368253 2.212 3.21E-14 Phosphatidylinositol transfer pitpna Dr.12713 393909 3.359 0.00E+00 protein, alpha Paired-like homeodomain pitx3 Dr.89375 402974 2.110 7.09E-09 transcription factor 3 pkd2 Polycystic kidney disease 2 Dr.92211 432387 10.280 3.06E-08 pkm2 Pyruvate kinase, muscle Dr.79861 335817 4.049 5.19E-15 pla2g12b Phospholipase A2, group XIIB Dr.76783 406739 1.905 2.60E-09 plek Pleckstrin Dr.29086 393814 1.890 1.63E-08 1.868 2.60E-14 1.704 3.05E-19 1.723 7.01E-17 1.849 7.65E-09 2.592 3.84E-20 2.798 2.83E-28 Pleckstrin homology domain plekhf1 containing, family F (with FYVE Dr.80998 393311 2.550 3.13E-12 4.516 0.00E+00 domain) member 1 plk3 Polo-like kinase 3 (Drosophila) Dr.78613 334202 3.455 0.00E+00 pllp Plasma membrane proteolipid Dr.15775 558650 2.122 1.27E-12 Procollagen-lysine, 2-oxoglutarate plod2 Dr.77688 100036767 2.293 2.51E-07 5-dioxygenase 2 plrg1 Pleiotropic regulator 1 Dr.79159 406749 2.358 1.82E-28 2.146 6.33E-15 pls1 Plastin 1 (I isoform) Dr.113808 334273 3.125 4.73E-14 2.563 3.17E-10 plxnd1 Plexin D1 Dr.103153 402998 1.538 7.71E-06 PMS1 postmeiotic segregation pms1 Dr.116514 368631 2.484 9.97E-09 increased 1 (S. cerevisiae) polb Polymerase (DNA directed), beta Dr.116029 445402 2.157 7.95E-11 1.784 3.37E-07 polr1a Polymerase (RNA) I polypeptide A Dr.101226 327078 1.952 1.24E-07 polr1a Polymerase (RNA) I polypeptide A Dr.12641 327078 2.141 1.68E-12
Polymerase (RNA) III (DNA polr3e Dr.4746 336518 2.927 0.00E+00 directed) polypeptide E popdc3 Popeye domain containing 3 Dr.81159 415108 1.775 0.00E+00 por P450 (cytochrome) oxidoreductase Dr.48619 568202 1.961 6.41E-09 pou47 POU domain gene 47 Dr.221 30397 1.795 1.00E-05 2.826 7.24E-09 POU domain, class 5, transcription pou5f1 Dr.258 30333 1.577 1.04E-11 factor 1 ppan Peter pan homolog (Drosophila) Dr.75454 317739 1.592 9.88E-14 Protein phosphatase 1, catalytic ppp1cb Dr.29419 368904 2.023 1.92E-40 subunit, beta isoform Palmitoyl-protein thioesterase 1 ppt1 (ceroid-lipofuscinosis, neuronal 1, Dr.80819 406648 1.849 1.65E-12 infantile) PR domain containing 1, with ZNF prdm1 Dr.77773 323473 1.914 9.83E-28 domain prelid1 PRELI domain containing 1 Dr.79342 393337 1.778 4.20E-45 prg4 Proteoglycan 4 Dr.78705 553377 2.912 2.08E-34 Protein kinase, cGMP-dependent, prkg1 Dr.26605 394005 1.782 6.00E-05 2.042 4.00E-05 2.478 1.36E-07 type I prnp Prion protein Dr.116262 494129 2.193 3.00E-05 provisionalck Provisional gene CK739236 Dr.110959 492326 2.897 3.40E-29 739236 prss35 Protease, serine, 35 Dr.118662 431759 2.053 5.03E-32 1.785 2.96E-16 psap Prosaposin Dr.75922 140811 1.630 7.99E-12 psat1 Phosphoserine aminotransferase 1 Dr.11425 327512 3.900 0.00E+00 psen2 Presenilin2 Dr.81267 58026 2.504 0.00E+00
Proteasome (prosome, macropain) psma6b Dr.82172 83917 2.379 2.37E-22 2.584 2.19E-14 2.039 4.87E-21 3.041 6.19E-31 4.161 7.01E-45 subunit, alpha type, 6b
Proteasome (prosome, macropain) psmb11 Dr.8210 64279 2.078 5.27E-12 subunit, beta type, 11 Proteasome (prosome, macropain) psmb8 Dr.7957 30666 5.543 5.80E-07 subunit, beta type, 8
Proteasome (prosome, macropain) psmb9a Dr.76004 30665 1.775 1.06E-08 2.396 4.77E-06 subunit, beta type, 9a
Proteasome (prosome, macropain) psmd7 26S subunit, non-ATPase, 7 Dr.80368 327330 2.243 3.25E-06 (Mov34 homolog) psme1 Proteasome activator subunit 1 Dr.81309 30648 2.913 0.00E+00 5.553 3.47E-25 1.861 1.67E-10 2.945 0.00E+00 5.551 0.00E+00 4.638 6.90E-37 psme2 Proteasome activator subunit 2 Dr.76266 30647 2.874 8.18E-08 3.153 2.67E-06 2.103 4.96E-06 2.626 1.04E-07 3.660 6.11E-07 8.710 9.83E-15 Prostaglandin E receptor 2 ptger2l Dr.87881 393608 6.878 1.09E-06 7.087 1.01E-09 3.627 1.38E-06 (subtype EP2)-like Prostaglandin I2 (prostacyclin) ptgisl Dr.82271 559148 1.835 0.00E+00 synthase like Prostaglandin-endoperoxide ptgs1 Dr.115126 246226 1.910 3.60E-08 2.136 1.00E-05 2.891 1.11E-08 synthase 1 Prostaglandin-endoperoxide ptgs2a Dr.113864 246227 1.525 8.24E-15 4.834 1.89E-26 synthase 2a Prostaglandin-endoperoxide ptgs2b Dr.48719 559020 12.378 4.96E-13 synthase 2b pth1 Parathyroid hormone 1 Dr.86325 405886 5.524 2.28E-11 71.023 0.00E+00 pthr2 Parathyroid hormone receptor 2 Dr.8136 30650 2.052 3.18E-11 Protein tyrosine phosphatase type ptp4a3 Dr.119316 406460 1.569 2.65E-06 IVA, member 3 Protein tyrosine phosphatase, ptpmt1 Dr.79837 567019 1.781 0.00E+00 mitochondrial 1 Protein tyrosine phosphatase, ptprn Dr.78558 324790 1.925 6.70E-10 receptor type, N pvalb7 Parvalbumin 7 Dr.78166 402807 2.408 0.00E+00 PX domain containing pxk Dr.79151 557065 1.720 1.02E-13 serine/threonine kinase pyy Peptide YY Dr.81113 30211 1.708 2.37E-25 qars Glutaminyl-tRNA synthetase Dr.20108 394188 1.740 2.46E-22 qk Quaking Dr.75774 30471 1.560 2.50E-15
Queuine tRNA-ribosyltransferase qtrtd1 Dr.15434 402798 1.750 6.69E-13 domain containing 1
RAB1A, member RAS oncogene rab1a Dr.77140 368883 1.530 7.69E-11 family RAB20, member RAS oncogene rab20 Dr.76410 337199 1.747 4.73E-14 family RAB32, member RAS oncogene rab32 Dr.119612 378969 2.072 2.00E-05 2.647 1.43E-22 family RAB35, member RAS oncogene rab35 Dr.14855 445154 1.988 2.46E-37 family Ras-related C3 botulinum toxin rac2 substrate 2 (rho family, small GTP Dr.75565 415151 1.954 7.34E-06 binding protein Rac2) rad17 RAD17 homolog (S. pombe) Dr.31220 436934 2.199 1.21E-18 1.539 1.17E-06 ralgps2 Ral-A exchange factor RalGPS2 Dr.17213 393446 1.579 2.15E-06 raraa Retinoic acid receptor, alpha a Dr.193 30680 1.880 5.64E-06 rars Arginyl-tRNA synthetase Dr.132233 337070 3.981 0.00E+00 rasl11b RAS-like, family 11, member B Dr.51739 393109 1.623 0.00E+00 Ras association (RalGDS/AF-6) rassf1 Dr.78467 447811 4.248 0.00E+00 domain family 1 RNA terminal phosphate cyclase- rcl1 Dr.31536 445388 1.861 4.17E-16 like 1 rdh10 Retinol dehydrogenase 10 Dr.76149 378722 2.854 0.00E+00 rdh12l Retinol dehydrogenase 12, like Dr.108840 494176 2.796 8.23E-27 V-rel reticuloendotheliosis viral rel Dr.86023 415101 2.507 4.40E-23 1.885 0.00E+00 2.251 4.82E-09 4.593 0.00E+00 oncogene homolog V-rel reticuloendotheliosis viral rela Dr.84126 415099 3.952 5.85E-09 oncogene homolog A ren Renin Dr.88880 405786 2.837 1.47E-07 Ral guanine nucleotide dissociation rgl1 Dr.106940 402933 1.647 1.14E-07 stimulator-like 1 rgs12 Regulator of G-protein signalling 12 Dr.84135 378970 1.624 1.32E-08 rgs14 Regulator of G-protein signalling 14 Dr.80473 327368 1.650 1.44E-09 rgs4 Regulator of G-protein signalling 4 Dr.75538 321256 1.997 0.00E+00 2.407 3.71E-43 2.307 4.41E-24 2.472 0.00E+00 3.229 0.00E+00 4.300 0.00E+00
Ras homolog gene family, member rhoae Dr.75611 394125 2.180 2.80E-45 Ae Ras homolog gene family, member rhogb Dr.9665 336933 1.908 3.07E-31 Gb Ras homolog gene family, member rhov Dr.133150 378852 2.588 0.00E+00 V Rhophilin, Rho GTPase binding rhpn2 Dr.75930 321330 1.912 1.55E-12 protein 2 riok1 RIO kinase 1 (yeast) Dr.77784 406268 1.541 9.26E-14 riok3 RIO kinase 3 (yeast) Dr.34142 445220 1.696 1.81E-31 6.617 0.00E+00 Receptor-interacting serine- ripk2 Dr.28180 373874 1.543 1.18E-14 1.741 3.02E-33 1.569 1.77E-09 2.601 1.99E-26 threonine kinase 2 rnd1l Rho family GTPase 1 like Dr.82570 553414 1.969 2.20E-12 rnf128 Ring finger protein 128 Dr.4850 322325 1.847 0.00E+00 RNA, U3 small nucleolar rnu3ip2 Dr.6359 402808 1.873 5.75E-15 interacting protein 2 Retinitis pigmentosa 2 (X-linked rp2 Dr.80773 406755 2.267 1.75E-21 2.124 9.05E-21 1.736 2.47E-10 recessive) Novel protein similar to vertebrate RP71- heat shock 70kDa protein 1B Dr.116131 798846 1.734 5.00E-05 15H20.7 (HSPA1B) rpl10 Ribosomal protein L10 Dr.75581 336712 1.831 3.23E-11 rpl11 Ribosomal protein L11 Dr.32573 415229 1.554 9.41E-18 rpl23a Ribosomal protein L23a Dr.76079 335539 1.533 9.12E-07 rpl35 Ribosomal protein L35 Dr.119727 192299 1.530 3.98E-11 rpl37 Ribosomal protein L37 Dr.114066 415159 1.683 6.73E-15 rpl7l1 Ribosomal protein L7-like 1 Dr.76997 322251 1.689 5.09E-18 rps25 Ribosomal protein S25 Dr.32370 393788 1.504 2.26E-10 rraga Ras-related GTP binding A Dr.1798 325358 1.575 1.71E-12 Ribosomal RNA processing 1 rrp1 Dr.76886 321059 1.618 6.35E-12 homolog (S. cerevisiae) Ribosomal RNA processing 15 rrp15 Dr.75896 327053 1.699 8.59E-08 homolog (S. cerevisiae) rtk6 Eph-like receptor tyrosine kinase 6 Dr.75828 30689 3.564 5.76E-11 rtn4ip1 Reticulon 4 interacting protein 1 Dr.16642 393323 2.675 9.00E-05 2.976 4.07E-08 rtn4rl2a Reticulon 4 receptor-like 2 a Dr.91444 403307 2.223 3.62E-06 rtn4rl2b Reticulon 4 receptor-like 2b Dr.30165 403309 4.262 3.37E-06 runx1 Runt-related transcription factor 1 Dr.82592 58126 3.655 3.60E-07
RUN and TBC1 domain containing rutbc3 Dr.75230 406635 2.199 7.70E-25 3 sars Seryl-tRNA synthetase Dr.32657 445405 1.841 5.48E-27 sb:cb1016 Sb:cb1016 Dr.79346 387309 1.735 3.65E-19 sb:cb166 Sb:cb166 Dr.116122 321132 2.160 5.00E-05 sb:cb188 Sb:cb188 Dr.140764 321147 2.462 4.95E-08 sb:cb230 Sb:cb230 Dr.81902 321163 1.827 1.46E-06 sb:cb25 Sb:cb25 Dr.16312 321045 3.068 1.33E-10 sb:cb26 Sb:cb26 Dr.77174 321046 1.803 4.99E-15 1.655 3.00E-05 1.673 1.18E-06 2.494 1.75E-11 sb:cb307 Sb:cb307 Dr.38 321198 2.095 1.14E-28 sb:cb336 Sb:cb336 Dr.108525 321208 2.045 9.13E-18 sb:cb339 Sb:cb339 Dr.100378 321210 1.939 1.96E-14 1.910 3.34E-13 sb:cb366 Sb:cb366 Dr.75327 321222 3.522 0.00E+00 sb:cb372 Sb:cb372 Dr.75342 321225 1.720 3.83E-06 sb:cb379 Sb:cb379 Dr.67781 321231 2.051 8.67E-12 sb:cb439 Sb:cb439 Dr.1309 321257 1.559 8.10E-12 sb:cb444 Sb:cb444 Dr.22514 321258 1.708 3.55E-07 sb:cb454 Sb:cb454 Dr.75495 321263 1.730 6.78E-22 sb:cb474 Sb:cb474 Dr.77270 321271 1.930 9.68E-07 6.671 5.68E-37 sb:cb606 Sb:cb606 Dr.114993 321320 2.340 3.65E-07 2.548 7.30E-13 sb:cb657 Sb:cb657 Dr.76278 368358 1.930 6.00E-05 sb:cb658 Sb:cb658 Dr.76383 373146 2.513 6.68E-13 sb:cb797 Sb:cb797 Dr.31604 378745 3.012 2.86E-21 sb:cb930 Sb:cb930 Dr.115730 399650 1.603 8.00E-05 sc4mol Sterol-C4-methyl oxidase-like Dr.12110 406662 2.976 9.34E-33 Secretory carrier membrane protein scamp2 Dr.121550 406687 2.036 2.44E-19 2.039 1.42E-26 2 Scavenger receptor class F, scarf1 Dr.74559 336834 1.773 3.00E-05 1.802 1.31E-07 member 1 Sodium channel, voltage gated, scn12ab Dr.110026 566868 2.374 2.51E-15 2.130 1.65E-12 type VIII, alpha b scpep1 Serine carboxypeptidase 1 Dr.80589 393161 2.636 0.00E+00 Signal peptide, CUB domain, EGF- scube2 Dr.3848 503728 1.715 1.15E-09 like 2 sdad1 SDA1 domain containing 1 Dr.35193 286746 2.401 3.43E-42 sdc4l Syndecan 4 like Dr.74531 568593 4.253 0.00E+00 Syndecan binding protein sdcbp Dr.1778 325004 3.117 1.21E-32 (syntenin) sdf2 Stromal cell-derived factor 2 Dr.79812 336879 1.983 9.73E-10 sdf2l1 Stromal cell-derived factor 2-like 1 Dr.51929 445275 1.955 2.59E-14 sec13 SEC13 homolog (S. cerevisiae) Dr.5496 406644 2.039 4.00E-05 1.975 5.45E-07 selt1a Selenoprotein T, 1a Dr.77136 352919 1.614 1.39E-08 sepw2b Selenoprotein W, 2b Dr.80915 378438 1.626 2.00E-05 Serpin peptidase inhibitor, clade B serpinb1 Dr.77198 436926 2.093 0.00E+00 (ovalbumin), member 1 Serpin peptidase inhibitor, clade B serpinb1l1 Dr.82062 494155 3.017 5.44E-11 3.282 1.71E-24 2.172 8.08E-08 2.426 7.61E-08 3.348 1.45E-28 5.066 0.00E+00 (ovalbumin), member 1, like 1 Serpin peptidase inhibitor, clade B serpinb1l4 Dr.119520 335229 2.324 1.56E-11 (ovalbumin), member 1, like 4 Serpin peptidase inhibitor, clade B serpinb5l Dr.30392 405813 8.087 1.13E-08 (ovalbumin), member 5, like Serine (or cysteine) proteinase inhibitor, clade E (nexin, serpine2 Dr.79374 393153 2.429 7.41E-33 plasminogen activator inhibitor type 1), member 2 sesn2 Sestrin 2 Dr.44360 558966 2.903 3.94E-11 10.344 1.09E-20 sesn3 Sestrin 3 Dr.5129 406840 3.079 2.80E-44 sf3a1 Splicing factor 3a, subunit 1 Dr.116253 368732 2.002 7.48E-06 sfmbt2 Scm-like with four mbt domains 2 Dr.93790 555450 1.583 9.70E-10 sfxn2 Sideroflexin 2 Dr.117332 334757 1.711 2.53E-17 Serum/glucocorticoid regulated sgk Dr.78523 324140 1.993 9.45E-25 kinase sh3bp4 SH3-domain binding protein 4 Dr.17077 403082 1.530 4.00E-05 SH3-domain binding protein 5 (BTK- sh3bp5 Dr.78598 406767 1.992 1.48E-23 associated)
Serine hydroxymethyltransferase 1 shmt1 Dr.26801 394021 1.796 7.76E-20 (soluble) si:busm1- Si:busm1-105l16.2 Dr.34873 368709 1.996 7.00E-05 105l16.2 si:busm1- Si:busm1-180o5.3 Dr.45761 368518 1.898 1.94E-07 180o5.3 si:busm1- Si:busm1-241h12.4 Dr.81772 368857 3.262 3.29E-07 3.138 1.81E-06 241h12.4 si:busm1- Si:busm1-57f23.1 Dr.81717 368621 2.490 5.64E-21 11.722 0.00E+00 57f23.1 si:busm1- Si:busm1-6a2.1 Dr.123332 368398 1.833 3.00E-05 2.653 1.59E-10 1.966 3.31E-15 7.933 1.05E-28 6a2.1 si:busm1- Si:busm1-6a2.1 Dr.120944 368398 20.147 8.18E-07 6a2.1 si:ch211- Si:ch211-105d11.2 Dr.78479 562734 3.924 1.00E-05 105d11.2 si:ch211- Si:ch211-116i17.1 Dr.114645 555520 3.125 0.00E+00 116i17.1 si:ch211- Si:ch211-11c20.1 Dr.83512 568060 2.171 3.00E-05 2.100 4.04E-11 11c20.1 si:ch211- Si:ch211-122c9.1 Dr.132822 565225 2.040 1.38E-12 122c9.1 si:ch211- Si:ch211-129c21.1 Dr.120146 563087 2.025 7.38E-06 129c21.1 si:ch211- Si:ch211-129c21.1 Dr.39085 563087 1.921 1.06E-07 129c21.1 si:ch211- Si:ch211-132b12.8 Dr.14015 327242 2.073 6.70E-07 132b12.8 si:ch211- Si:ch211-132p20.4 Dr.78433 566537 1.648 7.21E-36 2.626 0.00E+00 132p20.4 si:ch211- Si:ch211-135f11.1 Dr.35445 334294 2.035 7.32E-21 135f11.1 si:ch211- Si:ch211-14a17.6 Dr.113962 368668 2.456 2.00E-05 14a17.6 si:ch211- Si:ch211-154o6.6 Dr.73909 564061 2.707 0.00E+00 154o6.6 si:ch211- Si:ch211-191d7.3 Dr.122452 337530 2.266 2.30E-27 2.022 2.69E-19 191d7.3 si:ch211- Si:ch211-197g15.7 Dr.22154 571377 1.684 9.00E-05 197g15.7 si:ch211- Si:ch211-199g17.7 Dr.78777 324497 3.220 6.87E-17 6.011 1.21E-14 199g17.7 si:ch211- Si:ch211-199l3.4 Dr.106140 449649 3.013 2.51E-20 199l3.4 si:ch211- Si:ch211-202c21.3 Dr.87374 553387 3.131 1.30E-12 2.402 4.82E-06 3.769 3.62E-16 3.173 6.39E-13 4.662 1.21E-10 9.144 0.00E+00 5.171 0.00E+00 202c21.3 si:ch211- Si:ch211-203b8.5 Dr.133317 553269 1.658 1.04E-10 203b8.5 si:ch211- Si:ch211-214j24.10 Dr.75171 558894 1.642 1.19E-13 214j24.10 si:ch211- Si:ch211-218c6.6 Dr.79393 492676 2.265 1.29E-22 218c6.6 si:ch211- Si:ch211-225p5.3 Dr.78676 327152 1.644 5.74E-06 3.568 2.83E-24 225p5.3 si:ch211- Si:ch211-235e18.3 Dr.81479 337500 2.474 6.00E-05 235e18.3 si:ch211- Si:ch211-240l19.1 Dr.32532 561159 1.713 8.00E-05 240l19.1 si:ch211- Si:ch211-240l19.8 Dr.114622 799298 5.161 1.83E-09 240l19.8 si:ch211- Si:ch211-241e15.2 Dr.107310 337666 1.664 2.01E-22 241e15.2 si:ch211- Si:ch211-244b2.3 Dr.80060 557230 2.373 2.41E-13 5.347 1.82E-44 244b2.3 si:ch211- Si:ch211-244b2.4 Dr.42682 336755 1.686 1.08E-06 1.741 5.98E-06 1.767 5.47E-07 2.319 5.33E-07 244b2.4 si:ch211- Si:ch211-245h14.1 Dr.85745 563420 1.736 6.00E-05 1.646 1.21E-09 1.860 3.00E-05 3.376 4.40E-34 245h14.1 si:ch211- Si:ch211-261f7.2 Dr.87449 567341 2.742 1.85E-09 261f7.2 si:ch211- Si:ch211-262h13.3 Dr.18273 569577 14.156 2.83E-07 262h13.3 si:ch211- Si:ch211-266k8.3 Dr.4617 325458 2.932 5.83E-25 266k8.3 si:ch211- Si:ch211-272f3.3 Dr.76284 336776 2.289 4.93E-15 1.706 2.16E-08 2.426 5.70E-15 272f3.3 si:ch211- Si:ch211-284a13.1 Dr.82007 564009 1.727 5.67E-19 284a13.1 si:ch211- Si:ch211-284e13.1 Dr.133004 497506 2.730 9.19E-16 284e13.1 si:ch211- Si:ch211-286m4.4 Dr.140765 558020 2.484 1.79E-15 286m4.4 si:ch211- Si:ch211-57g18.1 Dr.22092 322706 4.661 8.59E-08 57g18.1 si:ch211- Si:ch211-63o20.5 Dr.43918 566703 3.198 0.00E+00 63o20.5 si:ch211- Si:ch211-81a5.8 Dr.18438 560648 3.041 3.67E-08 81a5.8 si:ch211- Si:ch211-89p1.3 Dr.79241 325248 1.590 6.08E-17 89p1.3 si:ch211- Si:ch211-8a9.4 Dr.31089 570136 1.663 5.48E-08 8a9.4 si:dkey- Si:dkey-105n5.2 Dr.76945 324401 2.024 5.13E-06 105n5.2 si:dkey- Si:dkey-111e8.1 Dr.15488 323719 1.542 1.02E-09 111e8.1 si:dkey- Si:dkey-11p23.3 Dr.84401 559138 1.549 1.68E-44 11p23.3 si:dkey- Si:dkey-149j18.2 Dr.75278 322721 1.817 3.00E-05 149j18.2 si:dkey- Si:dkey-14d8.3 Dr.79865 558154 1.768 5.74E-35 14d8.3 si:dkey- Si:dkey-15j16.2 Dr.106771 555775 3.513 0.00E+00 15j16.2 si:dkey- Si:dkey-170o10.1 Dr.78607 557526 1.551 5.00E-05 3.834 3.94E-32 170o10.1 si:dkey- Si:dkey-177p2.16 Dr.132056 325997 1.547 9.25E-07 2.727 2.08E-10 177p2.16 si:dkey- Si:dkey-177p2.6 Dr.85086 568712 2.519 2.88E-19 177p2.6 si:dkey- Si:dkey-217k21.2 Dr.78654 567941 2.220 1.17E-08 217k21.2 si:dkey- Si:dkey-217m5.1 Dr.122462 564535 1.849 1.54E-19 217m5.1 si:dkey- Si:dkey-218h11.4 Dr.80044 325917 2.398 5.93E-13 218h11.4 si:dkey- Si:dkey-222b8.2 Dr.41221 567959 2.311 1.29E-22 1.642 2.00E-05 2.024 2.68E-15 222b8.2 si:dkey- Si:dkey-222f8.3 Dr.76969 324935 1.587 0.00E+00 222f8.3 si:dkey- Si:dkey-22a1.3 Dr.75294 550343 2.217 3.65E-09 22a1.3 si:dkey- Si:dkey-253d23.1 Dr.4570 386996 1.559 7.13E-06 1.575 9.11E-07 253d23.1 si:dkey- Si:dkey-25e12.3 Dr.78146 569300 1.875 8.88E-08 3.131 9.41E-18 2.191 5.21E-07 3.269 5.05E-30 21.779 0.00E+00 25e12.3 si:dkey- Si:dkey-25f3.3 Dr.83732 558800 1.682 3.61E-08 4.163 6.62E-26 25f3.3 si:dkey- Si:dkey-261e22.2 Dr.77248 561433 1.931 1.00E-05 261e22.2 si:dkey- Si:dkey-266j7.1 Dr.22774 336156 1.779 7.00E-05 266j7.1 si:dkey- Si:dkey-30c15.13 Dr.119059 558731 1.555 7.52E-07 30c15.13 si:dkey- Si:dkey-34f16.1 Dr.91271 563018 2.002 2.23E-07 34f16.1 si:dkey- Si:dkey-37m8.10 Dr.106102 325257 2.074 4.00E-05 37m8.10 si:dkey- Si:dkey-42i9.4 Dr.32436 336454 1.637 2.64E-23 42i9.4 si:dkey- Si:dkey-42i9.6 Dr.107461 334656 2.745 5.00E-05 42i9.6 si:dkey- Si:dkey-44g23.7 Dr.120210 448873 1.622 6.54E-10 44g23.7 si:dkey- Si:dkey-65m5.3 Dr.79041 568061 1.979 0.00E+00 65m5.3 si:dkey- Si:dkey-71l10.2 Dr.81228 336243 5.328 1.27E-27 71l10.2 si:dkey- Si:dkey-72l14.4 Dr.7451 562545 1.518 8.00E-05 1.880 1.73E-07 72l14.4 si:dkey- Si:dkey-73n10.1 Dr.14401 337365 2.752 5.30E-14 73n10.1 si:dkey- Si:dkey-78d16.1 Dr.76232 336965 1.650 7.72E-12 78d16.1 si:dkey- Si:dkey-80c24.6 Dr.120873 100038765 2.778 2.33E-28 80c24.6 si:dkey- Si:dkey-86e18.1 Dr.91215 557342 2.385 7.00E-05 86e18.1 si:dkey- Si:dkey-8l13.4 Dr.67664 324864 2.725 0.00E+00 8l13.4 si:dkey- Si:dkey-90m5.4 Dr.75680 553466 4.209 8.76E-20 90m5.4 si:dkey- Si:dkey-91f15.6 Dr.34109 564304 2.115 1.88E-06 91f15.6 si:dkey- Si:dkey-9a20.7 Dr.76242 337033 1.577 5.47E-17 9a20.7 si:dkeyp- Si:dkeyp-113f10.1 Dr.81070 336053 1.699 3.60E-07 113f10.1 si:dkeyp- Si:dkeyp-11g8.2 Dr.77413 559432 1.579 3.00E-05 11g8.2 si:dkeyp- Si:dkeyp-20g2.4 Dr.82396 334561 1.520 1.02E-13 1.590 1.43E-10 8.625 0.00E+00 20g2.4 si:dkeyp- Si:dkeyp-55f12.4 Dr.76408 619265 1.669 1.43E-14 55f12.4 si:dkeyp- Si:dkeyp-59a8.2 Dr.84529 563208 2.101 4.72E-11 2.780 8.54E-23 2.921 3.41E-12 2.724 1.71E-09 3.135 1.01E-17 59a8.2 si:dkeyp- Si:dkeyp-90a8.2 Dr.77261 562273 2.201 7.66E-06 2.419 2.76E-07 2.922 2.00E-05 90a8.2 si:rp71- Si:rp71-1g18.13 Dr.86885 560271 1.729 1.80E-06 1g18.13 si:rp71- Si:rp71-46j2.8 Dr.125361 368434 1.558 2.06E-07 46j2.8 si:rp71- Si:rp71-4m17.1 Dr.30413 407657 6.255 1.06E-10 4m17.1 si:rp71- Si:rp71-57j15.4 Dr.78407 561007 1.685 1.00E-04 57j15.4 skib Nuclear oncoprotein skib Dr.3980 30113 2.086 1.57E-16 Solute carrier family 10 slc10a2 (sodium/bile acid cotransporter Dr.88326 393329 2.686 1.09E-09 family), member 2 Solute carrier family 16 slc16a3 (monocarboxylic acid transporters), Dr.23391 327276 6.250 0.00E+00 member 3 Solute carrier family 16 slc16a9a (monocarboxylic acid transporters), Dr.7340 393382 5.025 0.00E+00 1.617 2.00E-05 41.429 0.00E+00 member 9a Solute carrier family 16 slc16a9b (monocarboxylic acid transporters), Dr.140314 445158 4.387 1.25E-12 member 9b Solute carrier family 1 slc1a4 (glutamate/neutral amino acid Dr.77685 368885 1.599 4.90E-13 2.517 9.14E-14 4.996 0.00E+00 transporter), member 4 Solute carrier family 20, member slc20a1a Dr.116243 406458 1.677 3.17E-08 2.786 0.00E+00 1a Solute carrier family 20, member slc20a1b Dr.5307 321541 1.603 2.01E-18 1b Solute carrier family 25 slc25a12 (mitochondrial carrier, Aralar), Dr.76801 337675 2.973 2.08E-12 2.782 2.13E-11 member 12 Solute carrier family 25, member slc25a16 Dr.78884 324578 1.887 1.74E-11 2.184 2.88E-15 16 Solute carrier family 25 slc25a25 (mitochondrial carrier; phosphate Dr.7614 406541 2.636 0.00E+00 carrier), member 25 Solute carrier family 25, member slc25a33 Dr.76663 406436 3.356 0.00E+00 33 Solute carrier family 25, member slc25a37 Dr.116247 387000 3.481 4.00E-05 37 Solute carrier family 25, member slc25a43 Dr.76536 368427 3.407 0.00E+00 43 slc26a5 Solute carrier family 26, member 5 Dr.77323 322846 1.995 2.39E-38
Solute carrier family 2 (facilitated slc2a12 Dr.28449 393510 2.090 2.32E-08 glucose transporter), member 12
Solute carrier family 2 (facilitated slc2a8l glucose transporter), member 8- Dr.82374 373140 2.155 1.49E-32 2.015 2.00E-05 like Solute carrier family 30 (zinc slc30a1 Dr.79763 393853 2.351 2.29E-14 transporter), member 1 Solute carrier family 31 (copper slc31a1 Dr.79948 403028 1.602 4.74E-20 transporters), member 1 slc38a3 Solute carrier family 38, member 3 Dr.32995 436921 1.623 9.17E-06
Solute carrier family 39 (zinc slc39a1 Dr.30340 321324 1.501 6.23E-07 4.248 6.90E-16 transporter), member 1 slc43a1 Solute carrier family 43, member 1 Dr.106021 334395 1.601 9.54E-06 slc44a4 Solute carrier family 44, member 4 Dr.26602 393385 2.707 1.51E-33
Solute carrier family 5 slc5a1 (sodium/glucose cotransporter), Dr.87868 393654 4.459 0.00E+00 member 1 Solute carrier family 7 (cationic slc7a3 amino acid transporter, y+ system), Dr.77674 492363 2.399 5.65E-06 6.813 2.49E-06 member 3 slmap Sarcolemma associated protein Dr.81986 393146 1.879 4.29E-06 Smith-Magenis syndrome smcr8 chromosome region, candidate 8 Dr.113441 407723 2.268 1.00E-05 homolog (human) smo Smoothened homolog (Drosophila) Dr.114683 30225 1.694 6.05E-06
Secreted modular calcium binding smoc2 Dr.108698 266988 1.811 5.00E-05 1.903 1.16E-09 protein 2 snai1b Snail homolog 1b (Drosophila) Dr.625 30182 7.720 0.00E+00 snx1 Sorting nexin 1 Dr.140305 337386 2.651 9.18E-09 snx27 Sorting nexin family member 27 Dr.76167 393512 1.541 4.72E-29 snx8 Sorting nexin 8 Dr.83133 387289 3.490 7.00E-05 socs3 Suppressor of cytokine signaling 3 Dr.6431 335409 2.911 0.00E+00 3.581 6.18E-21 3.678 1.48E-36 3.068 0.00E+00 2.081 6.16E-14 7.257 2.58E-35 20.283 0.00E+00 sox21b SRY-box containing gene 21 b Dr.116538 406246 2.868 3.00E-05 sox32 SRY-box containing gene 32 Dr.133216 116990 2.231 8.27E-10 SRY (sex determining region Y)- sox7 Dr.27174 394203 4.024 3.15E-26 box 7 sox9a SRY-box containing gene 9a Dr.80814 60641 1.551 2.00E-05 sp8 Sp8 transcription factor Dr.32632 321264 1.748 0.00E+00 sp9 Sp9 transcription factor Dr.86028 405896 3.126 0.00E+00 spag6 Sperm associated antigen 6 Dr.80821 431757 1.602 5.12E-19 spg21 Spastic paraplegia 21 (H. sapiens) Dr.27161 406704 2.171 0.00E+00
Serine protease inhibitor, Kunitz spint1l Dr.75391 406426 1.597 1.54E-06 1.732 2.44E-08 2.920 7.32E-08 1.823 2.00E-05 type 1-like spry4 Sprouty (Drosophila) homolog 4 Dr.32057 114437 3.715 0.00E+00 sqstm1 Sequestosome 1 Dr.76246 406452 8.947 0.00E+00
V-src sarcoma (Schmidt-Ruppin A- src Dr.2731 325084 1.627 8.60E-18 2) viral oncogene homolog (avian)
ST3 beta-galactoside alpha-2,3- st3gal2l Dr.78215 445567 2.715 0.00E+00 sialyltransferase 2, like ST6 beta-galactosamide alpha-2,6- st6gal2 Dr.82299 403116 1.862 4.96E-06 1.657 3.10E-07 sialyltranferase 2 stambp STAM binding protein Dr.75634 393470 3.494 0.00E+00 stard10 START domain containing 10 Dr.78104 393189 5.005 0.00E+00 stard3nl STARD3 N-terminal like Dr.75372 436592 1.827 4.10E-07 2.110 4.40E-21 Signal transduction and activation stat1 Dr.120105 30768 2.434 0.00E+00 of transcription 1 Signal transduction and activation stat3 Dr.132860 30767 2.547 1.66E-29 of transcription 3 Signal transducer and activator of stat4 Dr.34491 368519 1.536 8.00E-05 1.563 1.07E-07 1.642 2.68E-19 3.675 3.97E-15 transcription 4 stc1 Stanniocalcin 1 Dr.88421 393511 1.934 3.85E-16 2.326 2.27E-25 stk35 Serine/threonine kinase 35 Dr.76552 568080 3.103 7.87E-12 stmn4l Stathmin-like 4, like Dr.82837 436836 2.961 0.00E+00 STIP1 homology and U-Box stub1 Dr.78513 324243 1.935 2.47E-06 1.964 7.66E-09 containing protein 1 stx3a Syntaxin 3A Dr.82925 393515 1.573 1.53E-07 1.728 6.83E-08 1.653 3.03E-09 stx5a Syntaxin 5A Dr.31674 436605 2.012 1.50E-06 stx8 Syntaxin 8 Dr.15516 393346 1.714 1.60E-12 Suppressor of Ty 3 homolog (S. supt3h Dr.108054 436898 1.743 3.02E-22 cerevisiae) surf6l Surfeit 6-like Dr.79220 394040 1.906 0.00E+00 sybl1 Synaptobrevin-like 1 Dr.15571 393236 1.667 1.67E-10 Tumor-associated calcium signal tacstd Dr.104752 406454 2.095 1.45E-21 1.939 1.53E-10 transducer tagln2 Transgelin 2 Dr.104755 259183 2.109 3.00E-05 2.625 6.45E-06 Tax1 (human T-cell leukemia virus tax1bp1 Dr.99194 324152 1.757 3.98E-22 type I) binding protein 1 Tax1 (human T-cell leukemia virus tax1bp1 Dr.76221 324152 1.779 1.12E-10 type I) binding protein 1 Tax1 (human T-cell leukemia virus tax1bp3 Dr.104903 406779 1.961 5.57E-30 type I) binding protein 3 tbpl2 TATA box binding protein like 2 Dr.85608 407713 8.879 0.00E+00 tbx24 T-box 24 Dr.83300 192294 2.387 3.18E-07 Transcription elongation factor A tcea2 Dr.85125 393961 1.522 7.00E-05 1.760 4.53E-07 (SII), 2 tdh L-threonine dehydrogenase Dr.10250 406528 1.819 3.49E-13 3.950 0.00E+00 Testis derived transcript (3 LIM tes Dr.76291 403032 1.757 2.81E-06 domains) Transcription factor binding to tfe3a Dr.78052 114834 4.707 1.09E-10 IGHM enhancer 3a tgfb1 Transforming growth factor, beta 1 Dr.76626 359834 1.651 2.14E-11 3.349 0.00E+00
Transforming growth factor, beta tgfbr2 Dr.77521 30739 1.931 0.00E+00 receptor II th2 Tyrosine hydroxylase 2 Dr.88913 414844 1.852 1.00E-05 5.424 3.57E-17 thbs1 Thrombospondin 1 Dr.78947 561901 2.014 2.08E-19 thra Thyroid hormone receptor alpha Dr.75070 30670 2.179 9.62E-20 Thyroid hormone receptor thrap6 Dr.84829 393690 1.572 2.90E-10 associated protein 6
Translocase of inner mitochondrial timm23 Dr.80644 192337 1.738 1.05E-35 membrane 23 homolog (yeast)
Tissue inhibitor of timp2l Dr.102602 406650 1.917 2.97E-23 4.255 3.05E-19 3.908 5.53E-09 2.996 2.67E-16 10.144 3.78E-08 42.961 0.00E+00 metalloproteinase 2, like Tuberoinfundibular peptide of 39 tip39 Dr.83558 402812 2.125 1.00E-05 amino acids tjp3 Tight junction protein 3 Dr.78241 373089 1.945 1.09E-06 tk2 Thymidine kinase 2, mitochondrial Dr.115855 437016 1.584 4.67E-38 tlcd1 TLC domain containing 1 Dr.36920 450051 2.194 1.15E-09 tlr5a Toll-like receptor 5a Dr.89423 403138 2.342 2.70E-10 1.601 2.00E-05 1.564 1.99E-09 2.219 1.38E-23 2.072 9.50E-13 2.077 1.36E-14 4.500 1.31E-36 tlr5b Toll-like receptor 5b Dr.89707 403139 2.316 2.58E-41 1.639 2.90E-13 1.808 9.57E-06 2.190 0.00E+00 2.116 3.24E-12 2.204 4.75E-06 3.707 0.00E+00 Transmembrane BAX inhibitor tmbim1 Dr.98035 449819 3.443 3.03E-10 motif containing 1 tmem129 Transmembrane protein 129 Dr.78463 406756 1.869 1.01E-17 tmem177 Transmembrane protein 177 Dr.3515 322274 1.973 6.78E-10 1.505 3.30E-09 1.993 0.00E+00 tmem49 Transmembrane protein 49 Dr.982 336789 2.963 0.00E+00 tmem9b TMEM9 domain family, member B Dr.79957 325931 2.314 0.00E+00
Tumor necrosis factor a (TNF tnfa Dr.89727 405785 6.372 3.85E-12 4.039 1.00E-05 5.077 2.74E-09 3.446 6.71E-06 7.302 2.00E-05 15.973 5.28E-07 superfamily, member 2) Tumor necrosis factor, alpha- tnfaip1 Dr.106647 327399 1.512 5.70E-13 induced protein 1 (endothelial) Tumor necrosis factor, alpha- tnfaip8 Dr.105711 393303 1.577 9.24E-10 induced protein 8 Tumor necrosis factor, alpha- tnfaip8l Dr.88310 393345 3.175 2.98E-06 induced protein 8, like Tumor necrosis factor b (TNF tnfb Dr.94015 554167 2.644 8.33E-27 2.129 1.14E-18 5.554 0.00E+00 2.669 2.02E-18 11.544 0.00E+00 35.903 0.00E+00 superfamily, member 2) Tumor necrosis factor receptor tnfrsf21 Dr.118263 334039 1.522 8.61E-08 superfamily, member 21 Tumor necrosis factor (ligand) tnfsf10l2 Dr.86839 436866 2.106 1.18E-30 1.685 7.00E-05 1.876 6.07E-07 superfamily, member 10 like 2 Tumor necrosis factor (ligand) tnfsf10l4 Dr.86302 503595 1.813 2.96E-06 superfamily, member 10 like 4 tnip1 TNFAIP3 interacting protein 1 Dr.16192 449958 2.754 2.13E-17 tnnt1 Troponin T1, skeletal, slow Dr.13906 353248 1.949 8.55E-06 2.390 6.00E-05 tob1a Transducer of ERBB2, 1a Dr.79310 386629 1.696 7.63E-08 tob1b Transducer of ERBB2, 1b Dr.10199 406245 3.245 0.00E+00 tom1 Target of myb1 (chicken) Dr.76330 553244 1.796 1.37E-08
TOM1 Similar to target of myb1 (chicken) Dr.2710 403083 3.039 5.88E-06
Translocase of outer mitochondrial tomm20 Dr.122125 406309 1.503 6.19E-22 membrane 20 homolog (yeast)
Translocase of outer mitochondrial tomm22 Dr.117210 321232 1.627 7.61E-09 membrane 22 homolog (yeast)
Translocase of outer mitochondrial tomm40l Dr.84273 405895 1.769 1.14E-18 1.783 2.92E-21 membrane 40 homolog, like tp53 Tumor protein p53 Dr.75100 30590 3.236 0.00E+00 Tumor protein p53 binding protein, tp53bp2 Dr.32621 407983 1.748 1.46E-07 2 Tumor protein p53 binding protein, tp53bp2 Dr.117439 407983 1.838 1.57E-17 2 Tryptophan hydroxylase 1 tph1 Dr.19931 352943 1.708 6.88E-07 (tryptophan 5-monooxygenase) Tryptophan hydroxylase 2 tph2 Dr.84644 407712 1.746 1.28E-11 (tryptophan 5-monooxygenase) tpp1 Tripeptidyl peptidase I Dr.35596 334714 2.442 2.00E-15 tpsn Tapasin Dr.132863 30163 1.539 4.33E-09 1.790 4.00E-05 3.266 0.00E+00 trabd TraB domain containing Dr.77456 322581 2.452 5.61E-33 traf4a Tnf receptor-associated factor 4a Dr.81750 404045 1.848 8.93E-35 traf4b Tnf receptor-associated factor 4b Dr.15893 404035 3.223 0.00E+00 traf6 TNF receptor-associated factor 6 Dr.74618 327524 2.279 7.46E-09
TIR domain containing adaptor trif Dr.82215 403147 1.537 2.49E-29 inducing interferon-beta trim71 Tripartite motif-containing 71 Dr.75602 399547 3.163 2.18E-07 TRNA methyltransferase 11 trmt11 Dr.132740 393185 1.556 6.32E-18 homolog (S. cerevisiae)
Transient receptor potential cation trpv6 Dr.118447 415109 1.804 2.13E-11 channel, subfamily V, member 6 ttna Titin a Dr.140815 317731 2.391 1.05E-15 tuba7l Tubulin, alpha 7 like Dr.12524 431777 1.686 1.34E-10 twistnb TWIST neighbor Dr.18556 402856 1.535 1.00E-05 txnip Thioredoxin interacting protein Dr.18396 368359 2.082 1.78E-22 Ubiquitin-conjugating enzyme E2D ube2d2 Dr.7352 335444 1.917 0.00E+00 2 (UBC4/5 homolog, yeast) ucp2l Uncoupling protein 2, like Dr.85272 393324 2.713 1.40E-45 9.270 0.00E+00 unc119.1 Unc-119 homolog 1 Dr.108220 338230 1.960 5.91E-14 unc119.2 Unc-119 homolog 2 Dr.94317 403018 2.373 9.95E-14 UPF3 regulator of nonsense upf3b Dr.13796 393929 1.714 9.81E-44 transcripts homolog B (yeast) Usher syndrome 1C (autosomal ush1c Dr.80034 564412 1.801 2.37E-13 10.553 0.00E+00 recessive, severe) usp36 Ubiquitin specific peptidase 36 Dr.10523 327239 1.918 2.78E-33 usp39 Ubiquitin specific peptidase 39 Dr.77033 322247 1.696 3.00E-05 1.580 2.00E-05
Vesicle-associated membrane vapb Dr.935 323628 2.871 2.00E-05 protein, associated protein B and C vars Valyl-tRNA synthetase Dr.1481 114427 2.348 1.26E-22 Vascular endothelial growth factor vegfa Dr.597 30682 5.456 0.00E+00 A vent Ventral expressed homeobox Dr.106743 64810 1.755 1.93E-10 vps37a Vacuolar protein sorting 37A Dr.76677 336368 2.668 0.00E+00 vrk2 Vaccinia related kinase 2 Dr.77483 394145 2.166 1.46E-06 vtg3 Vitellogenin 3, phosvitinless Dr.33265 30518 1.669 3.98E-16 wars Tryptophanyl-tRNA synthetase Dr.79691 393745 1.981 1.51E-25 wasl Wiskott-Aldrich syndrome, like Dr.10901 394034 1.536 6.00E-05 wdr3 WD repeat domain 3 Dr.132361 321058 1.628 8.62E-23 wdr75 WD repeat domain 75 Dr.132270 368478 1.604 2.18E-09 wee1 WEE1 homolog (S. pombe) Dr.75899 327060 1.594 2.00E-05 Wingless-type MMTV integration wnt1 Dr.85371 30128 1.527 3.49E-06 site family, member 1 Wingless-type MMTV integration wnt10a Dr.342 30171 9.128 1.06E-12 site family, member 10a Wingless-type MMTV integration wnt16 Dr.87285 404628 1.717 3.00E-05 1.884 1.84E-06 site family, member 16 Wingless-type MMTV integration wnt4a Dr.385 30123 1.597 0.00E+00 site family, member 4a SOCS box-containing WD protein wsb1 Dr.33037 323226 3.014 4.40E-15 SWiP-1 wu:fa01c11 Wu:fa01c11 Dr.75374 334720 3.791 3.17E-15 6.150 1.13E-32 wu:fa04a09 Wu:fa04a09 Dr.75323 334800 2.922 1.00E-05 wu:fa04d06 Wu:fa04d06 Dr.25381 334819 1.544 6.00E-05 wu:fa04g06 Wu:fa04g06 Dr.75459 334833 3.447 3.73E-07 3.115 1.71E-06 wu:fa04h11 Wu:fa04h11 Dr.34097 334840 1.638 4.00E-05 wu:fa05b11 Wu:fa05b11 Dr.75266 334850 2.627 1.36E-11 wu:fa05e12 Wu:fa05e12 Dr.491 334861 2.969 2.19E-41 wu:fa06h01 Wu:fa06h01 Dr.13577 334875 1.787 1.39E-15 2.155 4.74E-26 wu:fa10d10 Wu:fa10d10 Dr.73730 334945 2.967 1.82E-14 wu:fa11a02 Wu:fa11a02 Dr.119676 334965 2.615 1.33E-15 wu:fa11b04 Wu:fa11b04 Dr.75224 334976 2.166 1.82E-09 wu:fa11h11 Wu:fa11h11 Dr.16978 335022 2.801 3.00E-36 wu:fa14a01 Wu:fa14a01 Dr.75919 334589 1.621 6.99E-06 wu:fa20b10 Wu:fa20b10 Dr.135679 327042 1.538 6.23E-06 wu:fa25f02 Wu:fa25f02 Dr.75915 327073 2.372 1.17E-17 wu:fa91d01 Wu:fa91d01 Dr.76189 336652 2.726 3.42E-07 wu:fa91f10 Wu:fa91f10 Dr.76195 336665 2.026 5.21E-19 2.227 1.43E-25 wu:fa92f10 Wu:fa92f10 Dr.36904 386905 1.796 7.31E-14 wu:fa92h04 Wu:fa92h04 Dr.76237 336694 1.980 1.12E-16 wu:fa92h06 Wu:fa92h06 Dr.76238 336696 1.593 3.26E-06 wu:fa92h10 Wu:fa92h10 Dr.76239 336699 4.256 1.02E-08 2.738 7.00E-05 wu:fa92h11 Wu:fa92h11 Dr.132222 336700 1.508 9.57E-08 wu:fa94g04 Wu:fa94g04 Dr.4770 336754 1.807 3.00E-05 wu:fa94h02 Wu:fa94h02 Dr.104626 336756 1.636 1.68E-17 wu:fa94h07 Wu:fa94h07 Dr.23516 336758 2.040 4.83E-08 2.664 4.03E-17 2.693 4.00E-05 wu:fa95e03 Wu:fa95e03 Dr.1101 337025 1.620 6.00E-05 wu:fa96c08 Wu:fa96c08 Dr.39062 337052 1.517 1.00E-05 wu:fa97d10 Wu:fa97d10 Dr.76347 337101 2.656 3.64E-06 wu:fa97h07 Wu:fa97h07 Dr.104634 337111 6.642 9.53E-07 8.304 7.71E-08 wu:fa98d10 Wu:fa98d10 Dr.27231 337125 3.470 5.89E-06 4.758 3.73E-07 wu:fa98e05 Wu:fa98e05 Dr.1258 337127 1.535 1.64E-12 wu:fa98e11 Wu:fa98e11 Dr.76350 337130 1.611 2.64E-09 1.765 7.02E-07 2.359 1.21E-21 4.729 7.59E-32 wu:fb01b03 Wu:fb01b03 Dr.70656 337182 1.975 4.45E-09 11.039 2.94E-25 wu:fb03e09 Wu:fb03e09 Dr.20328 337254 3.147 2.80E-09 wu:fb06f07 Wu:fb06f07 Dr.41307 336817 2.412 3.25E-20 wu:fb07c05 Wu:fb07c05 Dr.76639 336835 3.844 0.00E+00 wu:fb08f07 Wu:fb08f07 Dr.104781 336369 1.777 1.78E-08 wu:fb08g12 Wu:fb08g12 Dr.51536 336378 1.596 5.98E-10 2.504 5.25E-23 1.722 9.56E-12 2.571 7.56E-25 wu:fb09c03 Wu:fb09c03 Dr.138857 336394 2.146 3.83E-08 wu:fb09g03 Wu:fb09g03 Dr.76687 336411 1.674 1.00E-05 4.668 8.23E-32 wu:fb09h12 Wu:fb09h12 Dr.23638 336415 1.818 2.30E-09 wu:fb10a09 Wu:fb10a09 Dr.51646 336418 2.917 1.20E-30 2.413 8.46E-39 2.857 2.61E-29 3.118 0.00E+00 3.977 1.30E-43 31.688 0.00E+00 wu:fb10g03 Wu:fb10g03 Dr.27253 336442 1.747 5.24E-08 wu:fb11a04 Wu:fb11a04 Dr.3436 336451 2.659 8.00E-05 wu:fb11b01 Wu:fb11b01 Dr.23593 336456 1.648 1.41E-09 wu:fb11c02 Wu:fb11c02 Dr.23574 336462 1.720 3.05E-09 wu:fb11h05 Wu:fb11h05 Dr.76693 336493 2.807 5.00E-05 3.218 4.83E-06 wu:fb12a05 Wu:fb12a05 Dr.24997 336499 3.533 8.54E-19 4.899 1.12E-07 wu:fb12b01 Wu:fb12b01 Dr.76670 336502 1.727 2.00E-05 wu:fb12e11 Wu:fb12e11 Dr.6748 336522 2.511 1.01E-19 wu:fb12g02 Wu:fb12g02 Dr.76611 336527 2.497 7.81E-20 wu:fb13b07 Wu:fb13b07 Dr.23569 336539 1.557 6.19E-07 wu:fb13d05 Wu:fb13d05 Dr.104799 336548 1.835 3.00E-05 wu:fb13h06 Wu:fb13h06 Dr.114079 336567 1.534 4.34E-09 wu:fb14a07 Wu:fb14a07 Dr.63919 336572 1.805 1.06E-06 wu:fb14b11 Wu:fb14b11 Dr.13965 336580 3.547 5.15E-19 wu:fb14c11 Wu:fb14c11 Dr.32415 336586 1.581 1.52E-10 2.532 1.91E-15 3.806 2.97E-28 wu:fb14g06 Wu:fb14g06 Dr.76652 336604 1.619 8.00E-05 2.147 8.05E-13 wu:fb15h11 Wu:fb15h11 Dr.5716 336638 2.825 1.31E-07 2.743 2.86E-07 wu:fb16f08 Wu:fb16f08 Dr.104825 321479 2.334 3.04E-13 wu:fb17f01 Wu:fb17f01 Dr.76619 321500 2.572 4.96E-19 2.641 1.49E-15 wu:fb18b12 Wu:fb18b12 Dr.23649 321526 5.507 2.00E-05 4.134 3.13E-12 wu:fb18g01 Wu:fb18g01 Dr.104896 321547 1.628 2.78E-12 wu:fb19b08 Wu:fb19b08 Dr.24364 321557 3.668 1.48E-07 3.819 4.48E-08 wu:fb19g02 Wu:fb19g02 Dr.32560 321570 1.782 1.42E-12 wu:fb25b09 Wu:fb25b09 Dr.75159 321660 2.056 1.00E-04 wu:fb25h12 Wu:fb25h12 Dr.76766 321668 2.589 1.30E-06 2.481 8.00E-05 wu:fb26f10 Wu:fb26f10 Dr.76802 321684 2.078 1.54E-18 1.947 3.12E-15 wu:fb30b04 Wu:fb30b04 Dr.76812 321693 2.625 6.69E-09 wu:fb33a11 Wu:fb33a11 Dr.132276 321728 3.423 3.96E-21 wu:fb34a04 Wu:fb34a04 Dr.104473 321763 1.692 1.24E-15 wu:fb36b12 Wu:fb36b12 Dr.76829 321815 2.124 7.41E-08 wu:fb36d12 Wu:fb36d12 Dr.17984 321826 2.142 3.33E-29 wu:fb37a05 Wu:fb37a05 Dr.104782 321848 2.143 8.28E-09 wu:fb37a10 Wu:fb37a10 Dr.11310 321850 2.462 4.44E-30 wu:fb38e05 Wu:fb38e05 Dr.121668 321923 1.790 5.82E-10 wu:fb39a09 Wu:fb39a09 Dr.76921 321950 2.404 9.86E-37 wu:fb39d01 Wu:fb39d01 Dr.76365 321959 1.556 3.00E-05 wu:fb39h11 Wu:fb39h11 Dr.121679 321977 1.990 8.07E-11 wu:fb48a08 Wu:fb48a08 Dr.77186 322050 2.927 5.54E-16 wu:fb50g04 Wu:fb50g04 Dr.132290 322124 1.598 2.00E-05 wu:fb50h02 Wu:fb50h02 Dr.104970 322128 2.229 1.76E-09 wu:fb51h06 Wu:fb51h06 Dr.1967 322159 6.025 0.00E+00 wu:fb53e06 Wu:fb53e06 Dr.75169 322218 1.822 5.44E-09 wu:fb54d07 Wu:fb54d07 Dr.33295 322245 2.116 6.00E-05 wu:fb55g09 Wu:fb55g09 Dr.76976 322290 1.553 2.68E-17 wu:fb57b02 Wu:fb57b02 Dr.4216 322299 2.323 2.00E-05 wu:fb57b08 Wu:fb57b08 Dr.23720 322301 1.695 4.73E-07 wu:fb57f08 Wu:fb57f08 Dr.23725 322318 2.932 2.00E-05 10.124 7.35E-07 30.249 6.75E-39 64.359 1.64E-14 wu:fb58f04 Wu:fb58f04 Dr.132301 322344 4.793 1.32E-12 4.021 1.09E-09 wu:fb60a10 Wu:fb60a10 Dr.13867 322403 3.309 0.00E+00 wu:fb60c02 Wu:fb60c02 Dr.77169 322409 2.700 1.88E-11 2.978 4.00E-05 3.106 1.34E-20 5.990 4.79E-10 7.115 4.28E-10 wu:fb60g12 Wu:fb60g12 Dr.77226 322426 2.951 1.29E-06 wu:fb61e06 Wu:fb61e06 Dr.77125 322446 2.322 2.69E-18 2.248 3.32E-19 wu:fb63d05 Wu:fb63d05 Dr.132313 322510 6.181 5.06E-16 2.120 3.77E-07 3.868 3.03E-10 4.305 2.62E-13 4.506 1.67E-06 wu:fb64e03 Wu:fb64e03 Dr.76413 322540 1.811 2.30E-07 1.636 1.37E-26 3.093 7.00E-20 wu:fb66c11 Wu:fb66c11 Dr.105221 322582 11.395 6.45E-11 6.207 1.38E-08 11.361 2.30E-07 9.959 4.00E-05 wu:fb66d05 Wu:fb66d05 Dr.4955 322585 3.366 4.64E-34 wu:fb66f11 Wu:fb66f11 Dr.77427 322595 1.715 7.96E-07 2.019 8.17E-06 wu:fb66g10 Wu:fb66g10 Dr.77135 322601 3.121 5.53E-28 wu:fb69e09 Wu:fb69e09 Dr.74230 322663 5.028 1.09E-26 wu:fb70a09 Wu:fb70a09 Dr.107277 322678 2.846 3.30E-33 wu:fb71a06 Wu:fb71a06 Dr.116172 322700 8.398 7.18E-39 wu:fb71g04 Wu:fb71g04 Dr.461 322720 1.947 1.68E-09 wu:fb72c11 Wu:fb72c11 Dr.75160 322739 2.971 3.00E-05 3.394 1.94E-08 2.895 2.00E-05 wu:fb72c11 Wu:fb72c11 Dr.129593 322739 2.526 1.33E-11 2.584 3.82E-12 wu:fb73f07 Wu:fb73f07 Dr.39150 322800 2.736 2.34E-33 wu:fb74c10 Wu:fb74c10 Dr.2492 322824 2.225 7.90E-06 wu:fb74g08 Wu:fb74g08 Dr.105194 322844 1.863 1.99E-11 1.578 3.00E-05 2.113 1.84E-07 wu:fb75f03 Wu:fb75f03 Dr.77249 322875 1.901 1.50E-40 wu:fb76h05 Wu:fb76h05 Dr.53013 322916 1.876 0.00E+00 wu:fb76h05 Wu:fb76h05 Dr.107363 322916 1.996 4.47E-13 wu:fb77b09 Wu:fb77b09 Dr.77283 322929 1.835 4.23E-08 wu:fb77c03 Wu:fb77c03 Dr.40309 322933 2.392 2.71E-30 wu:fb77f12 Wu:fb77f12 Dr.77289 322955 1.626 1.71E-09 wu:fb78d08 Wu:fb78d08 Dr.25218 322990 1.785 1.27E-12 wu:fb79e06 Wu:fb79e06 Dr.39734 323032 1.663 5.00E-05 2.064 1.67E-26 wu:fb79h11 Wu:fb79h11 Dr.77499 323044 1.525 2.77E-06 wu:fb80f02 Wu:fb80f02 Dr.77380 323066 4.777 9.87E-08 4.151 7.61E-07 wu:fb81c07 Wu:fb81c07 Dr.75682 323088 1.548 3.85E-06 1.842 2.19E-15 wu:fb81e09 Wu:fb81e09 Dr.77406 323095 2.109 8.98E-08 wu:fb81e12 Wu:fb81e12 Dr.77408 323096 1.625 8.59E-06 wu:fb82a05 Wu:fb82a05 Dr.77549 323109 2.835 2.48E-13 wu:fb82f02 Wu:fb82f02 Dr.77556 323126 1.874 1.68E-16 wu:fb82f05 Wu:fb82f05 Dr.26261 323127 2.899 2.75E-06 wu:fb82f07 Wu:fb82f07 Dr.77558 323128 4.254 2.99E-10 wu:fb82f09 Wu:fb82f09 Dr.77559 323130 1.548 3.27E-06 1.965 5.44E-09 wu:fb82g11 Wu:fb82g11 Dr.21167 323136 1.552 3.40E-06 wu:fb82h02 Wu:fb82h02 Dr.21169 323139 2.367 2.91E-09 wu:fb83a05 Wu:fb83a05 Dr.3662 323144 1.708 2.28E-07 wu:fb83b10 Wu:fb83b10 Dr.74022 323150 3.766 0.00E+00 wu:fb92a07 Wu:fb92a07 Dr.54126 323184 2.162 2.02E-24 wu:fb92f04 Wu:fb92f04 Dr.21193 323215 2.202 5.00E-05 2.624 2.44E-07 wu:fb94e12 Wu:fb94e12 Dr.21224 323301 1.784 2.25E-13 1.743 4.90E-13 1.687 1.00E-18 wu:fb97g01 Wu:fb97g01 Dr.77734 323413 2.106 4.00E-05 wu:fb97g08 Wu:fb97g08 Dr.121803 323416 1.788 1.55E-12 wu:fb98c10 Wu:fb98c10 Dr.77747 323431 2.331 2.71E-08 wu:fb99g10 Wu:fb99g10 Dr.77790 323495 1.608 7.00E-05 wu:fb99h02 Wu:fb99h02 Dr.77792 323497 1.539 9.00E-05 wu:fc01a02 Wu:fc01a02 Dr.77797 323504 1.759 9.48E-11 wu:fc01f10 Wu:fc01f10 Dr.135376 323526 6.738 9.70E-07 5.313 1.00E-05 wu:fc02a12 Wu:fc02a12 Dr.77825 323536 2.591 1.15E-14 wu:fc02a12 Wu:fc02a12 Dr.107657 323536 3.898 5.23E-13 wu:fc02d02 Wu:fc02d02 Dr.122760 323547 2.061 1.57E-12 wu:fc02e08 Wu:fc02e08 Dr.38295 323552 3.203 1.11E-34 wu:fc02h06 Wu:fc02h06 Dr.77844 323564 2.236 1.44E-17 wu:fc04b03 Wu:fc04b03 Dr.78003 323592 2.360 3.00E-05 2.985 2.52E-09 wu:fc04g08 Wu:fc04g08 Dr.120412 323608 2.124 1.44E-19 wu:fc06e12 Wu:fc06e12 Dr.27420 323668 1.739 1.31E-11 wu:fc07b07 Wu:fc07b07 Dr.77935 323690 1.689 1.00E-05 1.864 5.25E-06 wu:fc07b09 Wu:fc07b09 Dr.104714 323691 1.584 5.00E-05 wu:fc08e01 Wu:fc08e01 Dr.105450 323740 1.746 7.00E-05 wu:fc09d04 Wu:fc09d04 Dr.77889 323761 2.429 1.97E-25 wu:fc09e12 Wu:fc09e12 Dr.51867 323770 1.713 4.00E-05 2.842 8.69E-08 wu:fc10e04 Wu:fc10e04 Dr.74588 323803 1.560 7.56E-07 wu:fc10e09 Wu:fc10e09 Dr.2117 323804 1.736 2.77E-24 wu:fc10e09 Wu:fc10e09 Dr.132581 323804 1.770 5.09E-06 wu:fc11c01 Wu:fc11c01 Dr.21327 323828 1.790 2.63E-19 wu:fc11d12 Wu:fc11d12 Dr.132393 323842 1.525 9.72E-08 wu:fc12a05 Wu:fc12a05 Dr.78025 323853 1.572 3.58E-08 wu:fc14a04 Wu:fc14a04 Dr.22881 323913 1.691 8.25E-12 1.626 2.36E-09 wu:fc14a08 Wu:fc14a08 Dr.26777 323915 1.540 4.00E-05 wu:fc14a10 Wu:fc14a10 Dr.118157 323917 1.891 6.00E-05 16.974 0.00E+00 wu:fc14f09 Wu:fc14f09 Dr.105655 323938 1.836 2.00E-06 1.588 2.70E-07 wu:fc14h11 Wu:fc14h11 Dr.75449 323945 1.532 5.43E-07 wu:fc15d04 Wu:fc15d04 Dr.33055 323958 1.504 2.71E-08 wu:fc15e02 Wu:fc15e02 Dr.78430 323961 1.820 4.17E-07 3.898 8.85E-22 wu:fc15g09 Wu:fc15g09 Dr.141526 323971 2.236 7.07E-13 wu:fc16a03 Wu:fc16a03 Dr.132893 323979 2.455 4.54E-14 wu:fc16b12 Wu:fc16b12 Dr.22265 323989 2.056 1.93E-09 wu:fc17a11 Wu:fc17a11 Dr.105522 324025 2.599 1.70E-28 wu:fc17c08 Wu:fc17c08 Dr.33005 324032 2.190 9.90E-30 wu:fc17e03 Wu:fc17e03 Dr.78464 324043 2.551 1.79E-24 wu:fc17f11 Wu:fc17f11 Dr.123008 324054 1.573 2.25E-14 wu:fc17g08 Wu:fc17g08 Dr.132895 324061 1.953 7.02E-06 wu:fc17h04 Wu:fc17h04 Dr.122420 324068 1.624 3.00E-05 wu:fc19f02 Wu:fc19f02 Dr.78461 324127 1.754 6.56E-09 wu:fc20c08 Wu:fc20c08 Dr.22852 324150 2.258 3.39E-13 wu:fc20g06 Wu:fc20g06 Dr.2805 324163 2.755 3.26E-21 2.883 1.44E-26 wu:fc21e07 Wu:fc21e07 Dr.22874 324197 2.404 0.00E+00 wu:fc21h03 Wu:fc21h03 Dr.105703 324214 1.923 6.42E-08 wu:fc22a10 Wu:fc22a10 Dr.78495 324222 1.656 1.16E-08 2.028 1.96E-33 wu:fc22a11 Wu:fc22a11 Dr.78496 324223 3.222 2.65E-07 wu:fc22b06 Wu:fc22b06 Dr.104555 324227 2.176 4.25E-16 wu:fc23d01 Wu:fc23d01 Dr.22938 324271 2.022 8.48E-09 2.573 1.81E-15 wu:fc23d08 Wu:fc23d08 Dr.22939 324276 2.239 5.01E-07 wu:fc23f06 Wu:fc23f06 Dr.15418 324283 1.576 3.19E-08 1.772 7.51E-13 wu:fc25c08 Wu:fc25c08 Dr.21601 324310 1.883 2.26E-17 wu:fc25e01 Wu:fc25e01 Dr.78816 324318 2.287 1.87E-06 wu:fc25e04 Wu:fc25e04 Dr.21605 324319 1.583 1.39E-12 2.641 2.88E-19 wu:fc26g10 Wu:fc26g10 Dr.121893 324369 2.440 3.09E-12 wu:fc27b12 Wu:fc27b12 Dr.35817 324380 3.876 1.09E-12 3.797 4.12E-12 wu:fc27e05 Wu:fc27e05 Dr.9728 324392 1.721 3.12E-19 wu:fc29f06 Wu:fc29f06 Dr.105810 324451 1.540 1.86E-08 wu:fc29f08 Wu:fc29f08 Dr.78751 324453 2.094 4.54E-08 wu:fc31b05 Wu:fc31b05 Dr.78780 324505 2.079 4.84E-08 wu:fc31g04 Wu:fc31g04 Dr.38944 324528 2.245 2.24E-08 wu:fc32b07 Wu:fc32b07 Dr.27493 324543 1.675 5.33E-10 wu:fc32g11 Wu:fc32g11 Dr.57833 324558 1.915 2.59E-23 wu:fc34e06 Wu:fc34e06 Dr.76401 324610 1.750 3.82E-11 wu:fc35a10 Wu:fc35a10 Dr.5234 324618 1.938 3.16E-06 wu:fc37g06 Wu:fc37g06 Dr.21483 324668 1.671 2.00E-05 wu:fc38b05 Wu:fc38b05 Dr.78588 324684 5.409 8.42E-09 wu:fc38e07 Wu:fc38e07 Dr.36513 386883 2.747 9.33E-16 wu:fc38f09 Wu:fc38f09 Dr.130445 324702 1.967 3.14E-17 wu:fc38g12 Wu:fc38g12 Dr.79079 324708 2.659 1.55E-21 wu:fc41b02 Wu:fc41b02 Dr.76119 324748 2.047 8.93E-18 wu:fc41f10 Wu:fc41f10 Dr.75531 324768 1.634 6.64E-07 wu:fc44a11 Wu:fc44a11 Dr.76739 324811 2.881 7.23E-28 wu:fc44e02 Wu:fc44e02 Dr.79112 324828 2.826 4.41E-18 2.379 2.65E-10 wu:fc46a02 Wu:fc46a02 Dr.79391 324870 2.611 8.23E-19 2.827 4.83E-18 wu:fc46b01 Wu:fc46b01 Dr.75467 324873 1.807 6.15E-12 wu:fc46c11 Wu:fc46c11 Dr.121987 324877 1.585 1.89E-07 1.663 8.45E-17 wu:fc46e05 Wu:fc46e05 Dr.79133 324881 2.122 7.82E-09 wu:fc46g07 Wu:fc46g07 Dr.121991 386991 2.547 1.39E-06 wu:fc48h01 Wu:fc48h01 Dr.3875 324938 1.715 1.66E-07 wu:fc49d01 Wu:fc49d01 Dr.10914 324954 2.138 1.27E-07 1.672 5.00E-05 2.999 1.07E-06 24.499 0.00E+00 wu:fc50f07 Wu:fc50f07 Dr.132531 324990 2.805 0.00E+00 wu:fc50f07 Wu:fc50f07 Dr.86277 324990 3.853 6.11E-42 wu:fc51a09 Wu:fc51a09 Dr.78976 324996 1.925 3.26E-16 wu:fc51b07 Wu:fc51b07 Dr.78979 325002 1.583 1.57E-07 wu:fc51c08 Wu:fc51c08 Dr.132533 325007 1.683 7.12E-06 wu:fc51c12 Wu:fc51c12 Dr.76205 325009 1.727 7.99E-41 wu:fc51c12 Wu:fc51c12 Dr.121141 325009 2.125 2.00E-05 wu:fc51f03 Wu:fc51f03 Dr.78985 325018 1.771 1.87E-20 1.823 1.89E-19 3.803 4.09E-32 wu:fc51h09 Wu:fc51h09 Dr.78993 325029 2.236 0.00E+00 wu:fc52f08 Wu:fc52f08 Dr.38192 325047 1.888 1.81E-08 wu:fc54b08 Wu:fc54b08 Dr.79013 325063 2.521 3.50E-16 2.084 1.98E-06 1.959 4.63E-09 wu:fc54d07 Wu:fc54d07 Dr.52859 325076 1.899 9.79E-09 wu:fc54g06 Wu:fc54g06 Dr.78101 325086 2.032 3.34E-07 1.798 3.29E-06 wu:fc55a06 Wu:fc55a06 Dr.3915 325091 2.486 4.95E-06 2.498 2.00E-05 wu:fc55e03 Wu:fc55e03 Dr.79031 325104 2.269 3.59E-17 wu:fc55f12 Wu:fc55f12 Dr.79034 325111 1.500 4.00E-05 wu:fc55g06 Wu:fc55g06 Dr.79035 325115 2.912 2.07E-13 2.733 1.02E-10 wu:fc58a04 Wu:fc58a04 Dr.121953 325179 1.730 4.62E-20 wu:fc59e04 Wu:fc59e04 Dr.121957 325206 2.612 2.53E-28 wu:fc59e05 Wu:fc59e05 Dr.79223 325207 1.636 8.00E-05 wu:fc62b10 Wu:fc62b10 Dr.115771 325250 1.903 8.33E-16 wu:fc66a05 Wu:fc66a05 Dr.132549 325305 1.669 2.51E-16 wu:fc66g05 Wu:fc66g05 Dr.72357 325325 2.671 5.56E-18 wu:fc66g09 Wu:fc66g09 Dr.32530 325327 1.552 1.71E-16 wu:fc67h08 Wu:fc67h08 Dr.53929 325345 2.620 5.27E-08 wu:fc68e03 Wu:fc68e03 Dr.79354 325354 2.648 4.44E-11 wu:fc70h07 Wu:fc70h07 Dr.76504 325376 2.220 1.24E-10 1.957 3.69E-07 wu:fc74a06 Wu:fc74a06 Dr.78055 325391 1.657 2.90E-09 wu:fc74e04 Wu:fc74e04 Dr.77547 325404 1.651 2.28E-08 9.159 0.00E+00 wu:fc75h04 Wu:fc75h04 Dr.45814 325424 2.083 2.40E-09 wu:fc76c11 Wu:fc76c11 Dr.27582 325434 2.018 7.46E-19 1.988 4.08E-23 wu:fc79b02 Wu:fc79b02 Dr.3325 325456 2.981 1.03E-17 2.814 2.54E-16 wu:fc83a09 Wu:fc83a09 Dr.79472 325480 1.612 7.00E-05 2.158 2.18E-22 wu:fc83f05 Wu:fc83f05 Dr.79478 325498 6.625 8.06E-07 wu:fc84a08 Wu:fc84a08 Dr.79489 325512 10.053 1.88E-21 wu:fc84b12 Wu:fc84b12 Dr.106235 325517 1.959 6.00E-05 wu:fc84c07 Wu:fc84c07 Dr.108582 325519 2.864 6.00E-05 2.733 1.00E-05 wu:fc85d06 Wu:fc85d06 Dr.77570 325539 1.702 1.04E-08 wu:fc89a04 Wu:fc89a04 Dr.79591 325575 1.600 4.56E-11 1.955 0.00E+00 wu:fc89f07 Wu:fc89f07 Dr.79597 325583 1.819 2.17E-14 wu:fc91a05 Wu:fc91a05 Dr.106263 325603 4.728 9.66E-08 wu:fc93b03 Wu:fc93b03 Dr.15376 325620 1.680 5.77E-07 wu:fd02c11 Wu:fd02c11 Dr.79060 325683 8.574 0.00E+00 wu:fd05h06 Wu:fd05h06 Dr.77180 386811 2.388 1.07E-10 wu:fd10a10 Wu:fd10a10 Dr.4005 325758 2.562 5.22E-12 2.870 6.76E-14 wu:fd11a11 Wu:fd11a11 Dr.79705 325772 1.597 2.71E-07 wu:fd11d10 Wu:fd11d10 Dr.79713 325782 3.391 1.57E-11 2.733 1.50E-18 wu:fd12e04 Wu:fd12e04 Dr.22083 325811 2.833 3.18E-43 wu:fd18g06 Wu:fd18g06 Dr.75970 327229 1.963 3.08E-44 wu:fd20c02 Wu:fd20c02 Dr.78698 327280 3.462 9.08E-06 wu:fd20c05 Wu:fd20c05 Dr.78700 327281 1.737 2.00E-09 wu:fd36h06 Wu:fd36h06 Dr.79872 325877 2.275 5.66E-10 1.970 8.00E-05 1.973 3.02E-11 wu:fd42f04 Wu:fd42f04 Dr.106615 325883 2.852 7.00E-05 wu:fd44f11 Wu:fd44f11 Dr.9988 325909 2.075 2.60E-08 wu:fd46h01 Wu:fd46h01 Dr.80066 325929 2.316 2.10E-19 wu:fd47h11 Wu:fd47h11 Dr.79961 325937 1.504 1.19E-07 wu:fd50h12 Wu:fd50h12 Dr.79973 325953 1.641 7.96E-10 wu:fd51h11 Wu:fd51h11 Dr.105888 325964 1.647 1.76E-06 wu:fd56c02 Wu:fd56c02 Dr.80055 325999 1.940 2.34E-15 wu:fd57b02 Wu:fd57b02 Dr.80070 326014 1.946 6.08E-24 wu:fd58b05 Wu:fd58b05 Dr.94688 326021 1.584 4.68E-07 wu:fd58f02 Wu:fd58f02 Dr.32680 326027 1.545 7.70E-11 wu:fd61c04 Wu:fd61c04 Dr.113440 326081 9.793 3.00E-05 wu:fe01a07 Wu:fe01a07 Dr.80626 326635 2.930 1.21E-13 3.326 3.48E-13 wu:fe05h01 Wu:fe05h01 Dr.43988 326696 2.150 4.81E-20 wu:fe06f11 Wu:fe06f11 Dr.79176 326714 1.513 7.00E-05 wu:fe11b02 Wu:fe11b02 Dr.79981 326722 13.832 2.70E-20 wu:fe11c03 Wu:fe11c03 Dr.79983 326726 1.647 4.00E-05 wu:fe11d05 Wu:fe11d05 Dr.106465 326730 1.915 2.80E-07 wu:fe11g10 Wu:fe11g10 Dr.79993 326739 2.482 6.68E-20 2.458 2.65E-19 wu:fe14d02 Wu:fe14d02 Dr.80113 326751 1.546 3.12E-13 wu:fe16a10 Wu:fe16a10 Dr.106017 326768 1.806 5.34E-06 wu:fe16c03 Wu:fe16c03 Dr.106191 326770 1.508 4.73E-08 1.650 5.00E-05 wu:fe16c11 Wu:fe16c11 Dr.122189 326772 1.956 9.42E-23 1.833 1.38E-18 2.789 1.00E-05 wu:fe18c06 Wu:fe18c06 Dr.76658 326796 1.787 3.76E-11 wu:fe18c08 Wu:fe18c08 Dr.106709 326797 3.487 4.68E-29 wu:fe24a06 Wu:fe24a06 Dr.132679 326807 3.195 7.46E-08 4.087 2.00E-05 wu:fe25c11 Wu:fe25c11 Dr.106131 326821 3.002 2.93E-37 wu:fe26f02 Wu:fe26f02 Dr.5843 326838 1.944 1.37E-13 wu:fe36d04 Wu:fe36d04 Dr.106714 326853 4.447 1.69E-09 wu:fe38b01 Wu:fe38b01 Dr.132306 326880 3.460 0.00E+00 wu:fe38g07 Wu:fe38g07 Dr.140598 326889 2.587 0.00E+00 wu:fe47a12 Wu:fe47a12 Dr.76804 326892 2.049 3.38E-14 2.093 0.00E+00 wu:fe49g02 Wu:fe49g02 Dr.22281 326925 2.001 5.00E-05 wu:fe50f06 Wu:fe50f06 Dr.79692 326939 1.783 1.01E-09 wu:fi03f09 Wu:fi03f09 Dr.106635 327340 2.968 1.31E-11 wu:fi04f09 Wu:fi04f09 Dr.80340 327366 6.346 0.00E+00 wu:fi06d09 Wu:fi06d09 Dr.132729 327409 1.566 2.42E-12 2.779 2.20E-21 wu:fi12h09 Wu:fi12h09 Dr.122177 327466 1.521 5.34E-11 wu:fi15d04 Wu:fi15d04 Dr.79942 327519 1.823 8.00E-05 wu:fi15h08 Wu:fi15h08 Dr.106676 327532 1.697 5.26E-06 wu:fi17a03 Wu:fi17a03 Dr.127965 327550 2.800 2.46E-28 wu:fi23e07 Wu:fi23e07 Dr.80556 333962 4.586 2.00E-05 wu:fi26c04 Wu:fi26c04 Dr.76646 334003 1.975 2.59E-25 wu:fi27c11 Wu:fi27c11 Dr.80587 334024 1.799 1.80E-23 wu:fi29f12 Wu:fi29f12 Dr.122229 334068 2.079 1.56E-22 wu:fi30c07 Wu:fi30c07 Dr.104447 334078 2.863 1.94E-19 wu:fi32b04 Wu:fi32b04 Dr.132168 334117 1.715 1.00E-05 2.023 1.05E-09 wu:fi32b04 Wu:fi32b04 Dr.75440 334117 2.929 0.00E+00 wu:fi35e03 Wu:fi35e03 Dr.39091 334196 1.787 6.82E-08 wu:fi36g12 Wu:fi36g12 Dr.80708 334220 6.769 3.01E-22 3.217 1.53E-07 wu:fi37b05 Wu:fi37b05 Dr.7324 334231 2.638 1.00E-05 wu:fi38a11 Wu:fi38a11 Dr.20697 334257 1.713 4.47E-06 6.807 2.05E-10 5.034 3.60E-16 wu:fi38b05 Wu:fi38b05 Dr.75367 334258 1.677 9.73E-06 wu:fi40d02 Wu:fi40d02 Dr.140094 334318 1.941 4.28E-07 wu:fi40f02 Wu:fi40f02 Dr.132661 334324 2.421 1.91E-23 wu:fi41c08 Wu:fi41c08 Dr.132496 334333 1.884 3.77E-11 wu:fi42c05 Wu:fi42c05 Dr.37483 334348 2.801 3.75E-21 wu:fi72h12 Wu:fi72h12 Dr.43915 334455 1.887 7.87E-25 wu:fj01a12 Wu:fj01a12 Dr.80190 335318 1.960 6.16E-31 wu:fj05c06 Wu:fj05c06 Dr.80727 335354 1.657 8.34E-07 2.386 7.30E-18 wu:fj05f01 Wu:fj05f01 Dr.6703 335361 1.954 9.00E-17 wu:fj05f05 Wu:fj05f05 Dr.80731 335362 3.524 8.84E-08 10.043 4.90E-06 wu:fj07d01 Wu:fj07d01 Dr.80306 335373 1.962 3.67E-11 wu:fj08d01 Wu:fj08d01 Dr.80874 335387 2.842 6.00E-05 wu:fj08f02 Wu:fj08f02 Dr.43229 335391 4.688 0.00E+00 wu:fj10e08 Wu:fj10e08 Dr.6709 335420 1.883 3.66E-16 13.479 1.18E-40 wu:fj14f03 Wu:fj14f03 Dr.132807 335460 1.780 1.52E-24 1.844 6.50E-10 wu:fj14g08 Wu:fj14g08 Dr.43244 335462 1.881 9.37E-07 wu:fj15c09 Wu:fj15c09 Dr.122302 335468 2.519 2.78E-34 wu:fj19a05 Wu:fj19a05 Dr.22588 335520 1.737 5.14E-09 wu:fj20h02 Wu:fj20h02 Dr.80919 335544 3.415 8.08E-17 wu:fj20h08 Wu:fj20h08 Dr.122319 335545 4.398 1.00E-05 4.229 4.83E-19 6.303 5.21E-15 15.556 1.40E-45 wu:fj21g01 Wu:fj21g01 Dr.74624 335556 2.410 1.45E-07 wu:fj23a05 Wu:fj23a05 Dr.80855 335583 1.747 8.68E-06 3.515 3.19E-21 wu:fj23b10 Wu:fj23b10 Dr.79319 335586 1.945 1.39E-29 wu:fj29h10 Wu:fj29h10 Dr.79667 335617 2.501 2.49E-14 2.638 4.38E-15 wu:fj30a12 Wu:fj30a12 Dr.80946 335619 1.689 7.00E-05 5.308 0.00E+00 wu:fj32a06 Wu:fj32a06 Dr.28387 335633 1.537 8.90E-20 wu:fj33b10 Wu:fj33b10 Dr.6315 335802 1.762 1.43E-06 wu:fj34a03 Wu:fj34a03 Dr.6319 335827 2.752 0.00E+00 wu:fj40g04 Wu:fj40g04 Dr.81043 335970 4.974 0.00E+00 wu:fj43a09 Wu:fj43a09 Dr.81055 336009 2.803 3.00E-05 wu:fj48a06 Wu:fj48a06 Dr.76584 336088 1.829 1.00E-05 1.846 7.50E-07 wu:fj49c01 Wu:fj49c01 Dr.76105 336116 1.656 1.96E-06 1.667 3.08E-06 wu:fj49c03 Wu:fj49c03 Dr.81095 336117 3.066 8.52E-30 wu:fj49g09 Wu:fj49g09 Dr.81099 336128 1.573 3.00E-05 wu:fj53e10 Wu:fj53e10 Dr.80301 336172 1.737 8.29E-09 2.771 2.42E-06 1.702 0.00E+00 2.408 6.32E-15 10.592 1.84E-27 wu:fj54e10 Wu:fj54e10 Dr.43382 336185 1.960 1.28E-14 wu:fj58c09 Wu:fj58c09 Dr.107117 336232 1.698 1.79E-08 wu:fj61b10 Wu:fj61b10 Dr.81244 336280 2.064 7.17E-06 wu:fj62d01 Wu:fj62d01 Dr.132859 336300 1.582 6.00E-05 6.521 0.00E+00 wu:fj62g02 Wu:fj62g02 Dr.81251 336305 2.668 1.37E-09 2.350 1.16E-07 wu:fj65h10 Wu:fj65h10 Dr.106582 337391 3.318 9.99E-16 wu:fj66h07 Wu:fj66h07 Dr.1574 337418 2.149 6.79E-13 wu:fj67d03 Wu:fj67d03 Dr.132704 337431 2.129 5.00E-05 2.117 4.00E-05 wu:fj67h12 Wu:fj67h12 Dr.7234 337451 1.704 4.00E-05 wu:fj68e01 Wu:fj68e01 Dr.39753 337462 1.891 1.37E-08 wu:fj78e01 Wu:fj78e01 Dr.114483 337490 1.921 4.48E-23 wu:fj81e05 Wu:fj81e05 Dr.118658 337531 1.572 1.70E-09 wu:fj81e10 Wu:fj81e10 Dr.79927 337532 1.613 4.70E-07 wu:fj81f10 Wu:fj81f10 Dr.30882 337534 3.145 2.42E-43 wu:fj81h04 Wu:fj81h04 Dr.81511 337539 1.685 3.93E-17 wu:fj83f12 Wu:fj83f12 Dr.5370 386812 1.998 5.07E-21 wu:fj84d07 Wu:fj84d07 Dr.66177 337573 2.205 2.81E-36 wu:fj84f01 Wu:fj84f01 Dr.81535 337578 2.136 4.00E-05 2.625 1.22E-10 wu:fj84g06 Wu:fj84g06 Dr.81536 337579 2.075 3.93E-16 wu:fj85b02 Wu:fj85b02 Dr.81541 337585 2.660 3.49E-07 4.510 8.49E-17 wu:fj85h12 Wu:fj85h12 Dr.81581 337599 1.535 5.75E-07 wu:fj86d12 Wu:fj86d12 Dr.122466 337604 1.877 4.00E-05 wu:fj86g03 Wu:fj86g03 Dr.132921 337607 1.678 4.00E-05 2.285 2.57E-30 wu:fj90d02 Wu:fj90d02 Dr.81590 337641 9.645 0.00E+00 wu:fk14g08 Wu:fk14g08 Dr.81512 337300 3.453 4.05E-34 3.722 2.49E-17 1.790 1.74E-07 7.209 1.18E-08 35.019 0.00E+00 wu:fk30f11 Wu:fk30f11 Dr.80135 336934 2.048 3.79E-13 wu:fk31a07 Wu:fk31a07 Dr.23104 336938 1.665 3.42E-10 1.881 1.94E-08 1.656 7.11E-09 2.065 9.28E-06 2.185 2.29E-11 2.261 1.05E-12 wu:fk33d07 Wu:fk33d07 Dr.76944 336954 1.666 7.27E-11 wu:fk35f04 Wu:fk35f04 Dr.76616 386925 1.737 9.01E-06 15.293 0.00E+00 wu:fk36h04 Wu:fk36h04 Dr.23134 336972 1.770 4.00E-05 1.688 1.95E-07 wu:fk48e08 Wu:fk48e08 Dr.79162 334673 1.969 3.74E-18 wu:fk50g02 Wu:fk50g02 Dr.81894 334686 2.432 1.78E-14 wu:fk57d06 Wu:fk57d06 Dr.132976 335695 1.622 6.59E-06 wu:fk58a07 Wu:fk58a07 Dr.27905 335703 1.587 7.00E-05 wu:fk66c02 Wu:fk66c02 Dr.132987 335089 1.932 1.43E-31 wu:fk81c02 Wu:fk81c02 Dr.82060 335157 2.557 4.60E-09 8.388 6.98E-25 7.454 3.99E-08 wu:fk86b08 Wu:fk86b08 Dr.24158 335187 8.043 0.00E+00 wu:fk89f01 Wu:fk89f01 Dr.691 335212 1.903 5.00E-05 wu:fk91e06 Wu:fk91e06 Dr.82105 335225 2.743 1.90E-11 wu:fk92c07 Wu:fk92c07 Dr.69803 335227 2.327 2.01E-11 wu:fl03b09 Wu:fl03b09 Dr.10410 335267 2.580 0.00E+00 1.888 2.41E-17 1.856 3.13E-08 2.495 0.00E+00 2.043 2.13E-35 4.533 0.00E+00 11.744 0.00E+00 wu:fl03e01 Wu:fl03e01 Dr.82179 335270 2.027 5.00E-05 wu:fl05f04 Wu:fl05f04 Dr.82190 335278 6.788 0.00E+00 wu:fl22g01 Wu:fl22g01 Dr.107611 335303 2.216 2.99E-23 wu:fl23c11 Wu:fl23c11 Dr.82303 335307 1.843 3.65E-06 wu:fl24d12 Wu:fl24d12 Dr.133019 335311 2.774 1.07E-23 wu:fm82b06 Wu:fm82b06 Dr.122949 337686 5.500 1.06E-07 4.770 1.69E-06 wu:fp02c03 Wu:fp02c03 Dr.67618 337694 1.548 2.87E-17 wu:fp56f09 Wu:fp56f09 Dr.122259 337698 4.897 1.52E-09 4.527 2.60E-08 wu:fq77h11 Wu:fq77h11 Dr.108155 503777 2.571 2.00E-05 2.398 2.00E-05 wu:fr13b05 Wu:fr13b05 Dr.78340 503810 3.253 8.19E-18 WW domain containing wwox Dr.81193 393887 1.930 6.27E-12 oxidoreductase xbp1 X-box binding protein 1 Dr.76130 140614 1.978 3.99E-28 X-prolyl aminopeptidase xpnpep1 Dr.75352 406253 1.922 2.34E-14 (aminopeptidase P) 1, soluble xpo6 Exportin 6 Dr.78887 333980 1.811 1.75E-12 X-ray repair complementing xrcc4 defective repair in Chinese hamster Dr.83748 393759 3.931 3.26E-06 cells 4 yars Tyrosyl-tRNA synthetase Dr.81609 368235 4.206 0.00E+00 yipf1 Yip1 domain family, member 1 Dr.18679 445484 1.811 1.65E-07 ythdf1 YTH domain family, member 1 Dr.3039 327606 1.937 4.98E-07 3-monooxygenase/tryptophan 5- ywhag1 monooxygenase activation protein, Dr.107091 117604 2.261 1.32E-11 gamma polypeptide 1 Zinc finger and BTB domain zbtb48 Dr.72135 325725 1.740 1.00E-05 1.824 1.86E-06 containing 48 Zinc finger and BTB domain zbtb8os Dr.10898 550382 2.795 1.28E-14 containing 8 opposite strand Zinc finger, CCHC domain zcchc10 Dr.80591 334240 2.036 4.56E-36 1.603 4.00E-05 1.726 9.28E-15 containing 10 Zinc finger, CCHC domain zcchc9 Dr.79609 386639 2.203 2.11E-35 containing 9 Zinc finger, DHHC domain zdhhc16 Dr.26719 394017 1.741 2.39E-18 containing 16 Zinc finger, DHHC-type containing zdhhc23 Dr.83252 445301 2.196 8.00E-05 2.712 1.64E-11 23 zfand5a Zinc finger, AN1-type domain 5a Dr.3123 406312 1.595 1.21E-14
Zinc finger protein 36, C3H type- zfp36l1 Dr.31482 321273 1.924 9.00E-05 2.380 0.00E+00 like 1 Zinc finger protein 36, C3H type- zfp36l1 Dr.105582 321273 2.069 1.99E-13 2.043 4.62E-12 like 1 zgc:100789 Zgc:100789 Dr.34241 445493 1.913 1.15E-15 zgc:100804 Zgc:100804 Dr.76643 445252 1.711 5.18E-14 zgc:100829 Zgc:100829 Dr.9484 445149 1.686 2.72E-11 zgc:100849 Zgc:100849 Dr.77914 445144 2.272 2.78E-10 zgc:100897 Zgc:100897 Dr.23554 445297 2.761 1.69E-31 3.099 4.07E-34 zgc:100900 Zgc:100900 Dr.77429 445127 3.084 1.90E-27 zgc:100914 Zgc:100914 Dr.85875 445245 3.771 5.75E-19 zgc:100919 Zgc:100919 Dr.77360 437021 7.703 0.00E+00 zgc:100952 Zgc:100952 Dr.114908 445324 1.975 2.02E-17 zgc:100959 Zgc:100959 Dr.106411 445225 1.600 2.01E-10 3.930 0.00E+00 zgc:100975 Zgc:100975 Dr.89049 445320 1.716 4.91E-33 zgc:100982 Zgc:100982 Dr.84694 445319 1.761 8.91E-07 zgc:101015 Zgc:101015 Dr.85594 445498 1.574 2.19E-06 zgc:101016 Zgc:101016 Dr.34238 445497 1.815 1.87E-40 zgc:101047 Zgc:101047 Dr.3019 445189 4.259 0.00E+00 zgc:101100 Zgc:101100 Dr.90945 445169 1.501 4.97E-14 zgc:101111 Zgc:101111 Dr.107433 445167 1.582 1.90E-07 zgc:101113 Zgc:101113 Dr.80746 445166 2.682 0.00E+00 zgc:101121 Zgc:101121 Dr.4742 336461 1.535 6.19E-40 zgc:101122 Zgc:101122 Dr.78016 445162 1.738 1.21E-08 zgc:101560 Zgc:101560 Dr.34284 449825 1.622 5.65E-06 zgc:101561 Zgc:101561 Dr.86300 492775 1.772 3.00E-05 zgc:101562 Zgc:101562 Dr.85447 449824 1.852 7.57E-10 zgc:101574 Zgc:101574 Dr.88110 450084 2.160 2.02E-35 zgc:101594 Zgc:101594 Dr.36517 447901 4.863 0.00E+00 zgc:101609 Zgc:101609 Dr.16865 492814 1.616 3.79E-32 zgc:101621 Zgc:101621 Dr.120445 450073 2.066 4.82E-27 zgc:101645 Zgc:101645 Dr.30620 494099 1.592 2.00E-05 zgc:101659 Zgc:101659 Dr.37198 492798 2.510 4.05E-09 zgc:101676 Zgc:101676 Dr.114036 447897 2.298 2.11E-26 zgc:101687 Zgc:101687 Dr.82189 450053 1.513 4.00E-05 2.389 1.92E-18 zgc:101688 Zgc:101688 Dr.82220 494109 3.413 8.43E-07 1.918 6.00E-05 8.939 2.00E-05 15.802 0.00E+00 zgc:101699 Zgc:101699 Dr.115979 492789 3.454 3.00E-05 zgc:101705 Zgc:101705 Dr.34325 450050 2.208 0.00E+00 zgc:101706 Zgc:101706 Dr.86119 492786 1.874 2.00E-05 zgc:101715 Zgc:101715 Dr.36473 447894 1.824 5.95E-08 zgc:101724 Zgc:101724 Dr.78374 334483 1.635 9.68E-06 zgc:101731 Zgc:101731 Dr.81219 447892 2.304 2.30E-12 zgc:101737 Zgc:101737 Dr.91295 492767 1.642 7.21E-32 zgc:101739 Zgc:101739 Dr.80825 447890 3.034 0.00E+00 3.250 2.98E-06 5.648 0.00E+00 8.601 6.51E-12 zgc:101740 Zgc:101740 Dr.88161 447889 10.124 6.24E-22 zgc:101741 Zgc:101741 Dr.84246 492766 2.970 1.05E-10 2.533 4.16E-08 zgc:101746 Zgc:101746 Dr.84306 450040 1.640 2.74E-21 zgc:101757 Zgc:101757 Dr.83264 494083 1.691 2.03E-10 zgc:101776 Zgc:101776 Dr.78866 492763 5.208 2.23E-13 zgc:101789 Zgc:101789 Dr.37136 474324 1.892 4.71E-11 zgc:101791 Zgc:101791 Dr.119134 494080 2.308 2.70E-09 zgc:101794 Zgc:101794 Dr.114873 447881 1.516 2.09E-08 zgc:101801 Zgc:101801 Dr.91108 450031 1.988 1.26E-24 zgc:101803 Zgc:101803 Dr.88420 450030 1.695 6.42E-08 zgc:101811 Zgc:101811 Dr.77501 450028 2.622 1.14E-08 2.111 1.99E-09 2.664 1.72E-07 2.110 8.28E-08 2.459 2.08E-11 6.594 2.91E-33 zgc:101818 Zgc:101818 Dr.117252 494076 2.598 1.50E-14 2.429 3.01E-11 zgc:101827 Zgc:101827 Dr.87643 492513 1.801 1.25E-09 zgc:101851 Zgc:101851 Dr.108187 447937 1.623 2.25E-17 zgc:101853 Zgc:101853 Dr.79673 494049 1.807 1.29E-08 zgc:101855 Zgc:101855 Dr.78542 494048 1.870 2.89E-06 zgc:101886 Zgc:101886 Dr.86897 492502 2.163 3.81E-09 zgc:101894 Zgc:101894 Dr.90415 447933 2.665 5.30E-17 zgc:103407 Zgc:103407 Dr.133305 445564 3.826 5.83E-08 zgc:103418 Zgc:103418 Dr.40045 450024 2.007 1.88E-32 zgc:103419 Zgc:103419 Dr.87001 450023 1.610 3.17E-24 zgc:103425 Zgc:103425 Dr.76528 450020 2.215 2.30E-08 zgc:103426 Zgc:103426 Dr.85262 450019 1.518 2.55E-06 zgc:103433 Zgc:103433 Dr.91379 450017 2.280 3.00E-05 2.201 3.39E-07 zgc:103434 Zgc:103434 Dr.53468 450016 2.344 1.94E-07 zgc:103438 Zgc:103438 Dr.86834 450015 3.990 1.21E-33 7.541 0.00E+00 8.349 1.85E-15 zgc:103451 Zgc:103451 Dr.85637 494071 2.787 1.99E-06 zgc:103463 Zgc:103463 Dr.81837 492479 2.007 0.00E+00 zgc:103473 Zgc:103473 Dr.84834 492477 2.020 9.41E-07 zgc:103480 Zgc:103480 Dr.36495 447875 1.532 2.65E-07 zgc:103512 Zgc:103512 Dr.79955 449995 1.775 1.67E-13 zgc:103538 Zgc:103538 Dr.82281 449816 2.008 1.71E-13 zgc:103566 Zgc:103566 Dr.119956 403071 8.661 0.00E+00 3.132 0.00E+00 4.968 6.86E-26 6.900 0.00E+00 1.781 3.99E-31 12.247 0.00E+00 51.023 0.00E+00 zgc:103575 Zgc:103575 Dr.85993 449806 1.708 9.14E-09 1.732 1.70E-11 zgc:103580 Zgc:103580 Dr.13131 449557 10.535 8.54E-14 4.431 1.90E-08 10.341 3.41E-11 106.876 0.00E+00 zgc:103602 Zgc:103602 Dr.118348 492515 2.379 3.98E-07 zgc:103720 Zgc:103720 Dr.85073 492482 1.853 9.79E-13 zgc:103738 Zgc:103738 Dr.39013 541319 1.670 4.51E-12 zgc:103749 Zgc:103749 Dr.134176 449990 1.605 4.47E-07 zgc:109719 Zgc:109719 Dr.86187 402910 2.228 5.94E-08 zgc:109721 Zgc:109721 Dr.85339 402892 1.761 2.17E-10 zgc:109896 Zgc:109896 Dr.26640 553543 2.054 1.32E-10 zgc:109927 Zgc:109927 Dr.91483 553550 2.376 8.74E-16 zgc:109969 Zgc:109969 Dr.78796 553560 2.456 7.22E-25 2.365 7.12E-27 zgc:109981 Zgc:109981 Dr.85410 436842 2.956 0.00E+00 zgc:110010 Zgc:110010 Dr.83699 553575 2.404 0.00E+00 zgc:110065 Zgc:110065 Dr.88697 552960 2.586 8.51E-40 zgc:110152 Zgc:110152 Dr.27897 550551 3.626 6.70E-07 3.154 1.07E-09 2.444 1.53E-06 10.013 6.21E-23 41.633 0.00E+00 zgc:110177 Zgc:110177 Dr.77019 541353 1.703 6.28E-06 zgc:110200 Zgc:110200 Dr.116678 550523 2.083 2.25E-06 zgc:110202 Zgc:110202 Dr.86832 553596 2.281 2.63E-10 zgc:110205 Zgc:110205 Dr.117434 553776 1.944 6.95E-06 zgc:110207 Zgc:110207 Dr.86812 553597 2.338 2.43E-17 zgc:110234 Zgc:110234 Dr.80158 550330 3.400 8.55E-28 zgc:110246 Zgc:110246 Dr.42999 550289 1.617 4.44E-06 zgc:110283 Zgc:110283 Dr.133535 550268 2.159 1.00E-05 zgc:110290 Zgc:110290 Dr.81450 571148 1.739 3.59E-17 zgc:110304 Zgc:110304 Dr.39071 550255 1.904 0.00E+00 zgc:110312 Zgc:110312 Dr.39467 553608 1.547 4.97E-10 zgc:110333 Zgc:110333 Dr.140317 550497 1.999 9.69E-10 zgc:110340 Zgc:110340 Dr.76395 541345 5.469 2.67E-06 zgc:110354 Zgc:110354 Dr.88891 553612 4.056 9.00E-05 2.990 3.04E-14 5.296 1.63E-08 6.088 3.41E-23 10.192 2.33E-14 zgc:110361 Zgc:110361 Dr.40351 550478 1.726 1.59E-12 zgc:110380 Zgc:110380 Dr.104962 550353 3.779 0.00E+00 zgc:110410 Zgc:110410 Dr.91454 553618 2.559 4.60E-10 zgc:110411 Zgc:110411 Dr.90104 571309 2.911 3.00E-05 3.364 9.89E-11 8.364 4.62E-19 zgc:110443 Zgc:110443 Dr.79042 554092 2.396 3.37E-19 zgc:110459 Zgc:110459 Dr.78179 553622 2.059 9.74E-08 7.832 0.00E+00 zgc:110461 Zgc:110461 Dr.42917 554090 1.699 4.00E-05 zgc:110617 Zgc:110617 Dr.45532 553639 1.688 3.21E-10 zgc:110661 Zgc:110661 Dr.82411 553646 1.516 7.15E-06 zgc:110676 Zgc:110676 Dr.75438 550571 1.522 1.90E-08 zgc:110677 Zgc:110677 Dr.83007 550570 3.798 5.73E-09 zgc:110697 Zgc:110697 Dr.16628 550562 1.720 2.65E-10 zgc:110738 Zgc:110738 Dr.83914 503532 2.345 2.89E-22 zgc:110746 Zgc:110746 Dr.88727 541479 2.638 3.07E-21 zgc:110788 Zgc:110788 Dr.83494 503601 1.735 9.45E-19 zgc:110815 Zgc:110815 Dr.26819 541519 1.983 5.57E-06 zgc:110823 Zgc:110823 Dr.80770 548343 2.156 1.40E-16 zgc:110825 Zgc:110825 Dr.84519 541428 1.555 6.00E-05 zgc:111983 Zgc:111983 Dr.4740 550501 11.199 4.46E-18 zgc:112009 Zgc:112009 Dr.118650 550378 2.651 1.95E-26 zgc:112015 Zgc:112015 Dr.81785 550376 2.150 5.88E-18 zgc:112024 Zgc:112024 Dr.14420 541338 1.603 3.00E-05 zgc:112060 Zgc:112060 Dr.92771 550346 5.592 8.81E-28 zgc:112092 Zgc:112092 Dr.92660 553677 4.099 0.00E+00 zgc:112094 Zgc:112094 Dr.113647 550449 3.230 1.12E-06 3.316 8.88E-08 zgc:112143 Zgc:112143 Dr.76505 550429 8.051 0.00E+00 1.707 5.49E-13 1.961 2.02E-06 9.257 0.00E+00 2.866 1.67E-09 2.646 0.00E+00 zgc:112151 Zgc:112151 Dr.90156 550423 5.751 8.72E-12 zgc:112165 Zgc:112165 Dr.14414 553683 2.707 1.60E-14 zgc:112199 Zgc:112199 Dr.76995 550402 81.149 9.50E-40 zgc:112232 Zgc:112232 Dr.90608 565258 1.573 1.02E-08 zgc:112236 Zgc:112236 Dr.132927 553693 1.919 1.03E-06 zgc:112242 Zgc:112242 Dr.44274 553694 2.449 2.26E-23 zgc:112267 Zgc:112267 Dr.82291 554143 2.156 2.42E-39 zgc:112350 Zgc:112350 Dr.84733 553715 1.637 9.14E-07 zgc:112361 Zgc:112361 Dr.134432 554112 2.211 3.32E-06 zgc:112390 Zgc:112390 Dr.117449 550328 2.415 2.13E-15 zgc:112399 Zgc:112399 Dr.84511 554121 2.339 2.00E-05 zgc:112417 Zgc:112417 Dr.84960 550508 1.533 6.00E-05 zgc:112430 Zgc:112430 Dr.83908 550484 1.967 1.02E-37 zgc:112487 Zgc:112487 Dr.17290 541337 1.986 6.40E-21 zgc:112531 Zgc:112531 Dr.85000 550441 3.424 7.65E-42 zgc:112961 Zgc:112961 Dr.88889 503752 6.715 2.52E-44 zgc:112964 Zgc:112964 Dr.21205 503764 1.899 6.99E-07 zgc:112983 Zgc:112983 Dr.14459 503609 2.975 0.00E+00 zgc:113045 Zgc:113045 Dr.41669 664768 2.175 2.00E-05 zgc:113078 Zgc:113078 Dr.41750 553811 3.256 3.05E-26 zgc:113102 Zgc:113102 Dr.134817 503754 2.907 1.18E-10 2.773 8.21E-10 zgc:113121 Zgc:113121 Dr.86165 503608 2.548 0.00E+00 zgc:113138 Zgc:113138 Dr.104304 503604 1.545 8.26E-06 zgc:113194 Zgc:113194 Dr.75261 541435 4.757 3.66E-27 zgc:113201 Zgc:113201 Dr.4120 553813 1.578 2.00E-05 zgc:113232 Zgc:113232 Dr.43135 541546 7.160 3.21E-06 zgc:113424 Zgc:113424 Dr.38137 503598 1.657 2.00E-05 zgc:113516 Zgc:113516 Dr.79930 541449 1.696 7.46E-06 zgc:113527 Zgc:113527 Dr.88899 613245 1.834 2.71E-13 1.883 4.00E-05 1.845 2.26E-06 2.891 1.09E-15 4.323 0.00E+00 zgc:113571 Zgc:113571 Dr.87456 541385 2.145 4.35E-09 zgc:113947 Zgc:113947 Dr.140628 403081 1.728 4.42E-14 zgc:114034 Zgc:114034 Dr.87731 553529 2.520 2.45E-11 zgc:114034 Zgc:114034 Dr.80829 553529 2.553 1.06E-08 zgc:114066 Zgc:114066 Dr.84802 566506 2.286 5.61E-15 2.452 2.13E-13 zgc:114069 Zgc:114069 Dr.75706 573998 1.774 7.33E-09 zgc:114084 Zgc:114084 Dr.16264 566757 2.281 8.38E-23 zgc:114089 Zgc:114089 Dr.78908 553218 1.978 7.49E-21 zgc:114134 Zgc:114134 Dr.132634 565499 2.312 7.89E-13 zgc:114170 Zgc:114170 Dr.91502 557352 3.016 3.64E-27 4.912 0.00E+00 zgc:123046 Zgc:123046 Dr.114190 568429 1.797 1.58E-21 zgc:123047 Zgc:123047 Dr.20771 553283 1.740 7.00E-05 zgc:123068 Zgc:123068 Dr.83585 403118 2.416 5.00E-05 zgc:123105 Zgc:123105 Dr.79894 664766 1.538 6.35E-06 zgc:123218 Zgc:123218 Dr.86778 641321 1.613 1.35E-06 2.278 6.88E-11 2.025 1.65E-16 2.342 2.14E-08 2.629 5.13E-24 3.520 0.00E+00 11.983 0.00E+00 zgc:123236 Zgc:123236 Dr.110015 557480 2.261 4.58E-11 2.455 1.20E-09 2.650 1.52E-35 2.739 2.68E-13 zgc:123285 Zgc:123285 Dr.52077 641492 1.778 1.60E-20 zgc:123291 Zgc:123291 Dr.39466 555725 1.621 4.70E-06 zgc:123295 Zgc:123295 Dr.18631 641564 1.894 8.00E-05 zgc:123333 Zgc:123333 Dr.82169 560778 3.535 0.00E+00 zgc:123339 Zgc:123339 Dr.15815 567972 1.594 4.18E-28 3.715 0.00E+00 zgc:136232 Zgc:136232 Dr.48479 692302 1.893 1.07E-17 zgc:136362 Zgc:136362 Dr.115122 692259 1.528 3.21E-20 4.997 0.00E+00 zgc:136465 Zgc:136465 Dr.115363 678591 1.629 7.00E-05 zgc:136551 Zgc:136551 Dr.132866 557983 3.251 4.95E-07 zgc:136578 Zgc:136578 Dr.32376 678540 1.593 9.85E-08 zgc:136612 Zgc:136612 Dr.14207 678581 1.712 2.18E-11 zgc:136632 Zgc:136632 Dr.80625 326634 1.728 2.00E-05 zgc:136650 Zgc:136650 Dr.79737 678644 2.583 1.59E-12 zgc:136778 Zgc:136778 Dr.132955 678567 2.086 1.25E-08 zgc:136784 Zgc:136784 Dr.116127 692280 1.554 8.27E-08 zgc:136826 Zgc:136826 Dr.78145 677743 10.559 0.00E+00 zgc:136828 Zgc:136828 Dr.80235 678517 2.135 1.16E-06 zgc:136830 Zgc:136830 Dr.81845 678516 1.836 2.57E-10 zgc:136842 Zgc:136842 Dr.83230 678549 2.192 5.63E-08 zgc:136844 Zgc:136844 Dr.54003 724012 1.812 4.16E-13 zgc:136889 Zgc:136889 Dr.17382 678519 1.702 0.00E+00 zgc:136895 Zgc:136895 Dr.120252 678632 4.652 0.00E+00 zgc:136956 Zgc:136956 Dr.67666 566685 3.696 0.00E+00 zgc:136982 Zgc:136982 Dr.132749 678628 2.435 3.00E-05 zgc:152822 Zgc:152822 Dr.76915 321938 2.185 3.37E-12 zgc:152945 Zgc:152945 Dr.77704 767787 11.175 1.15E-10 13.686 7.24E-39 38.363 0.00E+00 5.428 3.97E-09 15.064 9.06E-24 24.618 0.00E+00 35.986 0.00E+00 25.224 4.02E-28 zgc:152979 Zgc:152979 Dr.133940 767671 1.549 3.00E-05 zgc:153020 Zgc:153020 Dr.134726 560761 1.635 7.71E-06 1.839 1.05E-10 zgc:153025 Zgc:153025 Dr.82018 557567 1.610 7.64E-06 zgc:153034 Zgc:153034 Dr.121047 767699 4.651 5.00E-05 zgc:153039 Zgc:153039 Dr.87314 767698 2.480 1.42E-14 zgc:153050 Zgc:153050 Dr.79389 767737 2.801 2.49E-12 zgc:153057 Zgc:153057 Dr.13838 767798 1.544 7.22E-06 4.997 0.00E+00 zgc:153058 Zgc:153058 Dr.12509 751648 2.367 2.47E-33 zgc:153092 Zgc:153092 Dr.84539 768193 9.224 4.14E-16 zgc:153148 Zgc:153148 Dr.115926 767775 1.847 2.00E-05 zgc:153267 Zgc:153267 Dr.89419 767684 1.904 8.59E-18 2.987 3.26E-11 3.634 0.00E+00 1.974 2.11E-06 2.615 3.71E-18 3.304 5.61E-07 zgc:153286 Zgc:153286 Dr.11537 767649 7.135 0.00E+00 zgc:153349 Zgc:153349 Dr.37104 555269 1.540 2.00E-05 zgc:153411 Zgc:153411 Dr.82013 751688 1.502 2.90E-06 zgc:153437 Zgc:153437 Dr.33839 567109 3.323 0.00E+00 zgc:153490 Zgc:153490 Dr.84256 553351 1.897 1.95E-22 zgc:153595 Zgc:153595 Dr.43367 767723 1.841 1.12E-23 zgc:153666 Zgc:153666 Dr.81083 751664 2.399 1.76E-26 zgc:153678 Zgc:153678 Dr.79638 768291 1.875 2.67E-15 zgc:153679 Zgc:153679 Dr.104877 556393 3.008 1.55E-12 zgc:153723 Zgc:153723 Dr.88985 767718 2.872 1.01E-10 1.597 3.00E-05 2.163 3.62E-21 2.482 3.27E-08 2.578 6.71E-09 3.277 8.74E-37 zgc:153738 Zgc:153738 Dr.124910 558115 1.740 3.31E-13 zgc:153787 Zgc:153787 Dr.81196 768202 3.856 1.20E-24 zgc:153795 Zgc:153795 Dr.67738 562009 1.890 1.00E-05 zgc:153827 Zgc:153827 Dr.79755 558677 3.218 3.16E-06 zgc:153924 Zgc:153924 Dr.76073 767776 1.984 5.65E-07 zgc:153928 Zgc:153928 Dr.54339 559896 1.566 5.00E-05 zgc:153973 Zgc:153973 Dr.18932 558487 2.153 1.40E-45 zgc:153989 Zgc:153989 Dr.41526 767796 2.868 0.00E+00 zgc:153997 Zgc:153997 Dr.67670 572469 1.773 7.00E-05 zgc:154007 Zgc:154007 Dr.42522 559784 4.261 8.32E-30 zgc:154040 Zgc:154040 Dr.90121 767688 3.312 9.63E-20 zgc:154075 Zgc:154075 Dr.79553 556929 2.485 3.19E-33 zgc:154116 Zgc:154116 Dr.78291 768123 1.629 2.18E-07 zgc:158255 Zgc:158255 Dr.82412 567601 1.792 1.15E-17 zgc:158299 Zgc:158299 Dr.76441 790937 3.018 4.36E-08 zgc:158343 Zgc:158343 Dr.37679 568780 7.774 0.00E+00 zgc:158367 Zgc:158367 Dr.116845 571403 3.545 2.05E-07 zgc:158385 Zgc:158385 Dr.78057 791159 4.175 0.00E+00 zgc:158387 Zgc:158387 Dr.75902 567275 2.726 7.46E-17 1.519 6.50E-07 2.514 1.52E-11 zgc:158404 Zgc:158404 Dr.89148 557029 1.824 3.00E-05 1.845 1.07E-06 2.103 8.04E-12 6.027 5.75E-23 2.747 6.00E-05 zgc:158463 Zgc:158463 Dr.27261 100037361 1.903 2.00E-05 zgc:158494 Zgc:158494 Dr.107928 386720 1.528 2.56E-13 zgc:158528 Zgc:158528 Dr.11289 553708 5.818 3.08E-30 zgc:158560 Zgc:158560 Dr.9145 403117 4.241 3.06E-19 zgc:158722 Zgc:158722 Dr.90467 791202 2.857 3.45E-30 zgc:158807 Zgc:158807 Dr.83792 100009648 4.701 2.00E-05 zgc:158852 Zgc:158852 Dr.112519 565497 3.427 0.00E+00 zgc:158861 Zgc:158861 Dr.120725 100005434 3.323 7.69E-13 3.443 8.25E-14 zgc:162095 Zgc:162095 Dr.132653 553256 1.767 1.01E-10 1.868 3.09E-06 zgc:162151 Zgc:162151 Dr.118829 563441 2.778 1.32E-26 zgc:162159 Zgc:162159 Dr.86238 560433 4.297 8.00E-05 zgc:162183 Zgc:162183 Dr.86797 100037314 3.147 4.56E-08 zgc:162198 Zgc:162198 Dr.66850 325787 2.496 7.65E-07 2.717 2.06E-18 zgc:162266 Zgc:162266 Dr.79929 100037322 1.795 2.60E-08 zgc:162316 Zgc:162316 Dr.92977 100037372 2.030 9.00E-05 2.171 3.00E-05 zgc:162651 Zgc:162651 Dr.115655 323364 2.479 9.40E-11 2.140 1.72E-07 zgc:162756 Zgc:162756 Dr.119128 565917 1.533 5.32E-07 zgc:162874 Zgc:162874 Dr.9564 798401 1.505 2.00E-05 zgc:162897 Zgc:162897 Dr.132990 100049157 2.606 7.85E-08 2.043 5.59E-09 2.830 3.70E-11 10.236 7.65E-40 zgc:162933 Zgc:162933 Dr.86859 100037376 2.115 1.26E-08 zgc:162946 Zgc:162946 Dr.16479 100000104 3.570 8.00E-05 zgc:162968 Zgc:162968 Dr.85263 564166 2.468 8.26E-40 zgc:163054 Zgc:163054 Dr.134652 798022 2.498 4.27E-06 zgc:163081 Zgc:163081 Dr.86506 100037359 2.907 2.72E-09 zgc:165461 Zgc:165461 Dr.108135 497419 2.452 5.49E-11 zgc:55259 Zgc:55259 Dr.114179 338155 1.919 2.17E-33 zgc:55292 Zgc:55292 Dr.1786 321491 1.919 9.20E-33 1.705 2.72E-15 zgc:55345 Zgc:55345 Dr.77883 393096 1.575 1.12E-09 zgc:55363 Zgc:55363 Dr.4451 327599 2.622 0.00E+00 zgc:55396 Zgc:55396 Dr.115188 406835 1.551 3.00E-05 zgc:55423 Zgc:55423 Dr.35017 394146 4.833 2.19E-09 zgc:55492 Zgc:55492 Dr.26675 327244 5.188 0.00E+00 zgc:55511 Zgc:55511 Dr.81636 393129 3.656 0.00E+00 zgc:55512 Zgc:55512 Dr.78153 325470 1.678 7.07E-14 zgc:55572 Zgc:55572 Dr.18403 406765 2.552 0.00E+00 zgc:55573 Zgc:55573 Dr.206 406764 1.777 2.19E-13 zgc:55605 Zgc:55605 Dr.9480 393970 1.782 6.52E-42 zgc:55642 Zgc:55642 Dr.75985 791998 2.205 1.71E-16 zgc:55671 Zgc:55671 Dr.76387 321460 2.248 4.39E-13 zgc:55671 Zgc:55671 Dr.115941 321460 2.513 0.00E+00 zgc:55705 Zgc:55705 Dr.116756 406351 3.024 0.00E+00 zgc:55773 Zgc:55773 Dr.81374 393144 2.966 1.12E-15 zgc:55794 Zgc:55794 Dr.80343 327593 2.972 0.00E+00 1.550 6.69E-10 2.703 0.00E+00 zgc:55813 Zgc:55813 Dr.80110 399488 1.919 3.18E-11 3.817 8.02E-38 zgc:55843 Zgc:55843 Dr.132844 334383 1.752 1.70E-06 zgc:55863 Zgc:55863 Dr.82569 393937 2.246 3.00E-05 1.614 7.55E-11 2.195 1.05E-22 zgc:55891 Zgc:55891 Dr.3804 406342 1.965 1.00E-05 zgc:55983 Zgc:55983 Dr.80447 327592 2.985 0.00E+00 zgc:56011 Zgc:56011 Dr.108477 334308 1.590 8.84E-09 zgc:56033 Zgc:56033 Dr.83776 393958 1.520 8.32E-06 zgc:56065 Zgc:56065 Dr.82452 393905 2.577 9.02E-23 zgc:56072 Zgc:56072 Dr.86170 393159 1.850 7.12E-14 zgc:56112 Zgc:56112 Dr.74679 393164 2.396 5.99E-27 zgc:56134 Zgc:56134 Dr.8435 336426 2.639 0.00E+00 zgc:56141 Zgc:56141 Dr.42026 406277 2.236 0.00E+00 2.426 1.04E-24 zgc:56152 Zgc:56152 Dr.132868 394173 1.778 3.05E-06 zgc:56186 Zgc:56186 Dr.119329 393219 4.312 0.00E+00 zgc:56228 Zgc:56228 Dr.78794 393183 1.671 1.09E-06 zgc:56251 Zgc:56251 Dr.117666 335866 1.637 1.26E-13 zgc:56258 Zgc:56258 Dr.78227 393291 1.850 5.34E-15 zgc:56292 Zgc:56292 Dr.79814 393193 1.700 3.00E-05 zgc:56306 Zgc:56306 Dr.113626 393285 4.100 0.00E+00 zgc:56330 Zgc:56330 Dr.78024 324490 4.560 0.00E+00 zgc:56376 Zgc:56376 Dr.133568 394070 2.070 8.03E-22 zgc:56407 Zgc:56407 Dr.79344 393257 1.503 4.89E-07 2.525 3.00E-09 zgc:56417 Zgc:56417 Dr.79371 393258 2.336 1.00E-05 2.755 0.00E+00 zgc:56424 Zgc:56424 Dr.84789 393276 2.931 4.00E-05 zgc:56443 Zgc:56443 Dr.79075 406386 1.556 8.94E-10 zgc:56444 Zgc:56444 Dr.16713 406385 1.503 8.31E-09 zgc:56445 Zgc:56445 Dr.115431 336339 2.262 4.07E-28 zgc:56457 Zgc:56457 Dr.85135 393260 1.937 1.03E-42 zgc:56486 Zgc:56486 Dr.79178 393262 1.806 5.56E-06 zgc:56530 Zgc:56530 Dr.17325 393238 2.316 4.72E-12 zgc:56538 Zgc:56538 Dr.18376 393296 2.648 5.61E-11 zgc:56567 Zgc:56567 Dr.117075 406725 1.932 3.12E-17 2.977 2.86E-24 zgc:56572 Zgc:56572 Dr.1692 406724 1.597 1.44E-11 zgc:56585 Zgc:56585 Dr.24982 393297 6.423 8.68E-34 zgc:56637 Zgc:56637 Dr.114056 325799 1.779 1.37E-08 zgc:56688 Zgc:56688 Dr.86039 393243 2.864 4.07E-13 zgc:56706 Zgc:56706 Dr.85461 393244 1.770 7.37E-10 6.158 0.00E+00 zgc:56709 Zgc:56709 Dr.82400 393275 2.099 8.63E-20 zgc:63466 Zgc:63466 Dr.80350 393404 2.697 2.08E-31 zgc:63471 Zgc:63471 Dr.80392 327396 5.438 3.19E-40 zgc:63485 Zgc:63485 Dr.80576 394115 1.836 3.53E-15 zgc:63488 Zgc:63488 Dr.80748 334082 5.755 6.75E-10 zgc:63489 Zgc:63489 Dr.80610 393602 1.862 0.00E+00 zgc:63495 Zgc:63495 Dr.26559 394108 2.792 1.33E-06 zgc:63504 Zgc:63504 Dr.76348 393849 2.153 2.92E-20 zgc:63505 Zgc:63505 Dr.81633 394006 2.632 1.14E-43 zgc:63514 Zgc:63514 Dr.4097 336412 1.990 1.01E-17 zgc:63565 Zgc:63565 Dr.79024 386994 2.205 0.00E+00 zgc:63570 Zgc:63570 Dr.83760 393408 3.563 1.26E-26 zgc:63579 Zgc:63579 Dr.119012 393429 3.444 2.90E-43 zgc:63590 Zgc:63590 Dr.15092 393432 2.701 9.57E-17 zgc:63593 Zgc:63593 Dr.15095 393658 1.751 4.53E-29 zgc:63602 Zgc:63602 Dr.84970 393433 1.862 1.25E-09 zgc:63606 Zgc:63606 Dr.83598 393412 3.042 3.73E-10 zgc:63634 Zgc:63634 Dr.12674 393367 3.794 2.98E-07 zgc:63645 Zgc:63645 Dr.17499 393584 1.569 6.00E-05 zgc:63663 Zgc:63663 Dr.118336 393586 1.631 1.00E-05 zgc:63666 Zgc:63666 Dr.86390 393414 1.769 3.87E-10 zgc:63667 Zgc:63667 Dr.17457 393451 2.287 8.95E-10 4.479 7.00E-05 zgc:63672 Zgc:63672 Dr.86785 393416 2.978 7.00E-05 zgc:63682 Zgc:63682 Dr.85231 393880 2.362 9.55E-07 zgc:63688 Zgc:63688 Dr.85293 393811 2.199 2.18E-37 zgc:63689 Zgc:63689 Dr.108 393371 1.923 4.24E-36 zgc:63695 Zgc:63695 Dr.133823 394139 2.835 4.10E-16 zgc:63696 Zgc:63696 Dr.96129 405773 1.850 8.00E-05 zgc:63749 Zgc:63749 Dr.77732 394182 1.651 4.00E-05 zgc:63767 Zgc:63767 Dr.116215 393932 2.735 2.05E-26 zgc:63792 Zgc:63792 Dr.75976 337333 1.518 6.01E-06 2.053 8.00E-05 2.640 7.61E-07 4.475 4.69E-10 13.126 4.35E-09 zgc:63831 Zgc:63831 Dr.1302 336746 2.369 3.23E-20 zgc:63850 Zgc:63850 Dr.13140 393305 1.707 2.50E-07 zgc:63863 Zgc:63863 Dr.82376 393372 2.181 8.36E-16 zgc:63904 Zgc:63904 Dr.79146 325361 1.589 5.00E-05 zgc:63920 Zgc:63920 Dr.120542 394148 2.632 1.30E-14 zgc:63947 Zgc:63947 Dr.26461 393995 2.153 3.29E-21 zgc:63950 Zgc:63950 Dr.85725 378998 1.936 2.43E-10 zgc:63962 Zgc:63962 Dr.80134 326808 1.631 6.41E-10 zgc:63972 Zgc:63972 Dr.82419 393325 2.965 2.07E-10 zgc:63982 Zgc:63982 Dr.48970 337376 1.566 2.00E-05 zgc:63991 Zgc:63991 Dr.88365 393877 2.821 7.59E-38 zgc:64013 Zgc:64013 Dr.119341 393333 1.970 8.00E-05 2.515 1.13E-13 zgc:64031 Zgc:64031 Dr.82104 393338 8.453 4.93E-24 5.530 2.91E-16 zgc:64042 Zgc:64042 Dr.84488 393609 1.658 6.53E-14 2.087 0.00E+00 1.838 4.07E-14 zgc:64065 Zgc:64065 Dr.134296 393379 1.711 1.03E-07 zgc:64072 Zgc:64072 Dr.113396 324985 2.373 3.67E-09 zgc:64076 Zgc:64076 Dr.75640 406424 2.540 5.77E-27 zgc:64085 Zgc:64085 Dr.12508 393380 1.632 6.00E-05 2.400 3.47E-17 1.806 4.09E-06 zgc:64090 Zgc:64090 Dr.97367 393383 1.751 5.71E-19 zgc:64101 Zgc:64101 Dr.80315 393878 1.743 4.35E-09 zgc:64106 Zgc:64106 Dr.78121 393348 1.988 3.64E-08 zgc:64114 Zgc:64114 Dr.82488 378866 3.934 0.00E+00 zgc:64115 Zgc:64115 Dr.77541 406410 2.235 5.82E-07 zgc:64172 Zgc:64172 Dr.26600 393387 8.747 0.00E+00 zgc:64202 Zgc:64202 Dr.75250 323760 1.830 7.93E-07 zgc:64213 Zgc:64213 Dr.82669 393393 7.684 0.00E+00 zgc:64214 Zgc:64214 Dr.83940 393394 1.622 8.26E-22 zgc:64227 Zgc:64227 Dr.82397 393364 2.511 3.11E-08 zgc:65788 Zgc:65788 Dr.77223 322420 2.506 1.09E-35 5.062 0.00E+00 5.106 0.00E+00 2.692 6.74E-12 9.948 1.97E-31 33.661 0.00E+00 zgc:65802 Zgc:65802 Dr.76831 321818 2.594 1.12E-26 zgc:65831 Zgc:65831 Dr.12437 393541 1.631 5.93E-09 zgc:65845 Zgc:65845 Dr.120811 368341 1.663 1.20E-06 zgc:65861 Zgc:65861 Dr.4096 321618 3.140 9.14E-19 zgc:65956 Zgc:65956 Dr.28276 321928 2.886 0.00E+00 zgc:65997 Zgc:65997 Dr.134566 393525 2.757 8.25E-16 zgc:66026 Zgc:66026 Dr.18349 393549 4.955 2.00E-05 zgc:66125 Zgc:66125 Dr.96456 393796 1.579 1.77E-06 1.841 1.99E-14 zgc:66135 Zgc:66135 Dr.82480 393469 1.616 3.30E-24 zgc:66260 Zgc:66260 Dr.83619 394158 2.119 0.00E+00 zgc:66295 Zgc:66295 Dr.83931 393489 2.138 1.12E-20 zgc:66326 Zgc:66326 Dr.76836 321842 1.527 9.23E-06 2.005 1.16E-06 zgc:66353 Zgc:66353 Dr.4114 321378 3.247 1.41E-15 2.996 1.16E-14 zgc:66417 Zgc:66417 Dr.76870 387303 1.757 5.00E-05 zgc:66419 Zgc:66419 Dr.85930 394086 2.501 2.55E-07 3.580 2.27E-14 zgc:66432 Zgc:66432 Dr.80338 327616 2.002 4.46E-13 zgc:66434 Zgc:66434 Dr.80353 335485 1.602 8.57E-23 zgc:66437 Zgc:66437 Dr.80365 327327 1.931 2.86E-09 zgc:66443 Zgc:66443 Dr.114215 406856 2.695 2.29E-11 2.538 3.30E-10 zgc:66449 Zgc:66449 Dr.13689 327407 1.573 9.18E-06 1.835 2.56E-08 4.547 6.93E-10 zgc:66450 Zgc:66450 Dr.80393 393501 5.137 5.62E-09 zgc:66473 Zgc:66473 Dr.80413 327497 2.181 8.74E-38 zgc:66481 Zgc:66481 Dr.80430 406841 2.181 1.24E-06 zgc:66482 Zgc:66482 Dr.78563 386643 2.947 2.46E-29 zgc:73056 Zgc:73056 Dr.81060 393668 2.829 0.00E+00 zgc:73070 Zgc:73070 Dr.11136 406310 1.546 1.24E-09 zgc:73112 Zgc:73112 Dr.6047 393799 2.732 5.32E-06 2.465 7.42E-18 zgc:73123 Zgc:73123 Dr.82245 393800 1.817 1.45E-17 zgc:73138 Zgc:73138 Dr.80241 336334 2.267 0.00E+00 zgc:73197 Zgc:73197 Dr.10285 337237 2.735 2.38E-36 zgc:73201 Zgc:73201 Dr.26944 324079 1.791 1.06E-07 2.687 2.00E-05 zgc:73220 Zgc:73220 Dr.81480 393726 2.138 4.80E-10 zgc:73223 Zgc:73223 Dr.78528 393805 1.838 8.37E-13 zgc:73230 Zgc:73230 Dr.76747 406311 2.855 0.00E+00 zgc:73259 Zgc:73259 Dr.82649 393807 1.969 5.24E-19 zgc:73324 Zgc:73324 Dr.78050 393762 1.783 5.78E-17 zgc:76867 Zgc:76867 Dr.30163 404612 1.719 5.71E-06 zgc:76875 Zgc:76875 Dr.82970 405849 1.520 1.31E-06 zgc:76940 Zgc:76940 Dr.132462 327301 1.894 6.63E-10 zgc:76951 Zgc:76951 Dr.79424 325410 1.780 5.00E-05 zgc:76966 Zgc:76966 Dr.30396 405805 1.752 1.69E-11 6.985 8.73E-20 zgc:76972 Zgc:76972 Dr.48763 406621 1.780 4.39E-20 zgc:77002 Zgc:77002 Dr.83170 405846 1.738 2.51E-11 1.655 5.12E-12 1.678 1.73E-09 1.781 1.57E-14 5.519 0.00E+00 zgc:77021 Zgc:77021 Dr.30401 406601 3.774 0.00E+00 zgc:77025 Zgc:77025 Dr.113617 405840 1.527 1.61E-07 zgc:77033 Zgc:77033 Dr.23613 406598 1.688 1.00E-05 1.617 6.84E-09 1.909 1.92E-11 1.840 2.14E-06 zgc:77038 Zgc:77038 Dr.81607 406596 2.193 5.94E-37 1.699 1.49E-17 2.088 1.50E-22 2.491 0.00E+00 1.832 2.03E-23 3.981 0.00E+00 8.900 0.00E+00 zgc:77041 Zgc:77041 Dr.16044 404632 4.290 1.46E-10 3.773 5.87E-10 zgc:77049 Zgc:77049 Dr.82527 405810 1.980 1.04E-19 zgc:77060 Zgc:77060 Dr.81949 431765 6.430 1.04E-33 zgc:77068 Zgc:77068 Dr.113519 405824 2.693 6.00E-05 2.612 2.00E-05 zgc:77094 Zgc:77094 Dr.3780 406466 1.782 5.54E-09 zgc:77112 Zgc:77112 Dr.79757 406459 2.770 5.90E-15 zgc:77165 Zgc:77165 Dr.19061 404608 2.187 9.39E-07 zgc:77182 Zgc:77182 Dr.88453 402953 1.970 1.16E-07 zgc:77211 Zgc:77211 Dr.116871 327246 1.589 8.14E-06 zgc:77223 Zgc:77223 Dr.81858 402848 1.930 2.33E-08 zgc:77242 Zgc:77242 Dr.89035 402969 5.822 4.61E-20 5.078 1.65E-18 zgc:77247 Zgc:77247 Dr.10567 406523 1.675 1.37E-09 zgc:77286 Zgc:77286 Dr.76277 337244 3.665 3.80E-11 zgc:77287 Zgc:77287 Dr.84139 404617 1.821 1.00E-05 1.807 5.62E-06 zgc:77306 Zgc:77306 Dr.80127 406509 1.811 4.00E-05 zgc:77358 Zgc:77358 Dr.82216 402928 1.964 9.34E-07 2.016 6.24E-09 zgc:77380 Zgc:77380 Dr.134001 406554 1.598 1.62E-14 zgc:77387 Zgc:77387 Dr.6336 324010 2.595 7.41E-07 zgc:77395 Zgc:77395 Dr.124693 402965 3.356 0.00E+00 zgc:77424 Zgc:77424 Dr.88467 404622 5.072 9.44E-09 4.133 1.54E-07 zgc:77486 Zgc:77486 Dr.85913 405808 3.206 1.58E-43 zgc:77495 Zgc:77495 Dr.39283 406633 2.421 9.42E-18 zgc:77517 Zgc:77517 Dr.76027 393540 2.754 2.39E-19 2.819 8.94E-20 zgc:77552 Zgc:77552 Dr.35692 325366 2.046 1.23E-12 zgc:77563 Zgc:77563 Dr.81839 406470 2.471 1.08E-19 zgc:77650 Zgc:77650 Dr.28638 334219 2.261 0.00E+00 zgc:77655 Zgc:77655 Dr.3449 333952 1.554 3.00E-05 zgc:77727 Zgc:77727 Dr.89530 393830 2.667 6.00E-05 2.885 5.22E-06 zgc:77732 Zgc:77732 Dr.100029 402983 1.880 1.71E-10 zgc:77775 Zgc:77775 Dr.84266 402981 3.135 2.86E-06 zgc:77806 Zgc:77806 Dr.116194 402991 2.578 1.46E-28 zgc:77817 Zgc:77817 Dr.83905 402960 4.080 5.00E-38 zgc:77825 Zgc:77825 Dr.80068 402940 2.060 1.12E-09 zgc:77828 Zgc:77828 Dr.86893 405832 1.995 4.27E-28 zgc:77836 Zgc:77836 Dr.78447 406477 2.128 8.28E-09 zgc:77853 Zgc:77853 Dr.31316 402988 1.602 6.79E-06 zgc:77855 Zgc:77855 Dr.88688 393836 1.967 7.00E-05 2.468 4.21E-10 zgc:77861 Zgc:77861 Dr.77739 393823 1.898 1.22E-10 1.832 7.40E-06 zgc:77868 Zgc:77868 Dr.79390 336159 7.439 0.00E+00 zgc:77882 Zgc:77882 Dr.78307 323671 1.561 1.51E-06 3.128 0.00E+00 zgc:77891 Zgc:77891 Dr.78475 402993 1.577 4.32E-10 zgc:77906 Zgc:77906 Dr.134550 402945 1.756 2.09E-06 zgc:85616 Zgc:85616 Dr.113645 406356 1.600 2.63E-12 1.576 1.00E-14 zgc:85662 Zgc:85662 Dr.79382 334420 1.560 1.07E-08 zgc:85678 Zgc:85678 Dr.119833 406444 1.823 4.15E-33 zgc:85752 Zgc:85752 Dr.83956 405868 2.278 1.81E-32 zgc:85763 Zgc:85763 Dr.2298 338247 2.817 0.00E+00 zgc:85789 Zgc:85789 Dr.77043 322350 2.708 3.35E-13 zgc:85807 Zgc:85807 Dr.132562 406578 2.513 0.00E+00 zgc:85838 Zgc:85838 Dr.30318 405870 2.934 2.00E-05 zgc:85857 Zgc:85857 Dr.79191 335842 1.547 1.53E-06 zgc:85866 Zgc:85866 Dr.15501 403033 1.893 2.98E-09 zgc:85909 Zgc:85909 Dr.79074 405867 1.605 1.52E-18 zgc:85914 Zgc:85914 Dr.27758 406471 1.843 1.10E-06 zgc:85923 Zgc:85923 Dr.30256 406448 2.406 8.62E-06 zgc:85944 Zgc:85944 Dr.84638 415199 2.701 3.08E-06 zgc:85948 Zgc:85948 Dr.3014 406516 1.784 2.45E-09 zgc:85965 Zgc:85965 Dr.81190 405857 2.672 8.45E-06 2.670 3.86E-10 zgc:86604 Zgc:86604 Dr.83945 415250 1.640 4.66E-11 zgc:86715 Zgc:86715 Dr.86190 415236 2.276 0.00E+00 zgc:86749 Zgc:86749 Dr.121376 407650 2.029 1.48E-08 zgc:86754 Zgc:86754 Dr.80284 415225 2.657 3.13E-07 2.185 1.00E-05 zgc:86757 Zgc:86757 Dr.436 415223 2.547 7.44E-11 zgc:86870 Zgc:86870 Dr.84307 436953 1.611 2.27E-06 zgc:86889 Zgc:86889 Dr.133321 415192 13.284 3.66E-08 8.691 5.56E-06 zgc:86892 Zgc:86892 Dr.86400 436952 5.852 9.87E-07 zgc:86895 Zgc:86895 Dr.31063 415191 1.856 3.00E-05 zgc:86905 Zgc:86905 Dr.31087 415185 1.660 2.13E-16 zgc:86914 Zgc:86914 Dr.83963 415183 1.730 4.62E-29 zgc:86926 Zgc:86926 Dr.69080 415179 2.609 4.88E-08 2.333 9.11E-07 zgc:86927 Zgc:86927 Dr.36067 415178 3.113 1.22E-07 zgc:91794 Zgc:91794 Dr.132314 431764 2.907 1.33E-14 4.556 6.51E-13 zgc:91796 Zgc:91796 Dr.88264 431761 1.677 1.13E-08 2.884 1.34E-06 zgc:91814 Zgc:91814 Dr.13285 445085 3.255 2.53E-16 zgc:91855 Zgc:91855 Dr.88522 431742 3.646 6.00E-05 zgc:91868 Zgc:91868 Dr.79974 445073 1.624 5.00E-05 2.146 3.33E-19 2.270 4.21E-17 zgc:91874 Zgc:91874 Dr.78328 431735 2.123 6.44E-08 zgc:91880 Zgc:91880 Dr.105402 431733 1.583 3.00E-05 zgc:91888 Zgc:91888 Dr.121304 445068 1.576 2.00E-05 zgc:91890 Zgc:91890 Dr.83427 431729 1.723 1.27E-26 6.563 2.59E-39 zgc:91905 Zgc:91905 Dr.81996 445065 2.422 1.64E-38 zgc:91908 Zgc:91908 Dr.118948 431726 2.270 8.52E-15 zgc:91909 Zgc:91909 Dr.32183 431725 6.739 0.00E+00 zgc:91912 Zgc:91912 Dr.117370 431723 1.814 6.46E-23 zgc:91915 Zgc:91915 Dr.84836 436595 3.044 4.00E-05 3.444 3.85E-08 zgc:91940 Zgc:91940 Dr.81687 436942 2.052 1.00E-04 2.601 3.60E-13 zgc:91957 Zgc:91957 Dr.119031 431716 2.205 8.23E-09 8.497 0.00E+00 zgc:91959 Zgc:91959 Dr.32109 436939 2.193 2.00E-05 2.082 3.00E-05 zgc:91963 Zgc:91963 Dr.85722 445108 3.033 5.58E-14 6.477 4.79E-33 2.198 1.79E-06 6.911 2.96E-23 66.754 0.00E+00 zgc:91964 Zgc:91964 Dr.81856 431715 3.316 8.05E-14 zgc:91976 Zgc:91976 Dr.118860 492359 2.757 4.27E-31 zgc:91978 Zgc:91978 Dr.106802 436927 2.903 8.00E-05 zgc:91984 Zgc:91984 Dr.32169 431775 1.685 2.29E-07 2.075 1.21E-21 zgc:91992 Zgc:91992 Dr.32094 436923 1.718 1.00E-05 zgc:92005 Zgc:92005 Dr.34246 445477 1.985 6.44E-08 zgc:92034 Zgc:92034 Dr.82262 447866 6.946 0.00E+00 zgc:92055 Zgc:92055 Dr.75498 493608 2.122 8.97E-15 zgc:92077 Zgc:92077 Dr.81204 447861 1.722 1.92E-18 zgc:92083 Zgc:92083 Dr.117302 447860 2.401 3.00E-05 2.222 1.14E-10 zgc:92086 Zgc:92086 Dr.18499 436643 2.278 2.73E-21 zgc:92087 Zgc:92087 Dr.79909 492333 1.906 8.24E-11 zgc:92095 Zgc:92095 Dr.76508 447858 1.857 6.27E-09 zgc:92097 Zgc:92097 Dr.133138 403013 1.667 1.30E-20 2.116 6.26E-13 5.836 0.00E+00 zgc:92106 Zgc:92106 Dr.7710 326672 5.026 1.91E-35 zgc:92109 Zgc:92109 Dr.81623 492328 2.403 1.92E-22 zgc:92116 Zgc:92116 Dr.76702 492355 1.824 8.26E-10 zgc:92129 Zgc:92129 Dr.85188 436630 1.905 3.91E-06 zgc:92136 Zgc:92136 Dr.78544 436629 2.215 1.01E-13 zgc:92137 Zgc:92137 Dr.33934 445049 3.059 3.96E-08 4.138 2.50E-13 7.372 0.00E+00 12.445 2.45E-30 3.546 1.01E-07 4.692 9.09E-12 12.675 1.40E-45 90.799 0.00E+00 zgc:92162 Zgc:92162 Dr.87011 436622 4.003 1.00E-05 zgc:92167 Zgc:92167 Dr.111731 436621 2.062 1.00E-05 3.092 8.33E-14 zgc:92192 Zgc:92192 Dr.90111 436612 1.744 3.00E-05 zgc:92196 Zgc:92196 Dr.78079 436609 3.592 2.52E-44 zgc:92215 Zgc:92215 Dr.76966 447847 1.919 0.00E+00 zgc:92225 Zgc:92225 Dr.132558 436906 3.170 1.63E-08 2.575 7.13E-06 zgc:92236 Zgc:92236 Dr.88917 436901 1.928 4.51E-12 zgc:92239 Zgc:92239 Dr.120620 494036 1.827 7.20E-14 zgc:92249 Zgc:92249 Dr.84875 436896 2.715 2.83E-07 zgc:92250 Zgc:92250 Dr.81554 447821 1.970 4.00E-05 zgc:92251 Zgc:92251 Dr.84835 445025 1.717 5.38E-06 zgc:92266 Zgc:92266 Dr.88692 436890 2.195 0.00E+00 zgc:92267 Zgc:92267 Dr.102467 494035 2.005 2.44E-20 2.360 4.07E-31 zgc:92270 Zgc:92270 Dr.86108 436888 1.813 3.45E-18 zgc:92276 Zgc:92276 Dr.83119 445024 1.566 1.50E-08 zgc:92305 Zgc:92305 Dr.84723 436875 2.042 3.52E-10 zgc:92306 Zgc:92306 Dr.113700 436874 2.070 7.57E-15 zgc:92308 Zgc:92308 Dr.84566 447841 2.411 1.88E-09 zgc:92317 Zgc:92317 Dr.76480 449545 1.614 1.19E-14 zgc:92326 Zgc:92326 Dr.78702 327284 1.749 1.13E-14 zgc:92327 Zgc:92327 Dr.31557 436731 2.505 1.18E-17 zgc:92335 Zgc:92335 Dr.118048 436726 2.887 5.61E-18 zgc:92339 Zgc:92339 Dr.32118 436725 7.136 4.02E-40 zgc:92354 Zgc:92354 Dr.107615 492346 7.643 4.82E-12 zgc:92360 Zgc:92360 Dr.19030 436988 1.630 1.72E-14 zgc:92367 Zgc:92367 Dr.81587 445119 1.991 1.79E-15 1.613 3.73E-06 3.261 5.17E-12 zgc:92368 Zgc:92368 Dr.88762 445118 2.278 1.21E-13 18.200 0.00E+00 zgc:92393 Zgc:92393 Dr.82457 445082 1.743 1.79E-09 zgc:92395 Zgc:92395 Dr.118350 445080 1.693 1.33E-13 zgc:92408 Zgc:92408 Dr.85432 431738 2.580 6.48E-14 zgc:92420 Zgc:92420 Dr.28514 445069 2.087 1.08E-22 2.291 1.60E-32 zgc:92423 Zgc:92423 Dr.141054 445067 1.646 2.85E-06 zgc:92476 Zgc:92476 Dr.77577 436916 3.241 0.00E+00 zgc:92479 Zgc:92479 Dr.77381 445095 2.982 2.41E-08 zgc:92510 Zgc:92510 Dr.75490 436638 1.533 1.86E-17 zgc:92512 Zgc:92512 Dr.120800 436637 2.826 6.02E-31 zgc:92520 Zgc:92520 Dr.79317 436633 1.899 4.99E-07 zgc:92523 Zgc:92523 Dr.79683 445055 2.113 0.00E+00 zgc:92530 Zgc:92530 Dr.77138 445052 3.131 1.07E-10 9.248 6.14E-10 zgc:92599 Zgc:92599 Dr.86411 447868 2.753 8.55E-42 zgc:92601 Zgc:92601 Dr.77117 436983 4.769 2.86E-22 zgc:92608 Zgc:92608 Dr.134016 436979 3.096 1.20E-07 5.239 5.36E-18 3.514 7.21E-14 4.627 8.50E-15 7.414 4.98E-13 zgc:92657 Zgc:92657 Dr.33940 445046 2.364 3.83E-19 zgc:92662 Zgc:92662 Dr.83126 436697 3.518 3.41E-08 11.599 2.79E-13 zgc:92746 Zgc:92746 Dr.81975 436845 1.659 0.00E+00 zgc:92747 Zgc:92747 Dr.77221 436844 1.730 0.00E+00 zgc:92754 Zgc:92754 Dr.32124 436840 1.649 4.88E-10 1.583 4.02E-13 2.603 8.38E-12 zgc:92762 Zgc:92762 Dr.84618 436834 1.787 8.40E-07 1.654 1.57E-06 2.023 4.25E-14 2.083 3.34E-38 4.414 5.89E-15 6.271 0.00E+00 zgc:92765 Zgc:92765 Dr.77961 436832 1.917 1.49E-11 zgc:92774 Zgc:92774 Dr.132213 436826 4.395 0.00E+00 zgc:92791 Zgc:92791 Dr.85452 436816 1.679 1.00E-05 3.014 9.00E-05 zgc:92794 Zgc:92794 Dr.83100 436813 1.804 6.59E-08 zgc:92812 Zgc:92812 Dr.83453 436789 1.668 1.03E-21 zgc:92822 Zgc:92822 Dr.81885 447828 1.728 8.20E-26 zgc:92849 Zgc:92849 Dr.86222 436767 1.641 4.61E-10 1.826 2.70E-17 2.531 0.00E+00 1.870 1.72E-13 2.160 6.17E-18 3.376 0.00E+00 2.384 3.05E-14 zgc:92851 Zgc:92851 Dr.10032 436766 2.011 3.96E-09 2.644 6.16E-31 5.229 0.00E+00 zgc:92860 Zgc:92860 Dr.84 436759 1.762 3.15E-12 zgc:92866 Zgc:92866 Dr.76532 436755 1.539 3.43E-07 zgc:92866 Zgc:92866 Dr.121908 436755 1.922 3.00E-05 zgc:92888 Zgc:92888 Dr.30129 492336 1.705 3.28E-33 zgc:92890 Zgc:92890 Dr.88790 436742 3.716 1.55E-06 2.801 8.00E-05 zgc:92903 Zgc:92903 Dr.79021 436734 6.006 0.00E+00 zgc:92926 Zgc:92926 Dr.80970 436797 2.149 1.00E-05 3.442 1.41E-19 3.206 2.00E-05 zhx3 Zinc fingers and homeoboxes 3 Dr.134568 386659 1.974 0.00E+00 zhx3 Zinc fingers and homeoboxes 3 Dr.82149 386659 2.075 9.81E-45 znf259 Zinc finger protein 259 Dr.25202 406382 1.868 2.42E-20 znf313 Zinc finger protein 313 Dr.86280 414843 2.164 1.42E-06 4.381 1.73E-12 znf593 Zinc finger protein 593 Dr.85766 393790 2.270 4.25E-20 Zona pellucida glycoprotein 2, like zp2l1 Dr.75593 555180 1.502 4.46E-07 1
*Significance cut off values were set to p<10-4 and fold changes ≥ 1.5 Supplementary Table II. UniGene clusters down-regulated upon S. typhimurium wt and/or S. typhimurium Ra infection*
Gene Description UniGene Code Entrez GeneID Ra 2h Ra 2h Ra 5h Ra 5h Ra 8h Ra 8h Ra 24h Ra 24h wt 2h wt 2h wt 5h wt 5h wt 8h wt 8h wt 24h wt 24h Symbol (build # 105) Fold Change P-value Fold Change P-value Fold Change P-value Fold Change P-value Fold Change P-value Fold Change P-value Fold Change P-value Fold Change P-value 15-Sep Selenoprotein 15 Dr.11333 352923 -1.754 2.08E-38 2-Sep Septin 2 Dr.77028 323457 -1.658 1.17E-27 Achalasia, adrenocortical aaas insufficiency, alacrimia Dr.81869 378454 -1.639 4.06E-16 Acetyl-Coenzyme A acaa1 acyltransferase 1 Dr.82559 431754 -2.919 4.28E-07
Acyl-Coenzyme A dehydrogenase acad8 family, member 8 Dr.107967 394130 -1.774 5.75E-24 Acyl-Coenzyme A acadl dehydrogenase, long chain Dr.76592 394156 -1.802 2.87E-34 Acyl-Coenzyme A dehydrogenase, C-4 to C-12 acadm straight chain Dr.132310 406283 -2.182 2.46E-39 acat2 Acetyl-CoA acetyltransferase 2 Dr.813 30643 -2.215 0.00E+00 Acyl-Coenzyme A binding domain acbd6 containing 6 Dr.78504 324090 -1.562 6.64E-39 Amiloride-sensitive cation channel accn1 1 Dr.134961 407669 -1.520 5.46E-11 Amiloride-sensitive cation channel accn2c 2 c Dr.120630 407670 -1.617 5.31E-07 Amiloride-sensitive cation channel accn4a 4 a Dr.91508 407668 -2.226 1.00E-05 aco2 Aconitase 2, mitochondrial Dr.2353 322670 -1.599 1.79E-07 acta1 Actin, alpha 1, skeletal muscle Dr.47173 58114 -2.138 6.90E-06 acta1 Actin, alpha 1, skeletal muscle Dr.75552 58114 -1.630 2.86E-11 Actin, alpha 2, smooth muscle, acta2 aorta Dr.20277 322509 -1.717 2.66E-11 Adenosine deaminase, RNA- adar specific Dr.10204 58119 -1.666 5.94E-12 adh8b Alcohol dehydrogenase 8b Dr.16130 402841 -3.035 0.00E+00 adka Adenosine kinase a Dr.76313 368220 -2.042 9.24E-18 Anti-dorsalizing morphogenic admp protein Dr.80639 140619 -1.932 3.93E-08 adnp Activity-dependent neuroprotector Dr.74585 334453 -2.499 1.05E-06 adnp Activity-dependent neuroprotector Dr.132880 334453 -2.207 3.74E-09 adra2c Adrenergic, alpha-2C-, receptor Dr.90038 266752 -2.466 4.90E-11 adra2da Adrenergic, alpha-2D-, receptor a Dr.88495 266754 -1.978 4.74E-15 agc1 Aggrecan 1 Dr.89851 497505 -9.668 2.94E-34 1-acylglycerol-3-phosphate O- agpat3 acyltransferase 3 Dr.122443 406734 -1.908 5.19E-09 1-acylglycerol-3-phosphate O- agpat3 acyltransferase 3 Dr.75961 406734 -1.848 3.13E-07 Alkylglycerone phosphate agps synthase Dr.101140 386801 -1.570 2.00E-05 Alanine-glyoxylate agxtl aminotransferase, like Dr.82558 436603 -3.645 0.00E+00 ak5 Adenylate kinase 5 Dr.122428 336312 -2.130 1.02E-07 ak5 Adenylate kinase 5 Dr.81461 336312 -1.862 4.79E-06 Aldehyde dehydrogenase 7 aldh7a1 family, member A1 Dr.76991 334197 -1.812 0.00E+00 Aldehyde dehydrogenase 8 aldh8a1 family, member A1 Dr.16380 447801 -2.881 5.60E-31 Aldolase a, fructose- aldoab bisphosphate, b Dr.76452 406496 -1.750 3.58E-12
Asparagine-linked glycosylation 8 homolog (yeast, alpha-1,3- alg8 glucosyltransferase) Dr.80448 327601 -1.565 2.52E-37 AlkB, alkylation repair homolog 6 alkbh6 (E. coli) Dr.77412 317736 -1.851 6.79E-20 alp Alkaline phosphatase Dr.116988 393982 -2.608 1.48E-30 amphAmphiphysin Dr.83547 393804 -1.863 2.00E-05 amt Aminomethyltransferase Dr.78748 450000 -2.260 1.85E-12 Anaphase promoting complex anapc5 subunit 5 Dr.4173 322854 -2.077 6.03E-19 angptl3 Angiopoietin-like 3 Dr.121736 114421 -2.285 4.94E-09 angptl3 Angiopoietin-like 3 Dr.3332 114421 -2.277 1.43E-37 ankrd10a Ankyrin repeat domain 10a Dr.132735 393955 -1.976 1.40E-45 ankrd10b Ankyrin repeat domain 10b Dr.134050 559527 -1.717 1.00E-05 Acidic (leucine-rich) nuclear phosphoprotein 32 family, anp32e member E Dr.33193 406562 -2.842 1.26E-26 anxa1b Annexin A1b Dr.1190 353358 -3.088 1.91E-28 anxa1c Annexin A1c Dr.104495 327066 -1.769 3.71E-08 anxa3 Annexin A3 Dr.85627 447893 -1.665 4.00E-05 api5 Apoptosis inhibitor 5 Dr.20106 321676 -1.620 7.00E-06 apoa1 Apolipoprotein A-I Dr.75775 30355 -1.831 2.36E-07 apoa1bp Apolipoprotein A-I binding protein Dr.85107 436891 -2.066 6.43E-19 apoa4 Apolipoprotein A-IV Dr.77089 322543 -1.982 4.93E-06 Amyloid beta (A4) precursor appb protein b Dr.116483 170846 -1.639 6.49E-06 Amyloid beta precursor protein appbp1 binding protein 1 Dr.26720 393471 -2.690 0.00E+00 aqp3Aquaporin 3 Dr.76207 406777 -1.880 8.09E-20 aqp8Aquaporin 8 Dr.36543 447923 -4.689 4.83E-33 arhgap12 Rho GTPase activating protein 12 Dr.67202 393848 -1.927 0.00E+00 Ariadne ubiquitin-conjugating enzyme E2 binding protein arih1 homolog 1 (Drosophila) Dr.75869 327005 -1.878 2.28E-16 -1.779 1.12E-14 arl13a ADP-ribosylation factor-like 13A Dr.133056 393791 -3.231 2.70E-18 ADP-ribosylation factor-like 3, like arl3l1 1 Dr.82794 393666 -4.874 0.00E+00 ADP-ribosylation factor-like 3, like arl3l2 2 Dr.81947 393692 -2.390 1.78E-17 arl6 ADP-ribosylation factor-like 6 Dr.100186 494134 -1.689 8.00E-05 Actin related protein 2/3 complex, arpc1b subunit 1B Dr.76686 335474 -1.566 5.00E-05 Actin related protein 2/3 complex, arpc5b subunit 5B Dr.10390 399482 -1.613 2.15E-18 arr3l Arrestin 3, retinal (X-arrestin), like Dr.82729 436678 -2.324 8.00E-05 ars2 Arsenate resistance protein 2 Dr.4841 192311 -1.783 2.05E-21 Ankyrin repeat and SOCS box- asb13 containing 13 Dr.31363 436801 -1.520 5.29E-09 ASF1 anti-silencing function 1 asf1b homolog B (S. cerevisiae) Dr.79347 386897 -1.585 3.63E-13 Similar to additional sex combs Asxl1 like 1 (Drosophila) Dr.28826 403066 -1.571 1.02E-14 Ankyrin repeat, SAM and basic leucine zipper domain containing asz1 1 Dr.82345 572911 -1.616 1.16E-13 atoh2a Atonal homolog 2a Dr.81281 114414 -3.579 4.61E-28 atoh2b Atonal homolog 2b Dr.81125 114415 -3.792 0.00E+00 atp11c ATPase, Class VI, type 11C Dr.132351 368385 -1.874 2.56E-07
ATPase, Na+/K+ transporting, atp1a1a.3 alpha 1a.3 polypeptide Dr.10713 64614 -1.837 5.10E-08 -1.708 2.44E-09
ATPase, Na+/K+ transporting, atp1a1a.4 alpha 1a.4 polypeptide Dr.132267 64615 -1.625 1.18E-14
ATPase, Na+/K+ transporting, atp1a1b alpha 1b polypeptide Dr.7840 64616 -1.648 6.22E-09
ATPase, Na+/K+ transporting, atp1a3a alpha 3a polypeptide Dr.77442 64610 -2.338 1.37E-25
ATPase, Na+/K+ transporting, atp1b2b beta 2b polypeptide Dr.12400 114457 -3.758 2.24E-35
ATPase, Na+/K+ transporting, atp1b3a beta 3a polypeptide Dr.21720 30468 -1.791 8.97E-13
ATPase, Na+/K+ transporting, atp1b3b beta 3b polypeptide Dr.96696 64272 -1.609 1.78E-12 ATPase, Ca++ transporting, atp2b3 plasma membrane 3 Dr.133601 436745 -2.312 1.23E-08
ATP synthase, H+ transporting, mitochondrial F1 complex, gamma atp5c1 polypeptide 1 Dr.75686 336957 -1.575 1.66E-35 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit atp6v1b2 B2 Dr.132618 359840 -2.125 4.00E-05 Alpha thalassemia/mental retardation syndrome X-linked, atrxl like Dr.5568 323299 -1.989 1.02E-13
Beta-1,3-N- b3galnt2 acetylgalactosaminyltransferase 2 Dr.88062 553716 -1.617 1.04E-15 bactin1 Bactin1 Dr.35143 57934 -1.953 0.00E+00 bactin2 Bactin2 Dr.75125 57935 -1.516 2.58E-32 -1.573 2.80E-20 barhl2 BarH-like 2 Dr.79590 403056 -1.754 1.79E-09 barx1 BarH-like homeobox 1 Dr.87457 553644 -1.929 4.00E-05 Bromodomain adjacent to zinc baz1a finger domain, 1A Dr.36447 334173 -1.597 2.11E-17 bbs2 Bardet-Biedl syndrome 2 Dr.1599 259187 -2.759 0.00E+00
Branched chain aminotransferase bcat2 2, mitochondrial Dr.75512 436949 -1.546 1.00E-04 Branched chain ketoacid dehydrogenase E1, beta bckdhb polypeptide Dr.2410 317766 -1.993 1.58E-29
Branched chain alpha-ketoacid bckdk dehydrogenase kinase Dr.75460 282677 -1.514 1.00E-05 bcl2 B-cell leukemia/lymphoma 2 Dr.45607 570772 -1.690 7.00E-05 bcl2l13 BCL2-like 13 (apoptosis facilitator) Dr.80225 559355 -1.801 8.44E-09 bcl7a B-cell CLL/lymphoma 7A Dr.28229 57952 -1.715 3.94E-29 bgnBiglycan Dr.28930 431774 -2.326 1.32E-07 Basic helix-loop-helix domain bhlhb5 containing, class B, 5 Dr.84568 393930 -1.640 2.77E-18 bin2 Bridging integrator 2 Dr.37659 492780 -2.418 7.40E-30 bmp3 Bone morphogenetic protein 3 Dr.82154 335252 -1.516 3.00E-05 brd1 Bromodomain containing 1 Dr.91233 449908 -1.931 1.79E-08 brd7 Bromodomain containing 7 Dr.115819 406675 -1.836 0.00E+00 brd8 Bromodomain containing 8 Dr.80311 337414 -1.615 3.07E-22
BUB3 budding uninhibited by bub3 benzimidazoles 3 homolog (yeast) Dr.78635 403012 -1.678 1.81E-22
Core 1 synthase, glycoprotein-N- acetylgalactosamine 3-beta- c1galt1l galactosyltransferase 1, like Dr.79145 327441 -1.862 3.31E-14 Complement component 1, q c1qc subcomponent, C chain Dr.133251 449803 -2.304 2.40E-10 -2.083 1.07E-06 ca7 Carbonic anhydrase VII Dr.82742 393786 -2.104 2.90E-24 Calcium channel, voltage- dependent, L type, alpha 1C cacna1c subunit Dr.83683 170581 -1.627 2.87E-09 calb2 Calbindin 2, (calretinin) Dr.82690 393684 -2.835 2.80E-45 calb2l Calbindin 2, like Dr.7048 393691 -2.795 0.00E+00 calm1a Calmodulin 1a Dr.76175 336364 -1.574 1.00E-05
Calmodulin 2a (phosphorylase calm2a kinase, delta) Dr.6963 336121 -3.113 5.00E-12
Calmodulin 3a (phosphorylase calm3a kinase, delta) Dr.7638 327379 -1.641 3.02E-26
Calmodulin 3b (phosphorylase calm3b kinase, delta) Dr.76748 321808 -2.497 2.90E-43 calr Calreticulin Dr.104606 30248 -1.633 1.86E-14 calrl Calreticulin like Dr.105519 321315 -1.521 8.02E-11 calrl2 Calreticulin, like 2 Dr.132550 325317 -2.518 2.30E-22 calub Calumenin b Dr.1956 394057 -3.265 6.43E-13 calub Calumenin b Dr.66116 394057 -2.866 1.54E-22 Calcium/calmodulin-dependent camk1g protein kinase IG Dr.9874 335654 -1.547 3.69E-06 Calcium/calmodulin-dependent protein kinase (CaM kinase) II camk2da delta a Dr.84611 436815 -1.843 0.00E+00 Calcium/calmodulin-dependent camk4 protein kinase IV Dr.81050 550270 -1.825 2.00E-31
Calmodulin regulated spectrin- camsap1l1 associated protein 1-like 1 Dr.14595 324296 -1.899 1.53E-40 capn3 Calpain 3, (p94) Dr.36430 447832 -1.511 3.73E-07 -1.678 8.30E-11 capn9 Calpain 9 Dr.77287 114400 -2.558 0.00E+00 Coactivator-associated arginine carm1 methyltransferase 1 Dr.83746 445251 -1.778 3.04E-08 Caspase 3, apoptosis-related casp3 cysteine protease Dr.11726 140621 -1.685 1.02E-15 caspbCaspase b Dr.81726 259303 -7.148 0.00E+00 cat Catalase Dr.1079 30068 -4.197 0.00E+00 cbln1 Cerebellin 1 precursor Dr.81250 436793 -1.883 4.91E-08 cbwd COBW domain containing Dr.104911 406536 -6.790 0.00E+00 Chromobox homolog 1 (HP1 beta cbx1 homolog Drosophila ) Dr.76974 326746 -2.183 2.89E-37 ccbl2 Cysteine conjugate-beta lyase 2 Dr.82010 393315 -1.758 4.47E-25 ccdc52 Coiled-coil domain containing 52 Dr.85458 494093 -2.448 1.03E-08 ccna2 Cyclin A2 Dr.51365 192295 -2.279 0.00E+00 ccna2 Cyclin A2 Dr.121874 192295 -2.006 1.98E-06 ccnb1 Cyclin B1 Dr.75689 58025 -2.282 1.85E-42 ccnb2 Cyclin B2 Dr.80580 368316 -1.562 4.24E-08 ccne Cyclin E Dr.29 30188 -1.587 2.57E-18 ccnf Cyclin F Dr.132154 266981 -2.097 1.36E-07 cd82 CD82 antigen Dr.2713 324137 -2.282 3.13E-13 cd99l2 CD99 antigen-like 2 Dr.75649 323266 -1.853 6.56E-19 CDC14 cell division cycle 14 cdc14a homolog A (S. cerevisiae) Dr.105353 393148 -1.892 2.91E-15 cdc2 Cell division cycle 2 Dr.24379 80973 -2.007 1.41E-20 cdc20 Cell division cycle 20 homolog Dr.105018 406353 -1.650 1.89E-06 CDC23 (cell division cycle 23, cdc23 yeast, homolog) Dr.80112 393907 -1.561 1.46E-10 cdc27 Cell division cycle 27 Dr.40998 30450 -1.641 1.72E-28 Cell division cycle associated 8- cdca8l like Dr.114838 492815 -1.577 7.00E-05 cdh11 Cadherin 11, osteoblast Dr.251 30461 -2.012 5.50E-14 cdh6 Cadherin 6 Dr.132516 541393 -1.585 4.08E-17 cdk2 Cyclin-dependent kinase 2 Dr.75152 406715 -2.282 0.00E+00 Cell adhesion molecule- related/down-regulated by cdon oncogenes Dr.121780 280652 -1.528 8.30E-06 -1.726 8.41E-06 CCAAT/enhancer binding protein cebp1 (C/EBP) 1 Dr.41318 114453 -1.821 1.59E-09 cfl2l Cofilin 2, like Dr.33445 321496 -1.914 2.32E-09 cfl2l Cofilin 2, like Dr.121602 321496 -1.839 5.04E-11 CH211- Similar to cask-interacting protein 119C20.3 2 Dr.112790 564179 -1.505 2.08E-06 -1.642 1.58E-06
Novel protein similar to vertebrate platelet-activating factor CH211- acetylhydrolase, isoform Ib, beta 139A5.3 subunit 30kDa (PAFAH1B2) Dr.133419 567170 -1.938 1.32E-08 Similar to Leucine-rich repeat- containing 4 protein precursor CH211- (Brain tumor-associated protein 235L7.2 MBAG1) Dr.114688 565021 -1.691 1.44E-11
CH211- Novel protein similar to vertebrate 279M15.2 syntaxin binding protein Dr.82936 556789 -2.098 0.00E+00 CH211- 45M15.1 Hypothetical protein LOC556137 Dr.82864 556137 -1.557 7.59E-12 CH211- 89F7.1 Hypothetical LOC558964 Dr.81910 558964 -2.368 2.60E-08 chad Chondroadherin Dr.80402 394038 -1.809 4.96E-12 Chromatin assembly factor 1, chaf1b subunit B Dr.77022 406285 -2.308 0.00E+00 chga Chromogranin A Dr.20148 450039 -2.702 8.26E-35 Cholinergic receptor, nicotinic, chrnb3a beta polypeptide 3a Dr.79601 394200 -1.845 9.61E-08
Carbohydrate (keratan sulfate Gal- chst1 6) sulfotransferase 1 Dr.120785 445124 -2.400 7.28E-14 churc1 Churchill domain containing 1 Dr.79574 492508 -1.829 4.09E-08 Cytosolic iron-sulfur protein assembly 1 homolog (S. ciao1 cerevisiae) Dr.83731 393116 -1.554 2.13E-06 Calcium and integrin binding cib2 family member 2 Dr.82904 393679 -1.984 6.39E-11 ckap5 Cytoskeleton associated protein 5 Dr.132252 492614 -2.013 4.80E-21 ckb Creatine kinase, brain Dr.75625 140744 -3.111 1.02E-30 cldn11 Claudin 11 Dr.77854 81592 -1.739 6.53E-12 clock3 Clock homolog 3 (mouse) Dr.86747 352927 -1.595 8.00E-05 clstn1 Calsyntenin 1 Dr.53665 393986 -2.061 2.22E-07
CNDP dipeptidase 2 cndp2 (metallopeptidase M20 family) Dr.6571 327288 -3.687 1.40E-43 CCR4-NOT transcription complex, cnot6 subunit 6 Dr.75311 324048 -1.734 2.00E-05 cntn1b Contactin 1b Dr.84810 541474 -3.392 4.03E-13 cobra1 Cofactor of BRCA1 Dr.114920 393137 -1.694 6.64E-14 col10a1 Collagen, type X, alpha 1 Dr.38145 558919 -12.885 3.10E-09 col18a1 Collagen type XVIII, alpha 1 Dr.52833 360140 -2.622 8.81E-19 col1a1 Collagen, type I, alpha 1 Dr.20097 337158 -5.987 0.00E+00 col1a2 Collagen, type I, alpha 2 Dr.75575 336471 -4.507 2.38E-44 col1a3 Collagen, type I, alpha 3 Dr.73918 325675 -5.676 0.00E+00 col2a1a Collagen type II, alpha-1a Dr.75057 30550 -2.610 4.84E-20 col5a2l Collagen, type V, alpha 2-like Dr.75905 368682 -1.748 1.71E-24 col9a2 Procollagen, type IX, alpha 2 Dr.75252 321212 -2.055 7.09E-17 colec11 Collectin sub-family member 11 Dr.37101 492459 -1.732 2.82E-33 colm Collomin Dr.108644 494570 -2.104 1.00E-04 COP9 constitutive photomorphogenic homolog cops4 subunit 4 (Arabidopsis) Dr.77245 325592 -1.569 1.22E-32 COP9 constitutive photomorphogenic homolog cops5 subunit 5 Dr.81074 393698 -2.020 1.95E-31 Coenzyme Q3 homolog, coq3 methyltransferase (yeast) Dr.75681 436893 -1.567 9.41E-17 coro1a Coronin, actin binding protein, 1A Dr.114363 337566 -1.554 2.47E-30 -1.580 5.99E-21 -2.823 5.02E-29 cox5a Cytochrome c oxidase subunit Va Dr.76110 326962 -1.515 1.62E-10 cpa5 Carboxypeptidase A5 Dr.77201 246092 -2.387 0.00E+00 -3.450 7.16E-37 -1.674 3.81E-06 -2.853 0.00E+00 -4.389 0.00E+00 -8.694 0.00E+00 cpb1 Carboxypeptidase B1 (tissue) Dr.77173 322412 -2.448 3.81E-18 cplx2 Complexin 2 Dr.35716 436732 -1.995 7.11E-20
Cleavage and polyadenylation cpsf2 specific factor 2 Dr.116813 436657 -1.553 2.94E-43
Cleavage and polyadenylation cpsf5 specific factor 5 Dr.80520 394092 -1.928 5.05E-24 cpt2 Carnitine palmitoyltransferase II Dr.75429 334779 -3.872 1.61E-16 Cellular retinoic acid binding crabp1a protein 1a Dr.83594 171479 -1.980 1.52E-08 crb1 Crumbs homolog 1 (Drosophila) Dr.17713 560792 -1.792 8.00E-05 crh Corticotropin releasing hormone Dr.96618 492507 -3.365 3.21E-06 crtap Cartilage associated protein Dr.76949 406626 -1.972 1.68E-18 crx Cone-rod homeobox Dr.14325 81881 -4.648 0.00E+00 cry1a Cryptochrome 1a Dr.82313 83777 -1.585 9.94E-11 -1.580 3.00E-05 cry2a Cryptochrome 2a Dr.116325 83779 -1.748 9.15E-06 cryaa Crystallin, alpha A Dr.78315 245947 -5.307 0.00E+00 crybb1 Crystallin, beta B1 Dr.84900 114418 -1.970 2.46E-16 crybb3 Crystallin, beta B3 Dr.41866 553184 -7.670 2.59E-39 crygm2c Crystallin, gamma M2c Dr.85026 493628 -4.514 5.00E-05 crygm2d1 Crystallin, gamma M2d1 Dr.75631 553710 -3.498 8.67E-08 crygm2d6 Crystallin, gamma M2d6 Dr.134350 415228 -1.516 3.76E-09 -3.912 5.16E-35 crygm2d8 Crystallin, gamma M2d8 Dr.134711 436854 -3.849 7.23E-27 crygm3 Crystallin, gamma M3 Dr.132190 493631 -3.313 1.85E-09 crygm4 Crystallin, gamma M4 Dr.79043 338225 -1.582 0.00E+00 crygm5 Crystallin, gamma M5 Dr.134555 474328 -2.588 4.68E-17 -20.219 0.00E+00 crygm6 Crystallin, gamma M6 Dr.15363 553966 -2.985 6.63E-06 crygn2 Crystallin, gamma N2 Dr.87252 445034 -6.554 1.13E-14 crygs3 Crystallin, gamma S3 Dr.92878 550617 -1.642 6.40E-08 -1.582 1.98E-10 Chromosome segregation 1-like cse1l (S. cerevisiae) Dr.75377 30707 -2.118 2.03E-29 Cleavage stimulation factor, 3' pre- cstf2 RNA, subunit 2 Dr.132247 386806 -1.537 5.00E-05 ctbp2 C-terminal binding protein 2 Dr.77714 65230 -1.695 2.38E-06 CCCTC-binding factor (zinc finger ctcf protein) Dr.53867 415104 -1.856 1.89E-09 Catenin (cadherin-associated ctnna2 protein), alpha 2 Dr.86260 553258 -1.638 1.64E-08 -1.660 3.45E-22 -1.677 2.00E-05 ctnnbl1 Catenin, beta like 1 Dr.77271 393840 -1.643 8.61E-06 ctsll Cathepsin L, like Dr.79994 449826 -5.030 1.99E-36 ctssa Cathepsin S, a Dr.81560 393398 -1.643 2.98E-07 -1.719 9.55E-08 -1.816 1.94E-11 -2.251 1.99E-15 -3.391 1.87E-15 cx28.9 Connexin 28.9 Dr.79900 492358 -1.635 1.00E-05 cx32.3 Connexin 32.3 Dr.4243 322617 -2.408 3.64E-13 cx44.1 Connexin 44.1 Dr.85399 114403 -5.670 6.85E-14 cx44.2 Connexin 44.2 Dr.21365 114404 -2.594 5.79E-18 cx52.6 Connexin 52.6 Dr.86920 404207 -2.201 7.00E-05 cx52.9 Connexin 52.9 Dr.30170 404625 -1.816 4.99E-12
Chemokine (C-X-C motif) ligand cxcl12b 12b (stromal cell-derived factor 1) Dr.105027 369022 -2.108 1.40E-16 Chemokine (C-X-C motif) receptor cxcr3.2 3.2 Dr.82754 492348 -1.964 0.00E+00 -1.729 3.93E-15 -1.509 4.64E-11 -1.988 1.40E-13 -3.618 0.00E+00 -2.528 3.06E-11 -10.157 1.14E-33 cygb2 Cytoglobin 2 Dr.43049 554176 -1.565 2.26E-07 Cytochrome P450, family 17, cyp17a1 subfamily A, polypeptide 1 Dr.79318 399692 -1.880 3.88E-09 -2.214 1.25E-31 Cytochrome P450, family 1, cyp1a subfamily A Dr.105078 140634 -1.833 3.09E-17 Cytochrome P450, family 2, cyp2j27 subfamily J, polypeptide 27 Dr.85615 569245 -1.761 4.51E-13 Cytochrome P450, family 2, cyp2j30 subfamily J, polypeptide 30 Dr.37032 492484 -1.507 7.37E-07 Cysteine and tyrosine-rich protein cyyr1 1 Dr.70621 405818 -1.735 1.75E-14 dab2 Disabled homolog 2 (Drosophila) Dr.79878 404040 -2.832 1.30E-37 dao.1 D-amino-acid oxidase 1 Dr.47162 619259 -1.691 1.98E-09 dap1b Death associated protein 1b Dr.76473 58094 -1.527 2.19E-11
Dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl- dci Coenzyme A isomerase) Dr.988 334101 -3.308 1.31E-24 dcn Decorin Dr.76351 64698 -4.163 0.00E+00 DCP2 decapping enzyme dcp2 homolog (S. cerevisiae) Dr.117411 393121 -1.651 4.44E-28 dcps MRNA decapping enzyme Dr.531 402850 -1.703 5.23E-13 dctd DCMP deaminase Dr.39980 550332 -1.547 1.42E-06 Dolichyl- diphosphooligosaccharide-protein ddost glycosyltransferase Dr.1142 406408 -2.058 0.00E+00 DEAD (Asp-Glu-Ala-Asp) box ddx39a polypeptide 39a Dr.1111 325550 -1.516 1.59E-17 DEAD (Asp-Glu-Ala-Asp) box ddx39b polypeptide 39b Dr.75872 406249 -1.672 1.07E-09 2,4-dienoyl CoA reductase 2, decr2 peroxisomal Dr.30642 406623 -2.070 6.66E-14 Death effector domain-containing dedd1 1 Dr.78368 58125 -1.795 2.93E-11 dfna5 Deafness, autosomal dominant 5 Dr.79081 335722 -1.594 5.74E-22
Diacylglycerol O-acyltransferase dgat1 homolog 1 (mouse) Dr.79871 325875 -1.503 1.74E-10 DiGeorge syndrome critical region dgcr8 gene 8 Dr.78349 324700 -1.788 1.10E-06 dhfr Dihydrofolate reductase Dr.75601 81882 -2.659 3.34E-17 Dehydrogenase/reductase (SDR dhrs1 family) member 1 Dr.32174 368670 -2.418 2.90E-06 dj383j4.3l DJ383J4.3-like Dr.32150 445401 -1.684 1.00E-05 DKEY- Similar to peroxisomal acyl-CoA 183C16.6 thioesterase 2b like 1 Dr.12004 572757 -9.572 1.87E-08 DKEY- Electrogenic Na+ bicarbonate 256M11.1 cotransporter Dr.80179 568631 -1.899 4.00E-18 dlx2b Distal-less homeobox gene 2b Dr.136 30557 -1.650 9.32E-09 dlx4a Distal-less homeobox gene 4a Dr.158 30561 -2.678 0.00E+00 dlx4b Distal-less homeobox gene 4b Dr.75093 30581 -1.743 5.09E-13 Diencephalon/mesencephalon dmbx1a homeobox 1a Dr.78986 142987 -1.816 2.59E-28 DnaJ (Hsp40) homolog, subfamily dnajb11 B, member 11 Dr.9667 386709 -2.236 0.00E+00 dnl2 Dynein light chain 2 Dr.84945 373083 -2.289 4.20E-07 dnl2l Dynein light chain 2, like Dr.91281 572690 -1.677 1.40E-07 dnm1l Dynamin 1-like Dr.77967 393896 -1.741 2.28E-28 DNA (cytosine-5-)- dnmt1 methyltransferase 1 Dr.25162 30430 -1.788 1.87E-26 DNA (cytosine-5-)- dnmt4 methyltransferase 4 Dr.34505 317744 -1.521 7.73E-09 DNA (cytosine-5-)- dnmt5 methyltransferase 5 Dr.77945 323723 -1.501 5.00E-05 DNA (cytosine-5-)- dnmt7 methyltransferase 7 Dr.104826 321084 -2.297 0.00E+00 Similar to dedicator of cytokinesis Dock8 8 Dr.27090 403040 -1.823 4.74E-11 dpp3Dipeptidylpeptidase 3 Dr.75694 322527 -2.510 0.00E+00 dpyd Dihydropyrimidine dehydrogenase Dr.79932 405829 -1.664 4.61E-10 dpysl2 Dihydropyrimidinase-like 2 Dr.81425 553412 -2.438 3.00E-05 dpysl5a Dihydropyrimidinase-like 5a Dr.78726 324416 -3.116 4.60E-07 Dr.100635 Transcribed locus Dr.100635 -1.662 3.27E-08 -2.022 1.26E-14 Dr.101608 Transcribed locus Dr.101608 -2.517 2.85E-07 Dr.102573 Transcribed locus Dr.102573 -1.905 3.11E-11 Dr.1026 Transcribed locus Dr.1026 -8.589 7.68E-06 Dr.102711 Transcribed locus Dr.102711 -2.481 2.00E-05 Dr.103469 Transcribed locus Dr.103469 -1.556 2.29E-06 Dr.103734 Transcribed locus Dr.103734 -2.790 3.35E-10 Dr.104095 Transcribed locus Dr.104095 -2.295 5.00E-05 Dr.104563 Transcribed locus Dr.104563 -1.972 1.90E-06 -2.239 3.28E-11 Dr.105347 Transcribed locus Dr.105347 -1.649 1.24E-08 Dr.106573 Transcribed locus Dr.106573 -2.482 8.12E-10 Dr.106912 Transcribed locus Dr.106912 -1.602 8.96E-06 Dr.107516 Transcribed locus Dr.107516 -3.112 1.06E-08 -9.344 9.79E-22
Transcribed locus, weakly similar to XP_706569.2 hypothetical Dr.107610 protein [Danio rerio] Dr.107610 -1.579 7.61E-06 Dr.107707 Transcribed locus Dr.107707 -1.821 1.90E-06 Dr.107710 CDNA clone IMAGE:8126885 Dr.107710 -2.267 0.00E+00 Dr.107715 Transcribed locus Dr.107715 -2.537 2.90E-07 Dr.107744 Transcribed locus Dr.107744 -2.421 1.43E-19 Dr.108164 Transcribed locus Dr.108164 -2.109 9.54E-18 Dr.108238 Transcribed locus Dr.108238 -1.585 5.00E-05 Dr.109966 Transcribed locus Dr.109966 -3.335 7.34E-22 Dr.11111 Transcribed locus Dr.11111 -2.128 6.15E-22 Dr.111512 Transcribed locus Dr.111512 -1.659 2.00E-05
Transcribed locus, weakly similar to XP_001080758.1 similar to PEBP family protein precursor Dr.111618 [Rattus norvegicus] Dr.111618 -5.612 1.05E-15 Dr.11235 Transcribed locus Dr.11235 -1.973 1.06E-06 Dr.11268 Transcribed locus Dr.11268 -1.686 1.35E-08 Transcribed locus, weakly similar to XP_001105054.1 phosphoribosyl pyrophosphate synthetase 1-like 1 [Macaca Dr.113660 mulatta] Dr.113660 -1.585 6.10E-14 Dr.11368 Transcribed locus Dr.11368 -2.370 7.79E-12 Dr.115780 Transcribed locus Dr.115780 -1.610 7.71E-10 Dr.11639 Transcribed locus Dr.11639 -1.520 5.00E-05
Transcribed locus, weakly similar to XP_001107670.1 hypothetical Dr.117455 protein [Macaca mulatta] Dr.117455 -2.067 2.47E-28
Transcribed locus, moderately similar to XP_001092092.1 similar to DNA topoisomerase II, Dr.119089 beta isozyme [Macaca mulatta] Dr.119089 -1.559 4.41E-12 Transcribed locus, weakly similar to XP_001087397.1 similar to selenoprotein P precursor Dr.121329 [Macaca mulatta] Dr.121329 -1.932 5.21E-07 Dr.121554 Transcribed locus Dr.121554 -1.558 2.00E-05 Dr.121574 Transcribed locus Dr.121574 -1.687 1.39E-07
Transcribed locus, weakly similar to XP_001112288.1 similar to actin-related protein M2 isoform 2 Dr.121588 [Macaca mulatta] Dr.121588 -2.361 5.71E-27 -2.831 2.48E-40 Dr.121646 Transcribed locus Dr.121646 -1.674 4.09E-14 Dr.121747 Transcribed locus Dr.121747 -2.960 6.29E-14
Transcribed locus, weakly similar to NP_067009.1 pellucida glycoprotein 4 preproprotein Dr.121890 [Homo sapiens] Dr.121890 -1.818 6.65E-07
Transcribed locus, moderately similar to XP_001093861.1 similar to Histone deacetylase 8 Dr.121897 (HD8) [Macaca mulatta] Dr.121897 -1.904 4.69E-19 Dr.121911 Transcribed locus Dr.121911 -1.576 6.72E-11 Dr.121928 Transcribed locus Dr.121928 -1.764 3.07E-06 Transcribed locus, weakly similar to XP_001104203.1 similar to tubulin, beta 8 isoform 2 [Macaca Dr.121942 mulatta] Dr.121942 -3.391 7.67E-32 Dr.122018 Transcribed locus Dr.122018 -6.684 1.40E-45
Transcribed locus, moderately similar to XP_001118319.1 similar to CG7593-PA [Macaca Dr.122053 mulatta] Dr.122053 -1.892 5.44E-12
Transcribed locus, strongly similar to XP_683307.2 hypothetical Dr.122064 protein [Danio rerio] Dr.122064 -1.593 6.79E-14
Transcribed locus, weakly similar to NP_001037299.1 superoxide Dr.122135 dismutase [Bombyx mori] Dr.122135 -1.894 3.85E-13 Dr.122159 Transcribed locus Dr.122159 -1.549 1.80E-14 Dr.122169 Transcribed locus Dr.122169 -1.916 1.55E-14 Transcribed locus, weakly similar to XP_001083269.1 similar to TBP-associated factor 15 isoform Dr.122171 1 isoform 5 [Macaca mulatta] Dr.122171 -1.749 0.00E+00 Dr.122206 Transcribed locus Dr.122206 -1.670 2.68E-07 Dr.122208 Transcribed locus Dr.122208 -1.751 7.28E-18
Transcribed locus, weakly similar to XP_001101217.1 similar to contactin 4 isoform a precursor Dr.122215 isoform 2 [Macaca mulatta] Dr.122215 -1.863 2.66E-11 Dr.122252 Transcribed locus Dr.122252 -1.674 7.83E-06 Dr.122357 Transcribed locus Dr.122357 -2.004 5.29E-10 Dr.122358 Transcribed locus Dr.122358 -3.037 4.70E-09 Dr.122382 Transcribed locus Dr.122382 -1.983 2.68E-11 Dr.122391 Transcribed locus Dr.122391 -1.688 7.06E-19 Dr.122401 Transcribed locus Dr.122401 -2.056 9.97E-37 Dr.122414 Transcribed locus Dr.122414 -1.895 3.96E-12 Dr.122492 Transcribed locus Dr.122492 -1.656 9.50E-16 Dr.122495 Transcribed locus Dr.122495 -1.572 1.00E-06 Dr.122581 Transcribed locus Dr.122581 -2.065 3.00E-05 Dr.122611 Transcribed locus Dr.122611 -2.114 0.00E+00
Transcribed locus, strongly similar to XP_001117773.1 similar to NMDA receptor 1 isoform NR1-1 Dr.122614 precursor [Macaca mulatta] Dr.122614 -1.820 1.57E-09 Dr.122623 Transcribed locus Dr.122623 -1.832 1.52E-07 Dr.122635 Transcribed locus Dr.122635 -2.703 1.34E-16 Dr.122637 Transcribed locus Dr.122637 -1.956 1.45E-19 Dr.122643 Transcribed locus Dr.122643 -3.029 1.77E-10 Dr.122669 Transcribed locus Dr.122669 -1.559 1.27E-07 -2.311 9.80E-14 Dr.122673 Transcribed locus Dr.122673 -1.679 1.00E-05 -2.870 3.00E-13 Dr.122675 Transcribed locus Dr.122675 -2.176 1.21E-15
Transcribed locus, strongly similar to NP_942121.1 protein Dr.122676 LOC386722 [Danio rerio] Dr.122676 -3.809 2.04E-12 Dr.122690 Transcribed locus Dr.122690 -1.614 5.67E-15 Dr.122695 Transcribed locus Dr.122695 -1.827 4.05E-17 Dr.122701 Transcribed locus Dr.122701 -1.647 7.72E-20
Transcribed locus, strongly similar to NP_001091666.1 protein Dr.122703 LOC100049158 [Danio rerio] Dr.122703 -1.602 2.24E-11 Dr.122741 Transcribed locus Dr.122741 -1.538 4.00E-05 Dr.122743 Transcribed locus Dr.122743 -3.699 8.14E-08 Transcribed locus, weakly similar to XP_001089735.1 similar to WW domain-containing binding protein 4 isoform 2 [Macaca Dr.122772 mulatta] Dr.122772 -1.931 1.08E-25 Dr.122781 Transcribed locus Dr.122781 -2.442 9.08E-11 Dr.122784 Transcribed locus Dr.122784 -1.541 1.85E-07 Dr.122786 Transcribed locus Dr.122786 -1.511 1.00E-05 -1.602 2.00E-05 -2.421 5.26E-07 Dr.122824 Transcribed locus Dr.122824 -1.796 5.86E-06 Dr.122836 Transcribed locus Dr.122836 -2.190 2.09E-24 Dr.122844 Transcribed locus Dr.122844 -2.403 1.86E-08 Dr.122866 Transcribed locus Dr.122866 -1.981 1.22E-16 Dr.122873 Transcribed locus Dr.122873 -1.902 7.30E-10 Dr.122887 Transcribed locus Dr.122887 -1.889 2.53E-11 Transcribed locus, weakly similar to XP_001107064.1 similar to tripartite motif-containing 62 Dr.122894 isoform 1 [Macaca mulatta] Dr.122894 -1.763 3.90E-07 -1.621 1.91E-07 Dr.122898 Transcribed locus Dr.122898 -1.745 2.72E-14 Dr.122900 Transcribed locus Dr.122900 -7.172 5.55E-09 Dr.122915 Transcribed locus Dr.122915 -1.579 1.67E-13 Dr.122923 Transcribed locus Dr.122923 -2.061 3.92E-34 Dr.122927 Transcribed locus Dr.122927 -1.517 1.17E-07 Dr.122965 Transcribed locus Dr.122965 -2.131 1.55E-07 Dr.122970 Transcribed locus Dr.122970 -2.666 5.46E-07 Dr.123013 Transcribed locus Dr.123013 -1.576 2.89E-12 Dr.123021 Transcribed locus Dr.123021 -2.086 1.09E-13 Dr.123049 Transcribed locus Dr.123049 -1.814 5.00E-05 Dr.123107 Transcribed locus Dr.123107 -2.367 8.06E-06 Dr.123119 Transcribed locus Dr.123119 -1.627 1.41E-10 -2.299 1.28E-09 Dr.123122 Transcribed locus Dr.123122 -1.983 7.00E-05 Dr.123130 Transcribed locus Dr.123130 -1.521 8.00E-05 Dr.123148 Transcribed locus Dr.123148 -1.598 1.25E-08
Transcribed locus, strongly similar to XP_001343436.1 similar to Dr.123153 ZNF318 protein [Danio rerio] Dr.123153 -2.337 2.66E-18 Transcribed locus, moderately similar to XP_684333.2 hypothetical protein, partial [Danio Dr.123160 rerio] Dr.123160 -1.552 4.19E-13 Dr.123165 Transcribed locus Dr.123165 -1.562 4.52E-12 Dr.123168 Transcribed locus Dr.123168 -10.309 0.00E+00 Dr.123195 Transcribed locus Dr.123195 -1.960 6.55E-09 Dr.123211 Transcribed locus Dr.123211 -1.830 7.84E-28 Dr.123221 Transcribed locus Dr.123221 -4.286 0.00E+00 Dr.123319 Transcribed locus Dr.123319 -1.688 2.21E-09 Dr.123321 Transcribed locus Dr.123321 -2.008 6.26E-34 Dr.123327 Transcribed locus Dr.123327 -1.777 4.42E-06 Dr.123328 Transcribed locus Dr.123328 -2.825 4.07E-19 Transcribed locus, moderately similar to NP_071504.2 carboxylase precursor [Homo Dr.123380 sapiens] Dr.123380 -2.308 2.04E-07
Transcribed locus, weakly similar to XP_426430.1 similar to papilin Dr.123421 [Gallus gallus] Dr.123421 -3.919 1.20E-16 Transcribed locus, weakly similar to XP_001111945.1 similar to Molybdenum cofactor synthesis protein cinnamon [Macaca Dr.123433 mulatta] Dr.123433 -1.566 1.70E-08 Dr.123507 Transcribed locus Dr.123507 -1.912 7.22E-15 Dr.123514 Transcribed locus Dr.123514 -2.045 9.93E-08 Dr.123516 Transcribed locus Dr.123516 -1.584 9.00E-05 Dr.123581 Transcribed locus Dr.123581 -1.715 4.35E-07 Dr.123618 Transcribed locus Dr.123618 -2.096 2.69E-08 Dr.123623 Transcribed locus Dr.123623 -1.563 2.57E-07 Dr.123651 Transcribed locus Dr.123651 -2.910 3.00E-05 Dr.123661 Transcribed locus Dr.123661 -1.726 2.91E-09 Dr.123673 Transcribed locus Dr.123673 -1.818 3.00E-05 Dr.123680 Transcribed locus Dr.123680 -1.776 2.20E-22 Dr.123750 Transcribed locus Dr.123750 -1.675 8.06E-07 Dr.123752 Transcribed locus Dr.123752 -2.152 9.77E-08 Dr.123773 Transcribed locus Dr.123773 -1.930 1.98E-21 Dr.123790 Transcribed locus Dr.123790 -2.277 3.08E-43 Dr.123795 Transcribed locus Dr.123795 -1.934 1.06E-22 Dr.123856 Transcribed locus Dr.123856 -1.648 8.05E-11 Dr.123864 Transcribed locus Dr.123864 -1.584 3.52E-06 Dr.123981 Transcribed locus Dr.123981 -5.074 4.24E-15 -4.386 4.00E-05 Dr.123991 Transcribed locus Dr.123991 -3.675 1.03E-15 Dr.124063 Transcribed locus Dr.124063 -1.516 6.75E-06 Dr.124074 Transcribed locus Dr.124074 -3.341 2.16E-07 Dr.124651 Transcribed locus Dr.124651 -3.419 4.29E-07 Dr.124668 Transcribed locus Dr.124668 -1.639 8.00E-05
Transcribed locus, moderately similar to XP_001082626.1 similar to dachshund homolog 1 isoform a isoform 3 [Macaca Dr.124697 mulatta] Dr.124697 -1.715 7.82E-06 Dr.124699 Transcribed locus Dr.124699 -3.526 5.73E-32 Dr.12474 Transcribed locus Dr.12474 -2.631 2.54E-19 Dr.124926 Transcribed locus Dr.124926 -3.169 3.71E-15 Dr.124946 Transcribed locus Dr.124946 -2.526 1.00E-05 Dr.124956 Transcribed locus Dr.124956 -1.578 3.84E-08 Dr.124983 Transcribed locus Dr.124983 -3.822 2.17E-17 Transcribed locus, weakly similar to XP_001099933.1 similar to ankyrin repeat and SOCS box- containing protein 14 [Macaca Dr.125002 mulatta] Dr.125002 -2.325 5.01E-10 Transcribed locus, weakly similar to NP_066269.1 gamma C Dr.125133 [Homo sapiens] Dr.125133 -4.682 1.11E-42 Transcribed locus, weakly similar to XP_001104203.1 similar to tubulin, beta 8 isoform 2 [Macaca Dr.125143 mulatta] Dr.125143 -3.211 1.43E-32 Dr.125154 Transcribed locus Dr.125154 -2.407 0.00E+00 Dr.125165 Transcribed locus Dr.125165 -1.523 1.20E-08 Dr.125384 Transcribed locus Dr.125384 -2.396 8.15E-35 Dr.125752 Transcribed locus Dr.125752 -1.771 2.00E-05
Transcribed locus, weakly similar to XP_001108659.1 protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform (calcineurin A alpha) isoform 5 Dr.125802 [Macaca mulatta] Dr.125802 -1.605 1.62E-12
Transcribed locus, strongly similar to XP_691964.2 similar to anaplastic lymphoma kinase (Ki- Dr.125887 1), [Danio rerio] Dr.125887 -1.868 3.57E-06
Transcribed locus, strongly similar to XP_001088312.1 similar to Actin, alpha cardiac (Alpha- cardiac actin) isoform 2 [Macaca Dr.125894 mulatta] Dr.125894 -1.696 1.28E-09 -1.880 1.00E-04
Transcribed locus, weakly similar to XP_001109611.1 similar to ataxin 2-binding protein 1 isoform Dr.126069 4 [Macaca mulatta] Dr.126069 -2.026 1.79E-06
Transcribed locus, moderately similar to XP_001090739.1 similar to tubulin, alpha 1 [Macaca Dr.126160 mulatta] Dr.126160 -2.240 2.49E-13 Transcribed locus, weakly similar to NP_065708.1 finger protein Dr.126204 304 [Homo sapiens] Dr.126204 -5.676 3.34E-08 Transcribed locus, weakly similar to NP_066269.1 gamma C Dr.126413 [Homo sapiens] Dr.126413 -1.772 5.00E-05 Dr.12642 Transcribed locus Dr.12642 -2.952 1.34E-14 Dr.126421 Transcribed locus Dr.126421 -3.209 2.02E-24 Dr.126489 Transcribed locus Dr.126489 -1.756 5.00E-05 Dr.126534 Transcribed locus Dr.126534 -2.080 6.49E-06 Dr.126656 Transcribed locus Dr.126656 -1.966 5.66E-06 Dr.127364 Transcribed locus Dr.127364 -2.590 3.31E-25 Dr.127471 Transcribed locus Dr.127471 -2.618 3.89E-17 Dr.127474 Transcribed locus Dr.127474 -1.745 1.28E-06 Dr.12769 Transcribed locus Dr.12769 -1.516 5.37E-11 Dr.12797 Transcribed locus Dr.12797 -2.024 9.22E-08 Dr.128222 Transcribed locus Dr.128222 -2.891 3.21E-07 Dr.12823 Transcribed locus Dr.12823 -1.872 4.37E-07 -5.669 3.55E-40 Dr.128803 Transcribed locus Dr.128803 -2.357 2.60E-10 Dr.128864 Transcribed locus Dr.128864 -1.751 2.50E-11 Dr.128876 Transcribed locus Dr.128876 -1.536 3.32E-10 Dr.128926 Transcribed locus Dr.128926 -1.884 6.02E-11 Dr.129203 Transcribed locus Dr.129203 -1.765 3.53E-12 Dr.129211 Transcribed locus Dr.129211 -3.312 5.81E-40 Dr.129467 Transcribed locus Dr.129467 -2.276 3.82E-07
Transcribed locus, moderately similar to XP_001084401.1 similar to 60S ribosomal protein Dr.129805 L26 [Macaca mulatta] Dr.129805 -1.944 1.51E-07 -1.711 8.52E-06 Dr.129833 Transcribed locus Dr.129833 -1.997 7.22E-21 Dr.130250 Transcribed locus Dr.130250 -2.208 1.00E-04 Dr.130694 Transcribed locus Dr.130694 -1.588 6.87E-06 Dr.130898 Transcribed locus Dr.130898 -1.814 4.00E-05
Transcribed locus, weakly similar to XP_001115982.1 similar to nuclear RNA export factor 1 Dr.130956 isoform 5 [Macaca mulatta] Dr.130956 -1.935 1.87E-10 Dr.131292 Transcribed locus Dr.131292 -2.881 3.14E-06 Transcribed locus, weakly similar to NP_062278.2 2 [Mus Dr.131488 musculus] Dr.131488 -2.248 3.14E-11 Dr.131509 Transcribed locus Dr.131509 -2.094 1.67E-13 Dr.131647 Transcribed locus Dr.131647 -1.818 3.99E-11 Dr.131671 Transcribed locus Dr.131671 -1.697 1.34E-17 Dr.131770 Transcribed locus Dr.131770 -2.377 2.79E-29 Dr.131784 Transcribed locus Dr.131784 -2.005 4.80E-08 Dr.131801 Transcribed locus Dr.131801 -1.727 5.36E-06 Dr.131941 Transcribed locus Dr.131941 -2.153 1.00E-16 Transcribed locus, weakly similar to XP_001102263.1 similar to solute carrier family 5 (sodium/glucose cotransporter), member 9, partial [Macaca Dr.131951 mulatta] Dr.131951 -1.792 1.06E-18 Dr.132049 Transcribed locus Dr.132049 -7.200 4.52E-06
Transcribed locus, moderately similar to XP_001113078.1 similar to protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b Dr.132068 [Macaca mulatta] Dr.132068 -1.578 7.56E-08 Dr.132082 Transcribed locus Dr.132082 -4.329 2.55E-13 Transcribed locus, weakly similar to XP_001100571.1 similar to keratin 10 isoform 2 [Macaca Dr.132092 mulatta] Dr.132092 -2.720 1.02E-10 Dr.132093 Transcribed locus Dr.132093 -1.686 4.72E-07 Dr.132151 Transcribed locus Dr.132151 -2.595 6.16E-11 Dr.132218 Transcribed locus Dr.132218 -1.714 2.00E-05 -1.640 3.00E-05 Dr.132355 Transcribed locus Dr.132355 -2.066 4.58E-21 Dr.132373 Transcribed locus Dr.132373 -1.681 2.45E-18 Dr.132377 Transcribed locus Dr.132377 -1.562 2.79E-08 Transcribed locus, weakly similar to XP_001104203.1 similar to tubulin, beta 8 isoform 2 [Macaca Dr.132411 mulatta] Dr.132411 -1.962 1.06E-19 Dr.132610 Transcribed locus Dr.132610 -2.612 5.32E-08 Dr.132675 Transcribed locus Dr.132675 -1.508 4.57E-06 Dr.132694 Transcribed locus Dr.132694 -3.439 1.17E-08
Transcribed locus, strongly similar to XP_001087479.1 similar to RNA binding motif protein 25 Dr.132723 isoform 3 [Macaca mulatta] Dr.132723 -1.513 9.00E-05 Dr.132854 Transcribed locus Dr.132854 -3.000 9.41E-13 Dr.132960 Transcribed locus Dr.132960 -1.630 5.74E-24 Dr.132962 Transcribed locus Dr.132962 -1.772 4.21E-16 Dr.132991 Transcribed locus Dr.132991 -2.673 2.76E-15 Dr.132997 Transcribed locus Dr.132997 -1.840 1.40E-10
Transcribed locus, weakly similar to XP_520327.2 hypothetical Dr.133001 protein [Pan troglodytes] Dr.133001 -1.849 2.00E-05 Dr.133100 Transcribed locus Dr.133100 -1.730 2.19E-10 Dr.133102 Transcribed locus Dr.133102 -1.626 2.00E-05 Dr.133115 Transcribed locus Dr.133115 -2.035 8.54E-13 Dr.133159 Transcribed locus Dr.133159 -1.540 3.07E-09 Dr.133188 Transcribed locus Dr.133188 -2.840 4.33E-29 Dr.133232 Transcribed locus Dr.133232 -1.737 2.23E-06 Dr.133237 Transcribed locus Dr.133237 -1.668 4.27E-09 Dr.133247 Transcribed locus Dr.133247 -1.644 2.06E-09
Transcribed locus, moderately similar to XP_001113107.1 similar to fibrillin 1 precursor Dr.133255 [Macaca mulatta] Dr.133255 -1.744 3.00E-05 Dr.133343 Transcribed locus Dr.133343 -6.095 2.34E-09 Dr.133368 Transcribed locus Dr.133368 -1.984 2.94E-07 Dr.133398 Transcribed locus Dr.133398 -2.263 4.01E-19 Dr.133421 Transcribed locus Dr.133421 -2.354 4.00E-05 Dr.133426 Transcribed locus Dr.133426 -2.749 2.91E-07 Dr.133501 Transcribed locus Dr.133501 -1.519 8.13E-06 Dr.133516 Transcribed locus Dr.133516 -2.504 4.95E-19 Dr.133523 Transcribed locus Dr.133523 -5.799 5.00E-06 Transcribed locus, weakly similar to XP_001104928.1 similar to notch1-induced protein [Macaca Dr.133524 mulatta] Dr.133524 -1.729 8.57E-11 Dr.133538 Transcribed locus Dr.133538 -2.795 5.20E-35
Transcribed locus, weakly similar to XP_001089456.1 plasma membrane calcium ATPase 2, Dr.133593 partial [Macaca mulatta] Dr.133593 -3.713 2.21E-07 Dr.133664 Transcribed locus Dr.133664 -1.766 2.00E-05 Dr.133672 Transcribed locus Dr.133672 -9.252 3.88E-19 Dr.133705 Transcribed locus Dr.133705 -2.033 7.57E-07 Dr.133752 Transcribed locus Dr.133752 -1.504 4.22E-06 Dr.133758 Transcribed locus Dr.133758 -2.082 1.05E-10
Transcribed locus, moderately similar to XP_001092961.1 similar to CG9047-PA, isoform A Dr.133767 [Macaca mulatta] Dr.133767 -1.761 1.57E-09 Dr.134581 Transcribed locus Dr.134581 -2.992 7.88E-07 Dr.134582 Transcribed locus Dr.134582 -2.490 9.39E-15 -1.994 3.01E-09 Dr.134588 Transcribed locus Dr.134588 -1.680 1.36E-06 Dr.13475 Transcribed locus Dr.13475 -1.794 9.81E-07 Dr.134753 Transcribed locus Dr.134753 -1.614 7.21E-06 Dr.134767 Transcribed locus Dr.134767 -1.921 1.54E-11 Dr.135072 Transcribed locus Dr.135072 -1.686 2.34E-07 Dr.135155 Transcribed locus Dr.135155 -1.999 1.00E-04 Dr.135177 Transcribed locus Dr.135177 -1.648 9.00E-05 Dr.135841 Transcribed locus Dr.135841 -1.571 1.07E-07 Dr.137583 Transcribed locus Dr.137583 -1.794 3.48E-07
Transcribed locus, weakly similar to XP_001105179.1 similar to patched domain containing 3 Dr.13837 [Macaca mulatta] Dr.13837 -2.036 9.00E-05 Dr.13875 Transcribed locus Dr.13875 -1.812 4.31E-06 Dr.13934 Transcribed locus Dr.13934 -2.662 6.38E-06 Dr.139973 Transcribed locus Dr.139973 -2.042 2.10E-13 Dr.140401 Transcribed locus Dr.140401 -1.699 8.68E-15
Transcribed locus, strongly similar to XP_001113390.1 neural precursor cell expressed, developmentally down-regulated 8 Dr.140445 [Macaca mulatta] Dr.140445 -2.007 3.59E-06 Dr.140473 Transcribed locus Dr.140473 -1.626 1.60E-29 Dr.140570 Transcribed locus Dr.140570 -4.571 2.22E-09 Dr.140589 CDNA clone IMAGE:7177046 Dr.140589 -1.953 1.00E-05
Transcribed locus, weakly similar to XP_001106483.1 similar to mammary tumor virus receptor 2 Dr.140617 isoform-like [Macaca mulatta] Dr.140617 -1.666 8.00E-05 Dr.140663 Transcribed locus Dr.140663 -1.667 5.70E-18 Dr.140672 Transcribed locus Dr.140672 -1.878 2.00E-05 -2.415 5.94E-11
Transcribed locus, weakly similar to XP_001105201.1 fructose-1,6- bisphosphatase 1 isoform 1 Dr.140686 [Macaca mulatta] Dr.140686 -1.945 2.23E-19 Transcribed locus, weakly similar to NP_766266.3 acyl-CoA dehydrogenase VLCAD homolog Dr.140721 [Mus musculus] Dr.140721 -2.326 4.01E-14 Transcribed locus, weakly similar to NP_001035802.1 tyrosine phosphatase, receptor type, D isoform 5 precursor [Homo Dr.140726 sapiens] Dr.140726 -3.855 1.06E-17 Dr.14074 Transcribed locus Dr.14074 -1.658 2.55E-08 Dr.140743 Transcribed locus Dr.140743 -7.870 1.00E-05
Transcribed locus, weakly similar to XP_001111693.1 hepatoma- derived growth factor, related Dr.140791 protein 3 [Macaca mulatta] Dr.140791 -1.575 2.97E-06 -2.243 3.46E-30 Transcribed locus, weakly similar to XP_001093258.1 hypothetical protein isoform 2 [Macaca Dr.140812 mulatta] Dr.140812 -1.589 2.90E-09 Dr.140827 Transcribed locus Dr.140827 -1.765 2.22E-25 Dr.140861 Transcribed locus Dr.140861 -1.782 1.75E-16
Transcribed locus, moderately similar to XP_001115197.1 hypothetical protein [Macaca Dr.140874 mulatta] Dr.140874 -2.533 6.60E-07
Transcribed locus, weakly similar to XP_001099879.1 similar to NCK-associated protein 1 isoform Dr.141044 2 [Macaca mulatta] Dr.141044 -3.796 3.97E-08 Dr.14119 Transcribed locus Dr.14119 -1.871 2.65E-10 Dr.141524 Transcribed locus Dr.141524 -1.599 3.17E-09 Dr.141562 Transcribed locus Dr.141562 -1.880 1.08E-24 Dr.14167 Transcribed locus Dr.14167 -1.549 6.00E-05 -2.939 2.08E-32 Dr.14317 Transcribed locus Dr.14317 -2.058 9.78E-13 Dr.14578 Transcribed locus Dr.14578 -1.653 1.00E-05 -1.645 6.00E-05 -2.457 1.81E-11 Dr.14761 Transcribed locus Dr.14761 -2.476 1.48E-12 Dr.14782 Transcribed locus Dr.14782 -2.119 7.00E-05 Dr.14870 Transcribed locus Dr.14870 -2.058 2.00E-05 Dr.15215 Transcribed locus Dr.15215 -1.663 7.21E-22 Dr.15245 Transcribed locus Dr.15245 -1.554 2.58E-06 -2.215 9.93E-15 Dr.15621 Transcribed locus Dr.15621 -10.487 1.36E-06
Transcribed locus, strongly similar to XP_001330938.1 hypothetical Dr.15757 protein [Danio rerio] Dr.15757 -1.630 2.97E-11 Dr.16097 Transcribed locus Dr.16097 -3.116 4.30E-16 Dr.16319 Transcribed locus Dr.16319 -1.807 1.11E-10
Transcribed locus, moderately similar to XP_001084127.1 regulating synaptic membrane exocytosis 3 isoform 1 [Macaca Dr.16325 mulatta] Dr.16325 -1.962 2.43E-12 Dr.16373 Transcribed locus Dr.16373 -1.878 9.15E-29 Dr.16782 Transcribed locus Dr.16782 -1.620 5.79E-09 Dr.16786 Transcribed locus Dr.16786 -1.608 6.50E-07 Dr.16919 Transcribed locus Dr.16919 -1.881 4.28E-18 Dr.17 Transcribed locus Dr.17 -1.603 5.62E-06 Dr.17820 Transcribed locus Dr.17820 -1.928 1.82E-12 Dr.18656 Transcribed locus Dr.18656 -1.988 2.59E-08 Dr.18980 Transcribed locus Dr.18980 -1.619 2.22E-06 Dr.19055 Transcribed locus Dr.19055 -2.186 1.00E-05 Dr.19769 Transcribed locus Dr.19769 -1.693 8.00E-05
Transcribed locus, moderately similar to XP_686398.1 similar to mammary tumor virus receptor 2 Dr.22344 (predicted) [Danio rerio] Dr.22344 -1.539 8.81E-06 Dr.22350 Transcribed locus Dr.22350 -3.111 2.97E-07 Dr.22437 Transcribed locus Dr.22437 -2.052 4.27E-34 Dr.22715 Transcribed locus Dr.22715 -2.203 6.99E-17 Dr.22827 Transcribed locus Dr.22827 -2.245 3.07E-17
Transcribed locus, strongly similar to NP_956362.1 protein Dr.22968 LOC337489 [Danio rerio] Dr.22968 -2.015 1.34E-20 Dr.23571 Transcribed locus Dr.23571 -2.206 3.38E-17 Dr.23828 Transcribed locus Dr.23828 -1.950 6.54E-11 Dr.26104 Transcribed locus Dr.26104 -5.920 2.29E-08 Dr.28338 Transcribed locus Dr.28338 -1.614 7.00E-05 Dr.28585 Transcribed locus Dr.28585 -1.511 1.80E-06 -1.512 6.76E-07 Dr.28831 Transcribed locus Dr.28831 -1.618 2.09E-06 Dr.28905 Transcribed locus Dr.28905 -1.746 9.00E-05 Dr.29649 Transcribed locus Dr.29649 -2.063 7.00E-33 Dr.30001 Transcribed locus Dr.30001 -1.671 3.00E-15 Dr.30688 Transcribed locus Dr.30688 -3.023 9.05E-07 Dr.30762 Transcribed locus Dr.30762 -2.107 6.03E-15
Transcribed locus, moderately similar to XP_001095785.1 similar to RIO kinase 2 [Macaca Dr.31035 mulatta] Dr.31035 -1.877 1.23E-08 Transcribed locus, weakly similar to NP_001036068.1 binding protein 2 isoform 1 [Homo Dr.40900 sapiens] Dr.40900 -1.506 6.00E-05 Dr.41245 Transcribed locus Dr.41245 -1.554 1.40E-45 Dr.42256 Transcribed locus Dr.42256 -1.782 5.65E-17
Transcribed locus, weakly similar to NP_066962.1 glycosyltransferase 2 family, Dr.42665 polypeptide B4 [Homo sapiens] Dr.42665 -1.515 2.43E-07 Dr.48127 Transcribed locus Dr.48127 -3.239 0.00E+00 Dr.49140 Transcribed locus Dr.49140 -1.682 3.00E-05 Dr.51813 CDNA clone IMAGE:7911771 Dr.51813 -1.638 8.13E-06 Dr.5571 Transcribed locus Dr.5571 -1.622 8.41E-06 Transcribed locus, weakly similar to XP_001107024.1 similar to HIRA interacting protein 3 Dr.6092 [Macaca mulatta] Dr.6092 -1.641 6.50E-10 Dr.6608 Transcribed locus Dr.6608 -1.909 6.70E-07 Dr.67399 Transcribed locus Dr.67399 -1.573 8.40E-08 Dr.68835 Transcribed locus Dr.68835 -2.162 1.71E-06 Dr.70517 Transcribed locus Dr.70517 -1.858 1.06E-06 Dr.70885 Transcribed locus Dr.70885 -2.867 0.00E+00 Dr.72342 Transcribed locus Dr.72342 -1.622 2.11E-20 -10.167 0.00E+00 Dr.74508 Transcribed locus Dr.74508 -1.598 2.01E-06 Dr.74691 Transcribed locus Dr.74691 -1.887 3.23E-14 Dr.75146 Transcribed locus Dr.75146 -1.843 9.70E-09 Dr.75644 Transcribed locus Dr.75644 -3.074 0.00E+00 Dr.76143 Transcribed locus Dr.76143 -1.736 2.00E-05 Dr.76712 Transcribed locus Dr.76712 -1.912 5.18E-13 Dr.76725 Transcribed locus Dr.76725 -2.913 4.00E-05 -8.105 5.24E-08
Transcribed locus, weakly similar to XP_001097218.1 similar to SLIT-ROBO Rho GTPase activating protein 3 isoform a Dr.76845 isoform 1 [Macaca mulatta] Dr.76845 -1.748 2.61E-08 Dr.77144 Transcribed locus Dr.77144 -1.985 4.60E-12 Dr.77378 Transcribed locus Dr.77378 -2.297 8.56E-29 Dr.77934 Transcribed locus Dr.77934 -1.681 6.15E-06 Dr.77941 Transcribed locus Dr.77941 -1.672 1.00E-05
Transcribed locus, weakly similar to XP_001105941.1 similar to molybdenum cofactor sulfurase Dr.77994 [Macaca mulatta] Dr.77994 -1.906 2.96E-06 Dr.78219 Transcribed locus Dr.78219 -2.606 1.01E-11 Dr.78245 CDNA clone IMAGE:7220766 Dr.78245 -1.560 3.00E-05 Dr.78353 Transcribed locus Dr.78353 -3.583 2.18E-07 Dr.78418 Transcribed locus Dr.78418 -2.062 3.00E-13 Dr.78420 Transcribed locus Dr.78420 -1.530 1.51E-08 -1.781 7.51E-10
Transcribed locus, moderately similar to XP_001102735.1 similar to zinc finger protein 536 Dr.78593 [Macaca mulatta] Dr.78593 -1.890 1.74E-06 Dr.78687 Transcribed locus Dr.78687 -2.257 7.42E-10 Dr.78762 Transcribed locus Dr.78762 -1.613 3.37E-07 Transcribed locus, strongly similar to NP_997849.1 2-like [Danio Dr.78788 rerio] Dr.78788 -1.632 1.65E-09 Dr.78817 Transcribed locus Dr.78817 -3.446 6.00E-05 Dr.78846 Transcribed locus Dr.78846 -1.501 3.00E-05 Dr.78860 CDNA clone IMAGE:7136240 Dr.78860 -1.534 6.47E-09 Dr.79065 Transcribed locus Dr.79065 -1.821 8.70E-06 Dr.79067 Transcribed locus Dr.79067 -1.829 9.01E-22 Dr.79238 Transcribed locus Dr.79238 -3.473 1.00E-05 Dr.79560 Transcribed locus Dr.79560 -1.506 1.87E-07 Dr.79577 Transcribed locus Dr.79577 -1.820 2.00E-05 Dr.79636 Transcribed locus Dr.79636 -2.007 4.03E-18 Dr.79750 Transcribed locus Dr.79750 -1.664 6.51E-09 Dr.79843 Transcribed locus Dr.79843 -1.691 1.29E-09 Dr.79979 Transcribed locus Dr.79979 -1.711 9.21E-09 Dr.80051 Transcribed locus Dr.80051 -1.780 2.47E-15 Dr.80071 Transcribed locus Dr.80071 -1.881 1.17E-10 Dr.8012 Transcribed locus Dr.8012 -1.659 4.00E-05 Dr.80203 Transcribed locus Dr.80203 -1.626 3.48E-08 Dr.80221 Transcribed locus Dr.80221 -1.701 6.00E-05 Dr.80441 Transcribed locus Dr.80441 -1.839 6.44E-22 Dr.80611 Transcribed locus Dr.80611 -2.085 7.54E-18
Transcribed locus, weakly similar to XP_001344229.1 hypothetical Dr.80672 protein [Danio rerio] Dr.80672 -1.696 7.68E-13
Transcribed locus, weakly similar to XP_001081857.1 similar to tubulin-specific chaperone d Dr.80786 [Rattus norvegicus] Dr.80786 -2.429 5.05E-07 Dr.80902 Transcribed locus Dr.80902 -2.147 3.06E-09 Dr.80904 Transcribed locus Dr.80904 -2.511 6.00E-05 Dr.80983 Transcribed locus Dr.80983 -1.801 2.43E-10 Dr.81027 Transcribed locus Dr.81027 -1.804 5.00E-05 Dr.81082 Transcribed locus Dr.81082 -2.788 5.96E-31 Dr.8110 Transcribed locus Dr.8110 -1.725 7.00E-05 Dr.81158 Transcribed locus Dr.81158 -1.735 0.00E+00 Dr.81496 Transcribed locus Dr.81496 -1.732 3.45E-17
Transcribed locus, strongly similar to XP_692533.1 similar to cDNA Dr.81703 sequence BC037674 [Danio rerio] Dr.81703 -1.833 3.45E-23 Dr.81922 Transcribed locus Dr.81922 -1.685 3.46E-06 Dr.81936 Transcribed locus Dr.81936 -2.018 9.22E-06 Dr.81953 Transcribed locus Dr.81953 -1.583 1.50E-19 Dr.81981 Transcribed locus Dr.81981 -2.494 9.40E-08
Transcribed locus, moderately similar to XP_001337741.1 Dr.82165 hypothetical protein [Danio rerio] Dr.82165 -1.596 4.72E-07 Dr.82198 Transcribed locus Dr.82198 -1.814 4.35E-10 -1.755 4.14E-07 Dr.82200 Transcribed locus Dr.82200 -1.833 6.73E-11 Dr.82295 Transcribed locus Dr.82295 -3.285 2.32E-16 Dr.82462 Transcribed locus Dr.82462 -1.568 1.00E-05 Dr.82495 Transcribed locus Dr.82495 -3.774 5.13E-06 Dr.82644 Transcribed locus Dr.82644 -2.187 4.38E-08 Dr.82651 Transcribed locus Dr.82651 -1.504 2.00E-05 Dr.82700 Transcribed locus Dr.82700 -2.793 5.54E-06 Dr.82741 Transcribed locus Dr.82741 -12.849 4.02E-06 Dr.82767 Transcribed locus Dr.82767 -1.511 4.27E-12 Dr.82788 Transcribed locus Dr.82788 -1.828 5.00E-07 Dr.82797 Transcribed locus Dr.82797 -4.919 9.22E-19 Dr.82804 Transcribed locus Dr.82804 -1.689 3.53E-06 Transcribed locus, weakly similar to XP_001099632.1 leucine rich repeat neuronal 1 [Macaca Dr.82818 mulatta] Dr.82818 -1.599 3.03E-06 Dr.82883 Transcribed locus Dr.82883 -3.289 3.00E-05 Dr.82887 Transcribed locus Dr.82887 -2.620 6.37E-23 Dr.82902 Transcribed locus Dr.82902 -1.832 2.36E-13 Dr.82913 Transcribed locus Dr.82913 -2.106 3.00E-05 Dr.82917 Transcribed locus Dr.82917 -1.887 4.25E-18 Dr.82924 Transcribed locus Dr.82924 -3.247 9.04E-21 Dr.82995 Transcribed locus Dr.82995 -2.035 4.41E-09 Dr.83069 Transcribed locus Dr.83069 -1.980 1.00E-05 Dr.83123 Transcribed locus Dr.83123 -2.452 6.00E-05
Transcribed locus, weakly similar to XP_001112624.1 similar to RUN domain containing 1 Dr.83157 [Macaca mulatta] Dr.83157 -2.934 5.00E-05 Dr.83158 Transcribed locus Dr.83158 -1.888 4.78E-13 Dr.83201 Transcribed locus Dr.83201 -2.335 5.00E-05 Dr.83202 Transcribed locus Dr.83202 -1.860 7.55E-07 Dr.83203 Transcribed locus Dr.83203 -1.926 3.16E-34
Transcribed locus, moderately similar to XP_001093326.1 similar to WD repeat, SAM and U- box domain containing 1 [Macaca Dr.83204 mulatta] Dr.83204 -1.635 4.17E-09 Dr.83209 Transcribed locus Dr.83209 -2.464 8.22E-06 Dr.83244 Transcribed locus Dr.83244 -1.533 3.00E-12 Dr.83285 Transcribed locus Dr.83285 -1.710 1.77E-09 Dr.83355 Transcribed locus Dr.83355 -2.004 2.35E-06 Dr.83358 Transcribed locus Dr.83358 -1.893 4.94E-07 Dr.83377 Transcribed locus Dr.83377 -3.835 2.90E-11 Dr.83390 Transcribed locus Dr.83390 -13.707 8.94E-08 Dr.83405 Transcribed locus Dr.83405 -1.759 5.88E-10 Dr.83434 Transcribed locus Dr.83434 -3.886 9.00E-05 Dr.83460 Transcribed locus Dr.83460 -1.788 1.00E-04 Dr.83483 Transcribed locus Dr.83483 -6.585 3.60E-15 Dr.83612 Transcribed locus Dr.83612 -2.178 6.47E-27 Dr.83614 Transcribed locus Dr.83614 -3.233 1.01E-12 Dr.83653 Transcribed locus Dr.83653 -1.552 4.81E-11 Dr.83690 Transcribed locus Dr.83690 -1.895 9.20E-11
Transcribed locus, weakly similar to XP_001232842.1 hypothetical Dr.83700 protein [Gallus gallus] Dr.83700 -3.792 4.35E-29 Dr.83752 Transcribed locus Dr.83752 -1.555 8.00E-05 Dr.83854 Transcribed locus Dr.83854 -3.181 1.81E-15 Dr.83865 Transcribed locus Dr.83865 -2.473 3.00E-05 Dr.83922 Transcribed locus Dr.83922 -2.402 7.52E-08 -3.488 3.51E-06 Dr.83951 Transcribed locus Dr.83951 -2.607 5.17E-12 Dr.84001 Transcribed locus Dr.84001 -3.945 6.27E-07 Dr.84080 Transcribed locus Dr.84080 -14.209 0.00E+00 Transcribed locus, moderately similar to XP_001332424.1 Dr.84084 hypothetical protein [Danio rerio] Dr.84084 -1.586 2.00E-05 Dr.84292 Transcribed locus Dr.84292 -1.611 1.00E-05 -1.562 3.00E-05 Dr.84330 Transcribed locus Dr.84330 -6.883 3.00E-05 Dr.84334 Transcribed locus Dr.84334 -1.831 1.43E-17 Dr.84352 Transcribed locus Dr.84352 -2.770 7.50E-33 Dr.84369 Transcribed locus Dr.84369 -2.226 4.54E-09 Dr.84371 Transcribed locus Dr.84371 -1.516 4.41E-11 Dr.84376 Transcribed locus Dr.84376 -1.512 8.75E-07 Dr.84380 Transcribed locus Dr.84380 -2.055 6.61E-12 Dr.84382 Transcribed locus Dr.84382 -1.650 5.00E-05 Dr.84409 Transcribed locus Dr.84409 -5.766 1.49E-12 Dr.84414 Transcribed locus Dr.84414 -1.697 1.00E-05 Dr.84419 Transcribed locus Dr.84419 -1.610 3.21E-10 Dr.84423 Transcribed locus Dr.84423 -1.715 3.79E-09 Dr.84433 Transcribed locus Dr.84433 -1.811 8.54E-06
Transcribed locus, strongly similar to XP_001118935.1 similar to cytoplasmic polyadenylation element binding protein 2 isoform Dr.84447 A [Macaca mulatta] Dr.84447 -1.569 1.48E-10 Dr.84459 Transcribed locus Dr.84459 -1.522 9.00E-05
Transcribed locus, strongly similar to XP_688200.1 similar to high- mobility group protein 2-like 1 Dr.84473 isoform a [Danio rerio] Dr.84473 -1.570 7.81E-06 Dr.84530 Transcribed locus Dr.84530 -1.800 1.30E-13 Dr.84577 Transcribed locus Dr.84577 -1.987 5.00E-05
Transcribed locus, weakly similar to XP_001092813.1 similar to spermatogenesis associated 18 Dr.84591 homolog [Macaca mulatta] Dr.84591 -1.735 1.99E-09 Dr.84613 Transcribed locus Dr.84613 -1.708 2.90E-09 Dr.84615 Transcribed locus Dr.84615 -3.442 5.00E-05 Dr.84675 Transcribed locus Dr.84675 -1.617 2.17E-22 Dr.84752 Transcribed locus Dr.84752 -2.868 4.11E-06 Dr.84753 Transcribed locus Dr.84753 -1.557 5.52E-06 Dr.84755 Transcribed locus Dr.84755 -1.526 1.39E-06 Dr.84775 Transcribed locus Dr.84775 -1.811 4.00E-05 Dr.84783 Transcribed locus Dr.84783 -1.608 6.71E-17 Dr.84799 Transcribed locus Dr.84799 -2.298 4.68E-28 Dr.84805 Transcribed locus Dr.84805 -1.870 3.61E-19 Dr.84819 Transcribed locus Dr.84819 -2.590 4.88E-11 Dr.84828 Transcribed locus Dr.84828 -2.148 1.59E-41 Dr.84831 Transcribed locus Dr.84831 -1.737 1.00E-14
Transcribed locus, weakly similar to XP_001116017.1 similar to phosphoinositide-specific phospholipase C beta 1 isoform a Dr.84832 [Macaca mulatta] Dr.84832 -2.492 9.63E-10
Transcribed locus, weakly similar to XP_222147.4 hypothetical Dr.84861 protein [Rattus norvegicus] Dr.84861 -1.731 4.33E-09 -1.531 3.00E-05 Dr.84864 Transcribed locus Dr.84864 -2.487 6.57E-06 -3.133 1.94E-06 Dr.84918 Transcribed locus Dr.84918 -1.814 6.71E-22 Transcribed locus, weakly similar to XP_001096144.1 similar to non-metastatic cells 1, protein (NM23A) expressed in isoform a Dr.84926 [Macaca mulatta] Dr.84926 -1.597 3.00E-05 -1.915 1.18E-08 Dr.84955 Transcribed locus Dr.84955 -2.264 6.24E-20 Dr.84995 Transcribed locus Dr.84995 -1.585 2.86E-10
Transcribed locus, moderately similar to XP_001093952.1 similar to poly (ADP-ribose) polymerase family, member 8 Dr.84998 isoform 3 [Macaca mulatta] Dr.84998 -1.713 1.92E-07
Transcribed locus, strongly similar to XP_705298.1 hypothetical Dr.85019 protein XP_700206 [Danio rerio] Dr.85019 -2.978 0.00E+00 Dr.85154 Transcribed locus Dr.85154 -6.512 5.00E-05 Dr.85408 CDNA clone IMAGE:7293246 Dr.85408 -3.349 1.00E-05 Dr.85425 Transcribed locus Dr.85425 -2.369 1.00E-04 Transcribed locus, weakly similar to XP_001111792.1 similar to carbohydrate (N- acetylglucosamine-6-O) sulfotransferase 2 [Macaca Dr.85506 mulatta] Dr.85506 -2.921 0.00E+00 Dr.85531 Transcribed locus Dr.85531 -1.516 1.65E-07 Dr.85696 Transcribed locus Dr.85696 -2.043 2.15E-08 Dr.85714 Transcribed locus Dr.85714 -3.507 4.00E-05 Dr.85775 Transcribed locus Dr.85775 -1.898 2.64E-08 Dr.85802 Transcribed locus Dr.85802 -2.210 3.82E-13 Dr.85833 Transcribed locus Dr.85833 -1.840 1.48E-22 Dr.85933 Transcribed locus Dr.85933 -1.511 1.83E-07 Dr.85939 Transcribed locus Dr.85939 -1.897 8.64E-07 Dr.85977 Transcribed locus Dr.85977 -1.935 3.65E-15 Dr.86051 Transcribed locus Dr.86051 -2.479 5.52E-06 Dr.86071 Transcribed locus Dr.86071 -1.851 2.61E-07 Dr.86075 Transcribed locus Dr.86075 -1.538 2.59E-13 Dr.86083 Transcribed locus Dr.86083 -2.160 0.00E+00 Dr.86091 Transcribed locus Dr.86091 -2.704 2.90E-08 Dr.86131 Transcribed locus Dr.86131 -1.549 3.00E-05 Dr.86142 Transcribed locus Dr.86142 -2.566 2.30E-08 Dr.86162 Transcribed locus Dr.86162 -1.831 1.00E-05
Transcribed locus, weakly similar to NP_066962.1 glycosyltransferase 2 family, Dr.86163 polypeptide B4 [Homo sapiens] Dr.86163 -2.803 5.07E-11 Dr.86198 Transcribed locus Dr.86198 -3.031 5.14E-31 Dr.86201 Transcribed locus Dr.86201 -2.587 7.61E-07 Dr.86228 Transcribed locus Dr.86228 -2.309 1.62E-18 Dr.86264 Transcribed locus Dr.86264 -1.670 2.12E-12 Dr.86461 Transcribed locus Dr.86461 -2.379 2.00E-05 Dr.86514 Transcribed locus Dr.86514 -1.888 3.79E-07 -1.736 3.00E-05 Dr.86633 Transcribed locus Dr.86633 -1.610 4.21E-14 Dr.86655 Transcribed locus Dr.86655 -1.653 9.72E-06 Transcribed locus, strongly similar to XP_697511.1 similar to GTPase, IMAP family member 7 Dr.87006 [Danio rerio] Dr.87006 -4.262 1.34E-07 Dr.88255 Transcribed locus Dr.88255 -1.793 7.96E-06 Embryonic shield mRNA, Dr.88294 complete sequence Dr.88294 -1.654 4.10E-11 -2.330 1.28E-13 Dr.88664 Transcribed locus Dr.88664 -1.629 4.94E-19 Dr.88858 Transcribed locus Dr.88858 -8.234 4.70E-08 -5.396 5.07E-08 Dr.89553 Transcribed locus Dr.89553 -1.916 2.33E-20 Dr.89615 Transcribed locus Dr.89615 -1.927 2.81E-06 Dr.9013 Transcribed locus Dr.9013 -1.893 7.84E-13 Dr.90399 Transcribed locus Dr.90399 -1.982 1.58E-11 Dr.90434 Transcribed locus Dr.90434 -2.208 3.77E-26
Transcribed locus, weakly similar to XP_001109969.1 similar to zinc finger protein 385 isoform 3 Dr.90449 [Macaca mulatta] Dr.90449 -1.566 1.72E-09 Dr.90491 Transcribed locus Dr.90491 -2.055 2.70E-08 Dr.90501 Transcribed locus Dr.90501 -1.618 1.98E-07 Dr.90558 Transcribed locus Dr.90558 -1.770 5.27E-10 Dr.90576 Transcribed locus Dr.90576 -1.621 1.44E-09 Dr.90589 Transcribed locus Dr.90589 -1.904 3.00E-05 Dr.90655 Transcribed locus Dr.90655 -3.683 1.57E-11 Dr.90695 Transcribed locus Dr.90695 -1.945 6.00E-05 Dr.90733 Transcribed locus Dr.90733 -2.110 5.24E-07 Dr.90735 Transcribed locus Dr.90735 -2.606 2.38E-15 Dr.90737 Transcribed locus Dr.90737 -1.930 1.40E-20 Transcribed locus, weakly similar to XP_001099789.1 kinesin family member 3A [Macaca Dr.90744 mulatta] Dr.90744 -2.167 7.00E-05 Dr.90773 Transcribed locus Dr.90773 -1.504 6.00E-05 -1.906 8.63E-25 Dr.90839 Transcribed locus Dr.90839 -1.600 2.00E-05 Dr.90938 Transcribed locus Dr.90938 -1.677 1.23E-08 Dr.92105 Transcribed locus Dr.92105 -3.124 6.13E-06 Dr.92144 Transcribed locus Dr.92144 -1.955 1.24E-12
Transcribed locus, moderately similar to NP_000531.1 receptor Dr.92303 1 (skeletal) [Homo sapiens] Dr.92303 -1.753 1.00E-05 Dr.92368 Transcribed locus Dr.92368 -3.476 2.00E-05 Dr.93120 CDNA clone IMAGE:7143041 Dr.93120 -2.563 0.00E+00 Dr.93821 Transcribed locus Dr.93821 -2.146 3.00E-05 Dr.97665 Transcribed locus Dr.97665 -1.746 4.00E-05 Dr.98974 Transcribed locus Dr.98974 -1.886 4.15E-08 DR1-associated protein 1 drap1 (negative cofactor 2 alpha) Dr.719 321681 -1.891 2.79E-14 dspbDesmoplakin b Dr.5502 322942 -1.706 6.70E-18 dtl Denticleless homolog (Drosophila) Dr.3526 192314 -1.722 1.88E-16 Deoxythymidylate kinase dtymk (thymidylate kinase) Dr.108200 30372 -2.146 3.62E-10 dut DUTP pyrophosphatase Dr.1438 449835 -2.878 6.03E-44 dvr1 Decapentaplegic and Vg-related 1 Dr.307 30125 -2.042 3.00E-05 dye Dead eye Dr.653 30172 -2.000 2.77E-06 dynll2 Dynein, light chain, LC8-type 2 Dr.28184 406297 -1.625 1.16E-09 e2f4 E2F transcription factor 4 Dr.77272 406741 -2.406 2.20E-06 ebplEmopamil binding protein-like Dr.74502 368641 -2.191 2.32E-16
Enoyl Coenzyme A hydratase, echs1 short chain, 1, mitochondrial Dr.81180 368912 -1.526 5.19E-40 ednrb1 Endothelin receptor B Dr.82510 30442 -2.606 7.84E-11 eef1d Elongation factor-1, delta Dr.75615 327630 -2.208 1.46E-10 Elongation factor Tu GTP binding eftud2 domain containing 2 Dr.132598 393480 -1.994 0.00E+00 egfl6 EGF-like-domain, multiple 6 Dr.79266 436730 -2.164 8.59E-19 egln3 Egl nine homolog 3 (C. elegans) Dr.9457 406602 -6.385 2.18E-27 ek3 Eph-like kinase 3 Dr.28327 30313 -1.732 3.93E-23 ela2 Elastase 2 Dr.82353 403061 -1.773 5.91E-06 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu elavl4 antigen D) Dr.75061 30737 -2.454 1.20E-30
Engulfment and cell motility 1 (ced- elmo1 12 homolog, C. elegans) Dr.78038 406364 -2.044 0.00E+00 Elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, elovl2 yeast)-like 2 Dr.91457 678614 -1.579 8.68E-11 Elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, elovl4 yeast)-like 4 Dr.81952 335732 -9.668 0.00E+00 ELOVL family member 6, elongation of long chain fatty elovl6 acids (yeast) Dr.107502 317738 -1.523 9.28E-26 Echinoderm microtubule eml2 associated protein like 2 Dr.14063 569375 -2.044 1.79E-19 emx2 Empty spiracles homeobox 2 Dr.75105 30537 -1.669 2.33E-08 emx3 Empty spiracles homeobox 3 Dr.75757 30536 -1.618 1.00E-05 eomesa Eomesodermin homolog a Dr.83042 64603 -1.872 2.31E-12 ephb4a Eph receptor B4a Dr.5764 30688 -1.755 3.00E-12 Epoxide hydrolase 1, microsomal ephx1 (xenobiotic) Dr.110647 322331 -4.713 5.71E-22 epycEpiphycan Dr.43204 449673 -2.749 3.00E-05 Excision repair cross- complementing rodent repair deficiency, complementation ercc3 group 3 Dr.78820 324323 -1.552 6.89E-30 Excision repair cross- complementing rodent repair deficiency, complementation ercc8 group 8 Dr.36769 449811 -1.593 2.66E-07 esrrg Estrogen-related receptor gamma Dr.118937 405890 -2.118 0.00E+00 Estrogen-related receptor gamma- esrrgl like Dr.84786 407691 -1.502 4.00E-05 evx2 Even-skipped homeobox 2 Dr.85397 30479 -1.751 1.28E-06 exorh Extra-ocular rhodopsin Dr.116306 30459 -1.567 5.27E-08 exosc6 Exosome component 6 Dr.80144 326786 -1.687 5.74E-08 Eyes absent homolog 4 eya4 (Drosophila) Dr.85873 541552 -1.633 5.79E-11 Enhancer of zeste homolog 2 ezh2 (Drosophila) Dr.76424 553429 -2.260 1.77E-22 f7 Coagulation factor VII Dr.77162 114423 -1.510 6.99E-06 faah2b Fatty acid amide hydrolase 2b Dr.81626 768298 -4.091 1.03E-07 fabp11l Fatty acid binding protein 11 like Dr.90421 553579 -23.279 6.25E-42 Fatty acid binding protein 7, brain, fabp7a a Dr.20850 58128 -3.230 6.60E-37 fads2 Fatty acid desaturase 2 Dr.120697 140615 -3.130 0.00E+00 faf1 Fas associated factor 1 Dr.75605 406243 -1.550 1.95E-22 Family with sequence similarity fam136a 136, member A Dr.75174 406709 -1.580 4.47E-15 Family with sequence similarity fam49b 49, member B Dr.9526 337591 -1.594 8.27E-20 Family with sequence similarity fam54b 54, member B Dr.118749 334296 -1.610 1.00E-05 Fanconi anemia, complementation fanci group I Dr.77582 324185 -1.796 1.81E-07 Fanconi anemia, complementation fancl group L Dr.85496 406255 -1.633 1.82E-06 fbln2 Fibulin 2 Dr.38135 553503 -3.126 1.28E-23 Fructose-1,6-bisphosphatase 1, fbp1l like Dr.10070 335231 -1.733 2.67E-07 F-box and leucine-rich repeat fbxl14 protein 14b Dr.79118 324835 -1.542 2.67E-08 F-box and leucine-rich repeat fbxl5 protein 5 Dr.76970 322181 -1.963 2.00E-15 -1.607 1.00E-05 fbxo5 F-box protein 5 Dr.79262 445392 -1.980 2.20E-10 F-box and WD-40 domain protein fbxw5 5 Dr.78606 406611 -2.033 0.00E+00 Flap structure-specific fen1 endonuclease 1 Dr.75750 386707 -2.040 1.35E-34 Fasciculation and elongation fez1 protein zeta 1 (zygin I) Dr.116746 406705 -1.674 2.69E-06 fezf2 FEZ family zinc finger 2 Dr.82591 60634 -1.756 1.96E-10 fgdFaciogenital dysplasia Dr.81271 58075 -1.940 4.81E-25 fgf1 Fibroblast growth factor 1 Dr.82932 393733 -1.728 1.53E-10 fgf13 Fibroblast growth factor 13 Dr.7596 492758 -1.510 1.00E-05 Fibroblast growth factor receptor- fgfrl1b like 1b Dr.37960 497135 -3.061 9.00E-05 fkbp10 FK506 binding protein 10 Dr.76253 324381 -3.290 0.00E+00 fkbp11 FK506 binding protein 11 Dr.115215 368823 -1.897 3.07E-12 fkbp4 FK506 binding protein 4 Dr.3473 321795 -2.143 2.28E-27 fkbp7 FK506 binding protein 7 Dr.76008 368498 -4.225 7.40E-22 fkbp9 FK506 binding protein 9 Dr.76879 445126 -2.086 5.00E-05 fli1a Friend leukemia integration 1a Dr.78408 30619 -1.969 1.46E-35 Hypothetical protein FLJ11749- flj11749l like (H. sapiens) Dr.77489 445397 -1.530 1.95E-14 foxc1a Forkhead box C1a Dr.82483 79374 -2.017 5.97E-07 foxd1 Forkhead box D1 Dr.88583 30525 -2.067 1.60E-35 foxg1 Forkhead box G1 Dr.75832 30274 -1.744 1.65E-25 foxl1 Forkhead box L1 Dr.15390 393959 -3.266 1.50E-09 foxn1 Forkhead box N1 Dr.30207 266748 -9.632 7.18E-38 foxo3a Forkhead box O3A Dr.104969 494532 -1.736 1.76E-06 foxp2 Forkhead box P2 Dr.106317 555242 -2.327 4.90E-13 freqb Frequenin homolog b (Drosophila) Dr.35114 553174 -2.520 2.14E-11 frzb Frizzled-related protein Dr.81280 30119 -1.597 4.00E-05 -2.448 5.84E-11 Fibronectin type III and SPRY fsd1 domain containing 1 Dr.16576 566722 -1.830 8.85E-16 Alpha(1,3)fucosyltransferase ft1 gene 1 Dr.85396 30683 -1.755 4.33E-09 Fucosyltransferase 8 (alpha (1,6) fut8 fucosyltransferase) Dr.79249 445378 -1.798 1.48E-20 FXYD domain containing ion fxyd6 transport regulator 6 Dr.26591 333987 -1.701 8.24E-10 FYN oncogene related to SRC, fyna FGR, YES a Dr.118812 373872 -1.819 4.74E-15 fzd10 Frizzled homolog 10 Dr.80513 30366 -1.809 0.00E+00 fzd8a Frizzled homolog 8a Dr.32845 58073 -1.964 0.00E+00 fzd8c Frizzled homolog 8c Dr.81286 30364 -1.549 2.95E-18 fzd9 Frizzled homolog 9 Dr.107616 58023 -2.344 5.18E-37 g22p1 Thyroid autoantigen (Ku antigen) Dr.117225 334488 -1.896 2.80E-45 g22p1 Thyroid autoantigen (Ku antigen) Dr.81334 334488 -1.829 9.24E-14 gad1 Glutamate decarboxylase 1 Dr.81985 378441 -1.694 4.00E-05 gap43 Growth associated protein 43 Dr.92 30608 -1.980 0.00E+00 Glycine amidinotransferase (L- arginine:glycine gatm amidinotransferase) Dr.75520 266799 -2.122 6.86E-36 gbas Glioblastoma amplified sequence Dr.8058 30232 -1.578 2.00E-05 gbx2 Gastrulation brain homeo box 2 Dr.17548 245948 -1.955 3.08E-08 gcat Glycine C-acetyltransferase Dr.79486 402822 -1.572 1.39E-15 -2.605 0.00E+00 gch2 GTP cyclohydrolase 2 Dr.75259 64263 -1.948 2.23E-06 GTP cyclohydrolase I feedback gchfr regulator Dr.82968 393735 -1.528 2.77E-06 Glial cells missing homolog 2 gcm2 (Drosophila) Dr.91436 449615 -1.728 1.95E-08 Ganglioside-induced differentiation-associated protein gdap1 1 Dr.85024 553702 -1.614 9.09E-09 gdf7 Growth/differentiation factor 7 Dr.88610 30642 -1.747 6.26E-09 Glycerophosphodiester phosphodiesterase domain gdpd1 containing 1 Dr.34264 445504 -3.430 0.00E+00 Glycerophosphodiester phosphodiesterase domain gdpd3 containing 3 Dr.114304 406482 -2.615 2.66E-07 gefiltin Gefiltin Dr.75101 30230 -1.526 1.44E-09 gfap Glial fibrillary acidic protein Dr.32667 30646 -1.514 2.24E-20 gfi1 Growth factor independent 1 Dr.89476 394238 -2.238 1.03E-17 gfra1b Gdnf family receptor alpha 1b Dr.117284 79377 -1.610 3.00E-05 glcea Glucuronyl C5-epimerase a Dr.120721 405776 -2.978 1.33E-07 gli3 GLI-Kruppel family member GLI3 Dr.76133 403042 -1.827 2.15E-06 gli3 GLI-Kruppel family member GLI3 Dr.99315 403042 -1.638 8.47E-26 glra3 Glycine receptor, alpha 3 Dr.12384 192124 -1.668 2.46E-09 glra4a Glycine receptor, alpha 4a Dr.82595 83413 -1.573 1.49E-16 glra4b Glycine receptor, alpha 4b Dr.83330 192125 -4.296 5.87E-38 glur1a AMPA receptor subunit GluR1A Dr.102601 402890 -1.594 5.61E-12 Germ cell-less homolog 1 gmcl1 (Drosophila) Dr.3520 322146 -1.553 5.02E-10 gmfb Glia maturation factor, beta Dr.76342 406384 -1.516 3.92E-09 Guanosine monophosphate gmpr2 reductase 2 Dr.49103 322518 -2.189 2.34E-13
Guanine nucleotide binding protein (G protein), alpha gnai2 inhibiting activity polypeptide 2 Dr.80461 327650 -1.902 0.00E+00
Guanine nucleotide binding protein (G protein), alpha gnat1 transducing activity polypeptide 1 Dr.32527 140428 -5.070 1.04E-18 Guanine nucleotide binding protein (G protein), beta gnb3l polypeptide 3, like Dr.32120 436710 -1.818 2.76E-07 -1.588 7.21E-08 -15.995 1.57E-20 Guanine nucleotide binding gng3 protein (G protein), gamma 3 Dr.29006 114462 -2.347 4.14E-27 Guanine nucleotide binding gng7 protein (G protein), gamma 7 Dr.107534 436670 -1.644 6.62E-06
Guanine nucleotide binding protein (G protein), gamma gngt1 transducing activity polypeptide 1 Dr.81940 335656 -1.766 1.00E-05
Guanine nucleotide binding protein (G protein), gamma gngt2 transducing activity polypeptide 2 Dr.19203 335655 -1.546 3.00E-05 -1.654 1.00E-05 -3.180 6.43E-32
N-acetylglucosamine-1-phosphate gnptg transferase, gamma subunit Dr.3328 415147 -1.784 1.65E-06 golph4 Golgi phosphoprotein 4 Dr.2251 474373 -1.600 3.32E-07 golph4 Golgi phosphoprotein 4 Dr.108424 474373 -1.504 1.69E-07 Glycerol-3-phosphate gpd1b dehydrogenase 1b Dr.79210 325181 -2.843 0.00E+00 gpm6aa Glycoprotein M6Aa Dr.118027 368223 -1.664 2.00E-05 gpr143 G protein-coupled receptor 143 Dr.84759 393795 -1.905 1.50E-26 gpr34a G protein-coupled receptor 34a Dr.82252 335288 -1.705 8.00E-05 Gpsm1 AGS3 Dr.115158 493623 -1.641 3.09E-07 Zgc:91987growth factor receptor- grb10 bound protein 10 Dr.105808 446167 -2.151 1.35E-14 -1.515 6.67E-06 -2.010 8.64E-36
Gremlin 1 homolog, cysteine knot grem1 superfamily (Xenopus laevis) Dr.119605 405778 -1.726 6.00E-05 -3.078 4.80E-10 Glyoxylate reductase/hydroxypyruvate grhpr reductase Dr.117776 497183 -2.580 1.06E-09 Glutamate receptor, ionotropic, gria2a AMPA 2a Dr.107958 170450 -1.519 7.00E-05 Glutamate receptor, ionotropic, gria2b AMPA 2b Dr.81161 170451 -1.903 2.46E-10 Growth hormone regulated TBC grtp1 protein 1 Dr.79569 406711 -1.886 6.91E-10 gsnl1 Gelsolin, like 1 Dr.75268 323285 -7.799 8.69E-40 gsnl2 Gelsolin, like 2 Dr.76196 336623 -2.592 0.00E+00 Glutathione S-transferase, alpha- gstal like Dr.23079 406703 -1.764 8.92E-09 gtf2b General transcription factor IIB Dr.78599 324823 -1.516 9.16E-10 General transcription factor IIH, gtf2h2 polypeptide 2 Dr.1630 323239 -1.855 3.28E-28 guk1 Guanylate kinase 1 Dr.82951 393697 -4.952 2.89E-24 h2afv H2A histone family, member V Dr.79682 252913 -1.691 1.46E-09 h2afx H2A histone family, member X Dr.114938 394048 -2.011 1.66E-28 hacl1 2-hydroxyacyl-CoA lyase 1 Dr.33577 406358 -2.937 0.00E+00 Hydroxyacyl-Coenzyme A hadh dehydrogenase Dr.34131 445121 -2.700 0.00E+00 Hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl- Coenzyme A thiolase/enoyl- Coenzyme A hydratase, alpha hadha subunit Dr.765 394202 -2.727 4.30E-12
Hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl- Coenzyme A thiolase/enoyl- Coenzyme A hydratase hadhb (trifunctional protein), beta subunit Dr.4060 336606 -2.253 0.00E+00 has1 Hyaluronan synthase 1 Dr.88031 403130 -1.579 8.00E-05 hbae1 Hemoglobin alpha embryonic-1 Dr.114510 30597 -2.228 9.13E-12 hbae3 Hemoglobin alpha embryonic-3 Dr.1450 30601 -2.344 2.96E-20 hbbe1 Hemoglobin beta embryonic-1 Dr.114511 81538 -2.235 1.41E-08 -2.630 7.00E-05 hbbe3 Hemoglobin beta embryonic-3 Dr.29153 30596 -1.946 5.76E-06 -1.602 2.67E-08 hdac1 Histone deacetylase 1 Dr.31752 192302 -1.822 0.00E+00 hdac8 Histone deacetylase 8 Dr.3849 406740 -1.724 0.00E+00 heatr5a HEAT repeat containing 5a Dr.79139 368728 -1.557 3.81E-14 Hairy/enhancer-of-split related hey1 with YRPW motif 1 Dr.119374 58008 -1.992 1.94E-22 Hairy/enhancer-of-split related hey2 with YRPW motif 2 Dr.81319 58146 -1.526 8.98E-20 hgd Homogentisate 1,2-dioxygenase Dr.120590 259189 -1.677 3.77E-26 Hematopoietically expressed hhex homeobox Dr.79053 30098 -1.591 3.87E-08 hic1 Hypermethylated in cancer 1 Dr.83225 436585 -1.724 2.00E-05 hirip3 HIRA interacting protein 3 Dr.114230 327542 -1.835 2.61E-09 hm:zeh0993 Hm:zeh0993 Dr.36180 321423 -1.786 3.72E-14 hm:zehn0379 Hm:zehn0379 Dr.34433 337718 -1.806 3.40E-23 hm:zehn2160 Hm:zehn2160 Dr.107623 337758 -2.197 2.71E-06 hmgb1 High-mobility group box 1 Dr.76184 321622 -2.023 6.13E-34 hmgb2 High-mobility group box 2 Dr.9743 447936 -1.505 1.52E-08 Hyaluronan mediated motility hmmr receptor Dr.28305 322012 -1.989 1.10E-26
Hematological and neurological hn1l expressed 1-like Dr.76885 321880 -1.648 5.94E-38 Heterogeneous nuclear hnrpa1 ribonucleoprotein A1 Dr.67768 378453 -1.653 4.43E-16 Heterogeneous nuclear hnrpab ribonucleoprotein A/B Dr.75877 321466 -2.193 5.58E-37 Heterogeneous nuclear hnrpdl ribonucleoprotein D-like Dr.75234 406701 -1.653 0.00E+00 Heterogeneous nuclear hnrpkl ribonucleoprotein K, like Dr.47275 406264 -1.937 1.12E-20 Heterogeneous nuclear hnrpl ribonucleoprotein L Dr.118088 406692 -1.624 0.00E+00 Heterogeneous nuclear hnrpu ribonucleoprotein U Dr.75178 334490 -1.763 0.00E+00 Heterogeneous nuclear hnrpul1 ribonucleoprotein U-like 1 Dr.77145 406555 -1.591 8.41E-11 homer1 Homer homolog 1 (Drosophila) Dr.90291 436769 -1.510 6.00E-05 hoxa13b Homeo box A13b Dr.15718 30438 -1.513 6.90E-10 hoxc12a Homeobox c12a Dr.140970 562600 -1.590 2.97E-21 -1.585 4.00E-05 hoxc13b Homeo box C13b Dr.30983 58063 -1.575 4.58E-17 hpxHemopexin Dr.80362 327588 -1.741 1.43E-09 -1.871 4.00E-05 Hydroxysteroid 11-beta hsd11b2 dehydrogenase 2 Dr.80613 334098 -1.701 9.07E-14 Hydroxysteroid (11-beta) hsd11b3 dehydrogenase 3 Dr.78218 393293 -3.016 0.00E+00 Hydroxysteroid (17-beta) hsd17b4 dehydrogenase 4 Dr.4883 393105 -2.386 1.07E-25 Hydroxy-delta-5-steroid dehydrogenase, 3 beta- and hsd3b7 steroid delta-isomerase Dr.32972 327462 -1.733 1.20E-23 Hydroxysteroid dehydrogenase hsdl2 like 2 Dr.77041 322347 -1.742 0.00E+00 hsp70 Heat shock cognate 70-kd protein Dr.114305 30671 -1.761 5.23E-09 htf9c HpaII tiny fragments locus 9c Dr.75151 334936 -1.693 2.32E-07 5-hydroxytryptamine (serotonin) htr5al receptor 5A like Dr.88866 368475 -1.598 9.78E-07 htra1 HtrA serine peptidase 1 Dr.118874 431766 -2.089 1.17E-06 icat Beta-catenin-interacting protein Dr.120421 58117 -2.109 0.00E+00 icn Ictacalcin Dr.67796 336655 -2.721 3.15E-10 icn2 Ictacalcin-2 Dr.118565 100005083 -2.434 1.16E-10 id:ibd1152 Id:ibd1152 Dr.104509 338300 -2.195 3.00E-05 id:ibd2861 Id:ibd2861 Dr.107890 57978 -1.519 8.11E-06 id:ibd3034 Id:ibd3034 Dr.132750 338254 -1.688 1.97E-14 id:ibd3293 Id:ibd3293 Dr.59620 338150 -3.933 1.95E-08 id:ibd5013 Id:ibd5013 Dr.105266 338315 -1.622 5.02E-16 id:ibd5135 Id:ibd5135 Dr.83328 80951 -2.158 3.89E-11 Inhibitor of DNA binding 2, dominant negative helix-loop-helix id2a protein, a Dr.32819 266599 -1.529 5.28E-07 Isocitrate dehydrogenase 1 idh1 (NADP+), soluble Dr.75844 378971 -1.564 4.66E-17 ift52 Intraflagellar transport protein 52 Dr.15827 414931 -2.007 7.58E-28 Insulin-like growth factor binding igfbp2 protein 2 Dr.115492 30743 -7.624 0.00E+00 ihpk2 Inositol hexaphosphate kinase 2 Dr.76762 322041 -2.066 1.59E-32 ik:tdsubc_1a 12 Ik:tdsubc_1a12 Dr.78416 337852 -1.722 3.43E-12 ik:tdsubc_2d 6 Ik:tdsubc_2d6 Dr.86298 337817 -1.527 6.17E-06 IKAROS family zinc finger 1 ikzf1 (Ikaros) Dr.8122 30177 -2.155 3.43E-27 il12a Interleukin 12a Dr.135199 445410 -1.710 8.70E-10 il15l Interleukin 15, like Dr.37800 494451 -1.611 6.32E-10 il1b Interleukin 1, beta Dr.30443 405770 -1.612 5.26E-17 Interleukin enhancer binding ilf2 factor 2 Dr.76824 406517 -1.911 2.26E-32 im:6894100 Im:6894100 Dr.133462 552929 -1.594 1.48E-16 im:6899804 Im:6899804 Dr.88215 552956 -1.728 2.42E-07 im:6901964 Im:6901964 Dr.40830 552973 -1.650 8.38E-13 im:6902697 Im:6902697 Dr.77591 552978 -1.550 3.00E-05 im:6904481 Im:6904481 Dr.12811 552999 -2.067 1.31E-07 im:6907289 Im:6907289 Dr.76594 606562 -1.873 1.30E-11 im:6909944 Im:6909944 Dr.108858 448889 -1.563 1.08E-20 im:7136056 Im:7136056 Dr.77689 448928 -1.645 5.76E-06 im:7136462 Im:7136462 Dr.74661 497326 -1.640 6.77E-16 im:7137994 Im:7137994 Dr.126342 497360 -1.708 1.38E-10 im:7138279 Im:7138279 Dr.119844 449888 -2.335 0.00E+00 im:7138989 Im:7138989 Dr.90926 492426 -2.426 6.08E-06 im:7140048 Im:7140048 Dr.108540 503899 -1.623 6.18E-14 im:7140067 Im:7140067 Dr.76314 449936 -1.874 3.00E-05 im:7141484 Im:7141484 Dr.76613 449959 -1.903 5.09E-14 im:7141573 Im:7141573 Dr.90963 492566 -1.865 7.30E-09 -1.996 1.93E-12 im:7142837 Im:7142837 Dr.29859 492595 -2.428 8.42E-06 im:7143041 Im:7143041 Dr.107459 550176 -2.541 5.97E-27 im:7145180 Im:7145180 Dr.79400 550179 -2.106 8.41E-16 im:7145273 Im:7145273 Dr.133223 492655 -1.658 1.00E-05 im:7145328 Im:7145328 Dr.104946 497482 -1.563 1.16E-06 im:7149561 Im:7149561 Dr.124869 503989 -2.890 7.00E-05 im:7150469 Im:7150469 Dr.78244 504015 -1.516 5.17E-09 im:7150932 Im:7150932 Dr.76198 504037 -1.818 4.56E-14 im:7151366 Im:7151366 Dr.133224 492705 -2.172 8.56E-06 im:7151632 Im:7151632 Dr.78186 492717 -1.567 1.00E-05 im:7151680 Im:7151680 Dr.80696 492719 -2.031 3.62E-37 im:7152043 Im:7152043 Dr.118598 492728 -2.868 1.38E-06 im:7153274 Im:7153274 Dr.81515 492744 -2.475 3.69E-06 im:7153475 Im:7153475 Dr.78448 504123 -2.261 2.87E-21 im:7153552 Im:7153552 Dr.75319 606595 -2.043 5.00E-05 im:7155045 Im:7155045 Dr.45660 550207 -1.687 9.59E-07 im:7156740 Im:7156740 Dr.105408 550315 -1.625 4.01E-06 Inhibitor of growth family, member ing5b 5b Dr.79544 368450 -2.840 1.14E-38 ins Preproinsulin Dr.75811 30262 -1.591 1.43E-12 -1.703 6.52E-32 -1.781 0.00E+00 Interphotoreceptor retinoid- irbp binding protein Dr.75802 30735 -2.548 2.96E-13 irf6 Interferon regulatory factor 6 Dr.81664 393570 -1.757 3.32E-17 irx4a Iroquois homeobox protein 4a Dr.88481 402999 -1.950 1.09E-10 irx6a Iroquois homeobox protein 6a Dr.90384 474317 -1.877 3.16E-09 irx7 Iroquois homeobox protein 7 Dr.78562 140746 -1.892 1.41E-21 isl1 Islet1 Dr.75106 30147 -2.329 5.66E-14 ism1 Isthmin 1 Dr.78446 497617 -1.523 1.87E-23 itgb1b.2 Integrin, beta 1b.2 Dr.83219 405864 -7.083 2.84E-10 itgb5 Integrin, beta 5 Dr.34301 563556 -3.115 1.07E-36 itm1 Integral membrane protein 1 Dr.75539 266797 -1.879 6.19E-14 Inositol 1,4,5-trisphosphate 3- itpkc kinase C Dr.77443 334077 -1.677 4.00E-05 Kv channel interacting protein 3, kcnip3l calsenilin, like Dr.27151 393792 -1.690 7.94E-12
Potassium inwardly-rectifying kcnj1 channel, subfamily J, member 1 Dr.82432 386933 -1.718 8.61E-11 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein kdelr2 retention receptor 2 Dr.75191 373129 -1.607 1.00E-04 KH domain containing, RNA binding, signal transduction khdrbs1 associated 1 Dr.75226 30082 -2.061 1.71E-06 kiaa0650l Kiaa0650 protein like Dr.115612 497282 -1.562 2.60E-13 kif11 Kinesin family member 11 Dr.36081 195818 -1.905 5.15E-18 kifc1 Kinesin family member C1 Dr.32496 30453 -1.895 3.65E-08 klf11 Kruppel-like factor 11 Dr.78042 324847 -2.193 3.11E-13 klf2a Kruppel-like factor 2a Dr.29173 117508 -1.847 3.06E-29 kmo Kynurenine 3-monooxygenase Dr.79892 368242 -6.452 7.19E-41 kntc2l Kinetochore associated 2-like Dr.77027 445386 -1.538 8.78E-10 Karyopherin alpha 2 (RAG cohort kpna2 1, importin alpha 1) Dr.75709 436607 -1.854 3.71E-36 Kreisler (mouse) maf-related krml2 leucine zipper homolog 2 Dr.81287 114460 -1.610 2.93E-09 krt15 Keratin 15 Dr.76187 406844 -6.745 0.00E+00 krt4 Keratin 4 Dr.75111 58021 -3.088 1.86E-10 krt5 Keratin 5 Dr.28410 30392 -7.719 1.84E-42 lamb4 Laminin, beta 4 Dr.120997 286831 -4.037 1.40E-06 lbr Lamin B receptor Dr.21958 368360 -1.519 5.06E-10 lcp1 Lymphocyte cytosolic plastin 1 Dr.25823 30583 -1.515 3.65E-06 -4.923 0.00E+00 ldb2b LIM-domain binding factor 2b Dr.75824 30578 -1.966 8.77E-09 ldhd Lactate dehydrogenase D Dr.16066 334208 -2.412 2.79E-24 Leukocyte cell derived lect1 chemotaxin 1 Dr.76996 114448 -1.924 0.00E+00 Leucine-rich, glioma inactivated lgi1a 1a Dr.1612 323011 -1.992 5.00E-05 lman1 Lectin, mannose-binding, 1 Dr.79017 559775 -2.502 0.00E+00 lman1 Lectin, mannose-binding, 1 Dr.79200 559775 -2.276 1.72E-19 lmbr1l Limb region 1 like Dr.19947 321314 -3.303 1.19E-11 lmnb1 Lamin B1 Dr.25051 195816 -2.119 0.00E+00 lmnb2 Lamin B2 Dr.75473 30196 -1.615 5.00E-05 lmo1 LIM domain only 1 Dr.121761 280646 -2.025 3.74E-11 lmo4l LIM domain only 4, like Dr.78922 324849 -1.829 1.42E-23
LOC1000000 Similar to vacuolar-type H+ 22 transporting ATPase subunit B2 Dr.116641 100000022 -1.520 7.68E-09 LOC1000000 95 Similar to cholecystokinin Dr.83652 100000095 -1.531 4.84E-08 LOC1000001 Hypothetical protein 27 LOC100000127 Dr.82265 100000127 -1.533 1.19E-07 LOC1000001 Hypothetical protein 76 LOC100000176 Dr.113705 100000176 -1.604 5.54E-08 LOC1000002 56 Similar to crystallin gamma EM2-7 Dr.84912 100000256 -4.224 1.20E-15 LOC1000003 Hypothetical protein 06 LOC100000306 Dr.116123 100000306 -1.612 1.00E-05 -1.642 3.27E-06 -1.789 4.69E-07 LOC1000003 Hypothetical protein 34 LOC100000334 Dr.83913 100000334 -1.575 7.99E-07 LOC1000003 Hypothetical protein 38 LOC100000338 Dr.140160 100000338 -1.941 5.36E-15 LOC1000004 Hypothetical protein 15 LOC100000415 Dr.117055 100000415 -1.892 1.10E-26 -2.835 7.95E-08 LOC1000004 Hypothetical protein 39 LOC100000439 Dr.83140 100000439 -3.165 1.29E-24 LOC1000006 Hypothetical protein 08 LOC100000608 Dr.85440 100000608 -2.012 1.26E-08 -1.855 5.75E-07 LOC1000006 12 Similar to LOC431792 protein Dr.75340 100000612 -1.893 4.99E-23 LOC1000006 Hypothetical protein 57 LOC100000657 Dr.113481 100000657 -2.169 6.06E-26 LOC1000008 Similar to high affinity copper 03 uptake protein Dr.119155 100000803 -1.774 7.89E-06 LOC1000008 Hypothetical protein 14 LOC100000814 Dr.78506 100000814 -2.452 2.58E-34 LOC1000008 Hypothetical protein 77 LOC100000877 Dr.118068 100000877 -1.523 0.00E+00 LOC1000011 Hypothetical protein 21 LOC100001121 Dr.106214 100001121 -3.312 3.74E-25 LOC1000011 Hypothetical protein 62 LOC100001162 Dr.81449 100001162 -1.893 6.02E-08
LOC1000011 Similar to CD2 antigen 92 (cytoplasmic tail) binding protein 2 Dr.114413 100001192 -1.721 2.64E-16 LOC1000013 Hypothetical protein 96 LOC100001396 Dr.39528 100001396 -3.110 1.05E-09 LOC1000014 Hypothetical protein 02 LOC100001402 Dr.86195 100001402 -6.135 2.00E-33 LOC1000019 07 Similar to Ppib protein Dr.120711 100001907 -1.683 7.40E-06 LOC1000019 68 Similar to bloodthirsty Dr.23709 100001968 -1.778 2.00E-05 LOC1000020 Hypothetical protein 43 LOC100002043 Dr.121481 100002043 -1.725 7.47E-11 LOC1000021 65 Similar to selenoprotein Pa Dr.9483 100002165 -1.879 5.88E-06 LOC1000023 Hypothetical protein 34 LOC100002334 Dr.23240 100002334 -1.846 6.00E-06 LOC1000023 Similar to Poly (ADP-ribose) 64 polymerase family, member 6 Dr.120837 100002364 -1.587 9.00E-05 LOC1000023 Hypothetical protein 83 LOC100002383 Dr.19812 100002383 -2.009 2.65E-09 LOC1000023 Hypothetical protein 87 LOC100002387 Dr.113485 100002387 -4.055 2.30E-08 LOC1000023 Hypothetical protein 93 LOC100002393 Dr.119868 100002393 -2.142 4.68E-18 LOC1000025 Similar to SEC14-like 1 (S. 10 cerevisiae) Dr.24948 100002510 -1.678 7.06E-12 LOC1000025 Hypothetical protein 23 LOC100002523 Dr.116473 100002523 -4.746 1.63E-06 LOC1000025 Hypothetical protein 31 LOC100002531 Dr.81807 100002531 -1.735 8.33E-11 LOC1000025 Hypothetical protein 33 LOC100002533 Dr.118823 100002533 -1.894 2.12E-26 LOC1000025 Hypothetical protein 37 LOC100002537 Dr.106015 100002537 -1.950 1.15E-21 LOC1000026 10 Similar to KIAA1070 protein Dr.86013 100002610 -1.565 4.94E-07 LOC1000026 34 Similar to beta-thymosin Dr.119962 100002634 -2.478 2.00E-05 LOC1000027 Similar to RIKEN cDNA 38 1600002O04 gene Dr.87661 100002738 -1.616 9.74E-06 LOC1000027 Similar to basic helix-loop-helix 41 transcription factor Dr.19915 100002741 -1.864 1.70E-08 LOC1000027 70 Similar to EphA4 protein Dr.47585 100002770 -2.003 1.00E-05 LOC1000028 Hypothetical protein 05 LOC100002805 Dr.110641 100002805 -2.864 3.17E-08 LOC1000028 58 Similar to zinc finger protein Dr.133030 100002858 -1.722 1.91E-19 LOC1000030 Hypothetical protein 11 LOC100003011 Dr.120572 100003011 -1.535 2.07E-33 LOC1000030 Hypothetical protein 13 LOC100003013 Dr.107569 100003013 -2.478 4.53E-09 LOC1000030 75 Similar to MTHFS protein Dr.16718 100003075 -1.607 6.91E-06
LOC1000030 Similar to coactivator-associated 90 arginine methyltransferase 1 Dr.85475 100003090 -2.338 2.76E-06 LOC1000033 Hypothetical protein 70 LOC100003370 Dr.132943 100003370 -1.864 1.55E-13 LOC1000034 Hypothetical protein 46 LOC100003446 Dr.94265 100003446 -2.239 9.47E-11 -1.777 1.82E-06 LOC1000035 Similar to actin-binding LIM 58 protein 1 Dr.134127 100003558 -1.811 3.51E-06 LOC1000036 Hypothetical protein 05 LOC100003605 Dr.87657 100003605 -1.521 1.49E-07 LOC1000036 Hypothetical protein 61 LOC100003661 Dr.115571 100003661 -1.695 5.80E-07 LOC1000037 Similar to NOL1/NOP2/Sun 62 domain family, member 7 Dr.84872 100003762 -1.996 2.98E-14 Similar to Mitogen-activated LOC1000037 protein kinase-activated protein 74 kinase 5 Dr.81410 100003774 -1.674 4.53E-14 LOC1000039 Hypothetical protein 36 LOC100003936 Dr.114594 100003936 -2.072 1.98E-06 LOC1000039 Similar to DEP domain containing 59 1a Dr.78376 100003959 -1.562 1.71E-07 LOC1000039 Hypothetical protein 99 LOC100003999 Dr.76467 100003999 -5.124 0.00E+00 LOC1000041 Similar to Selenium binding 31 protein 1 Dr.18416 100004131 -2.535 2.12E-24 LOC1000041 39 Similar to Cstf2 protein Dr.113612 100004139 -1.560 2.99E-09 LOC1000043 Hypothetical protein 29 LOC100004329 Dr.89636 100004329 -1.683 2.98E-13 LOC1000043 Hypothetical protein 98 LOC100004398 Dr.77098 100004398 -2.164 2.61E-20 Similar to Excision repair cross- complementing rodent repair LOC1000043 deficiency, complementation 99 group 8 Dr.116231 100004399 -1.723 4.66E-13 LOC1000044 Similar to solute carrier family 26 38 member 6 b Dr.116159 100004438 -2.276 9.35E-08 -1.632 6.82E-07 LOC1000044 Hypothetical protein 43 LOC100004443 Dr.76281 100004443 -2.148 1.40E-45
LOC1000044 Similar to ATPase, Na+/K+ 75 transporting, alpha 3a polypeptide Dr.95635 100004475 -2.293 2.51E-16 LOC1000045 Hypothetical protein 87 LOC100004587 Dr.6341 100004587 -1.533 3.00E-05 LOC1000046 Hypothetical protein 69 LOC100004669 Dr.13739 100004669 -1.588 5.17E-10 LOC1000047 Similar to D4, zinc and double 13 PHD fingers family 1 Dr.84982 100004713 -2.255 0.00E+00 LOC1000051 48 Androgen receptor a Dr.75914 100005148 -1.600 4.00E-05 LOC1000051 Hypothetical protein 59 LOC100005159 Dr.84866 100005159 -1.735 1.89E-15 LOC1000052 57 Similar to Si:dkeyp-20e4.1 protein Dr.118373 100005257 -2.910 8.25E-34 LOC1000052 Hypothetical protein 61 LOC100005261 Dr.79413 100005261 -2.279 4.13E-17
Similar to TAF12 RNA polymerase LOC1000053 II, TATA box binding protein (TBP)- 07 associated factor Dr.17679 100005307 -1.567 5.06E-08 LOC1000053 Similar to Retinoblastoma binding 86 protein 4, like Dr.97847 100005386 -1.880 4.22E-28 LOC1000054 Hypothetical protein 23 LOC100005423 Dr.14751 100005423 -1.622 6.17E-08 LOC1000054 Hypothetical protein 76 LOC100005476 Dr.74809 100005476 -2.674 2.20E-13
LOC1000054 Similar to activating transcription 85 factor 7 interacting protein Dr.114311 100005485 -1.761 5.09E-31 Similar to Aldehyde LOC1000055 dehydrogenase 9 family, member 87 A1 like 1 Dr.116081 100005587 -1.940 2.40E-37 Similar to beta-1,3- LOC1000056 glucuronyltransferase-3-like 59 protein Dr.115742 100005659 -1.509 1.70E-07 LOC1000056 Hypothetical protein 74 LOC100005674 Dr.22869 100005674 -2.194 6.70E-06 LOC1000057 Hypothetical protein 53 LOC100005753 Dr.79723 100005753 -1.769 2.78E-09 LOC1000061 08 Similar to Kctd12.2 protein Dr.116758 100006108 -1.534 1.24E-10 LOC1000062 48 Similar to Rbm38 protein Dr.80564 100006248 -2.220 4.72E-26 LOC1000062 81 Similar to Mip-2 Dr.120322 100006281 -7.929 5.90E-08 LOC1000063 21 Similar to leukotriene B4 receptor Dr.87054 100006321 -1.716 6.88E-07 -1.670 5.00E-05 LOC1000065 Hypothetical protein 49 LOC100006549 Dr.113922 100006549 -14.043 0.00E+00 LOC1000065 Hypothetical protein 60 LOC100006560 Dr.84920 100006560 -1.527 9.00E-05 LOC1000068 Hypothetical protein 61 LOC100006861 Dr.119602 100006861 -1.976 6.61E-11 LOC1000068 77 Similar to transposase Dr.86082 100006877 -1.757 3.85E-35 LOC1000076 Hypothetical protein 92 LOC100007692 Dr.133450 100007692 -2.805 7.00E-05 LOC1000077 80 Similar to putative RNA methylase Dr.3155 100007780 -1.506 6.86E-06 LOC1000078 87 Similar to LOC559853 protein Dr.113957 100007887 -1.757 1.32E-11 LOC1000083 Hypothetical protein 28 LOC100008328 Dr.121267 100008328 -1.991 2.22E-06
LOC402803 Hypothetical protein LOC402803 Dr.114195 402803 -1.512 5.96E-08
LOC402824 Hypothetical protein LOC402824 Dr.12263 402824 -2.208 2.06E-43
LOC402865 Hypothetical protein LOC402865 Dr.134291 402865 -3.042 2.00E-05 MAP3K12 binding inhibitory LOC402869 protein 1 Dr.86533 402869 -1.706 6.00E-05
LOC402888 Hypothetical protein LOC402888 Dr.18723 402888 -1.820 7.00E-05 LOC402976 Hypothetical protein LOC402976 Dr.82756 402976 -1.589 5.31E-06
LOC407643 Alpha-2 macroglobulin like-protein Dr.88606 407643 -2.396 5.34E-29
LOC407683 Hypothetical protein LOC407683 Dr.88434 407683 -9.222 1.02E-07
LOC553209 Hypothetical protein LOC553209 Dr.80530 553209 -2.414 0.00E+00
LOC553234 Hypothetical protein LOC553234 Dr.88768 553234 -1.986 1.90E-18 LOC553328 PASG Dr.75180 553328 -4.291 0.00E+00
LOC553340 Hypothetical protein LOC553340 Dr.106400 553340 -1.923 9.39E-09
LOC553343 Hypothetical protein LOC553343 Dr.78682 553343 -1.733 6.06E-10
LOC553370 Hypothetical protein LOC553370 Dr.37889 553370 -3.508 1.37E-32
LOC553371 Hypothetical protein LOC553371 Dr.76499 553371 -8.363 4.70E-32
LOC553384 Hypothetical protein LOC553384 Dr.43301 553384 -1.603 6.09E-26
LOC553422 Hypothetical protein LOC553422 Dr.72102 553422 -1.542 1.05E-08 -2.423 1.16E-08
LOC553434 Hypothetical protein LOC553434 Dr.91969 553434 -3.587 7.75E-10
LOC553453 Hypothetical protein LOC553453 Dr.120300 553453 -3.474 7.98E-13
LOC553472 Hypothetical protein LOC553472 Dr.82582 553472 -6.779 1.77E-13
LOC553479 Hypothetical protein LOC553479 Dr.40696 553479 -2.146 1.23E-09
LOC553493 Hypothetical protein LOC553493 Dr.78730 553493 -1.922 6.00E-05
LOC553505 Hypothetical protein LOC553505 Dr.39987 553505 -2.070 2.10E-08
LOC553506 Hypothetical protein LOC553506 Dr.75673 553506 -1.626 1.12E-09
LOC553507 Hypothetical protein LOC553507 Dr.18867 553507 -1.924 4.62E-13
LOC553527 Hypothetical protein LOC553527 Dr.118110 553527 -2.018 5.74E-29 LOC554983 Hypothetical LOC554983 Dr.26647 554983 -2.243 6.90E-08 Similar to GDP dissociation LOC554985 inhibitor 1 Dr.120407 554985 -2.435 2.45E-10 LOC555616 Hypothetical LOC555616 Dr.113662 555616 -1.885 6.80E-13 LOC555617 Hypothetical LOC555617 Dr.1387 555617 -20.834 6.70E-15 Similar to novel potassium channel tetramerisation domain LOC555637 protein Dr.79237 555637 -1.851 9.13E-07 Similar to Chain A, Structure Of LOC555797 P18ink4c (F92n) Dr.87476 555797 -1.623 1.00E-05
LOC555852 Similar to MGC107856 protein Dr.84324 555852 -2.637 2.41E-10 LOC555986 Hypothetical LOC555986 Dr.90448 555986 -2.054 5.09E-39 Similar to diaphanous homolog 2 LOC556029 (Drosophila) Dr.87568 556029 -2.026 3.00E-05 LOC556113 Similar to FLJ00281 protein Dr.83148 556113 -2.379 2.03E-39
Similar to eukaryotic translation LOC556227 initiation factor 4 gamma 3 Dr.71417 556227 -1.547 1.78E-06 LOC556362 Hypothetical LOC556362 Dr.17847 556362 -1.623 2.00E-05 Similar to Casein kinase II subunit LOC556379 alpha (CK II) Dr.120778 556379 -1.777 2.97E-17 LOC556387 Hypothetical LOC556387 Dr.116803 556387 -3.290 4.00E-05 LOC556395 Hypothetical LOC556395 Dr.78388 556395 -2.121 7.00E-05 LOC556437 Hypothetical LOC556437 Dr.89132 556437 -1.668 4.57E-06 -1.847 9.93E-06 LOC556467 Hypothetical LOC556467 Dr.77730 556467 -2.097 1.61E-07 -1.924 3.17E-16 -2.447 1.56E-34 Similar to TruB pseudouridine LOC556642 synthase-like protein 1 Dr.76382 556642 -1.741 1.92E-11 LOC556684 Hypothetical LOC556684 Dr.79496 556684 -2.508 8.50E-06 LOC556849 Hypothetical LOC556849 Dr.47655 556849 -20.824 0.00E+00 Similar to NCK associated protein LOC556951 1 like Dr.83105 556951 -2.886 1.95E-10
Similar to vitamin K-dependent LOC556971 gamma-glutamyl carboxylase Dr.83909 556971 -1.858 3.99E-10 LOC556973 Similar to KIAA1344 Dr.79608 556973 -2.081 6.26E-09 LOC556995 Similar to ligase I Dr.85513 556995 -1.660 7.00E-05 Similar to Pax-family transcription LOC557147 factor 6.2 Dr.52129 557147 -2.841 1.75E-08 LOC557237 Hypothetical LOC557237 Dr.83340 557237 -1.562 2.00E-05 LOC557257 Similar to autoantigen Dr.76578 557257 -1.636 4.00E-05 -12.128 1.25E-24 LOC557310 Hypothetical LOC557310 Dr.119595 557310 -1.838 1.17E-20 Similar to Mitochondrial LOC557349 intermediate peptidase Dr.132564 557349 -1.559 2.00E-05 LOC557363 Hypothetical LOC557363 Dr.115650 557363 -2.066 7.56E-06 LOC557408 Hypothetical LOC557408 Dr.91613 557408 -1.867 1.54E-06 LOC557460 Hypothetical LOC557460 Dr.82344 557460 -1.688 1.93E-10 LOC557591 Similar to Muc5b protein Dr.120883 557591 -2.557 6.00E-05 Similar to matrix LOC557654 metalloproteinase 13 Dr.121062 557654 -2.880 1.71E-06 LOC557679 Hypothetical LOC557679 Dr.81000 557679 -2.307 8.28E-06 LOC557976 Hypothetical LOC557976 Dr.86164 557976 -1.501 5.61E-06 Similar to very large inducible LOC558464 GTPase 1 Dr.120251 558464 -2.858 2.24E-25 LOC558498 Hypothetical LOC558498 Dr.74654 558498 -1.519 2.00E-05 -2.075 2.79E-20 LOC558513 Hypothetical LOC558513 Dr.4251 558513 -2.921 2.00E-05 LOC558636 Similar to hCG2044800 Dr.66958 558636 -2.505 2.72E-09 LOC558698 Hypothetical LOC558698 Dr.77128 558698 -1.537 2.00E-05
Similar to novel sulfotransferase LOC558790 family protein Dr.84486 558790 -2.888 4.39E-30 LOC558808 Hypothetical LOC558808 Dr.119508 558808 -2.376 1.85E-29 LOC558848 Hypothetical LOC558848 Dr.41000 558848 -1.526 6.58E-12 Similar to Brca1 associated LOC558885 protein 1 Dr.37720 558885 -2.561 2.17E-06 LOC558890 Hypothetical LOC558890 Dr.16289 558890 -1.666 3.47E-26 LOC558933 Hypothetical LOC558933 Dr.81136 558933 -1.643 3.25E-11 LOC558951 Hypothetical LOC558951 Dr.120741 558951 -1.961 4.23E-13 LOC558975 Hypothetical LOC558975 Dr.15071 558975 -1.721 5.67E-07 LOC558987 Hypothetical LOC558987 Dr.11051 558987 -2.108 5.70E-15 Similar to formin-binding protein LOC558990 17 Dr.42142 558990 -3.455 3.43E-07
Similar to Rho guanine nucleotide LOC559017 exchange factor 4 Dr.80254 559017 -1.716 7.69E-10 LOC559097 Hypothetical LOC559097 Dr.85695 559097 -1.804 2.00E-05 -1.562 3.93E-06 LOC559127 Similar to AWKS9372 Dr.86192 559127 -2.370 1.01E-10 LOC559247 Hypothetical LOC559247 Dr.116367 559247 -2.089 6.21E-16 -2.053 2.68E-10 LOC559333 Hypothetical LOC559333 Dr.104288 559333 -1.797 3.58E-14 Similar to procollagen, type VII, LOC559444 alpha 1 Dr.22027 559444 -4.940 0.00E+00 LOC559561 Hypothetical LOC559561 Dr.103201 559561 -1.710 9.63E-13 LOC559603 Hypothetical LOC559603 Dr.77445 559603 -2.063 3.48E-27 -1.907 5.33E-19 LOC559621 Hypothetical LOC559621 Dr.115297 559621 -5.175 3.00E-05 LOC559659 Hypothetical LOC559659 Dr.119804 559659 -1.544 4.00E-05 LOC559776 Hypothetical LOC559776 Dr.14226 559776 -1.779 3.00E-05 Similar to MAM domain containing LOC559790 4 Dr.82435 559790 -2.288 5.00E-05 -1.648 5.00E-05 -1.843 1.62E-06 Similar to ras homolog gene LOC559899 family, member T1 Dr.85821 559899 -1.784 1.00E-05 Similar to Rho-guanine nucleotide LOC559941 exchange factor Dr.78511 559941 -1.941 7.00E-05 Similar to B-cell LOC560054 lymphoma/leukaemia 11B Dr.42859 560054 -3.568 1.36E-26 LOC560055 Similar to LOC553473 protein Dr.113769 560055 -1.834 6.60E-28 LOC560127 Hypothetical LOC560127 Dr.91580 560127 -1.580 1.19E-11 LOC560138 Hypothetical LOC560138 Dr.84738 560138 -1.874 4.29E-07 -1.698 1.25E-06 LOC560369 Hypothetical LOC560369 Dr.84521 560369 -2.016 2.00E-05 LOC560634 Hypothetical LOC560634 Dr.39571 560634 -1.985 5.86E-06
LOC560828 Similar to Ribosomal protein L13a Dr.118752 560828 -1.849 9.09E-06 LOC560916 Hypothetical LOC560916 Dr.19538 560916 -1.928 2.83E-14 LOC561059 Hypothetical LOC561059 Dr.105374 561059 -2.126 6.71E-31 LOC561119 Similar to LOC531489 protein Dr.94004 561119 -1.543 7.66E-07 -1.863 2.11E-24 LOC561122 Similar to neuroligin X Dr.82134 561122 -2.074 2.90E-10 LOC561162 Hypothetical LOC561162 Dr.103979 561162 -2.934 1.62E-10
Similar to mutant Ca2+-dependent LOC561366 secretion activator Dr.133394 561366 -1.533 7.12E-10 LOC561469 Hypothetical LOC561469 Dr.82857 561469 -1.646 1.02E-10 Similar to pro-alpha 1 type V/XI LOC561584 collagen Dr.104436 561584 -2.869 5.07E-09 Similar to CUB and Sushi multiple LOC561674 domains 1 Dr.117463 561674 -2.061 2.93E-13 LOC561676 Hypothetical LOC561676 Dr.118857 561676 -2.011 1.00E-05 LOC561733 Hypothetical LOC561733 Dr.116711 561733 -2.444 1.77E-24 LOC561740 Similar to testican-2 Dr.81183 561740 -2.081 1.73E-16 LOC561750 Hypothetical LOC561750 Dr.78383 561750 -1.625 7.13E-06 LOC561769 Hypothetical LOC561769 Dr.29420 561769 -1.912 4.68E-07 LOC561788 Hypothetical LOC561788 Dr.104844 561788 -1.744 3.82E-08 LOC561810 Similar to RCL Dr.84538 561810 -2.930 1.85E-36 LOC561913 Hypothetical LOC561913 Dr.86359 561913 -1.630 1.00E-06 LOC561985 Hypothetical LOC561985 Dr.83151 561985 -1.648 2.00E-05 LOC562146 Hypothetical LOC562146 Dr.83930 562146 -2.400 6.76E-07 LOC562165 Similar to Cyclin D1 Dr.115576 562165 -1.721 1.83E-06 LOC562207 Hypothetical LOC562207 Dr.133880 562207 -1.611 1.33E-10 -1.722 1.81E-17 Similar to chromosome 6 open LOC562251 reading frame 84 Dr.83183 562251 -1.550 1.00E-05 -1.921 1.18E-17 LOC562320 Hypothetical LOC562320 Dr.115891 562320 -2.349 3.00E-05 LOC562338 Similar to latrophilin 2 Dr.133176 562338 -2.288 1.00E-05 LOC562343 Similar to NSP5beta3beta Dr.83172 562343 -1.725 3.00E-05 -1.878 2.11E-06 -1.983 5.10E-06 LOC562478 Hypothetical LOC562478 Dr.7628 562478 -1.556 1.30E-11 LOC562744 Hypothetical LOC562744 Dr.120600 562744 -2.205 9.23E-07 -2.087 8.92E-07 -1.656 1.65E-06 -4.773 2.21E-11 LOC562763 Hypothetical LOC562763 Dr.87477 562763 -2.614 4.00E-05 LOC562928 Similar to synaptotagmin VI Dr.133346 562928 -2.164 2.18E-17 LOC563053 Hypothetical LOC563053 Dr.78391 563053 -1.798 1.93E-07 LOC563116 Hypothetical LOC563116 Dr.84808 563116 -1.757 4.00E-05
LOC563180 Similar to glucose-6-phosphatase Dr.105165 563180 -1.682 5.48E-12 LOC563289 Similar to AW554918 protein Dr.7346 563289 -1.721 2.35E-08 LOC563576 Similar to hCG2040572 Dr.89828 563576 -2.176 3.02E-06 Similar to rhamnose binding lectin LOC563686 STL2 Dr.24876 563686 -2.343 2.04E-06 LOC563773 Hypothetical LOC563773 Dr.77693 563773 -2.137 1.72E-10 LOC563874 Hypothetical LOC563874 Dr.84665 563874 -18.338 0.00E+00
LOC563938 Hypothetical protein LOC563938 Dr.76955 563938 -1.659 1.00E-05 LOC563952 Similar to CC chemokine-1 Dr.29197 563952 -3.121 4.26E-08 -5.677 7.87E-20 -2.260 9.15E-08 -2.641 3.83E-09 -24.839 0.00E+00 LOC563958 Hypothetical LOC563958 Dr.75670 563958 -1.770 1.11E-17 Similar to Transducin-like LOC564019 enhancer protein 4 Dr.120150 564019 -1.962 6.09E-06 LOC564072 Hypothetical LOC564072 Dr.76354 564072 -1.558 1.23E-21 LOC564182 Hypothetical LOC564182 Dr.76582 564182 -3.359 1.21E-38 Similar to Ankyrin repeat and LOC564251 SOCS box-containing 3 Dr.117251 564251 -1.547 8.76E-06 Similar to conserved hypothetical LOC564674 protein Dr.79321 564674 -1.628 4.38E-06 LOC564830 Hypothetical LOC564830 Dr.75918 564830 -5.706 0.00E+00 LOC564883 Hypothetical LOC564883 Dr.53187 564883 -2.247 9.21E-14 LOC564956 Hypothetical LOC564956 Dr.83520 564956 -2.257 1.50E-08
LOC565123 Similar to SMT3 isopeptidase 1 Dr.132161 565123 -1.897 6.02E-16 Similar to Collagen alpha 1(XI) LOC565402 chain precursor Dr.120611 565402 -2.836 1.07E-12 LOC565592 Similar to hCG32806 Dr.14066 565592 -1.712 3.00E-05 LOC565611 Similar to ReO_6 Dr.114146 565611 -2.621 1.54E-08 LOC565631 Hypothetical LOC565631 Dr.133586 565631 -4.258 7.65E-09 LOC565641 Hypothetical LOC565641 Dr.112896 565641 -4.043 2.49E-28 LOC565701 Hypothetical LOC565701 Dr.78739 565701 -1.527 4.00E-05 Similar to novel GTPase LOC565728 activating protein Dr.74482 565728 -2.361 3.01E-11 LOC565777 Hypothetical LOC565777 Dr.86193 565777 -2.648 8.40E-06 -2.582 2.00E-05 LOC565839 Hypothetical LOC565839 Dr.80657 565839 -1.651 5.00E-05 Similar to differentiation LOC565859 enhancing factor 1 Dr.84962 565859 -1.638 1.78E-06
Novel protein similar to vertebrate mitochondrial ribosomal protein LOC565937 S10 (MRSP10) Dr.85590 565937 -1.689 8.45E-13
Similar to U6 snRNA-associated LOC566017 Sm-like protein LSm8 Dr.114661 566017 -2.217 0.00E+00 LOC566092 Hypothetical LOC566092 Dr.133269 566092 -2.089 2.79E-13 Similar to cell adhesion molecule LOC566122 NCAM Dr.79668 566122 -1.710 9.68E-11 -1.722 1.31E-07 LOC566185 Similar to Caspase b Dr.40733 566185 -10.177 4.85E-32 LOC566198 Hypothetical LOC566198 Dr.34220 566198 -1.522 3.00E-05
Similar to SI:zC220F6.1 (novel protein similar to human dynein LOC566246 heavy chain (DHC)) Dr.113538 566246 -1.656 1.96E-06 Similar to Regulator of G-protein LOC566268 signalling 4 Dr.82117 566268 -1.584 8.03E-08 LOC566329 Hypothetical LOC566329 Dr.12559 566329 -2.460 9.63E-11 LOC566383 Similar to Elastase inhibitor Dr.104450 566383 -1.600 3.26E-08 LOC566443 Hypothetical LOC566443 Dr.112766 566443 -1.618 0.00E+00
LOC566612 Similar to carbonic anhydrase 9 Dr.80089 566612 -5.905 2.87E-11 LOC566690 Hypothetical LOC566690 Dr.13764 566690 -1.863 4.24E-20 LOC566785 Hypothetical LOC566785 Dr.82831 566785 -1.638 1.06E-10 LOC566872 Hypothetical LOC566872 Dr.80048 566872 -2.583 0.00E+00 Similar to delayed rectifier LOC566883 potassium channel Kv2 Dr.120550 566883 -1.643 2.31E-14 LOC567031 Hypothetical LOC567031 Dr.89030 567031 -2.050 6.07E-07 Similar to ovary-specific C1q-like LOC567217 factor Dr.113963 567217 -1.816 1.59E-06 -1.786 5.46E-09 -2.750 8.79E-06 Similar to Retinal homeobox gene LOC567374 1 Dr.120035 567374 -2.891 7.24E-26 LOC567489 Similar to laminin, beta 1 Dr.84444 567489 -1.552 9.00E-05 Similar to Sperm associated LOC567619 antigen 5 Dr.18019 567619 -2.918 4.38E-06 LOC567756 Similar to fmHP Dr.84991 567756 -1.837 1.89E-08 LOC568321 Hypothetical LOC568321 Dr.84163 568321 -2.404 3.16E-28 LOC568476 Hypothetical LOC568476 Dr.85087 568476 -2.285 6.45E-08 -1.930 1.44E-08 LOC568605 Hypothetical LOC568605 Dr.118335 568605 -1.865 8.00E-05 Similar to tyrosine protein kinase LOC568653 BTK Dr.133658 568653 -1.852 4.00E-05 Similar to type IV antifreeze LOC568656 protein Dr.118680 568656 -1.823 1.56E-15 LOC568699 Hypothetical LOC568699 Dr.114795 568699 -2.289 2.00E-05 Similar to pre-B cell enhancing LOC568720 factor Dr.107484 568720 -1.696 4.00E-05 LOC568734 Hypothetical LOC568734 Dr.116437 568734 -1.565 2.36E-06
Similar to Acetyl-coenzyme A synthetase, cytoplasmic (Acetate-- CoA ligase) (Acyl-activating enzyme) (Acetyl-CoA synthetase) LOC568763 (ACS) (AceCS) Dr.83001 568763 -2.107 2.03E-07 Similar to Anaphase promoting LOC568795 complex subunit 1 Dr.81104 568795 -1.593 2.00E-05 LOC568832 Hypothetical LOC568832 Dr.83524 568832 -1.669 1.60E-14 -1.951 2.32E-08 LOC568839 Lysyl oxidase-like 3a Dr.117709 568839 -1.989 8.95E-08 -2.382 2.70E-08 LOC569006 Hypothetical LOC569006 Dr.115342 569006 -1.911 2.58E-14 LOC569014 Hypothetical LOC569014 Dr.89018 569014 -1.548 1.00E-04 LOC569091 Hypothetical LOC569091 Dr.83465 569091 -2.076 7.19E-07 Similar to protein tyrosine LOC569164 phosphatase e Dr.82846 569164 -1.960 5.39E-06 LOC569234 Hypothetical LOC569234 Dr.11568 569234 -1.513 2.46E-11 LOC569270 Similar to MGC83786 protein Dr.84475 569270 -2.405 8.03E-07 Similar to candidate tumor LOC569456 suppressor protein DICE1 Dr.82999 569456 -1.657 2.44E-09 LOC569516 Hypothetical LOC569516 Dr.114366 569516 -1.707 3.00E-05 LOC569586 Hypothetical LOC569586 Dr.119007 569586 -1.636 2.37E-15 LOC569609 Hypothetical LOC569609 Dr.115454 569609 -1.523 2.97E-14 -3.406 1.13E-12
LOC569631 Hypothetical protein LOC569631 Dr.53157 569631 -2.309 1.63E-13 LOC569640 Hypothetical LOC569640 Dr.114364 569640 -1.653 4.78E-10 Similar to Solute carrier organic anion transporter family, member LOC569735 3a1 Dr.82736 569735 -1.682 2.35E-06 LOC569746 Similar to DBCCR1-like Dr.90063 569746 -2.493 8.00E-05
LOC569755 Similar to collagen alpha1 type VI- Dr.43867 569755 -3.051 5.92E-32 LOC569958 Hypothetical LOC569958 Dr.86524 569958 -6.432 4.19E-18 LOC570055 Hypothetical LOC570055 Dr.15812 570055 -1.982 8.03E-16 LOC570148 Hypothetical LOC570148 Dr.19520 570148 -2.544 2.00E-05 Similar to calpain-like protease LOC570311 CAPN10a Dr.114024 570311 -1.920 4.00E-05 LOC570418 Hypothetical LOC570418 Dr.87241 570418 -2.815 2.04E-12 LOC570598 Hypothetical LOC570598 Dr.41818 570598 -1.695 3.41E-16 LOC570757 Hypothetical LOC570757 Dr.121002 570757 -2.244 7.00E-05 LOC570837 Hypothetical LOC570837 Dr.4160 570837 -1.808 4.13E-08
LOC571260 Hypothetical protein LOC571260 Dr.74715 571260 -3.760 2.49E-11 LOC571281 Hypothetical LOC571281 Dr.83442 571281 -1.773 6.00E-05 LOC571573 Similar to Egr2a protein Dr.118972 571573 -2.284 4.66E-26 LOC571608 Hypothetical LOC571608 Dr.75487 571608 -1.702 3.43E-13 Similar to ATPase, Class V, type LOC571658 10D Dr.31772 571658 -1.978 4.15E-07 LOC571747 Similar to beta2-syntrophin Dr.84005 571747 -1.597 2.74E-23 -2.128 2.80E-45 LOC571939 Hypothetical LOC571939 Dr.116371 571939 -2.242 1.00E-05
LOC571960 Similar to myosin heavy chain Dr.133648 571960 -2.390 1.13E-28 LOC571991 Hypothetical LOC571991 Dr.77176 571991 -1.554 4.89E-08 LOC572012 Hypothetical LOC572012 Dr.82647 572012 -2.042 2.00E-05 LOC572121 Similar to XL-INCENP Dr.104887 572121 -1.706 1.25E-15 -1.823 2.47E-20 -1.771 3.75E-06 LOC572173 Hypothetical LOC572173 Dr.69573 572173 -1.509 2.00E-08 LOC572175 Similar to Muc2 protein Dr.14396 572175 -2.725 1.17E-18
LOC572729 Similar to novel alpha-type globin Dr.114514 572729 -1.951 2.06E-14 Similar to Mitochondrial ribosomal LOC572907 protein L23 Dr.11081 572907 -1.511 2.00E-05 LOC573881 Similar to D13S106E-like Dr.394 573881 -1.547 5.17E-08
LOC791836 Hypothetical protein LOC791836 Dr.75989 791836 -1.621 2.60E-18
LOC791963 Hypothetical protein LOC791963 Dr.118394 791963 -2.180 4.29E-18
LOC792264 Hypothetical protein LOC792264 Dr.3156 792264 -1.798 1.25E-14
LOC792369 Hypothetical protein LOC792369 Dr.114268 792369 -1.699 5.00E-05
LOC792397 Hypothetical protein LOC792397 Dr.115023 792397 -2.346 4.60E-08 LOC792435 Similar to astrotactin Dr.84736 792435 -1.735 1.80E-06 LOC792449 Similar to Cofactor of BRCA1 Dr.79678 792449 -1.549 1.25E-09 Similar to complement factor B/C2- LOC792472 A3 Dr.119903 792472 -4.297 5.89E-17
LOC792765 Hypothetical protein LOC792765 Dr.113685 792765 -3.007 3.55E-09 LOC793089 Similar to Phf10 protein Dr.78790 793089 -1.527 3.77E-12
LOC793156 Hypothetical protein LOC793156 Dr.86008 793156 -1.737 3.85E-26
LOC793171 Similar to FLJ22611-like protein Dr.97656 793171 -1.529 4.00E-05 Similar to transmembrane protein LOC793262 132B Dr.54162 793262 -2.645 3.55E-08
LOC793280 Hypothetical protein LOC793280 Dr.132611 793280 -1.797 8.40E-06 -1.669 2.74E-17 -1.652 7.33E-08 LOC793299 Similar to sreb2 Dr.81229 793299 -2.041 9.94E-08
LOC793313 Hypothetical protein LOC793313 Dr.117615 793313 -2.404 1.49E-08
LOC793361 Hypothetical protein LOC793361 Dr.85225 793361 -1.540 2.78E-07
LOC793374 Hypothetical protein LOC793374 Dr.86757 793374 -1.935 4.00E-05 -2.285 1.17E-06
LOC793410 Hypothetical protein LOC793410 Dr.13853 793410 -2.128 4.59E-15
LOC793509 Hypothetical protein LOC793509 Dr.73230 793509 -1.553 2.00E-05 -1.671 7.00E-15
LOC793536 Similar to ring finger protein 185 Dr.119248 793536 -1.544 2.06E-07 LOC793666 Similar to popeye 2 Dr.116424 793666 -1.885 1.00E-05 -4.411 1.85E-13
Similar to Hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl- Coenzyme A thiolase/enoyl- Coenzyme A hydratase (trifunctional protein), alpha LOC793834 subunit Dr.29120 793834 -2.669 1.40E-31 Insulin-like growth factor binding LOC793907 protein-1b Dr.16095 793907 -2.255 1.53E-27
Similar to Karyopherin alpha 2 LOC793989 (RAG cohort 1, importin alpha 1) Dr.104964 793989 -1.629 2.00E-05
LOC794028 Hypothetical protein LOC794028 Dr.26626 794028 -1.559 4.30E-07
LOC794073 Hypothetical protein LOC794073 Dr.15198 794073 -1.652 1.29E-17
LOC794095 Hypothetical protein LOC794095 Dr.82703 794095 -2.246 8.25E-23
LOC794136 Hypothetical protein LOC794136 Dr.11446 794136 -1.577 1.29E-06 -2.567 6.20E-09 Similar to DNA polymerase delta1 LOC794370 catalytic subunit Dr.114210 794370 -1.915 4.97E-13 LOC794413 Hypothetical protein LOC794413 Dr.116674 794413 -4.133 3.25E-14 -2.213 6.04E-20
LOC794585 Hypothetical protein LOC794585 Dr.88620 794585 -1.699 1.73E-17
LOC794679 Hypothetical protein LOC794679 Dr.132271 794679 -1.962 2.18E-07
LOC794681 Hypothetical protein LOC794681 Dr.85839 794681 -3.046 6.00E-05 LOC794868 Similar to Myotrophin Dr.115341 794868 -1.622 4.00E-05 LOC794906 Similar to DMbeta1 Dr.28459 794906 -1.742 7.93E-15
LOC795015 Similar to Si:dkey-2n12.1 protein Dr.114986 795015 -1.806 3.94E-06 -5.008 1.73E-24
LOC795027 Hypothetical protein LOC795027 Dr.75124 795027 -1.807 3.57E-11 LOC795165 Similar to synapsin II Dr.83846 795165 -2.195 6.34E-08 Similar to Ubiquitin specific LOC795566 protease 1 Dr.75710 795566 -1.624 2.95E-09
LOC795587 Similar to ORF1-encoded protein Dr.118665 795587 -16.990 0.00E+00
LOC795752 Hypothetical protein LOC795752 Dr.118941 795752 -1.673 2.65E-06
LOC795755 Hypothetical protein LOC795755 Dr.85828 795755 -1.870 9.46E-06
LOC795782 Hypothetical protein LOC795782 Dr.121344 795782 -1.667 4.95E-06 Similar to CC chemokine LOC795788 SCYA103 Dr.81010 795788 -3.244 7.99E-09
LOC796145 Hypothetical protein LOC796145 Dr.48843 796145 -1.631 5.40E-10 LOC796588 Similar to thymosin beta b Dr.83488 796588 -2.129 5.50E-14 LOC796842 Similar to Cpb1 protein Dr.120514 796842 -1.523 5.41E-07 -1.522 1.08E-10 -2.626 1.07E-32 Similar to FLI-LRR associated LOC796851 protein-1 Dr.86787 796851 -4.275 1.27E-08
LOC796865 Hypothetical protein LOC796865 Dr.116887 796865 -1.837 9.00E-05
LOC796875 Hypothetical protein LOC796875 Dr.116408 796875 -2.065 6.71E-12
LOC797099 Hypothetical protein LOC797099 Dr.120111 797099 -7.027 1.56E-06
LOC797222 Hypothetical protein LOC797222 Dr.84020 797222 -3.393 2.18E-06
Similar to MCM3 minichromosome maintenance deficient 3 (S. LOC797310 cerevisiae) Dr.119587 797310 -3.639 3.14E-26 LOC797351 Similar to Krt5 protein Dr.120340 797351 -1.709 1.21E-07 -9.500 5.01E-35
LOC797514 Hypothetical protein LOC797514 Dr.83847 797514 -1.800 5.14E-10
LOC797545 Hypothetical protein LOC797545 Dr.82663 797545 -1.598 4.00E-05
LOC797698 Similar to 5-3 exoribonuclease 2 Dr.10637 797698 -1.506 2.00E-05
LOC797787 Similar to crystallin gamma EM2-7 Dr.104305 797787 -2.137 4.07E-08 -5.233 1.14E-28
LOC797833 Hypothetical protein LOC797833 Dr.84249 797833 -1.516 2.01E-08 -5.699 3.75E-19
LOC797836 Similar to MGC130935 protein Dr.6283 797836 -1.558 1.59E-09
LOC797973 Hypothetical protein LOC797973 Dr.114131 797973 -1.629 5.00E-05 -2.017 3.94E-10 LOC797976 Similar to FLJ39237 protein Dr.87039 797976 -1.804 6.00E-05
LOC798012 Similar to Uncoupling protein 2 Dr.121079 798012 -1.532 1.00E-05
LOC798122 Hypothetical protein LOC798122 Dr.114702 798122 -2.385 3.28E-06 LOC798346 Hypothetical protein LOC798346 Dr.9168 798346 -1.951 2.62E-13
LOC798352 Hypothetical protein LOC798352 Dr.83506 798352 -2.052 6.59E-09
Similar to 3-hydroxyisobutyryl- LOC798364 Coenzyme A hydrolase Dr.116519 798364 -1.821 1.56E-17
LOC798369 Hypothetical protein LOC798369 Dr.44549 798369 -1.510 1.00E-05
LOC798492 Hypothetical protein LOC798492 Dr.84868 798492 -1.800 1.00E-05 -1.812 1.29E-06 Similar to Catenin (cadherin- LOC798569 associated protein), beta 1 Dr.118407 798569 -1.814 8.82E-07 Similar to SH2 containing inositol- LOC798772 5-phosphatase Dr.115286 798772 -1.575 6.63E-06 -2.013 1.42E-14 -4.963 2.25E-36 LOC798774 Similar to SORD protein Dr.115985 798774 -1.773 6.00E-05 -3.311 8.48E-28 Similar to cytoplasmic dynein LOC798868 74kDa intermediate chain Dr.67279 798868 -1.835 5.02E-06 -1.818 8.66E-11
LOC799057 Hypothetical protein LOC799057 Dr.113508 799057 -2.336 9.73E-19
LOC799067 Hypothetical protein LOC799067 Dr.81695 799067 -2.021 1.21E-09 LOC799085 Similar to Abhd6-prov protein Dr.133048 799085 -2.066 2.56E-17
LOC799559 Hypothetical protein LOC799559 Dr.121199 799559 -1.601 4.21E-07
Similar to Nuclear autoantigenic LOC799570 sperm protein (histone-binding) Dr.115561 799570 -2.090 4.01E-19
LOC799689 Hypothetical protein LOC799689 Dr.86988 799689 -2.078 3.00E-05 -1.974 5.00E-06
LOC799865 Hypothetical protein LOC799865 Dr.84440 799865 -1.550 2.36E-07
LOC799884 Hypothetical protein LOC799884 Dr.117169 799884 -1.772 5.82E-09 Similar to Prostaglandin E LOC799964 synthase 2-like Dr.116181 799964 -1.963 2.18E-17
LOC799965 Similar to crystallin gamma EM2-7 Dr.133986 799965 -3.091 1.01E-25 lonp1 Lon peptidase 1, mitochondrial Dr.121787 325281 -1.581 3.16E-11 Low density lipoprotein receptor- lrp11 related protein 11 Dr.22391 335904 -1.782 1.40E-18 Low density lipoprotein receptor- related protein associated protein lrpap1 1 Dr.6972 333939 -1.806 0.00E+00 lrrc17 Leucine rich repeat containing 17 Dr.25268 321202 -1.622 6.64E-14
LSM7 homolog, U6 small nuclear lsm7 RNA associated (S. cerevisiae) Dr.10033 573047 -2.088 4.93E-14 lsmd1 LSM domain containing 1 Dr.82008 335819 -1.716 1.00E-05 lta4h Leukotriene A4 hydrolase Dr.79645 406575 -2.199 1.00E-24 Leukotriene B4 12- ltb4dh hydroxydehydrogenase Dr.76000 494108 -2.853 0.00E+00 lypd6 LY6/PLAUR domain containing 6 Dr.86558 447932 -1.990 8.80E-13 lyzLysozyme Dr.83681 246089 -2.225 2.00E-05 -1.586 7.17E-07 -2.731 1.55E-08 -13.822 0.00E+00 Leucine zipper transcription factor- lztfl1 like 1 Dr.76305 322226 -1.666 4.75E-32 Leucine zipper transcription factor- lztfl1 like 1 Dr.120567 322226 -1.574 7.45E-15 mab21l1 Mab-21-like 1 Dr.18293 246091 -2.092 1.75E-20 mab21l2 Mab-21-like 2 Dr.15056 117234 -1.615 9.00E-05 V-maf musculoaponeurotic fibrosarcoma (avian) oncogene maf homolog Dr.120867 114467 -2.189 4.36E-09 V-maf musculoaponeurotic fibrosarcoma (avian) oncogene mafl family, protein L Dr.83037 114468 -1.957 1.57E-06 MAK10 homolog, amino-acid N- acetyltransferase subunit, (S. mak10 cerevisiae) Dr.77236 321587 -1.574 3.45E-14 Mitogen-activated protein kinase map2k3 kinase 3 Dr.117346 65239 -2.549 0.00E+00 Mitogen activated protein kinase map3k7 kinase kinase 7 Dr.80386 553788 -1.666 7.12E-15
Mitogen-activated protein kinase- mapkapk5 activated protein kinase 5 Dr.115162 436608 -1.634 1.86E-17
Microtubule-associated protein, mapre1l RP/EB family, member 1, like Dr.77988 334135 -1.846 1.51E-35 Myristoylated alanine rich protein marcks kinase C substrate Dr.75599 323201 -1.835 1.43E-16 matn1 Matrilin 1 Dr.82373 403023 -1.731 6.00E-05 -8.507 0.00E+00 matn4 Matrilin 4 Dr.78017 497348 -2.317 6.95E-17 mb Myoglobin Dr.76034 393558 -4.117 0.00E+00 mbl Mannose binding-like lectin Dr.77668 58091 -1.634 1.00E-05 mbp Myelin basic protein Dr.80239 326281 -2.461 1.49E-10 MCM2 minichromosome maintenance deficient 2, mitotin mcm2 (S. cerevisiae) Dr.2291 192338 -2.529 9.15E-09 MCM3 minichromosome maintenance deficient 3 (S. mcm3 cerevisiae) Dr.20948 192323 -3.808 4.13E-39 MCM4 minichromosome maintenance deficient 4, mitotin mcm4 (S. cerevisiae) Dr.76603 337598 -2.614 2.12E-34 MCM5 minichromosome maintenance deficient 5 (S. mcm5 cerevisiae) Dr.28707 286747 -2.561 0.00E+00 MCM6 minichromosome maintenance deficient 6, mitotin mcm6 (S. cerevisiae) Dr.33010 378730 -3.529 2.80E-27 Malate dehydrogenase 1a, NAD mdh1a (soluble) Dr.4960 399662 -1.669 1.56E-10 Malate dehydrogenase 1b, NAD mdh1b (soluble) Dr.9860 335715 -1.539 0.00E+00 mecp2Methyl CpG binding protein 2 Dr.82151 335250 -1.866 1.03E-14 Myeloid ecotropic viral integration meis2.2 site 2.2 Dr.10232 170454 -1.657 4.61E-18 Myeloid ecotropic viral integration meis4.1a site 4.1a Dr.77992 170455 -1.533 7.78E-31 Maternal embryonic leucine zipper melk kinase Dr.113545 30724 -1.908 1.58E-12 mest Mesoderm specific transcript Dr.8060 30242 -1.540 7.74E-07 mfap2 Microfibrillar-associated protein 2 Dr.75309 334770 -3.065 4.11E-06 Milk fat globule-EGF factor 8 mfge8l protein, like Dr.84058 541486 -2.163 5.19E-14 mg:ab01b07 Mg:ab01b07 Dr.41813 326968 -1.540 6.00E-05 mg:db03g07 Mg:db03g07 Dr.76103 326955 -2.449 3.07E-06 -5.359 2.95E-21 MGC162955 Hypothetical LOC560253 Dr.117186 560253 -1.650 3.00E-05 Macrophage migration inhibitory mif factor Dr.81056 751093 -2.512 4.73E-07 Major intrinsic protein of lens fiber mip1 1 Dr.90943 445140 -8.488 0.00E+00 Megalencephalic leukoencephalopathy with mlc1 subcortical cysts 1 Dr.119073 559990 -1.686 1.33E-07 mlstd2 Male sterility domain containing 2 Dr.120413 406829 -1.709 8.98E-07 mmp13 Matrix metalloproteinase 13 Dr.81475 387293 -1.784 1.64E-10 mmp2 Matrix metalloproteinase 2 Dr.76397 337179 -2.190 0.00E+00 Membrane protein, palmitoylated 6 (MAGUK p55 subfamily member mpp6 6) Dr.67769 394134 -1.886 7.40E-12 Metallophosphoesterase domain mpped2 containing 2 Dr.81705 336959 -1.831 5.15E-12 msh2 MutS homolog 2 (E. coli) Dr.105564 406845 -2.583 6.17E-44 mstn Myostatin Dr.75782 30215 -1.892 8.18E-09 msxa Muscle segment homeobox A Dr.48765 573620 -1.666 1.63E-06 msxc Muscle segment homeobox C Dr.32741 30526 -1.795 0.00E+00 msxe Muscle segment homeobox E Dr.75086 30527 -1.813 1.96E-35 mt Metallothionein Dr.20068 30282 -1.832 9.22E-08 Metastasis associated 1 family, mta2 member 2 Dr.7307 326078 -1.719 2.00E-05 mtnr1c Melatonin receptor 1C Dr.88563 30661 -1.851 4.84E-10 mtx3 Metaxin 3 Dr.83756 402916 -1.778 1.32E-07 Myxovirus (influenza virus) mxc resistance C Dr.26703 360145 -1.712 6.06E-06 mybMyeloblastosis oncogene Dr.80654 30484 -1.632 9.29E-06 mybl2 Myeloblastosis oncogene-like 2 Dr.116863 445390 -1.732 9.33E-17
V-myc myelocytomatosis viral oncogene homolog 1, lung mycl1a carcinoma derived (avian) a Dr.79747 405873 -1.772 0.00E+00 myef2 Myelin expression factor 2 Dr.77011 641483 -1.755 5.64E-13 mynn Myoneurin Dr.78679 327167 -1.577 1.05E-13 myoc Myocilin Dr.77862 548602 -1.786 3.43E-11 nadl1.1 Neural adhesion molecule L1.1 Dr.120298 30656 -1.716 2.00E-05 Nuclear autoantigenic sperm nasp protein (histone-binding) Dr.105784 327300 -1.932 0.00E+00 Neuroblastoma, suppression of nbl1 tumorigenicity 1 Dr.82779 404629 -1.607 5.00E-05 -4.768 2.10E-14 ncam1 Neural cell adhesion molecule 1 Dr.75350 30447 -1.649 3.37E-07 ncanl Neurocan, like Dr.77232 407661 -1.645 3.00E-05 Nuclear cap binding protein ncbp2 subunit 2 Dr.83993 192325 -1.752 3.51E-34 Nucleoside diphosphate kinase- ndpkz4 Z4 Dr.73782 30086 -1.721 2.74E-41 N-myc downstream regulated ndrg1l gene 1, like Dr.8090 393665 -1.607 9.00E-05 NADH dehydrogenase (ubiquinone) 1, alpha/beta ndufab1 subcomplex, 1 Dr.78115 325712 -1.880 1.10E-36 NADH dehydrogenase ndufs1 (ubiquinone) Fe-S protein 1 Dr.76053 321759 -1.538 5.01E-16
NADH dehydrogenase (ubiquinone) Fe-S protein 3, ndufs3 (NADH-coenzyme Q reductase) Dr.75620 550451 -1.538 6.10E-15
Neural precursor cell expressed, nedd8 developmentally down-regulated 8 Dr.76081 368667 -1.726 5.99E-13 nefl Neurofilament, light polypeptide Dr.82477 664698 -2.342 1.31E-10 neurod Neurogenic differentiation Dr.75801 30169 -2.198 2.84E-24 neurod2 Neurogenic differentiation 2 Dr.32478 114435 -3.802 2.66E-31 ngb Neuroglobin Dr.119020 117233 -4.344 1.64E-29 nipsnap1Nipsnap1 Dr.78738 30231 -1.939 1.16E-07 nitr2b Novel immune-type receptor 2b Dr.83336 60647 -1.526 4.00E-05 Non-metastatic cells 4, protein nme4 expressed in Dr.119740 394170 -1.698 1.91E-12 Nicotinamide nucleotide nmnat2 adenylyltransferase 2 Dr.81237 336257 -1.647 3.63E-16 nmt1 N-myristoyltransferase 1 Dr.77367 323956 -1.629 1.00E-05 Nicotinamide nucleotide nnt transhydrogenase Dr.97168 406619 -1.709 5.77E-11 nog3Noggin 3 Dr.81276 30173 -2.458 6.00E-05 nos1 Nitric oxide synthase 1 (neuronal) Dr.88599 60658 -2.109 7.20E-24 Neurological oncogenic ventral nova1a antigen protein Dr.77006 553201 -1.562 7.00E-05 Neuropeptide FF-amide peptide npffl precursor like Dr.86921 368264 -1.510 5.61E-07
Nephrosis 2, idiopathic, steroid- nphs2l resistant (podocin)-like Dr.12280 557914 -1.676 7.00E-05 npsn Nephrosin Dr.79156 404039 -2.037 3.00E-05 -2.116 4.00E-05 -10.381 1.79E-11 NAD(P)H dehydrogenase, nqo1 quinone 1 Dr.4189 322506 -1.711 5.73E-11
Similar to nuclear receptor Nr0b2 subfamily 0, group B, member 2 Dr.13394 403010 -1.699 1.11E-10 -1.761 1.60E-12 Nuclear receptor subfamily 2, nr2f1 group F, member 1 Dr.16 30418 -1.654 2.18E-35 nrp1a Neuropilin 1a Dr.133652 353246 -2.222 1.74E-08 Nuclear receptor binding SET nsd1a domain protein 1a Dr.83733 556086 -1.894 1.09E-08 nsf N-ethylmaleimide-sensitive factor Dr.9155 368483 -2.267 4.28E-23 nt5c2 5'-nucleotidase, cytosolic II Dr.78870 324845 -1.817 1.49E-10 ntn1b Netrin 1b Dr.75773 30192 -1.565 4.95E-09 -1.558 1.44E-06 nudcd2 NudC domain containing 2 Dr.81887 445145 -2.020 3.41E-28
Nudix (nucleoside diphosphate nudt1 linked moiety X)-type motif 1 Dr.76941 406727 -1.526 3.08E-07 nup107 Nucleoporin 107 Dr.48434 550613 -1.903 8.48E-16 nup43 Nucleoporin 43 Dr.85700 405828 -1.742 3.94E-14 Nucleolar and spindle associated nusap1 protein 1 Dr.77256 322888 -1.769 2.00E-05 nutf2 Nuclear transport factor 2 Dr.4049 445204 -1.509 8.27E-23 nxph1 Neurexophilin 1 Dr.106453 437006 -2.136 0.00E+00 Ornithine decarboxylase antizyme oaz2 2 Dr.28785 259193 -1.811 1.55E-17 odz3 Odd Oz/ten-m homolog 3 Dr.121640 30155 -1.910 7.09E-15
O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N- acetylglucosamine:polypeptide-N- ogt acetylglucosaminyl transferase) Dr.105209 337685 -1.709 2.00E-05 olfm2 Olfactomedin 2 Dr.10562 334035 -2.118 3.21E-27 olfml3 Olfactomedin-like 3 Dr.76416 503827 -2.533 1.38E-25 Oligodendrocyte transcription olig3 factor 3 Dr.117660 324857 -2.770 6.50E-06 Opsin 1 (cone pigments), long- opn1lw2 wave-sensitive, 2 Dr.116975 436716 -3.537 1.75E-09 Opsin 1 (cone pigments), medium- opn1mw2 wave-sensitive, 2 Dr.9850 360151 -3.016 8.15E-06 Opsin 1 (cone pigments), short- opn1sw1 wave-sensitive 1 Dr.8194 30582 -13.255 0.00E+00 oprl Opiate receptor-like Dr.121451 402851 -1.860 3.00E-05 Odorant receptor, family 13, or13.1 member 1 Dr.75767 58111 -1.948 1.08E-06 -1.915 5.00E-05 Origin recognition complex, orc1l subunit 1-like Dr.366 335020 -1.794 6.32E-19 Origin recognition complex, orc3l subunit 3-like (yeast) Dr.2362 334315 -2.070 1.68E-07 Origin recognition complex, orc5l subunit 5-like (yeast) Dr.77218 406479 -2.460 2.28E-12 OTU domain, ubiquitin aldehyde otub1 binding 1 Dr.32713 436773 -1.828 1.06E-17 Purinergic receptor P2X, ligand- p2rx2 gated ion channel, 2 Dr.87352 387297 -3.948 8.51E-07 Purinergic receptor P2X, ligand- p2rx3a gated ion channel, 3a Dr.81322 58147 -2.452 7.07E-07 pa2g4a Proliferation-associated 2G4, a Dr.115217 368737 -1.713 7.02E-15 Poly A binding protein, pabpc1a cytoplasmic 1 a Dr.24504 606498 -1.628 5.00E-05 -1.768 3.00E-05
Protein kinase C and casein pacsin1 kinase substrate in neurons 1 Dr.36545 619246 -1.544 7.95E-07 Proliferation associated nuclear pane1 element Dr.81780 402852 -1.752 2.35E-28 Progestin and adipoQ receptor paqr8 family member VIII Dr.88639 368254 -3.082 3.73E-23 Poly (ADP-ribose) polymerase parp1 family, member 1 Dr.36319 325230 -3.270 8.14E-15 pax9 Paired box gene 9 Dr.1467 30558 -1.621 1.65E-13 pbk PDZ binding kinase Dr.77309 360218 -2.399 0.00E+00 Pre-B-cell leukemia transcription pbx1a factor 1a Dr.67581 58138 -2.317 1.24E-14 Pre-B-cell leukemia transcription pbx1a factor 1a Dr.110943 58138 -1.834 0.00E+00 Pre-B-cell leukemia transcription pbx3b factor 3b Dr.81268 58140 -1.867 1.49E-10
Propionyl Coenzyme A pccb carboxylase, beta polypeptide Dr.82447 405861 -1.781 5.99E-25 pcdh10a Protocadherin 10a Dr.107087 259186 -2.105 1.88E-12 pcdh1a3 Protocadherin 1 alpha 3 Dr.47088 497126 -1.989 2.00E-05 -1.793 6.10E-07 pcdh1g22 Protocadherin 1 gamma 22 Dr.77746 323975 -1.741 6.35E-11 pcdha Protocadherin a Dr.88614 259184 -1.521 1.51E-11 pcna Proliferating cell nuclear antigen Dr.35605 30678 -1.909 5.43E-20 pcp4a Purkinje cell protein 4a Dr.48610 386848 -2.589 2.48E-36 pcp4l1 Purkinje cell protein 4 like 1 Dr.85328 560196 -3.089 0.00E+00 Programmed cell death 8 pdcd8 (apoptosis-inducing factor) Dr.7667 373125 -2.768 0.00E+00 pde11a Phosphodiesterase 11A Dr.83467 386956 -2.120 3.00E-05 Phosphodiesterase 5A, cGMP- pde5a specific Dr.91637 553270 -1.849 7.23E-08 Phosphodiesterase 6G, cGMP- pde6g specific, rod, gamma Dr.117353 373876 -5.209 5.33E-08 Phosphodiesterase 6G, cGMP- pde6g specific, rod, gamma Dr.9829 373876 -2.991 2.87E-21 Platelet derived growth factor pdgfra receptor alpha Dr.75077 30745 -2.017 1.04E-35 Pyruvate dehydrogenase kinase, pdk2 isoenzyme 2 Dr.9528 393971 -2.385 3.00E-05 pdlim2 PDZ and LIM domain 2 (mystique) Dr.72048 560322 -2.627 1.98E-18 pdzk1ip1l PDZK1 interacting protein 1, like Dr.41116 368722 -2.603 1.49E-06 pex3 Peroxisomal biogenesis factor 3 Dr.79937 393197 -1.701 2.65E-22 pfn2l Profilin 2 like Dr.75574 321383 -1.641 3.18E-25 pgls 6-phosphogluconolactonase Dr.15803 445494 -1.956 6.00E-05 ph1 Polyhomeotic Ph1 homolog Dr.79798 403008 -1.679 3.51E-24 Phosphatase and actin regulator phactr4 4 Dr.80452 393643 -2.054 5.95E-24 phf16 PHD finger protein 16 Dr.5024 322209 -1.524 5.54E-10 Protein inhibitor of activated pias4 STAT, 4 Dr.6651 406712 -1.723 2.00E-05 Phosphatidylinositol glycan, class pigp P Dr.79270 325316 -1.677 9.79E-23 Phosphoinositide-3-kinase, class pik3c3 3 Dr.78335 548346 -1.600 0.00E+00 Phosphoinositide-3-kinase, pik3cd catalytic, delta polypeptide Dr.117764 394174 -2.527 8.03E-11
Protein (peptidyl-prolyl cis/trans pin1 isomerase) NIMA-interacting 1 Dr.83261 393721 -1.536 7.73E-12 pklr Pyruvate kinase, liver and RBC Dr.132396 114551 -1.517 2.06E-06 pknox1.2 Pbx/knotted 1 homeobox 1.2 Dr.87714 170445 -1.730 3.97E-10 -1.871 3.74E-29 Pleiomorphic adenoma gene-like plagl2 2 Dr.82515 259255 -1.528 2.41E-07
Procollagen-lysine, 2-oxoglutarate plod3 5-dioxygenase 3 Dr.75149 266991 -2.086 1.77E-23 plp1b Proteolipid protein 1b Dr.80279 368234 -1.999 0.00E+00 pls3 Plastin 3 (T isoform) Dr.132378 436598 -1.709 4.58E-09 pmp22 Peripheral myelin protein 22 Dr.249 334817 -2.033 2.68E-22 podxl2 Podocalyxin-like 2 Dr.80686 334309 -1.663 1.02E-11 Polymerase (DNA directed), alpha pola1 1 Dr.75324 317740 -1.873 3.81E-31 Polymerase (DNA directed), alpha pola2 2 Dr.77094 322059 -1.701 1.84E-40 Polymerase (DNA directed), delta pold2 2, regulatory subunit Dr.116248 368733 -1.879 8.88E-09 Polymerase (DNA directed), pole2 epsilon 2 Dr.118754 192320 -1.804 4.00E-05 Polymerase (DNA directed), pole2 epsilon 2 Dr.77075 192320 -1.520 2.09E-17 polr1a Polymerase (RNA) I polypeptide A Dr.101226 327078 -1.758 2.50E-15 -1.869 7.95E-20 Polymerase (RNA) II (DNA polr2c directed) polypeptide C Dr.81878 334669 -1.600 1.26E-13 Processing of precursor 7, pop7 ribonuclease P family Dr.81249 449834 -1.603 2.81E-11 Periostin, osteoblast specific postn factor Dr.30157 337176 -3.357 0.00E+00 POU domain, class 1, pou1f1 transcription factor 1 Dr.89712 405777 -1.624 5.64E-07 POU domain, class 4, pou4f1 transcription factor 1 Dr.26981 58057 -1.615 1.19E-18 POU domain, class 4, pou4f2 transcription factor 2 Dr.83621 402816 -2.772 2.00E-05 ppial Peptidylprolyl isomerase A, like Dr.78109 335519 -1.822 0.00E+00 Peptidylprolyl isomerase B ppib (cyclophilin B) Dr.20052 406292 -1.693 1.23E-22 Protein phosphatase 1D magnesium-dependent, delta ppm1d isoform Dr.81062 394065 -1.593 9.59E-06 Protein phosphatase 1G (formerly 2C), magnesium-dependent, ppm1g gamma isoform Dr.75564 368275 -1.815 1.62E-24
Protein phosphatase 1, regulatory ppp1r3b (inhibitor) subunit 3B Dr.75708 327285 -1.802 5.34E-10
Protein phosphatase 1, regulatory ppp1r7 (inhibitor) subunit 7 Dr.76971 560323 -1.796 6.05E-20 Protein phosphatase 2 (formerly 2A), regulatory subunit A, beta ppp2r1b isoform Dr.36457 449548 -1.619 2.87E-07
Peptidylprolyl isomerase domain ppwd1 and WD repeat containing 1 Dr.78163 100000660 -1.662 5.66E-29 Polyglutamine binding protein 1- pqbp1l like Dr.32075 368734 -1.880 1.14E-09 prc1 Protein regulator of cytokinesis 1 Dr.5696 259194 -2.143 1.11E-31 prdx1 Peroxiredoxin 1 Dr.5684 368219 -1.552 5.59E-27 prkcb1 Protein kinase C, beta 1 Dr.84921 393953 -2.432 8.57E-27 prkcb1l Protein kinase C, beta 1, like Dr.88228 394004 -2.555 5.00E-05 Protein arginine methyltransferase prmt8 8 Dr.22371 335848 -1.945 3.19E-14 prnp Prion protein Dr.116262 494129 -2.454 1.00E-04 prnprs1 Prion protein, related sequence 1 Dr.90045 503701 -2.324 6.00E-05 proml2 Prominin-like 2 Dr.113565 378834 -3.909 7.49E-24 Prospero-related homeobox gene prox1 1 Dr.133153 30679 -1.779 1.08E-09 PRP19/PSO4 homolog (S. prp19 cerevisiae) Dr.3564 321544 -1.677 5.07E-24
PRP31 pre-mRNA processing prpf31 factor 31 homolog (yeast) Dr.76439 393476 -1.894 1.61E-22 prphPeripherin Dr.263 30259 -2.669 0.00E+00 prss35 Protease, serine, 35 Dr.118662 431759 -2.122 5.02E-07
Proteasome (prosome, psma4 macropain) subunit, alpha type, 4 Dr.80643 326687 -1.592 7.11E-10 Proteasome (prosome, macropain) subunit, alpha type, psma6a 6a Dr.81152 171585 -1.655 8.27E-13
Proteasome (prosome, psmb3 macropain) subunit, beta type, 3 Dr.115460 406673 -1.635 2.00E-05
Proteasome (prosome, psmb5 macropain) subunit, beta type, 5 Dr.20627 30387 -1.788 0.00E+00
Proteasome (prosome, psmb7 macropain) subunit, beta type, 7 Dr.75860 64278 -1.515 1.59E-12 Proteasome (prosome, macropain) 26S subunit, ATPase, psmc1a 1a Dr.76288 336786 -1.729 1.82E-39 Proteasome (prosome, macropain) 26S subunit, ATPase, psmc1b 1b Dr.1187 415181 -1.601 1.68E-19 Proteasome (prosome, macropain) 26S subunit, ATPase, psmc3 3 Dr.31059 321947 -1.518 9.66E-21 Proteasome (prosome, macropain) 26S subunit, ATPase, psmc6 6 Dr.32860 321585 -1.705 1.98E-34 Proteasome (prosome, macropain) 26S subunit, non- psmd1 ATPase, 1 Dr.3103 554967 -1.734 3.23E-14 Proteasome (prosome, macropain) 216S subunit, non- psmd11b ATPase, 11b Dr.30259 322265 -1.557 2.52E-09 Proteasome (prosome, macropain) 26S subunit, non- psmd2 ATPase, 2 Dr.78209 393518 -1.522 0.00E+00 Proteasome (prosome, macropain) 26S subunit, non- psmd4 ATPase, 4 Dr.45739 550287 -1.599 1.58E-07 psme3 Proteasome activator subunit 3 Dr.33439 30649 -1.560 1.15E-10 ptc2 Patched 2 Dr.81263 30189 -1.631 6.00E-05 Prostaglandin E receptor 2 ptger2l (subtype EP2)-like Dr.87881 393608 -8.450 3.97E-07 ptgesl Prostaglandin E synthase 2-like Dr.16120 393250 -1.702 6.54E-10 pth1 Parathyroid hormone 1 Dr.86325 405886 -2.348 2.49E-16 ptma Prothymosin, alpha Dr.105146 335707 -2.339 0.00E+00
Protein tyrosine phosphatase-like (proline instead of catalytic ptplb arginine), member b Dr.12800 334121 -1.504 2.82E-07
Protein tyrosine phosphatase, non- ptpn6 receptor type 6 Dr.80850 335573 -4.271 1.89E-09
Protein tyrosine phosphatase, ptpru receptor type, U Dr.118674 335096 -1.543 1.13E-24 Purine-rich element binding pura protein A Dr.85924 415106 -1.941 1.38E-12 -1.709 2.43E-13 pvalb2 Parvalbumin 2 Dr.460 58028 -2.176 2.74E-42 -1.989 5.44E-32 pvalb6 Parvalbumin 6 Dr.81448 402806 -2.386 2.96E-37 pvalb8 Parvalbumin 8 Dr.82157 360208 -1.872 0.00E+00 PYD and CARD domain pycard containing Dr.8329 57923 -4.720 1.95E-06 pygo2 Pygopus homolog 2 (Drosophila) Dr.106008 613247 -2.003 1.00E-05 RAB11a, member RAS oncogene rab11a family Dr.80427 492487 -3.017 9.46E-06 -2.087 6.00E-05 RAB25, member RAS oncogene rab25 family Dr.81751 494098 -1.897 9.12E-24 RAB28, member RAS oncogene rab28 family Dr.80105 326923 -2.000 0.00E+00
Ras-related C3 botulinum toxin substrate 3 (rho family, small GTP rac3 binding protein Rac3) Dr.6811 437027 -1.726 1.18E-43 racgap1 Rac GTPase-activating protein 1 Dr.105341 323197 -1.674 3.93E-06 rag1 Recombination activating gene 1 Dr.133607 30663 -4.217 1.00E-05 ralgps2 Ral-A exchange factor RalGPS2 Dr.17213 393446 -1.566 2.80E-07 -1.504 9.20E-06 rap2ip Rap2 interacting protein Dr.11480 393118 -1.743 5.49E-19 rbb4 Retinoblastoma binding protein 4 Dr.76462 321726 -2.600 0.00E+00 Retinoblastoma binding protein 4, rbb4l like Dr.75908 322129 -1.826 1.75E-13 rbbp5 Retinoblastoma binding protein 5 Dr.81733 393215 -1.845 1.89E-35 RBM12 Swan Dr.133225 445379 -1.777 3.62E-23 rbm17 RNA binding motif protein 17 Dr.82331 393889 -1.644 2.46E-10 rbm38 RNA binding motif protein 38 Dr.120325 333991 -2.377 9.42E-19 rbm4 RNA binding motif protein 4 Dr.132298 325177 -1.971 0.00E+00 rbm42 RNA binding motif protein 42 Dr.77446 445360 -1.653 2.04E-17 rbm4l RNA binding motif protein 4, like Dr.132471 324299 -1.587 9.90E-38 rbp1a Retinol binding protein 1a, cellular Dr.28593 171477 -2.451 3.63E-28 rbp2a Retinol binding protein 2a, cellular Dr.77311 171475 -1.506 4.80E-15 rbp2b Retinol binding protein 2b, cellular Dr.89689 432384 -1.804 4.00E-05 -4.337 1.07E-07 rbp4 Retinol binding protein 4, plasma Dr.1400 30077 -3.473 6.49E-14 RNA binding protein with multiple rbpms2 splicing 2 Dr.81683 393229 -1.893 5.65E-26 Regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein rcbtb1 1 Dr.5968 336007 -1.634 3.51E-09 Reticulocalbin 3, EF-hand calcium rcn3 binding domain Dr.76356 415248 -4.829 1.00E-05 rcv1 Recoverin Dr.9871 335650 -5.420 0.00E+00 rdh1 Retinol dehydrogenase 1 Dr.97099 378440 -1.501 9.00E-05 -1.618 3.48E-06 -5.473 0.00E+00 rdh1l Retinol dehydrogenase 1, like Dr.77202 322529 -2.366 2.37E-37 Retinol dehydrogenase 5 (11- rdh5 cis/9-cis) Dr.87441 556528 -4.184 3.72E-27 Rad and gem related GTP binding rem1 protein 1 Dr.132758 394149 -1.943 5.05E-35 rfc3 Replication factor C (activator 1) 3 Dr.116737 259256 -1.519 2.97E-09 rfc5 Replication factor C (activator 1) 5 Dr.77092 445385 -1.580 0.00E+00 rftn2 Raftlin family member 2 Dr.80980 406729 -2.289 1.91E-43 rgma RGM domain family, member A Dr.77274 414272 -1.887 1.00E-05 rgs7 Regulator of G-protein signalling 7 Dr.76567 436814 -1.894 1.50E-24 Rhesus blood group, B rhbg glycoprotein Dr.118521 337596 -1.540 3.00E-05 -3.816 9.78E-12 rho Rhodopsin Dr.354 30295 -5.282 3.62E-10 Rho-related BTB domain rhobtb2a containing 2a Dr.115039 553415 -1.615 1.42E-15 -1.542 2.00E-05 -1.759 9.30E-06 Ras homolog gene family, rhoq member Q Dr.117263 327510 -2.355 0.00E+00 Ras homolog gene family, rhot1a member T1a Dr.6639 327143 -1.528 5.01E-42 Ras homolog gene family, rhoua member Ua Dr.84141 492802 -1.548 1.00E-05 Retinaldehyde binding protein 1, rlbp1l like Dr.120152 393678 -4.172 1.58E-18 rnaseh2a Ribonuclease H2, subunit A Dr.14704 393195 -2.118 1.53E-14 RNA guanylyltransferase and 5'- rngtt phosphatase Dr.77870 405803 -1.616 1.10E-06 rnmtl1 RNA methyltransferase like 1 Dr.84838 550390 -1.501 3.60E-06 RNA binding protein S1, serine- rnps1 rich domain Dr.75879 327020 -1.523 7.93E-38 RNA U, small nuclear RNA export adaptor (phosphorylation rnuxa regulated) Dr.76596 445490 -1.932 9.23E-07 robo2 Roundabout homolog 2 Dr.83334 60309 -1.559 7.58E-09 Novel protein similar to vertebrate RP71- syntaxin binding protein 1 10D23.3 (STXBP1) Dr.65703 557717 -2.672 5.27E-11 rpa2 Replication protein A2 Dr.33922 65226 -2.662 0.00E+00 rpl10 Ribosomal protein L10 Dr.75581 336712 -1.835 3.56E-11 rpl24 Ribosomal protein L24 Dr.1310 192301 -1.514 2.74E-09 rpl8 Ribosomal protein L8 Dr.4091 393686 -1.823 1.70E-06 rpn1 Ribophorin I Dr.445 325561 -1.875 1.48E-23 Reprimo, TP53 dependent G2 rprm arrest mediator candidate Dr.27132 393779 -3.183 5.00E-05 Ribosomal protein S6 kinase b, rps6kb1 polypeptide 1 Dr.24528 406349 -1.531 6.78E-06 rpsa Ribosomal protein SA Dr.75127 394027 -1.713 3.15E-08 Ribonucleotide reductase M1 rrm1 polypeptide Dr.33356 30740 -2.208 0.00E+00 rrm2b Ribonucleotide reductase M2 b Dr.51831 368909 -1.830 2.41E-21 Retinoschisis (X-linked, juvenile) rs1 1 Dr.133096 445044 -1.623 6.00E-05 -6.271 0.00E+00 Eph-like receptor tyrosine kinase rtk8 8 Dr.75829 30691 -1.555 1.42E-12 rtn1b Reticulon 1b Dr.673 327065 -2.094 0.00E+00 ruvbl2 RuvB-like 2 (E. coli) Dr.35479 317678 -1.793 1.54E-19 -1.786 4.38E-11 rx2 Retinal homeobox gene 2 Dr.75762 30473 -4.050 5.33E-22 rybpa RING1 and YY1 binding protein a Dr.77670 368248 -2.047 1.71E-25 S100 calcium binding protein, s100b beta (neural) Dr.14787 436825 -3.187 3.55E-08 saal1 Serum amyloid A-like 1 Dr.12883 393104 -2.010 6.14E-43 SUMO1 activating enzyme sae1 subunit 1 Dr.75954 415148 -3.534 1.44E-11 SUMO1 activating enzyme sae2 subunit 2 Dr.78013 406672 -1.520 1.73E-08
Sorting and assembly machinery samm50l component 50 homolog, like Dr.26274 492471 -1.573 3.82E-13 SAR1a gene homolog 2 (S. sara2 cerevisiae) Dr.10893 554177 -1.586 3.00E-05 Sterile alpha and TIR motif sarm1 containing 1 Dr.89697 403143 -2.763 2.80E-45 Spermidine/spermine N1-acetyl sat1 transferase 1 Dr.120559 567881 -1.571 1.57E-11 sb:cb113 Sb:cb113 Dr.123172 321102 -1.757 8.59E-06 sb:cb231 Sb:cb231 Dr.78806 321164 -1.554 9.36E-06 sb:cb339 Sb:cb339 Dr.100378 321210 -2.503 1.67E-06 sb:cb339 Sb:cb339 Dr.75196 321210 -2.242 1.00E-05 sb:cb367 Sb:cb367 Dr.34437 321223 -2.699 0.00E+00 sb:cb37 Sb:cb37 Dr.118244 321054 -1.790 5.08E-13 sb:cb441 Sb:cb441 Dr.77759 368293 -2.154 3.01E-18 sb:cb55 Sb:cb55 Dr.117532 321067 -1.570 3.00E-05 sb:cb584 Sb:cb584 Dr.79127 368361 -1.987 9.47E-08 sb:cb730 Sb:cb730 Dr.116552 373151 -3.830 1.45E-09 sb:cb844 Sb:cb844 Dr.84823 378858 -1.956 1.30E-06 sb:cb925 Sb:cb925 Dr.43984 378983 -4.849 0.00E+00 sb:cb986 Sb:cb986 Dr.110696 386779 -2.349 3.59E-08 sccpdha Saccharopine dehydrogenase a Dr.77107 436632 -1.704 9.36E-07 -1.872 8.83E-18 -4.884 7.49E-09 Sodium channel, voltage gated, scn12ab type VIII, alpha b Dr.110026 566868 -1.604 2.36E-06 sec11a SEC11 homolog A (S. cerevisiae) Dr.7472 436794 -2.053 1.70E-11 seh1l SEH1-like (S. cerevisiae) Dr.20191 334749 -1.514 5.68E-06 selenbp1 Selenium binding protein 1 Dr.118604 393542 -2.235 1.75E-08 sema3d Semaphorin 3d Dr.77612 30250 -2.613 5.18E-09 sema3fa Semaphorin 3fa Dr.35933 544658 -1.680 9.33E-12 SUMO1/sentrin/SMT3 specific senp3a peptidase 3a Dr.132401 323583 -1.919 1.17E-08 SUMO1/sentrin/SMT3 specific senp3b peptidase 3b Dr.52869 334774 -1.751 7.00E-05 sephs1 Selenophosphate synthetase 1 Dr.20919 324947 -4.136 0.00E+00 sepp1a Selenoprotein P, plasma, 1a Dr.107259 352931 -2.010 0.00E+00 sepp1b Selenoprotein P, plasma, 1b Dr.8516 352932 -3.078 0.00E+00 sepw2a Selenoprotein W, 2a Dr.101951 378437 -1.645 2.00E-05
Serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, serpina7 antitrypsin), member 7 Dr.46572 449799 -2.229 6.03E-06 Serine (or cysteine) proteinase inhibitor, clade C (antithrombin), serpinc1 member 1 Dr.4199 321545 -2.114 7.38E-19
Serine (or cysteine) proteinase inhibitor, clade D (heparin serpind1 cofactor), member 1 Dr.116015 359841 -1.882 6.37E-10 SET translocation (myeloid seta leukemia-associated) A Dr.75951 323501 -1.869 1.86E-10 SET translocation (myeloid setb leukemia-associated) B Dr.119738 321714 -1.565 2.47E-21 setd6 SET domain containing 6 Dr.77042 322348 -1.775 2.99E-21 sf3b3 Splicing factor 3b, subunit 3 Dr.76176 406824 -1.509 2.21E-06 sf3b4 Splicing factor 3b, subunit 4 Dr.1505 192318 -1.728 1.75E-12 sf3b5 Splicing factor 3b, subunit 5 Dr.85555 436751 -1.540 2.29E-06 Secreted frizzled-related protein sfrp1a 1a Dr.105557 402843 -1.621 4.85E-17 Secreted frizzled-related protein sfrp1b 1b Dr.134623 798564 -1.559 1.03E-06 -5.701 0.00E+00 sfrp5 Secreted frizzled-related protein 5 Dr.86566 117510 -2.879 0.00E+00
Splicing factor, arginine/serine- rich 1 (splicing factor 2, alternate sfrs1 splicing factor) Dr.77384 393565 -1.866 3.50E-23 Splicing factor, arginine/serine- sfrs10 rich, 10 Dr.9221 394172 -1.545 5.73E-12 Splicing factor, arginine/serine- sfrs1l rich 1, like Dr.118199 406288 -2.120 8.30E-35 Splicing factor, arginine/serine- sfrs1l rich 1, like Dr.140535 406288 -2.004 3.39E-10 Splicing factor, arginine/serine- sfrs2 rich 2 Dr.76609 406691 -1.622 8.52E-11 Splicing factor, arginine/serine- sfrs3 rich 3 Dr.75959 368925 -1.797 1.55E-38 Splicing factor, arginine/serine- sfrs3 rich 3 Dr.40822 368925 -1.794 1.10E-10 sfxn1 Sideroflexin 1 Dr.33964 445143 -1.903 6.61E-06 sfxn4 Sideroflexin 4 Dr.79653 556121 -1.660 5.46E-16 SH3-domain GRB2-like endophilin sh3glb2 B2 Dr.79610 394094 -1.707 2.11E-06 SHC SH2-domain binding protein shcbp1 1 Dr.106493 333933 -1.659 4.88E-07 shhb Sonic hedgehog b Dr.75752 30444 -1.962 2.47E-32 si:busm1- 189a20.4 Si:busm1-189a20.4 Dr.87489 566732 -2.410 2.17E-26 -2.866 0.00E+00 si:busm1- 234g15.1 Si:busm1-234g15.1 Dr.48567 368848 -1.565 8.73E-07 si:busm1- 60j23.1 Si:busm1-60j23.1 Dr.106173 541515 -1.759 6.75E-07 si:ch211- 103f16.4 Si:ch211-103f16.4 Dr.78329 541445 -1.753 1.79E-13 -2.227 0.00E+00 si:ch211- 106n13.3 Si:ch211-106n13.3 Dr.76318 337144 -2.938 2.33E-17 si:ch211- 129n15.3 Si:ch211-129n15.3 Dr.76423 564171 -1.637 5.24E-24 si:ch211- 133n4.4 Si:ch211-133n4.4 Dr.74540 322179 -2.320 0.00E+00 si:ch211- 147d7.6 Si:ch211-147d7.6 Dr.85648 562595 -1.793 7.00E-05 si:ch211- 14a17.7 Si:ch211-14a17.7 Dr.75717 368669 -1.695 6.00E-05 si:ch211- 152m4.1 Si:ch211-152m4.1 Dr.133573 565332 -1.840 2.15E-15 si:ch211- 168n16.2 Si:ch211-168n16.2 Dr.12904 562258 -1.708 7.40E-11 si:ch211- 173p18.1 Si:ch211-173p18.1 Dr.78827 327248 -1.704 1.31E-14 si:ch211- 192k9.1 Si:ch211-192k9.1 Dr.91260 445293 -1.536 5.00E-05 -1.646 1.09E-08 si:ch211- 197g15.1 Si:ch211-197g15.1 Dr.75142 334958 -1.910 2.12E-12 si:ch211- 197n10.4 Si:ch211-197n10.4 Dr.78298 794479 -5.175 8.24E-23 si:ch211- 198b3.2 Si:ch211-198b3.2 Dr.42900 557836 -1.697 6.95E-06 -2.631 7.68E-08 si:ch211- 201b11.2 Si:ch211-201b11.2 Dr.35714 565458 -1.661 6.89E-12 si:ch211- 203h15.3 Si:ch211-203h15.3 Dr.108675 323050 -1.883 5.00E-05 si:ch211- 206k18.2 Si:ch211-206k18.2 Dr.40391 553396 -1.747 8.17E-06 si:ch211- 209p5.2 Si:ch211-209p5.2 Dr.16758 335913 -1.518 4.55E-07 si:ch211- 210h11.4 Si:ch211-210h11.4 Dr.105651 324287 -2.589 0.00E+00 si:ch211- 212d10.1 Si:ch211-212d10.1 Dr.89859 557566 -2.355 1.02E-06 si:ch211- 212d10.3 Si:ch211-212d10.3 Dr.89654 550616 -2.361 5.09E-16 si:ch211- 214p16.2 Si:ch211-214p16.2 Dr.88124 368902 -1.527 3.25E-06 si:ch211- 225p5.3 Si:ch211-225p5.3 Dr.78676 327152 -2.090 7.18E-07 si:ch211- 234f20.7 Si:ch211-234f20.7 Dr.18975 567545 -1.949 3.21E-07 si:ch211- 237l4.2 Si:ch211-237l4.2 Dr.48022 561047 -1.878 1.62E-15 -1.883 1.27E-10 -3.404 9.93E-08 -18.590 0.00E+00 si:ch211- 238c15.1 Si:ch211-238c15.1 Dr.87397 560115 -1.911 5.66E-10 si:ch211- 238e6.5 Si:ch211-238e6.5 Dr.48383 556894 -2.344 3.00E-05 si:ch211- 238n5.2 Si:ch211-238n5.2 Dr.86250 559651 -1.504 7.23E-17 si:ch211- 240j22.1 Si:ch211-240j22.1 Dr.105692 555365 -1.602 7.08E-09 si:ch211- 241e1.5 Si:ch211-241e1.5 Dr.80697 334366 -1.547 3.24E-07 si:ch211- 242b18.1 Si:ch211-242b18.1 Dr.132349 566905 -2.050 2.47E-09 si:ch211- 243g18.2 Si:ch211-243g18.2 Dr.9236 559906 -2.181 4.14E-17 si:ch211- 244o22.2 Si:ch211-244o22.2 Dr.4479 324550 -2.510 4.47E-06 si:ch211- 258l4.3 Si:ch211-258l4.3 Dr.81786 570299 -1.780 2.17E-06 si:ch211- 262h13.1 Si:ch211-262h13.1 Dr.76225 492691 -2.447 1.48E-12 si:ch211- 264e16.1 Si:ch211-264e16.1 Dr.18002 563278 -7.101 9.12E-27 si:ch211- 282e16.1 Si:ch211-282e16.1 Dr.25898 448944 -1.676 6.00E-10 si:ch211- 283f6.8 Si:ch211-283f6.8 Dr.76427 338299 -2.046 4.75E-14 si:ch211- 284e20.8 Si:ch211-284e20.8 Dr.92573 100093712 -1.955 2.31E-07 si:ch211- 288g17.3 Si:ch211-288g17.3 Dr.104571 321742 -2.292 3.06E-09 si:ch211- 31p3.2 Si:ch211-31p3.2 Dr.79497 325530 -2.336 9.50E-07 si:ch211- 51e12.7 Si:ch211-51e12.7 Dr.11520 336335 -2.794 2.47E-34 si:ch211- 51l3.4 Si:ch211-51l3.4 Dr.82671 567716 -1.587 1.28E-10 -1.753 4.28E-15 si:ch211- 51m24.3 Si:ch211-51m24.3 Dr.75110 558344 -1.855 7.25E-11 si:ch211- 59d15.5 Si:ch211-59d15.5 Dr.77776 561348 -1.724 7.64E-27 si:ch211- 69g19.2 Si:ch211-69g19.2 Dr.118444 564374 -1.584 2.15E-07 si:ch211- 83f14.4 Si:ch211-83f14.4 Dr.34380 334312 -1.643 2.28E-23 si:ch211- 88d2.2 Si:ch211-88d2.2 Dr.76550 100034651 -3.169 6.43E-15 si:ch211- 89f7.3 Si:ch211-89f7.3 Dr.41850 322032 -1.551 6.00E-05 si:ch73- 266o15.1 Si:ch73-266o15.1 Dr.78347 323652 -2.087 4.18E-29 si:dkey- 110c1.5 Si:dkey-110c1.5 Dr.82366 565970 -1.847 6.32E-18 si:dkey- 110c1.6 Si:dkey-110c1.6 Dr.79503 553572 -1.510 1.48E-16 si:dkey- 114f6.1 Si:dkey-114f6.1 Dr.56035 327573 -14.703 9.43E-06 -14.703 9.88E-06 si:dkey- 11e23.4 Si:dkey-11e23.4 Dr.83275 553440 -2.000 7.07E-36 si:dkey- 11k24.3 Si:dkey-11k24.3 Dr.82796 565408 -1.762 1.49E-07 si:dkey- 121j17.5 Si:dkey-121j17.5 Dr.122079 326020 -4.821 1.92E-09 si:dkey- 12h9.11 Si:dkey-12h9.11 Dr.22835 569881 -1.799 2.86E-13 si:dkey- 146n1.1 Si:dkey-146n1.1 Dr.78276 563365 -1.628 5.07E-10 si:dkey- 151c10.1 Si:dkey-151c10.1 Dr.11514 337040 -1.619 2.16E-07 si:dkey- 16k6.1 Si:dkey-16k6.1 Dr.31660 378861 -1.517 1.00E-05 si:dkey- 171o17.4 Si:dkey-171o17.4 Dr.81347 557565 -2.069 8.30E-12 si:dkey- 174c12.2 Si:dkey-174c12.2 Dr.84880 449926 -1.625 5.79E-07 si:dkey- 192p21.4 Si:dkey-192p21.4 Dr.77748 337862 -1.719 2.03E-08 si:dkey-1o2.1 Si:dkey-1o2.1 Dr.132703 337426 -2.024 2.15E-08 si:dkey- 200h23.5 Si:dkey-200h23.5 Dr.7577 448936 -2.632 2.80E-24 si:dkey- 200h23.5 Si:dkey-200h23.5 Dr.132706 448936 -2.444 1.00E-05 si:dkey- 202b22.2 Si:dkey-202b22.2 Dr.74031 562678 -1.763 3.24E-08 si:dkey- 202g15.7 Si:dkey-202g15.7 Dr.80560 333977 -1.643 2.81E-06 si:dkey- 218n20.4 Si:dkey-218n20.4 Dr.84506 564010 -2.134 0.00E+00 si:dkey- 220f10.4 Si:dkey-220f10.4 Dr.83833 564717 -3.051 7.00E-09 si:dkey- 236e20.5 Si:dkey-236e20.5 Dr.36001 322415 -1.740 3.87E-10 -1.880 9.54E-06 -2.384 2.67E-09 -19.742 0.00E+00 si:dkey- 240e12.1 Si:dkey-240e12.1 Dr.109269 449953 -1.611 3.53E-09 si:dkey- 245f7.1 Si:dkey-245f7.1 Dr.122433 565865 -1.599 3.91E-08 si:dkey- 260j18.2 Si:dkey-260j18.2 Dr.106052 325231 -1.566 2.27E-21 si:dkey- 261j4.9 Si:dkey-261j4.9 Dr.77466 327124 -2.195 2.00E-05 si:dkey- 264g21.1 Si:dkey-264g21.1 Dr.74466 557132 -1.709 8.00E-05 -1.824 2.49E-14 -1.504 3.48E-07 si:dkey- 2n12.1 Si:dkey-2n12.1 Dr.79563 325699 -6.216 2.00E-05 si:dkey- 31f5.7 Si:dkey-31f5.7 Dr.43252 338306 -1.803 1.89E-07 si:dkey- 37m8.9 Si:dkey-37m8.9 Dr.107057 336081 -1.524 1.00E-05 si:dkey- 38l12.3 Si:dkey-38l12.3 Dr.132299 337617 -2.540 2.88E-09 si:dkey- 60a16.2 Si:dkey-60a16.2 Dr.80329 569432 -1.548 3.97E-14 si:dkey- 63j1.8 Si:dkey-63j1.8 Dr.79402 325383 -1.807 3.39E-16 si:dkey- 6e12.6 Si:dkey-6e12.6 Dr.80423 327525 -1.807 2.13E-11 si:dkey- 78l4.14 Si:dkey-78l4.14 Dr.78872 558738 -1.848 2.00E-05 si:dkey- 7l12.1 Si:dkey-7l12.1 Dr.79856 553232 -1.682 1.04E-13 si:dkey- 98n4.1 Si:dkey-98n4.1 Dr.105756 449876 -1.730 2.03E-28 si:dkey- 9a20.6 Si:dkey-9a20.6 Dr.82226 335251 -1.692 9.00E-05 -1.779 4.96E-07 si:dkeyp- 110c7.6 Si:dkeyp-110c7.6 Dr.25788 368326 -1.507 4.36E-07 -1.636 1.06E-28 -1.739 4.42E-07 -3.066 8.15E-24 si:dkeyp- 113d7.1 Si:dkeyp-113d7.1 Dr.31865 322036 -1.519 8.87E-21 si:dkeyp- 1h4.2 Si:dkeyp-1h4.2 Dr.122659 561568 -1.921 1.24E-18 si:dkeyp- 27e10.4 Si:dkeyp-27e10.4 Dr.45821 323897 -1.694 4.20E-17 si:dkeyp- 38g8.3 Si:dkeyp-38g8.3 Dr.140675 567017 -1.508 1.57E-09 -1.510 2.77E-17 -7.400 4.01E-34 si:dkeyp- 72h1.1 Si:dkeyp-72h1.1 Dr.134030 799956 -2.951 1.00E-05 si:dkeyp- 86e4.1 Si:dkeyp-86e4.1 Dr.90459 100034576 -2.048 1.52E-08 si:dkeyp- 89c11.1 Si:dkeyp-89c11.1 Dr.114710 402867 -1.746 4.35E-10 si:rp71- 36d5.1 Si:rp71-36d5.1 Dr.108558 368423 -2.025 6.00E-05 si:xx- 184l24.4 Si:xx-184l24.4 Dr.81117 368689 -1.868 2.14E-21 si:xx-35d8.1 Si:xx-35d8.1 Dr.81247 368404 -1.513 1.10E-07 si:xx-35d8.1 Si:xx-35d8.1 Dr.101800 368404 -1.504 1.48E-08 Seven in absentia homolog 2 siah2l (Drosophila)-like Dr.67167 378728 -1.699 1.15E-14 silvb Silver homolog (mouse) b Dr.75597 562810 -6.237 1.32E-22 Single-minded homolog 2 sim2 (Drosophila) Dr.15420 114450 -1.815 4.00E-05 Sine oculis homeobox homolog six2.1 2.1 Dr.8955 83415 -1.564 5.16E-15 six3a Sine oculis homeobox homolog 3a Dr.616 30635 -1.788 9.18E-24 six7 Sine oculis homeobox homolog 7 Dr.75839 30625 -1.712 5.00E-05 -2.607 9.64E-09
Solute carrier family 10 (sodium/bile acid cotransporter slc10a2 family), member 2 Dr.88326 393329 -4.013 3.11E-06 Solute carrier family 13 (sodium/sulphate symporters), slc13a1 member 1 Dr.83210 387592 -3.748 5.79E-17 Solute carrier family 16 (monocarboxylic acid slc16a9a transporters), member 9a Dr.7340 393382 -1.791 1.94E-07 -4.250 0.00E+00 -2.139 3.26E-17 -3.848 0.00E+00 Solute carrier family 16 (monocarboxylic acid slc16a9b transporters), member 9b Dr.140314 445158 -1.593 1.95E-09 Solute carrier family 25 (mitochondrial carrier; citrate slc25a1 transporter), member 1 Dr.13990 393579 -1.534 0.00E+00 Solute carrier family 25 (carnitine/acylcarnitine slc25a20 translocase), member 20 Dr.2784 393833 -1.775 0.00E+00
Solute carrier family 25 (mitochondrial carrier; phosphate slc25a3l carrier), member 3, like Dr.81977 393688 -2.585 2.05E-14 Solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member slc25a4 4 Dr.75854 327067 -2.082 0.00E+00 slc2a1 Solute carrier family 2, member 1 Dr.78744 555778 -6.631 2.01E-06 slc2a1 Solute carrier family 2, member 1 Dr.132485 555778 -3.183 9.86E-06 Solute carrier family 30 (zinc slc30a9 transporter), member 9 Dr.78263 497184 -1.613 3.44E-08 Solute carrier family 39 (zinc slc39a10 transporter), member 10 Dr.27119 393644 -1.845 1.91E-07 Solute carrier family 39 (zinc slc39a13 transporter), member 13 Dr.75981 368686 -1.589 5.56E-13 Solute carrier family 39 (zinc slc39a7 transporter), member 7 Dr.3818 30094 -2.878 1.19E-30
Solute carrier family 40 (iron- slc40a1 regulated transporter), member 1 Dr.81317 58153 -1.573 3.00E-35 Solute carrier family 4, anion slc4a1 exchanger, member 1 Dr.114267 84703 -1.603 1.29E-08 Solute carrier family 5 (sodium/glucose cotransporter), slc5a1 member 1 Dr.87868 393654 -1.881 1.00E-05
Solute carrier family 6 (neurotransmitter transporter, slc6a11 GABA), member 11 Dr.75244 325006 -2.670 5.00E-05
Solute carrier organic anion slco1c1 transporter family, member 1C1 Dr.83831 562772 -1.795 8.81E-18 slmap Sarcolemma associated protein Dr.81986 393146 -1.750 1.66E-08 -2.096 2.22E-21 smad2 MAD homolog 2 (Drosophila) Dr.79140 30639 -1.582 9.23E-13 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily smarca5 a, member 5 Dr.132275 282615 -1.703 1.19E-08 SWI/SNF-related matrix smarcb1 associated protein Dr.3884 30731 -1.792 4.01E-24 Structural maintenance of smc1a chromosomes 1A Dr.76942 403060 -1.703 3.00E-05 Structural maintenance of smc2 chromosomes 2 Dr.24234 321452 -1.542 3.44E-06 Structural maintenance of smc3 chromosomes 3 Dr.24937 324475 -1.549 5.01E-19 Structural maintenance of smc4 chromosomes 4 Dr.77769 192332 -1.578 7.00E-05
SMEK homolog 2, suppressor of smek2 mek1 (Dictyostelium) Dr.121387 336198 -2.172 4.38E-07 -1.881 3.11E-07 sms Spermine synthase Dr.79631 80872 -2.031 5.38E-23 SET and MYND domain smyd1b containing 1b Dr.40834 569027 -1.771 3.14E-06 Synaptosome-associated protein snap25b 25 b Dr.7598 30711 -2.108 5.70E-13 snrk SNF related kinase Dr.87325 436661 -1.985 6.33E-08
U1 small nuclear snrp70 ribonucleoprotein polypeptide A Dr.35845 445398 -1.696 4.83E-08
Small nuclear ribonucleoprotein snrpa polypeptide A Dr.76157 324121 -1.552 2.00E-05
Small nuclear ribonucleoprotein snrpc polypeptide C Dr.18318 192330 -1.656 1.70E-20
Small nuclear ribonucleoprotein snrpd3 D3 polypeptide Dr.83576 415171 -1.514 4.00E-05 snx1 Sorting nexin 1 Dr.140305 337386 -4.683 3.62E-08 -2.737 4.00E-05 snx12 Sorting nexin 12 Dr.132585 394098 -1.906 2.40E-21 sod1 Superoxide dismutase 1, soluble Dr.75822 30553 -1.964 7.98E-31 Superoxide dismutase 2, sod2 mitochondrial Dr.6314 335799 -1.738 6.00E-05 sol Solo Dr.79572 360133 -1.762 0.00E+00 sort1 Sortilin 1 Dr.30598 406511 -2.326 2.40E-22 sox1a SRY-box containing gene 1a Dr.6453 436756 -1.587 7.88E-09 SRY (sex determining region Y)- sox4b box 4b Dr.29160 393875 -1.657 8.62E-09 sox5 SRY-box containing gene 5 Dr.83313 567413 -1.739 1.55E-12 sp5Sp5 transcription factor Dr.78633 353154 -1.682 7.14E-20 sp5l Sp5 transcription factor-like Dr.78445 324261 -3.081 0.00E+00 Secreted acidic cysteine rich sparc glycoprotein Dr.75554 321357 -2.542 7.01E-13 Secreted acidic cysteine rich sparcl glycoprotein-like Dr.92040 567331 -1.542 4.00E-05 -4.157 4.74E-28 speg SPEG complex locus Dr.78781 324509 -1.999 1.34E-18 spi1 Spi1 Dr.34508 30117 -1.559 3.00E-05 spi1 Spi1 Dr.115782 30117 -2.685 2.16E-08 spon1a Spondin 1a Dr.75778 58027 -1.634 1.11E-09 spon1b Spondin 1b Dr.565 58029 -2.015 1.54E-28 Spondin 2b, extracellular matrix spon2b protein Dr.75777 30202 -2.285 2.75E-07 sprn Shadow of prion protein Dr.83352 386702 -1.583 3.03E-07 sps2 Selenophosphate synthetase 2 Dr.107753 352933 -2.249 1.89E-21 sr:nyz142 Sr:nyz142 Dr.33466 321347 -2.163 7.01E-06 sreb2 Sreb2 Dr.133606 57927 -1.757 3.72E-07 Serine/arginine-rich protein srpk1 specific kinase 1 Dr.77853 323679 -1.629 1.00E-04 Structure specific recognition ssrp1 protein 1 Dr.75223 386844 -2.343 5.01E-42
Suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 st13 interacting protein) Dr.76520 327184 -2.579 0.00E+00 ST6 beta-galactosamide alpha- st6gal1 2,6-sialyltranferase 1 Dr.84939 445376 -2.349 1.74E-29
ST6 (alpha-N-acetyl-neuraminyl- 2,3-beta-galactosyl-1,3)-N- acetylgalactosaminide alpha-2,6- st6galnac5 sialyltransferase 5 Dr.88733 407716 -1.820 1.00E-05
ST8 alpha-N-acetyl-neuraminide st8sia6 alpha-2,8-sialyltransferase 6 Dr.32597 553212 -1.834 6.78E-10 Signal transducer and activator of stat5.1 transcription 5.1 Dr.133576 369197 -1.595 4.00E-05
Staufen, RNA binding protein, stau2 homolog 2 (Drosophila) Dr.132481 393899 -1.587 7.55E-31 stc1 Stanniocalcin 1 Dr.88421 393511 -3.015 3.69E-16 Serine/threonine kinase 25 stk25 (STE20 homolog, yeast) Dr.16570 406600 -1.757 0.00E+00 stmn1 Stathmin 1 Dr.52664 378957 -2.654 5.47E-33 stxbp1Syntaxin binding protein 1 Dr.80263 574003 -1.586 3.00E-05 sub1 SUB1 homolog (S. cerevisiae) Dr.13991 436778 -2.070 2.50E-06 Succinate-CoA ligase, GDP- suclg2 forming, beta subunit Dr.102495 317746 -1.932 1.79E-41 Suppressor of fused homolog sufu (Drosophila) Dr.111032 334291 -1.519 5.23E-36 sulf2 Sulfatase 2 Dr.75551 393910 -1.670 1.02E-09 Sulfotransferase family, cytosolic sult1st1 sulfotransferase 1 Dr.132384 323424 -1.785 6.43E-30 Sulfotransferase family, cytosolic sult1st6 sulfotransferase 6 Dr.80724 436872 -6.630 0.00E+00 Sulfotransferase family 2, sult2st1 cytosolic sulfotransferase 1 Dr.25239 338214 -1.884 0.00E+00 SMT3 suppressor of mif two 3 sumo3 homolog 3 (yeast) Dr.1291 406398 -1.754 4.89E-17 surf5 Surfeit 5 Dr.15892 415234 -2.080 7.62E-27 Suppressor of variegation 3-9 suv39h1 homolog 1 Dr.80633 445198 -1.819 4.12E-10 Suppressor of variegation 4-20 suv420h1 homolog 1 (Drosophila) Dr.77736 572849 -2.150 8.00E-05 syn2 Synapsin II Dr.120313 436870 -2.465 3.15E-41 Synaptotagmin binding, cytoplasmic RNA interacting syncrip protein Dr.75407 326663 -1.841 3.46E-15 TAF5 RNA polymerase II, TATA box binding protein (TBP)- taf5 associated factor Dr.78627 641491 -1.790 7.19E-17 TAF5-like RNA polymerase II, p300/CBP-associated factor taf5l (PCAF)-associated factor Dr.80603 334055 -1.526 3.00E-05 TAF6 RNA polymerase II, TATA box binding protein (TBP)- taf6 associated factor Dr.36557 447818 -1.912 2.45E-10 T-cell activation GTPase tagap activating protein Dr.85673 447809 -3.493 1.36E-06 T-cell acute lymphocytic leukemia tal1 1 Dr.75812 30766 -2.271 0.00E+00 tardbp TAR DNA binding protein Dr.2409 325052 -1.629 5.00E-05 tat Tyrosine aminotransferase Dr.2455 322424 -1.916 4.00E-05 tbc1d19 TBC1 domain family, member 19 Dr.82468 393463 -2.015 4.75E-27 tbca Tubulin cofactor a Dr.76254 394029 -1.577 1.13E-10 tbl2 Transducin (beta)-like 2 Dr.116733 337068 -1.859 1.13E-12 tbr1 T-box 1, brain Dr.10723 58042 -1.622 1.52E-25 tbx1 T-box 1 Dr.78157 368206 -1.770 1.02E-25 tbx15 T-box 15 Dr.86249 246222 -1.853 4.42E-10 Transcription elongation factor B (SIII), polypeptide 2 (18kD, tceb2 elongin B) Dr.33340 192341 -1.696 4.01E-06 -2.578 3.26E-07 Transcription factor 7-like 2 (T-cell tcf7l2 specific, HMG-box) Dr.67692 30510 -1.641 4.57E-09 tdo2 Tryptophan 2,3-dioxygenase Dr.118021 322467 -8.487 8.52E-11 tfap2b Transcription factor AP-2 beta Dr.83177 550545 -2.748 8.39E-17 tfap2e Transcription factor AP-2 epsilon Dr.85842 393794 -2.183 2.72E-26 tfdp1 Transcription factor Dp-1 Dr.76564 393749 -1.603 1.08E-11 tfdp2 Transcription factor Dp-2 Dr.77606 338204 -1.528 4.24E-10 Transforming growth factor, beta tgfb3 3 Dr.116110 369195 -2.505 4.00E-05 Transforming growth factor, beta- tgfbi induced Dr.742 321421 -3.908 0.00E+00
THAP domain containing, thap3 apoptosis associated protein 3 Dr.91052 541481 -1.989 2.00E-05 Thyroid hormone receptor thrap4 associated protein 4 Dr.15534 323621 -3.815 7.00E-05 thrb Thyroid hormone receptor beta Dr.80868 30607 -1.720 4.24E-06 titf1a Thyroid transcription factor 1a Dr.82318 58112 -1.641 8.91E-07 tk1 Thymidine kinase 1, soluble Dr.20777 327590 -1.533 3.12E-12 tlr18 Toll-like receptor 18 Dr.89702 403133 -1.544 3.00E-05 -1.632 1.28E-26 tlr8b Toll-like receptor 8b Dr.89704 403136 -1.694 3.00E-05 Transmembrane and coiled-coil tmco1 domains 1 Dr.116099 378980 -1.553 2.51E-09
Transmembrane emp24 protein tmed3 transport domain containing 3 Dr.76728 336391 -1.582 5.00E-05 tmem112b Transmembrane protein 112b Dr.17394 407708 -1.705 7.10E-06 tmem161a Transmembrane protein 161A Dr.86254 492692 -1.510 7.00E-05 -1.556 2.00E-05 tmem16b Transmembrane protein 16B Dr.114611 566373 -4.001 3.00E-05 tmem48 Transmembrane protein 48 Dr.25587 335236 -1.750 6.31E-19 tmem56 Transmembrane protein 56 Dr.87204 449652 -1.549 1.39E-08 tmpoThymopoietin Dr.78808 352907 -2.260 9.01E-31 tmsb Thymosin, beta Dr.81294 402820 -2.226 6.07E-43 tnc Tenascin C Dr.33789 30037 -2.620 0.00E+00 tnc Tenascin C Dr.122483 30037 -1.904 2.94E-10 Tumor necrosis factor, alpha- tnfaip8l induced protein 8, like Dr.88310 393345 -1.678 8.88E-12
Tumor necrosis factor (ligand) tnfsf10l2 superfamily, member 10 like 2 Dr.86839 436866 -2.105 7.87E-07 tnw Tenascin W Dr.104489 30234 -3.356 8.39E-36 top1l Topoisomerase (DNA) I, like Dr.116982 553496 -3.497 1.00E-05 top2a Topoisomerase (DNA) II alpha Dr.31760 323733 -1.682 1.00E-05 tp73 Tumor protein p73 Dr.24319 368221 -2.465 9.40E-07 tpbglTrophoblast glycoprotein-like Dr.25206 373095 -2.442 5.10E-18 Tubulin polymerization-promoting tppp3 protein family member 3 Dr.23293 393825 -1.538 2.84E-10 traip TRAF-interacting protein Dr.84504 402900 -1.685 9.91E-16 trap1 TNF receptor-associated protein 1 Dr.77314 325532 -1.764 0.00E+00 trim35 Tripartite motif-containing 35 Dr.28310 334253 -1.661 5.09E-09 Thyroid hormone receptor trip13 interactor 13 Dr.79579 393554 -1.989 0.00E+00
Transient receptor potential cation trpc6 channel, subfamily C, member 6 Dr.48334 563989 -1.752 3.00E-05
Transient receptor potential cation trpv6 channel, subfamily V, member 6 Dr.118447 415109 -2.444 1.78E-09 try Trypsin Dr.75547 65223 -1.961 3.44E-06 tsga14 Testis specific, 14 Dr.79680 431741 -1.515 3.00E-05 tspan12 Tetraspanin 12 Dr.85232 394127 -1.653 1.51E-12 tspan13 Tetraspanin 13 Dr.119371 449797 -2.063 2.99E-27 tspan7 Tetraspanin 7 Dr.75189 406802 -1.983 2.38E-27 ttc5 Tetratricopeptide repeat domain 5 Dr.51677 550347 -1.647 2.47E-26 ttk Ttk protein kinase Dr.80755 317763 -1.516 2.72E-13
Tocopherol (alpha) transfer protein (ataxia (Friedreich-like) ttpa with vitamin E deficiency) Dr.78274 325906 -1.784 2.40E-13 Traf and tnf receptor associated ttrapl protein, like Dr.18071 553516 -2.051 1.74E-21 tuba1 Tubulin, alpha 1 Dr.132177 373080 -1.842 7.99E-13 tuba7l Tubulin, alpha 7 like Dr.12524 431777 -1.933 6.00E-05 tuba8l3 Tubulin, alpha 8 like 3 Dr.76038 445164 -2.377 8.55E-07 tuba8l4 Tubulin, alpha 8 like 4 Dr.132186 393154 -2.006 9.43E-28 tubb2b Tubulin, beta 2b Dr.52550 322003 -2.854 2.74E-28 tubb5 Tubulin, beta 5 Dr.35891 386701 -3.848 4.96E-09 Tubulin, gamma complex tubgcp5 associated protein 5 Dr.75301 553191 -1.560 3.44E-06 tubgl Tubulin, gamma-like Dr.11201 393882 -1.971 3.31E-42 twist2 Twist2 Dr.8299 30176 -2.000 4.54E-15 Twisted gastrulation homolog 1b twsg1b (Drosophila) Dr.83049 259304 -2.091 6.93E-24 txndc5 Thioredoxin domain containing 5 Dr.25420 406289 -2.912 0.00E+00 txnl2 Thioredoxin-like 2 Dr.36959 449777 -1.619 1.61E-09 tyms Thymidylate synthase Dr.1047 81540 -2.475 5.17E-26 tyrp1b Tyrosinase-related protein 1b Dr.132241 437022 -2.846 1.67E-14
Ubiquitin A-52 residue ribosomal uba52 protein fusion product 1 Dr.35198 641289 -2.398 1.43E-08 -2.061 2.00E-05 Ubiquitin-conjugating enzyme ube2n E2N Dr.16839 406807 -1.516 4.39E-13 Ubiquitin-conjugating enzyme ube2nl E2N-like Dr.114603 393313 -1.740 2.71E-27
Ubiquitin-like domain containing ublcp1 CTD phosphatase 1 Dr.106435 436591 -2.149 4.58E-24 Ubiquitin-like, containing PHD and uhrf1 RING finger domains, 1 Dr.77703 406350 -3.310 0.00E+00 ung Uracil-DNA glycosylase Dr.84790 393949 -1.670 5.92E-37 Ubiquinol-cytochrome c reductase, Rieske iron-sulfur uqcrfs1 polypeptide 1 Dr.76290 406359 -1.526 9.66E-07 usp1Ubiquitin specific protease 1 Dr.115559 322007 -1.544 1.72E-10 Ubiquitin specific protease 14 usp14 (tRNA-guanine transglycosylase) Dr.104685 335736 -1.647 4.77E-11 usp20 Ubiquitin specific protease 20 Dr.15440 393962 -1.576 2.00E-05 usp5Ubiquitin specific protease 5 Dr.20192 406618 -1.876 0.00E+00 Vesicle-associated membrane vamp1 protein 1 Dr.81227 406707 -1.943 8.55E-16 Vesicle-associated membrane vamp1 protein 1 Dr.119297 406707 -1.883 7.64E-14
Vesicle amine transport protein 1 vat1 homolog (T californica) Dr.63036 368752 -1.721 7.73E-07 -2.443 1.63E-06 vcanb Versican b Dr.77767 323465 -1.720 5.97E-23 -3.968 0.00E+00 vezf1 Vascular endothelial zinc finger 1 Dr.103946 556915 -1.813 6.94E-10 -1.727 1.06E-14 Visual system homeobox 1 vsx1 homolog, chx10-like Dr.558 30598 -2.767 5.26E-07 WD repeat and HMG-box DNA wdhd1 binding protein 1 Dr.52170 322945 -1.914 1.75E-16 WD repeat and HMG-box DNA wdhd1 binding protein 1 Dr.118814 322945 -1.637 4.18E-11 wdr18 WD repeat domain 18 Dr.95215 445819 -2.194 0.00E+00 wdr68 WD repeat domain 68 Dr.79208 337565 -1.647 9.67E-18 wdr8 WD repeat domain 8 Dr.25142 334381 -1.529 5.62E-09
Wingless-type MMTV integration wnt10b site family, member 10b Dr.88562 30308 -1.801 2.00E-05
Wingless-type MMTV integration wnt11r site family, member 11, related Dr.76466 30283 -2.091 0.00E+00
Wingless-type MMTV integration wnt2 site family member 2 Dr.378 30127 -1.533 5.17E-13
Wingless-type MMTV integration wnt5b site family, member 5b Dr.389 30105 -1.847 3.97E-27 wu:fa03a10 Wu:fa03a10 Dr.67 334758 -1.827 1.04E-07 wu:fa03a11 Wu:fa03a11 Dr.132160 334759 -1.725 5.57E-12 wu:fa03b06 Wu:fa03b06 Dr.75303 334763 -1.609 2.54E-07 wu:fa04a07 Wu:fa04a07 Dr.17958 334798 -1.571 3.49E-06 wu:fa04b03 Wu:fa04b03 Dr.75326 334804 -2.014 8.19E-34 wu:fa04e07 Wu:fa04e07 Dr.75451 334823 -1.616 4.03E-09 wu:fa04g05 Wu:fa04g05 Dr.181 334832 -1.521 1.74E-11 wu:fa04h02 Wu:fa04h02 Dr.185 334836 -1.731 4.63E-21 wu:fa06h02 Wu:fa06h02 Dr.41005 334876 -1.652 1.00E-04 -2.314 3.15E-11 wu:fa07c11 Wu:fa07c11 Dr.104432 334890 -1.566 7.81E-09 wu:fa08a03 Wu:fa08a03 Dr.18206 334901 -1.747 1.62E-33 wu:fa08e04 Wu:fa08e04 Dr.75525 334910 -2.001 3.48E-32 wu:fa08f05 Wu:fa08f05 Dr.75530 334912 -1.619 2.04E-06 wu:fa10g06 Wu:fa10g06 Dr.47429 334957 -1.739 8.00E-05 wu:fa11h05 Wu:fa11h05 Dr.52195 335017 -1.971 6.00E-09 wu:fa12e08 Wu:fa12e08 Dr.12565 335055 -2.930 5.64E-35 wu:fa12g12 Wu:fa12g12 Dr.46531 335066 -2.941 7.18E-13 wu:fa22g10 Wu:fa22g10 Dr.104496 327071 -2.067 1.98E-10 wu:fa55d05 Wu:fa55d05 Dr.39666 337318 -1.780 3.69E-12 wu:fa66a08 Wu:fa66a08 Dr.76007 336978 -1.828 1.70E-38 wu:fa91a03 Wu:fa91a03 Dr.75116 336640 -2.687 2.69E-14 wu:fa93c12 Wu:fa93c12 Dr.39606 336711 -1.849 1.96E-07 wu:fa95b08 Wu:fa95b08 Dr.104580 337012 -1.660 1.99E-14 -2.095 0.00E+00 -5.178 0.00E+00 wu:fa95e04 Wu:fa95e04 Dr.76219 337026 -4.145 1.35E-06 wu:fa95h12 Wu:fa95h12 Dr.32511 337041 -2.134 1.48E-24 wu:fa96a11 Wu:fa96a11 Dr.76248 337047 -1.561 4.25E-07 wu:fa96c07 Wu:fa96c07 Dr.47534 337051 -1.815 3.44E-11 wu:fa96e12 Wu:fa96e12 Dr.939 337064 -2.278 7.00E-05 wu:fa97d12 Wu:fa97d12 Dr.51640 337102 -2.436 3.39E-10 wu:fa97h07 Wu:fa97h07 Dr.104634 337111 -2.155 1.00E-05 wu:fa98c11 Wu:fa98c11 Dr.38020 337120 -1.870 1.00E-05 wu:fa99c11 Wu:fa99c11 Dr.76322 337157 -1.672 5.88E-13 wu:fa99d09 Wu:fa99d09 Dr.49154 337161 -4.579 2.21E-24 wu:fa99e11 Wu:fa99e11 Dr.1123 337165 -1.743 2.86E-17 wu:fa99f01 Wu:fa99f01 Dr.76388 337166 -2.382 6.85E-09 wu:fb02c11 Wu:fb02c11 Dr.76014 337216 -1.845 5.91E-27 wu:fb02c12 Wu:fb02c12 Dr.76417 337217 -1.793 4.63E-24 wu:fb02f05 Wu:fb02f05 Dr.32313 337231 -2.426 8.00E-05 -1.888 5.70E-06 wu:fb06e02 Wu:fb06e02 Dr.28545 336811 -2.814 0.00E+00 wu:fb06e12 Wu:fb06e12 Dr.104796 336814 -3.129 1.19E-33 wu:fb07d03 Wu:fb07d03 Dr.141511 336838 -1.777 1.08E-13 wu:fb07g12 Wu:fb07g12 Dr.76645 336853 -1.845 1.51E-34 wu:fb08e07 Wu:fb08e07 Dr.2877 336366 -8.038 1.83E-06 wu:fb08g06 Wu:fb08g06 Dr.4757 336375 -3.687 0.00E+00 wu:fb08h07 Wu:fb08h07 Dr.1911 336380 -2.032 2.00E-05 wu:fb09h07 Wu:fb09h07 Dr.23437 336413 -1.832 5.58E-07 -7.924 7.06E-07 wu:fb10e05 Wu:fb10e05 Dr.5356 336436 -1.506 2.51E-12 wu:fb10f12 Wu:fb10f12 Dr.76779 336441 -3.723 2.45E-36 wu:fb11e10 Wu:fb11e10 Dr.41811 336479 -2.816 2.30E-13 wu:fb11h05 Wu:fb11h05 Dr.76693 336493 -3.343 2.00E-05 wu:fb12a02 Wu:fb12a02 Dr.121628 336497 -1.694 2.00E-05 wu:fb12g12 Wu:fb12g12 Dr.130893 336532 -1.894 2.73E-15 wu:fb12g12 Wu:fb12g12 Dr.76615 336532 -1.803 9.71E-17 wu:fb13e09 Wu:fb13e09 Dr.121626 336554 -2.209 4.00E-05 wu:fb13g09 Wu:fb13g09 Dr.76665 336563 -1.589 7.00E-05 -1.627 3.00E-05 wu:fb14d09 Wu:fb14d09 Dr.76704 336592 -1.849 1.08E-09 wu:fb14g01 Wu:fb14g01 Dr.1484 336602 -2.170 9.00E-05 wu:fb15e04 Wu:fb15e04 Dr.32406 336624 -1.513 3.31E-06 -1.571 6.68E-10 -22.551 0.00E+00 wu:fb15g10 Wu:fb15g10 Dr.74463 336631 -1.642 1.74E-25 wu:fb18b07 Wu:fb18b07 Dr.76794 321521 -1.647 5.23E-06 wu:fb18f07 Wu:fb18f07 Dr.121708 321543 -1.671 4.48E-06 wu:fb20f08 Wu:fb20f08 Dr.76877 321582 -1.530 1.13E-06 wu:fb22b10 Wu:fb22b10 Dr.104833 321593 -1.798 3.00E-20 wu:fb22f09 Wu:fb22f09 Dr.21082 321604 -2.172 7.81E-12 wu:fb22g05 Wu:fb22g05 Dr.132265 321609 -1.729 1.00E-05 wu:fb24e01 Wu:fb24e01 Dr.4851 321648 -2.349 8.00E-05 wu:fb25h10 Wu:fb25h10 Dr.76765 321667 -1.560 8.41E-13 wu:fb30e01 Wu:fb30e01 Dr.76191 321699 -2.368 1.83E-18 wu:fb30e06 Wu:fb30e06 Dr.76846 321701 -2.536 1.11E-07 wu:fb30e12 Wu:fb30e12 Dr.106040 321704 -1.567 5.00E-05 wu:fb30f12 Wu:fb30f12 Dr.23664 321708 -1.956 7.22E-43 wu:fb33c08 Wu:fb33c08 Dr.23666 321735 -1.796 0.00E+00 wu:fb34c06 Wu:fb34c06 Dr.75618 321775 -1.822 5.43E-08 wu:fb36c10 Wu:fb36c10 Dr.104853 321820 -1.647 6.01E-10 wu:fb37a10 Wu:fb37a10 Dr.11310 321850 -2.769 7.38E-09 wu:fb37c10 Wu:fb37c10 Dr.76841 321862 -1.557 0.00E+00 wu:fb37g07 Wu:fb37g07 Dr.76888 321888 -2.526 6.22E-27 wu:fb40b03 Wu:fb40b03 Dr.76930 321985 -1.855 4.00E-05 wu:fb40f06 Wu:fb40f06 Dr.27293 322002 -1.862 2.73E-10 wu:fb44b02 Wu:fb44b02 Dr.34513 322020 -1.557 2.34E-08 wu:fb44b11 Wu:fb44b11 Dr.76935 322022 -2.118 4.16E-12 wu:fb44e02 Wu:fb44e02 Dr.31936 322029 -1.627 3.00E-05 wu:fb47c03 Wu:fb47c03 Dr.104822 322037 -1.757 4.08E-16 wu:fb48e04 Wu:fb48e04 Dr.12108 322056 -1.537 2.61E-08 wu:fb48g05 Wu:fb48g05 Dr.105024 322062 -1.935 3.83E-39 wu:fb49h10 Wu:fb49h10 Dr.23738 322096 -2.012 8.00E-05 wu:fb50f05 Wu:fb50f05 Dr.77010 322119 -2.072 8.77E-18 wu:fb51h04 Wu:fb51h04 Dr.33131 322158 -1.895 9.46E-40 wu:fb52b04 Wu:fb52b04 Dr.104977 322171 -1.728 6.43E-16 wu:fb53a11 Wu:fb53a11 Dr.105709 322203 -1.915 5.00E-05 wu:fb53c10 Wu:fb53c10 Dr.140557 322211 -1.531 6.00E-05 wu:fb55f05 Wu:fb55f05 Dr.75621 322286 -2.235 2.61E-07 wu:fb58f05 Wu:fb58f05 Dr.43294 322345 -1.981 6.78E-15 wu:fb58f07 Wu:fb58f07 Dr.4854 322346 -8.610 4.89E-09 wu:fb58g10 Wu:fb58g10 Dr.77046 322355 -1.520 8.14E-10 wu:fb59c09 Wu:fb59c09 Dr.77159 322377 -2.476 1.37E-34 wu:fb59d01 Wu:fb59d01 Dr.21094 322379 -1.732 4.77E-06 wu:fb59d03 Wu:fb59d03 Dr.77126 322381 -1.827 2.93E-09 wu:fb62a02 Wu:fb62a02 Dr.104435 322459 -4.112 3.00E-05 wu:fb62c07 Wu:fb62c07 Dr.74233 322470 -1.795 9.84E-06 wu:fb67h05 Wu:fb67h05 Dr.77299 322620 -2.501 1.08E-09 -17.614 1.09E-28 wu:fb68g12 Wu:fb68g12 Dr.524 322641 -1.849 2.50E-18 wu:fb69c03 Wu:fb69c03 Dr.4246 322653 -1.615 2.84E-06 wu:fb72c11 Wu:fb72c11 Dr.75160 322739 -4.663 2.09E-08 wu:fb72h05 Wu:fb72h05 Dr.104394 322766 -1.696 9.12E-32 wu:fb74b04 Wu:fb74b04 Dr.75220 322819 -1.646 1.84E-13 wu:fb74b10 Wu:fb74b10 Dr.75239 322820 -1.920 3.04E-10 wu:fb74f10 Wu:fb74f10 Dr.75210 322841 -1.567 1.32E-11 wu:fb74h01 Wu:fb74h01 Dr.104493 322847 -1.547 4.50E-08 wu:fb75h03 Wu:fb75h03 Dr.5361 322882 -1.658 1.00E-05 wu:fb76b09 Wu:fb76b09 Dr.65372 322895 -2.164 9.46E-07 wu:fb76c07 Wu:fb76c07 Dr.77262 322901 -1.513 5.00E-05 wu:fb76e01 Wu:fb76e01 Dr.13909 322908 -1.595 7.81E-20 wu:fb76e12 Wu:fb76e12 Dr.77247 322909 -1.980 6.91E-06 wu:fb77a07 Wu:fb77a07 Dr.31566 322920 -1.691 5.58E-22 wu:fb77c07 Wu:fb77c07 Dr.132327 322936 -2.012 3.46E-07 wu:fb77d11 Wu:fb77d11 Dr.106456 322944 -1.759 8.51E-09 wu:fb79b02 Wu:fb79b02 Dr.144 323019 -2.304 1.11E-23 wu:fb79c08 Wu:fb79c08 Dr.45830 323026 -2.079 1.17E-07 wu:fb79e08 Wu:fb79e08 Dr.11467 323034 -1.941 3.62E-22 wu:fb79g11 Wu:fb79g11 Dr.132348 323040 -1.775 4.38E-14 wu:fb81b05 Wu:fb81b05 Dr.3633 323083 -3.182 4.74E-26 wu:fb81f11 Wu:fb81f11 Dr.77411 323100 -1.766 5.34E-20 wu:fb82d10 Wu:fb82d10 Dr.15267 323118 -4.226 6.57E-07 wu:fb82g02 Wu:fb82g02 Dr.6230 323132 -1.718 5.76E-14 wu:fb82h05 Wu:fb82h05 Dr.77563 323142 -1.667 3.50E-11 wu:fb82h08 Wu:fb82h08 Dr.92043 323143 -1.944 4.00E-05 wu:fb83c11 Wu:fb83c11 Dr.3052 323154 -1.718 3.26E-06 wu:fb92b11 Wu:fb92b11 Dr.77574 323192 -1.609 1.07E-12 wu:fb92g05 Wu:fb92g05 Dr.132364 323222 -2.155 1.42E-18 wu:fb93c02 Wu:fb93c02 Dr.121775 323247 -1.634 1.07E-11 wu:fb93g03 Wu:fb93g03 Dr.77595 323265 -3.910 2.21E-37 wu:fb93g03 Wu:fb93g03 Dr.132381 323265 -1.792 2.30E-08 -1.735 5.10E-08 wu:fb93g07 Wu:fb93g07 Dr.21210 323267 -1.521 5.62E-06 wu:fb94b04 Wu:fb94b04 Dr.65946 323278 -1.698 6.00E-05 wu:fb94c04 Wu:fb94c04 Dr.128253 323286 -2.629 5.01E-14 wu:fb95f12 Wu:fb95f12 Dr.77618 323343 -1.947 2.90E-12 wu:fb96g10 Wu:fb96g10 Dr.77715 323385 -1.792 1.14E-08 wu:fb97a12 Wu:fb97a12 Dr.51349 323393 -1.777 9.55E-18 wu:fb97b07 Wu:fb97b07 Dr.77722 323395 -2.062 2.73E-10 wu:fb97h03 Wu:fb97h03 Dr.77738 323419 -1.960 9.80E-14 wu:fb98b12 Wu:fb98b12 Dr.14553 386977 -1.541 9.14E-06 wu:fb99c11 Wu:fb99c11 Dr.21284 323472 -1.660 4.65E-19 wu:fb99e06 Wu:fb99e06 Dr.77781 323481 -1.667 3.33E-06 -2.055 4.35E-06 -2.851 2.94E-06 -4.966 0.00E+00 wu:fb99f11 Wu:fb99f11 Dr.77788 323489 -1.809 3.82E-28 wu:fb99g07 Wu:fb99g07 Dr.75736 323493 -1.710 1.27E-08 wu:fc02c04 Wu:fc02c04 Dr.33092 323544 -1.566 6.61E-16 wu:fc02d01 Wu:fc02d01 Dr.77832 323546 -2.004 1.12E-07 wu:fc02g02 Wu:fc02g02 Dr.104398 323558 -1.636 1.22E-16 wu:fc03a11 Wu:fc03a11 Dr.117116 323566 -2.381 3.00E-05 wu:fc03c12 Wu:fc03c12 Dr.77991 323571 -1.547 4.00E-05 wu:fc04b02 Wu:fc04b02 Dr.121850 323591 -1.827 1.75E-06 wu:fc04c01 Wu:fc04c01 Dr.5648 323597 -2.698 1.76E-07 wu:fc04d08 Wu:fc04d08 Dr.121851 323604 -1.626 2.00E-05 wu:fc05g01 Wu:fc05g01 Dr.78375 323636 -1.833 5.63E-07 -1.778 1.68E-10 wu:fc06b06 Wu:fc06b06 Dr.108565 323651 -1.639 2.00E-05 wu:fc06d10 Wu:fc06d10 Dr.121840 323663 -2.059 3.21E-10 wu:fc06e02 Wu:fc06e02 Dr.105552 323666 -1.755 5.09E-09 wu:fc06f06 Wu:fc06f06 Dr.78305 323670 -3.992 3.13E-12 wu:fc07b10 Wu:fc07b10 Dr.77937 323692 -4.812 0.00E+00 wu:fc07e11 Wu:fc07e11 Dr.8617 323709 -1.626 3.29E-11 wu:fc12d07 Wu:fc12d07 Dr.76701 323866 -1.517 1.00E-05 wu:fc12g11 Wu:fc12g11 Dr.76533 323879 -1.538 2.78E-06 wu:fc13d09 Wu:fc13d09 Dr.32816 323898 -1.616 3.48E-10 wu:fc14a04 Wu:fc14a04 Dr.22881 323913 -1.884 2.62E-07 wu:fc14g02 Wu:fc14g02 Dr.34351 323940 -1.665 1.64E-12 wu:fc15f06 Wu:fc15f06 Dr.78434 323964 -2.031 3.46E-06 wu:fc15g08 Wu:fc15g08 Dr.77881 323970 -1.556 4.75E-06 wu:fc18f06 Wu:fc18f06 Dr.130606 324096 -1.919 1.37E-15 wu:fc18f10 Wu:fc18f10 Dr.122392 324097 -1.530 2.43E-10 wu:fc19f02 Wu:fc19f02 Dr.22472 324127 -1.692 2.40E-20 wu:fc19g04 Wu:fc19g04 Dr.20503 324133 -1.568 2.20E-19 wu:fc20b11 Wu:fc20b11 Dr.75331 324146 -1.525 5.31E-17 wu:fc20g02 Wu:fc20g02 Dr.91654 324160 -1.569 7.07E-06 wu:fc21a03 Wu:fc21a03 Dr.106313 324170 -1.655 5.97E-14 wu:fc21b02 Wu:fc21b02 Dr.122402 324174 -1.534 4.80E-06 wu:fc21b03 Wu:fc21b03 Dr.122403 324175 -2.017 8.97E-10 wu:fc22a11 Wu:fc22a11 Dr.78496 324223 -4.368 7.12E-13 wu:fc22b02 Wu:fc22b02 Dr.79080 324224 -1.857 8.31E-06 wu:fc22c09 Wu:fc22c09 Dr.74490 324234 -1.734 3.97E-16 -1.718 3.51E-06 wu:fc22h03 Wu:fc22h03 Dr.38615 324253 -2.456 1.68E-23 wu:fc23d01 Wu:fc23d01 Dr.22938 324271 -1.625 1.27E-07 wu:fc23h02 Wu:fc23h02 Dr.29914 324294 -1.534 7.46E-09 wu:fc25e11 Wu:fc25e11 Dr.21610 324320 -1.539 1.02E-10 wu:fc26h06 Wu:fc26h06 Dr.75184 324372 -3.115 1.12E-44 wu:fc28b11 Wu:fc28b11 Dr.105799 324418 -1.681 4.06E-10 wu:fc29c12 Wu:fc29c12 Dr.78749 324446 -3.526 1.36E-08 wu:fc30g11 Wu:fc30g11 Dr.105823 324493 -1.563 1.97E-12 wu:fc32b03 Wu:fc32b03 Dr.78840 386985 -1.534 9.00E-05 wu:fc32b08 Wu:fc32b08 Dr.21617 324544 -1.541 1.00E-05 -2.643 1.07E-10 wu:fc32g03 Wu:fc32g03 Dr.78845 324557 -2.051 3.02E-10 wu:fc33h04 Wu:fc33h04 Dr.104956 324596 -3.127 9.99E-20 wu:fc34g03 Wu:fc34g03 Dr.78590 324613 -1.768 3.76E-16 wu:fc37b07 Wu:fc37b07 Dr.105729 324647 -1.556 4.36E-06 wu:fc37c02 Wu:fc37c02 Dr.105731 324650 -1.720 9.00E-05 wu:fc38c08 Wu:fc38c08 Dr.132448 324687 -1.834 4.91E-25 wu:fc38d05 Wu:fc38d05 Dr.105744 324691 -1.763 3.03E-08 wu:fc38d09 Wu:fc38d09 Dr.21497 324693 -1.543 3.26E-06 wu:fc38f05 Wu:fc38f05 Dr.32964 324699 -1.958 1.71E-36 wu:fc39b12 Wu:fc39b12 Dr.52229 324715 -1.797 6.03E-24 wu:fc39c04 Wu:fc39c04 Dr.105765 324718 -1.603 1.70E-10 wu:fc43e12 Wu:fc43e12 Dr.52204 324797 -2.120 2.62E-37 wu:fc44c01 Wu:fc44c01 Dr.21501 324817 -2.010 9.62E-10 wu:fc44e02 Wu:fc44e02 Dr.79112 324828 -1.613 5.80E-08 wu:fc46h07 Wu:fc46h07 Dr.77491 324885 -1.880 3.62E-10 wu:fc46h12 Wu:fc46h12 Dr.106024 324888 -2.010 1.10E-13 wu:fc47a10 Wu:fc47a10 Dr.78936 324893 -1.571 1.66E-13 wu:fc48g12 Wu:fc48g12 Dr.78949 324937 -1.509 5.68E-13 wu:fc49f05 Wu:fc49f05 Dr.78960 324964 -1.950 6.86E-07 wu:fc50c06 Wu:fc50c06 Dr.105962 324980 -1.735 8.61E-10 wu:fc50e03 Wu:fc50e03 Dr.105964 324987 -1.989 2.57E-24 wu:fc50g04 Wu:fc50g04 Dr.78973 324991 -2.340 1.49E-33 wu:fc51b07 Wu:fc51b07 Dr.78979 325002 -1.556 3.00E-05 wu:fc51d01 Wu:fc51d01 Dr.76098 325010 -1.835 1.70E-11 wu:fc51g12 Wu:fc51g12 Dr.76734 573988 -1.602 4.80E-06 wu:fc51h02 Wu:fc51h02 Dr.78989 325026 -1.529 4.39E-07 wu:fc52e09 Wu:fc52e09 Dr.79004 325043 -1.563 6.00E-05 wu:fc52f04 Wu:fc52f04 Dr.76826 325046 -1.654 2.11E-09 wu:fc52f04 Wu:fc52f04 Dr.105980 325046 -1.527 4.92E-14 wu:fc55a06 Wu:fc55a06 Dr.3915 325091 -3.766 3.00E-05 wu:fc56a06 Wu:fc56a06 Dr.31478 325124 -1.649 7.36E-09 wu:fc56b06 Wu:fc56b06 Dr.32910 325128 -2.027 3.52E-10 wu:fc58a12 Wu:fc58a12 Dr.132522 325180 -1.581 8.33E-11 wu:fc58c10 Wu:fc58c10 Dr.79212 325183 -1.566 1.44E-16 wu:fc58d04 Wu:fc58d04 Dr.40125 325185 -2.427 4.80E-13 wu:fc59a02 Wu:fc59a02 Dr.109104 325195 -1.696 1.52E-10 wu:fc59c03 Wu:fc59c03 Dr.8738 325201 -1.532 9.00E-05 wu:fc60b09 Wu:fc60b09 Dr.106089 325220 -1.897 3.56E-07 wu:fc61h01 Wu:fc61h01 Dr.106096 325239 -2.472 9.77E-39 wu:fc63a01 Wu:fc63a01 Dr.79244 325259 -1.658 6.84E-06 wu:fc63c11 Wu:fc63c11 Dr.106107 325265 -1.717 1.11E-14 wu:fc63h12 Wu:fc63h12 Dr.18165 325273 -2.124 3.90E-20 wu:fc66a02 Wu:fc66a02 Dr.67676 325304 -2.341 2.25E-22 wu:fc74g12 Wu:fc74g12 Dr.78040 325408 -2.072 3.00E-05 wu:fc75c05 Wu:fc75c05 Dr.119731 325417 -1.797 4.12E-07 wu:fc79g11 Wu:fc79g11 Dr.67185 325468 -3.381 4.59E-20 wu:fc80c01 Wu:fc80c01 Dr.47774 325473 -1.723 4.06E-08 wu:fc80d08 Wu:fc80d08 Dr.106219 325475 -1.585 3.20E-06 wu:fc83c09 Wu:fc83c09 Dr.79475 325489 -2.909 3.33E-08 wu:fc83f05 Wu:fc83f05 Dr.79478 325498 -8.169 1.45E-08 wu:fc83h02 Wu:fc83h02 Dr.78745 325508 -2.058 1.73E-12 wu:fc88b11 Wu:fc88b11 Dr.51636 325562 -1.569 3.68E-07 wu:fc90b03 Wu:fc90b03 Dr.21962 325590 -1.854 3.14E-06 wu:fd02c11 Wu:fd02c11 Dr.79060 325683 -1.640 1.00E-05 wu:fd07b08 Wu:fd07b08 Dr.33763 325728 -1.688 2.11E-25 wu:fd07f11 Wu:fd07f11 Dr.106307 325739 -1.673 2.63E-10 wu:fd08a01 Wu:fd08a01 Dr.62690 325745 -1.516 9.27E-06 wu:fd13d06 Wu:fd13d06 Dr.105286 325836 -2.035 2.54E-10 wu:fd16d01 Wu:fd16d01 Dr.6236 327195 -2.549 6.91E-23 wu:fd16g01 Wu:fd16g01 Dr.6360 327209 -2.717 4.67E-09 wu:fd16h07 Wu:fd16h07 Dr.77084 327212 -2.212 3.28E-34 wu:fd23c12 Wu:fd23c12 Dr.132613 325853 -1.544 1.80E-08 wu:fd36h06 Wu:fd36h06 Dr.79872 325877 -3.278 3.82E-10 wu:fd42f04 Wu:fd42f04 Dr.106615 325883 -2.324 1.65E-06 wu:fd43b11 Wu:fd43b11 Dr.80003 325892 -2.218 3.13E-13 wu:fd44c11 Wu:fd44c11 Dr.22220 325903 -2.931 1.14E-17 wu:fd44h08 Wu:fd44h08 Dr.106461 325913 -4.359 7.36E-14 wu:fd56c01 Wu:fd56c01 Dr.122104 325998 -1.584 5.00E-05 wu:fd58b05 Wu:fd58b05 Dr.94688 326021 -3.632 5.03E-08 wu:fd59c01 Wu:fd59c01 Dr.52856 326037 -1.749 3.00E-05 -1.987 4.67E-12 -1.886 1.00E-05 -2.360 7.18E-15 wu:fd60a06 Wu:fd60a06 Dr.72373 326054 -1.527 4.80E-10 wu:fd60d11 Wu:fd60d11 Dr.132655 326064 -1.630 4.33E-06 wu:fd60e07 Wu:fd60e07 Dr.79935 326066 -1.621 1.00E-05 wu:fe01h05 Wu:fe01h05 Dr.33655 326659 -1.557 6.62E-15 wu:fe02c10 Wu:fe02c10 Dr.79297 326665 -1.972 6.37E-15 wu:fe05b03 Wu:fe05b03 Dr.80638 326679 -1.730 2.59E-08 wu:fe11g03 Wu:fe11g03 Dr.108812 326737 -1.665 1.96E-06 wu:fe11h11 Wu:fe11h11 Dr.74223 326742 -1.691 1.00E-05 wu:fe16b04 Wu:fe16b04 Dr.80133 326769 -1.676 5.78E-09 wu:fe24a06 Wu:fe24a06 Dr.132679 326807 -3.118 6.75E-06 wu:fe24e09 Wu:fe24e09 Dr.106515 326813 -1.567 3.00E-05 -1.519 4.00E-05 -2.027 2.54E-14 wu:fe36f02 Wu:fe36f02 Dr.6102 326858 -1.507 3.66E-06 wu:fe47d07 Wu:fe47d07 Dr.117308 326898 -1.500 3.89E-11 wu:fe47g12 Wu:fe47g12 Dr.104817 326904 -2.134 1.77E-32 wu:fi03h07 Wu:fi03h07 Dr.80373 327343 -2.139 4.43E-15 wu:fi04c12 Wu:fi04c12 Dr.80378 327353 -2.001 5.37E-13 wu:fi04d09 Wu:fi04d09 Dr.80380 327358 -1.515 9.62E-06 wu:fi05d09 Wu:fi05d09 Dr.35556 327386 -3.087 3.54E-06 wu:fi11e03 Wu:fi11e03 Dr.17505 327443 -1.572 8.00E-05 wu:fi11g01 Wu:fi11g01 Dr.33813 327448 -1.568 2.69E-11 wu:fi12c04 Wu:fi12c04 Dr.80375 327457 -1.586 1.00E-04 wu:fi13d03 Wu:fi13d03 Dr.106663 327475 -2.256 2.02E-06 wu:fi15a11 Wu:fi15a11 Dr.132732 327511 -1.855 3.91E-18 wu:fi15d04 Wu:fi15d04 Dr.79942 327519 -2.097 9.30E-12 wu:fi25c01 Wu:fi25c01 Dr.45899 333985 -2.532 4.20E-45 wu:fi31e12 Wu:fi31e12 Dr.75996 334103 -1.590 9.00E-05 wu:fi33c08 Wu:fi33c08 Dr.78150 334136 -1.959 1.55E-19 wu:fi35d08 Wu:fi35d08 Dr.76537 334194 -1.503 1.27E-06 wu:fi40b08 Wu:fi40b08 Dr.24020 334311 -2.435 4.44E-08 -2.445 1.02E-07 wu:fi41h04 Wu:fi41h04 Dr.80691 334344 -1.548 9.63E-10 wu:fi43f08 Wu:fi43f08 Dr.80699 334374 -1.595 3.96E-06 wu:fi48f03 Wu:fi48f03 Dr.119413 334410 -1.758 5.29E-09 wu:fi49b09 Wu:fi49b09 Dr.79130 334413 -4.164 0.00E+00 wu:fi69e10 Wu:fi69e10 Dr.75883 334445 -1.610 1.91E-06 wu:fi74c02 Wu:fi74c02 Dr.122384 334459 -3.359 0.00E+00 wu:fj01a12 Wu:fj01a12 Dr.80190 335318 -1.525 1.75E-06 wu:fj04c08 Wu:fj04c08 Dr.106551 335341 -2.601 1.57E-19 wu:fj04e09 Wu:fj04e09 Dr.22342 335344 -1.623 1.06E-06 wu:fj04f08 Wu:fj04f08 Dr.80233 335346 -1.504 8.05E-07 wu:fj08a11 Wu:fj08a11 Dr.104700 335381 -2.708 1.36E-08 wu:fj09e11 Wu:fj09e11 Dr.80772 335408 -1.636 1.18E-06 wu:fj11d04 Wu:fj11d04 Dr.122291 335428 -1.765 4.72E-13 wu:fj14d10 Wu:fj14d10 Dr.129380 335457 -1.541 2.33E-08 wu:fj15f04 Wu:fj15f04 Dr.122304 335471 -1.614 9.11E-08 wu:fj17a09 Wu:fj17a09 Dr.77645 335489 -1.687 6.33E-11 wu:fj17e06 Wu:fj17e06 Dr.78294 335500 -1.895 3.19E-09 wu:fj19a05 Wu:fj19a05 Dr.22588 335520 -2.388 2.52E-15 wu:fj19b07 Wu:fj19b07 Dr.7375 335521 -1.918 4.74E-31 wu:fj19g07 Wu:fj19g07 Dr.122316 335531 -1.595 4.00E-05 wu:fj20a04 Wu:fj20a04 Dr.80832 335533 -2.264 2.54E-13 wu:fj21f04 Wu:fj21f04 Dr.122321 335555 -3.520 0.00E+00 wu:fj22b05 Wu:fj22b05 Dr.80845 335563 -2.136 1.90E-07 wu:fj22d03 Wu:fj22d03 Dr.104779 335567 -9.868 1.36E-09 wu:fj22f08 Wu:fj22f08 Dr.80022 335575 -1.714 2.00E-05 wu:fj22f09 Wu:fj22f09 Dr.80938 335576 -1.631 2.00E-05 -2.020 3.00E-05 wu:fj23b11 Wu:fj23b11 Dr.21044 335587 -1.510 1.51E-06 -1.989 2.12E-11 wu:fj29e05 Wu:fj29e05 Dr.35268 335613 -2.052 3.14E-12 wu:fj29e12 Wu:fj29e12 Dr.107002 335614 -1.522 3.08E-07 wu:fj29g04 Wu:fj29g04 Dr.80944 335615 -1.562 4.55E-25 wu:fj29h11 Wu:fj29h11 Dr.80945 335618 -2.207 0.00E+00 wu:fj32d07 Wu:fj32d07 Dr.82612 335640 -1.903 4.29E-06 wu:fj34g08 Wu:fj34g08 Dr.7607 335853 -2.146 9.50E-22 wu:fj34h01 Wu:fj34h01 Dr.7066 335854 -1.601 1.18E-16 wu:fj35c01 Wu:fj35c01 Dr.79320 335862 -2.180 1.22E-27 wu:fj35g06 Wu:fj35g06 Dr.80269 335877 -1.531 3.37E-08 wu:fj36c08 Wu:fj36c08 Dr.80277 335897 -1.570 7.00E-05 wu:fj36c11 Wu:fj36c11 Dr.7605 335898 -1.570 1.68E-10 wu:fj36f04 Wu:fj36f04 Dr.118387 335908 -1.974 1.40E-45 wu:fj37c02 Wu:fj37c02 Dr.81020 335918 -2.277 3.76E-11 wu:fj38c09 Wu:fj38c09 Dr.81028 335932 -1.550 3.00E-05 -1.536 3.00E-05 wu:fj39b01 Wu:fj39b01 Dr.81036 335946 -1.821 1.62E-06 wu:fj39g12 Wu:fj39g12 Dr.81040 335958 -2.844 3.22E-09 wu:fj40c05 Wu:fj40c05 Dr.81042 335965 -2.036 2.65E-16 wu:fj40f01 Wu:fj40f01 Dr.115270 335969 -2.046 5.12E-06 wu:fj40f01 Wu:fj40f01 Dr.47145 335969 -1.789 3.58E-08 wu:fj41g03 Wu:fj41g03 Dr.22690 335986 -2.329 2.87E-07 wu:fj41h10 Wu:fj41h10 Dr.79624 335987 -1.905 4.49E-07 wu:fj41h10 Wu:fj41h10 Dr.132823 335987 -1.826 1.08E-31 wu:fj43h03 Wu:fj43h03 Dr.22709 336026 -2.243 0.00E+00 wu:fj43h12 Wu:fj43h12 Dr.81131 336029 -2.471 5.11E-20 wu:fj44b04 Wu:fj44b04 Dr.22713 336030 -1.553 7.00E-05 wu:fj46c01 Wu:fj46c01 Dr.81075 336059 -1.702 1.81E-06 wu:fj46d11 Wu:fj46d11 Dr.22733 336064 -2.654 1.88E-20 wu:fj46e08 Wu:fj46e08 Dr.22751 336065 -1.523 8.16E-10 wu:fj48b05 Wu:fj48b05 Dr.81085 336091 -2.120 2.61E-16 wu:fj49c06 Wu:fj49c06 Dr.22759 336119 -2.176 2.00E-05 wu:fj49d11 Wu:fj49d11 Dr.28607 336123 -1.530 1.99E-08 wu:fj52a04 Wu:fj52a04 Dr.81108 336150 -2.149 2.77E-18 wu:fj52e09 Wu:fj52e09 Dr.106574 336157 -1.714 4.93E-12 wu:fj53a05 Wu:fj53a05 Dr.81170 336163 -1.695 8.00E-05 wu:fj53a09 Wu:fj53a09 Dr.81171 336164 -1.868 2.87E-09 wu:fj53b07 Wu:fj53b07 Dr.107090 336166 -1.589 3.39E-07 wu:fj55b07 Wu:fj55b07 Dr.81177 336194 -2.724 6.65E-15 wu:fj55b09 Wu:fj55b09 Dr.122354 336195 -1.891 6.82E-09 wu:fj56b03 Wu:fj56b03 Dr.140645 336211 -3.879 3.14E-22 wu:fj59a01 Wu:fj59a01 Dr.81226 336240 -1.556 6.42E-06 wu:fj59h10 Wu:fj59h10 Dr.22812 336261 -1.519 2.73E-06 -1.670 2.00E-05 wu:fj60a06 Wu:fj60a06 Dr.7877 336263 -1.947 3.09E-20 wu:fj60a11 Wu:fj60a11 Dr.81239 336264 -3.349 1.84E-13 wu:fj60h04 Wu:fj60h04 Dr.107128 336273 -1.946 4.63E-06 wu:fj62g07 Wu:fj62g07 Dr.77191 336307 -2.242 1.56E-07 wu:fj63a01 Wu:fj63a01 Dr.107033 336310 -3.296 7.21E-20 wu:fj63a10 Wu:fj63a10 Dr.81489 336313 -2.164 3.71E-43 wu:fj63d08 Wu:fj63d08 Dr.74013 336320 -1.860 4.62E-20 wu:fj64b09 Wu:fj64b09 Dr.106845 336332 -1.983 1.32E-24 wu:fj65d03 Wu:fj65d03 Dr.106578 337377 -1.578 4.14E-07 wu:fj66h02 Wu:fj66h02 Dr.124781 337415 -2.080 9.77E-19 wu:fj67f05 Wu:fj67f05 Dr.77690 337439 -1.821 1.78E-09 wu:fj78b08 Wu:fj78b08 Dr.122441 337485 -2.511 1.39E-09 wu:fj82g10 Wu:fj82g10 Dr.81514 337554 -1.546 8.27E-07 wu:fj85a06 Wu:fj85a06 Dr.75397 337584 -1.881 8.28E-15 wu:fj85a06 Wu:fj85a06 Dr.113601 337584 -1.680 1.95E-07 wu:fj85h12 Wu:fj85h12 Dr.81581 337599 -2.056 1.00E-05 wu:fj85h12 Wu:fj85h12 Dr.122463 337599 -1.653 1.55E-07 wu:fj86d02 Wu:fj86d02 Dr.79919 337602 -1.505 1.57E-06 -5.113 1.04E-26 wu:fj87c06 Wu:fj87c06 Dr.9554 337619 -1.514 2.00E-05 -1.665 5.98E-15 wu:fj88f11 Wu:fj88f11 Dr.23030 337632 -2.068 1.49E-06 wu:fj97b11 Wu:fj97b11 Dr.72345 334501 -2.388 3.83E-13 wu:fj97b11 Wu:fj97b11 Dr.119832 334501 -1.978 4.00E-05 wu:fj98d09 Wu:fj98d09 Dr.79037 334525 -1.720 3.16E-23 wu:fk11d03 Wu:fk11d03 Dr.77088 337281 -1.795 2.77E-14 wu:fk20d12 Wu:fk20d12 Dr.80057 336868 -1.591 1.28E-13 wu:fk20e09 Wu:fk20e09 Dr.36327 336869 -1.540 1.00E-05 wu:fk23f11 Wu:fk23f11 Dr.14942 336881 -1.674 1.04E-17 wu:fk25e12 Wu:fk25e12 Dr.81805 336896 -2.066 1.28E-07 wu:fk30d11 Wu:fk30d11 Dr.81838 336932 -3.395 1.12E-17 wu:fk31a04 Wu:fk31a04 Dr.85995 336937 -2.316 2.00E-05 wu:fk31a07 Wu:fk31a07 Dr.23104 336938 -1.743 3.04E-08 wu:fk34f03 Wu:fk34f03 Dr.104587 336960 -1.708 4.29E-16 wu:fk35f04 Wu:fk35f04 Dr.76616 386925 -1.836 6.78E-06 wu:fk52f12 Wu:fk52f12 Dr.76671 334704 -1.851 4.25E-13 wu:fk54a10 Wu:fk54a10 Dr.81960 335663 -1.563 5.00E-05 -7.497 5.62E-33 wu:fk54d07 Wu:fk54d07 Dr.81961 335668 -2.358 4.93E-08 wu:fk56e01 Wu:fk56e01 Dr.81970 335690 -1.553 8.00E-05 wu:fk57e03 Wu:fk57e03 Dr.23279 335696 -1.996 1.78E-13 wu:fk57f03 Wu:fk57f03 Dr.81974 335697 -8.573 6.46E-07 wu:fk59g12 Wu:fk59g12 Dr.81942 335723 -2.235 2.89E-23 wu:fk59h02 Wu:fk59h02 Dr.81943 335724 -3.283 2.00E-05 wu:fk61g04 Wu:fk61g04 Dr.23225 335731 -1.679 3.48E-12 wu:fk63g08 Wu:fk63g08 Dr.81988 335741 -1.668 9.18E-08 wu:fk66f10 Wu:fk66f10 Dr.9981 335095 -2.428 6.33E-18 wu:fk76c08 Wu:fk76c08 Dr.104629 335139 -2.115 4.39E-10 wu:fk85d05 Wu:fk85d05 Dr.107555 335180 -2.025 1.93E-12 wu:fk85f10 Wu:fk85f10 Dr.105704 335182 -1.620 2.89E-09 wu:fk86g06 Wu:fk86g06 Dr.82091 335193 -2.359 5.08E-12 wu:fk86g11 Wu:fk86g11 Dr.10031 335194 -1.531 5.75E-06 -1.912 5.00E-05 -3.139 5.00E-05 wu:fk89a06 Wu:fk89a06 Dr.76229 335205 -3.624 5.76E-09 wu:fl02d04 Wu:fl02d04 Dr.122566 335264 -1.713 4.00E-05 -1.542 5.77E-08 wu:fl03d04 Wu:fl03d04 Dr.107584 335268 -1.583 3.69E-10 wu:fl03e01 Wu:fl03e01 Dr.82179 335270 -2.505 3.78E-11 wu:fl04a11 Wu:fl04a11 Dr.122575 335272 -2.258 5.00E-05 wu:fm52d09 Wu:fm52d09 Dr.43117 335745 -1.525 6.06E-16 wu:fq77h11 Wu:fq77h11 Dr.108155 503777 -3.259 4.00E-05 X-ray repair complementing defective repair in Chinese xrcc5 hamster cells 5 Dr.76405 449848 -1.761 3.13E-10 Tyrosine 3- monooxygenase/tryptophan 5- monooxygenase activation ywhab2 protein, beta polypeptide 2 Dr.5301 406419 -1.614 0.00E+00 Zinc finger and BTB domain zbtb22 containing 22 Dr.79311 64809 -1.513 1.99E-07 Zinc finger, C3HC-type containing zc3hc1 1 Dr.8987 560141 -1.614 5.64E-06 Zinc finger, CCHC domain zcchc8 containing 8 Dr.17330 553372 -1.681 1.87E-09 zgc:100801 Zgc:100801 Dr.80810 445255 -2.230 4.00E-05 zgc:100825 Zgc:100825 Dr.91510 494177 -1.721 4.55E-07 zgc:100832 Zgc:100832 Dr.132657 445148 -1.655 2.16E-21 zgc:100843 Zgc:100843 Dr.89417 449832 -1.716 5.30E-06 zgc:100846 Zgc:100846 Dr.82328 402895 -1.679 1.28E-08 zgc:100856 Zgc:100856 Dr.80848 445142 -1.503 4.81E-07 zgc:100857 Zgc:100857 Dr.78287 445141 -1.568 4.77E-10 zgc:100861 Zgc:100861 Dr.86114 445137 -1.577 7.87E-07 zgc:100881 Zgc:100881 Dr.90968 445507 -1.710 5.94E-06 zgc:100903 Zgc:100903 Dr.33963 445125 -2.732 6.20E-17 zgc:100906 Zgc:100906 Dr.18069 445123 -3.004 1.82E-44 zgc:100950 Zgc:100950 Dr.91020 445325 -1.989 2.00E-05 -3.049 2.49E-15 zgc:100957 Zgc:100957 Dr.87386 445226 -2.098 1.76E-07 zgc:100960 Zgc:100960 Dr.111296 445224 -1.659 4.59E-09 zgc:100971 Zgc:100971 Dr.14523 437014 -2.590 0.00E+00 zgc:100989 Zgc:100989 Dr.11977 445318 -1.717 6.49E-10 zgc:100994 Zgc:100994 Dr.6763 445213 -2.600 4.58E-27 zgc:101035 Zgc:101035 Dr.84113 447911 -2.046 1.06E-09 zgc:101040 Zgc:101040 Dr.79183 445194 -3.767 4.66E-11 zgc:101062 Zgc:101062 Dr.134107 447910 -2.155 4.22E-11 zgc:101066 Zgc:101066 Dr.88663 445178 -1.507 9.55E-08 -2.211 1.00E-05 zgc:101102 Zgc:101102 Dr.83753 437008 -2.744 2.61E-28 zgc:101129 Zgc:101129 Dr.109109 445303 -1.540 2.07E-08 zgc:101136 Zgc:101136 Dr.76743 445157 -1.656 0.00E+00 zgc:101531 Zgc:101531 Dr.90613 494089 -1.941 1.43E-12 zgc:101540 Zgc:101540 Dr.77116 494096 -2.955 1.95E-10 zgc:101549 Zgc:101549 Dr.89856 492779 -2.883 1.66E-06 zgc:101554 Zgc:101554 Dr.90146 492777 -1.623 6.03E-07 zgc:101581 Zgc:101581 Dr.85433 493617 -1.795 1.66E-39 zgc:101596 Zgc:101596 Dr.83418 450081 -1.669 2.24E-20 zgc:101608 Zgc:101608 Dr.75660 541414 -2.144 0.00E+00 zgc:101627 Zgc:101627 Dr.108142 492806 -3.771 1.50E-30 zgc:101661 Zgc:101661 Dr.72042 492797 -1.747 9.00E-05 zgc:101673 Zgc:101673 Dr.84315 450060 -3.647 1.79E-35 zgc:101674 Zgc:101674 Dr.13499 450059 -2.787 3.45E-09 zgc:101710 Zgc:101710 Dr.78138 450048 -1.530 3.79E-07 zgc:101717 Zgc:101717 Dr.85491 450046 -1.754 9.38E-14 zgc:101720 Zgc:101720 Dr.108122 450045 -1.686 1.87E-35 zgc:101772 Zgc:101772 Dr.118844 447886 -1.511 2.88E-11 zgc:101783 Zgc:101783 Dr.81754 447883 -1.833 6.55E-11 zgc:101786 Zgc:101786 Dr.80728 492757 -1.672 3.26E-08 zgc:101792 Zgc:101792 Dr.115224 494079 -2.123 0.00E+00 zgc:101819 Zgc:101819 Dr.3508 322021 -1.803 3.73E-11 zgc:101826 Zgc:101826 Dr.81584 447939 -1.512 7.33E-07 zgc:101840 Zgc:101840 Dr.14198 449795 -1.662 4.77E-07 zgc:101843 Zgc:101843 Dr.117314 494051 -1.903 0.00E+00 zgc:101859 Zgc:101859 Dr.91438 449792 -2.179 2.13E-26 zgc:101872 Zgc:101872 Dr.42075 494046 -1.806 1.04E-17 zgc:101876 Zgc:101876 Dr.88686 449790 -3.396 1.03E-26 zgc:101877 Zgc:101877 Dr.16863 492504 -1.531 0.00E+00 zgc:101893 Zgc:101893 Dr.37833 494045 -1.663 1.06E-06 zgc:101898 Zgc:101898 Dr.42866 449784 -1.630 6.10E-12 zgc:103467 Zgc:103467 Dr.89765 450006 -1.878 2.54E-07 zgc:103473 Zgc:103473 Dr.84834 492477 -1.971 2.81E-12 zgc:103478 Zgc:103478 Dr.108168 492476 -3.074 2.98E-09 zgc:103479 Zgc:103479 Dr.86322 450002 -2.362 1.00E-05 zgc:103498 Zgc:103498 Dr.86851 494064 -1.703 2.16E-14 zgc:103508 Zgc:103508 Dr.107428 494062 -1.846 2.38E-16 zgc:103517 Zgc:103517 Dr.15091 492469 -2.022 6.91E-17 zgc:103525 Zgc:103525 Dr.79325 492466 -1.997 9.83E-09 zgc:103553 Zgc:103553 Dr.28324 492463 -1.714 1.83E-12 zgc:103579 Zgc:103579 Dr.78577 492519 -1.815 1.79E-30 zgc:103582 Zgc:103582 Dr.108368 449804 -1.735 3.58E-32 zgc:103585 Zgc:103585 Dr.37102 492518 -2.587 2.00E-05 zgc:103594 Zgc:103594 Dr.76097 447942 -1.759 1.14E-26 -2.008 1.54E-10 -1.574 8.29E-09 zgc:103600 Zgc:103600 Dr.37357 492516 -2.028 9.57E-08 -5.045 2.10E-09 zgc:103625 Zgc:103625 Dr.114547 447931 -5.918 0.00E+00 zgc:103632 Zgc:103632 Dr.82160 449780 -2.039 2.20E-37 zgc:103635 Zgc:103635 Dr.133079 449554 -1.593 8.69E-07 -2.814 8.82E-09 zgc:103639 Zgc:103639 Dr.78106 447930 -1.502 3.59E-08 zgc:103650 Zgc:103650 Dr.91828 492493 -1.926 2.02E-19 zgc:103663 Zgc:103663 Dr.81071 492490 -2.680 4.38E-15 zgc:103681 Zgc:103681 Dr.118182 449773 -2.537 0.00E+00 zgc:103717 Zgc:103717 Dr.76782 492483 -3.066 9.89E-13 zgc:103736 Zgc:103736 Dr.85422 541317 -3.124 1.33E-18 zgc:103741 Zgc:103741 Dr.77288 492817 -1.646 7.99E-07 zgc:103747 Zgc:103747 Dr.36931 449991 -1.770 5.99E-12 -2.002 0.00E+00 zgc:103750 Zgc:103750 Dr.19486 494090 -2.599 7.87E-18 zgc:103752 Zgc:103752 Dr.14778 449552 -2.015 2.92E-07 zgc:103755 Zgc:103755 Dr.12697 449988 -3.776 4.59E-06 zgc:103764 Zgc:103764 Dr.78194 449551 -1.602 6.45E-14 zgc:103778 Zgc:103778 Dr.86643 494088 -1.625 3.10E-08 zgc:109868 Zgc:109868 Dr.132206 550522 -2.680 1.76E-29 zgc:109896 Zgc:109896 Dr.26640 553543 -2.210 4.13E-07 zgc:109898 Zgc:109898 Dr.76433 553760 -2.047 4.31E-09 zgc:109906 Zgc:109906 Dr.103989 449687 -1.747 1.65E-07 zgc:109963 Zgc:109963 Dr.47891 554104 -2.400 2.80E-45 zgc:109973 Zgc:109973 Dr.84297 553561 -2.083 2.57E-07 zgc:109979 Zgc:109979 Dr.75113 553178 -2.365 0.00E+00 zgc:109982 Zgc:109982 Dr.133603 553564 -8.920 2.57E-23 zgc:109984 Zgc:109984 Dr.109976 568055 -2.293 4.07E-06 zgc:109987 Zgc:109987 Dr.78284 553767 -1.791 7.37E-07 zgc:110002 Zgc:110002 Dr.81572 337556 -2.454 2.98E-19 zgc:110014 Zgc:110014 Dr.76357 606666 -1.828 1.02E-17 zgc:110025 Zgc:110025 Dr.135075 553578 -3.097 2.60E-07 zgc:110044 Zgc:110044 Dr.113513 553582 -1.604 4.89E-17 zgc:110045 Zgc:110045 Dr.87947 664755 -2.347 1.00E-05 zgc:110053 Zgc:110053 Dr.91933 553584 -1.818 9.90E-16 zgc:110063 Zgc:110063 Dr.85020 553772 -1.987 1.20E-16 zgc:110104 Zgc:110104 Dr.118370 566219 -1.988 2.02E-12 zgc:110112 Zgc:110112 Dr.76556 550237 -2.048 2.87E-10 zgc:110130 Zgc:110130 Dr.85111 553588 -2.016 9.65E-23 zgc:110133 Zgc:110133 Dr.37702 550229 -1.580 9.00E-05 -1.549 8.00E-05 zgc:110149 Zgc:110149 Dr.85219 553774 -1.820 8.51E-11 zgc:110155 Zgc:110155 Dr.14409 541390 -1.536 7.68E-07 zgc:110191 Zgc:110191 Dr.114250 553593 -1.624 2.62E-07 -5.401 1.39E-14 zgc:110241 Zgc:110241 Dr.75948 550325 -1.910 1.71E-34 zgc:110283 Zgc:110283 Dr.133535 550268 -5.346 1.57E-18 zgc:110293 Zgc:110293 Dr.28975 550261 -1.595 3.85E-13 zgc:110299 Zgc:110299 Dr.79437 550258 -1.584 3.80E-11 zgc:110316 Zgc:110316 Dr.92602 553609 -2.376 2.21E-20 zgc:110317 Zgc:110317 Dr.80984 550510 -1.603 1.00E-05 zgc:110339 Zgc:110339 Dr.76924 550490 -1.730 1.66E-08 zgc:110344 Zgc:110344 Dr.82855 553611 -1.822 1.64E-15 zgc:110366 Zgc:110366 Dr.89849 550476 -2.179 1.98E-20 zgc:110441 Zgc:110441 Dr.45818 449947 -1.553 1.45E-08 -1.606 6.02E-29 zgc:110525 Zgc:110525 Dr.76821 503767 -2.073 9.98E-06 zgc:110552 Zgc:110552 Dr.31402 550227 -1.657 1.20E-17 zgc:110599 Zgc:110599 Dr.118208 550600 -1.689 9.47E-08 zgc:110602 Zgc:110602 Dr.89885 550599 -1.804 3.46E-11 zgc:110620 Zgc:110620 Dr.141011 541419 -2.639 0.00E+00 zgc:110625 Zgc:110625 Dr.121188 553640 -1.802 4.80E-06 zgc:110639 Zgc:110639 Dr.134084 553642 -1.728 2.90E-19 zgc:110660 Zgc:110660 Dr.87510 550575 -2.331 1.13E-10 zgc:110671 Zgc:110671 Dr.75443 553648 -1.934 5.00E-05 zgc:110684 Zgc:110684 Dr.120368 553650 -1.624 2.00E-05 -2.678 9.98E-07 zgc:110692 Zgc:110692 Dr.75541 368352 -7.405 0.00E+00 zgc:110708 Zgc:110708 Dr.45535 553793 -1.690 1.24E-08 zgc:110709 Zgc:110709 Dr.43027 550252 -1.517 1.12E-09 zgc:110712 Zgc:110712 Dr.33453 550250 -1.608 1.46E-14 -1.557 2.28E-08 -8.025 2.85E-28 zgc:110773 Zgc:110773 Dr.109713 613246 -1.774 6.07E-06 zgc:110776 Zgc:110776 Dr.85346 407640 -1.674 1.17E-08 zgc:110777 Zgc:110777 Dr.39077 541365 -3.002 4.06E-09 zgc:110810 Zgc:110810 Dr.38728 503748 -1.923 6.64E-12 zgc:110829 Zgc:110829 Dr.121466 541427 -1.689 7.97E-21 zgc:110843 Zgc:110843 Dr.82430 541492 -1.784 9.40E-08 zgc:110848 Zgc:110848 Dr.118397 503751 -1.762 4.35E-12 zgc:111840 Zgc:111840 Dr.30432 407654 -2.195 8.37E-07 zgc:111964 Zgc:111964 Dr.44149 559796 -7.101 0.00E+00 zgc:111976 Zgc:111976 Dr.85177 553663 -2.091 5.49E-08 zgc:112050 Zgc:112050 Dr.76317 337142 -2.520 1.24E-08 zgc:112071 Zgc:112071 Dr.85973 550339 -1.672 4.06E-12 zgc:112088 Zgc:112088 Dr.120133 550456 -1.532 4.11E-06 zgc:112098 Zgc:112098 Dr.75118 550445 -1.636 4.79E-06 zgc:112118 Zgc:112118 Dr.87575 550435 -1.760 1.78E-09 zgc:112148 Zgc:112148 Dr.82236 550424 -1.885 2.00E-05 zgc:112155 Zgc:112155 Dr.84285 550422 -1.981 1.00E-05 zgc:112172 Zgc:112172 Dr.90055 550415 -1.697 1.83E-10 -2.613 1.20E-18 zgc:112198 Zgc:112198 Dr.81033 550403 -1.818 1.08E-07 zgc:112199 Zgc:112199 Dr.76995 550402 -1.791 2.00E-05 zgc:112208 Zgc:112208 Dr.82025 550398 -1.650 1.04E-08 -1.827 6.78E-06 zgc:112220 Zgc:112220 Dr.43183 550395 -1.529 1.07E-07 zgc:112226 Zgc:112226 Dr.75553 554157 -1.685 1.00E-05 zgc:112232 Zgc:112232 Dr.90608 565258 -1.853 6.00E-05 zgc:112242 Zgc:112242 Dr.44274 553694 -1.516 3.18E-07 zgc:112262 Zgc:112262 Dr.79799 554146 -1.880 6.04E-26 zgc:112263 Zgc:112263 Dr.109697 554145 -2.334 4.86E-15 zgc:112285 Zgc:112285 Dr.87941 561476 -7.159 1.40E-10 zgc:112293 Zgc:112293 Dr.86894 552981 -3.609 1.40E-45 zgc:112304 Zgc:112304 Dr.41753 554050 -1.717 2.07E-12 -1.879 2.15E-10 -2.965 3.73E-08 zgc:112332 Zgc:112332 Dr.85632 553712 -1.771 2.65E-06 zgc:112364 Zgc:112364 Dr.80679 554111 -1.556 7.01E-07 zgc:112425 Zgc:112425 Dr.75965 550495 -1.782 1.67E-06 zgc:112433 Zgc:112433 Dr.89507 550469 -1.530 2.78E-08 -1.681 4.00E-05 zgc:112443 Zgc:112443 Dr.6693 550392 -4.841 5.44E-17 zgc:112445 Zgc:112445 Dr.9805 550391 -1.583 2.70E-12 zgc:112467 Zgc:112467 Dr.76656 337730 -2.299 1.55E-24 zgc:112527 Zgc:112527 Dr.140640 550447 -1.832 1.87E-37 zgc:112535 Zgc:112535 Dr.107720 541329 -1.574 4.24E-12 zgc:113011 Zgc:113011 Dr.42603 553737 -2.220 3.57E-13 zgc:113016 Zgc:113016 Dr.86352 503772 -1.504 2.00E-05 zgc:113026 Zgc:113026 Dr.77987 503523 -1.919 3.34E-12 zgc:113030 Zgc:113030 Dr.121353 553738 -1.664 1.48E-06 zgc:113054 Zgc:113054 Dr.80042 541322 -2.649 2.05E-15 zgc:113186 Zgc:113186 Dr.7782 541517 -1.644 3.78E-07 zgc:113217 Zgc:113217 Dr.108377 541510 -2.276 1.75E-19 zgc:113277 Zgc:113277 Dr.87180 553814 -1.787 9.66E-06 zgc:113317 Zgc:113317 Dr.105275 619243 -2.173 2.90E-07 -3.992 9.06E-09 zgc:113413 Zgc:113413 Dr.104715 503710 -2.178 4.28E-15 zgc:113456 Zgc:113456 Dr.133900 449691 -4.781 4.54E-30 zgc:113516 Zgc:113516 Dr.79930 541449 -1.559 6.00E-05 -2.050 5.00E-05 zgc:113842 Zgc:113842 Dr.78735 324431 -1.609 7.12E-12 zgc:114101 Zgc:114101 Dr.81643 559198 -1.504 4.00E-05 -2.482 3.00E-05 zgc:114121 Zgc:114121 Dr.82288 555400 -1.594 3.07E-10 zgc:114180 Zgc:114180 Dr.90388 570333 -8.779 4.24E-13 zgc:122989 Zgc:122989 Dr.121312 553374 -1.669 1.04E-09 zgc:123007 Zgc:123007 Dr.26098 557205 -1.625 2.34E-11 zgc:123047 Zgc:123047 Dr.20771 553283 -2.305 1.48E-14 zgc:123096 Zgc:123096 Dr.10129 552941 -1.569 1.12E-09 zgc:123166 Zgc:123166 Dr.113488 567194 -1.977 1.69E-13 zgc:123203 Zgc:123203 Dr.92219 641583 -1.780 4.15E-13 zgc:123214 Zgc:123214 Dr.77286 664761 -2.525 1.96E-31 zgc:123251 Zgc:123251 Dr.75167 641503 -1.735 6.00E-05 zgc:123254 Zgc:123254 Dr.77590 556486 -1.686 9.21E-06 zgc:123304 Zgc:123304 Dr.79607 556136 -1.660 2.00E-05 zgc:123318 Zgc:123318 Dr.79483 641495 -2.060 3.87E-09 zgc:123326 Zgc:123326 Dr.132817 641324 -1.513 2.72E-06 zgc:123334 Zgc:123334 Dr.78614 677660 -1.540 1.00E-05 zgc:136220 Zgc:136220 Dr.30811 553474 -1.763 4.89E-10 zgc:136228 Zgc:136228 Dr.76679 570276 -1.710 2.37E-06 -1.627 2.00E-05 zgc:136238 Zgc:136238 Dr.78641 692288 -2.957 1.34E-30 zgc:136244 Zgc:136244 Dr.114907 678544 -2.266 1.09E-18 zgc:136281 Zgc:136281 Dr.76518 724001 -1.567 9.00E-05 zgc:136311 Zgc:136311 Dr.132858 336252 -1.814 3.78E-11 zgc:136469 Zgc:136469 Dr.133101 570162 -2.028 3.80E-35 zgc:136476 Zgc:136476 Dr.82922 678653 -1.902 1.66E-16 zgc:136488 Zgc:136488 Dr.116040 405765 -1.628 4.36E-10 zgc:136545 Zgc:136545 Dr.48052 692317 -1.694 3.59E-08 zgc:136569 Zgc:136569 Dr.85861 692318 -1.537 1.00E-05 -3.104 2.84E-06 zgc:136593 Zgc:136593 Dr.76791 326906 -2.024 2.16E-06 zgc:136620 Zgc:136620 Dr.108105 678626 -1.655 1.73E-09 zgc:136656 Zgc:136656 Dr.33774 692308 -2.237 3.00E-05 zgc:136733 Zgc:136733 Dr.19887 386959 -1.909 3.41E-08 zgc:136734 Zgc:136734 Dr.103079 677744 -2.248 3.67E-11 -9.517 9.12E-27 zgc:136766 Zgc:136766 Dr.4520 692305 -2.136 1.04E-07 zgc:136816 Zgc:136816 Dr.825 723996 -1.953 1.10E-06 -1.894 1.00E-05 -2.041 8.42E-06 -1.839 7.56E-07 -2.725 2.35E-10 zgc:136850 Zgc:136850 Dr.91014 678619 -1.651 1.61E-15 zgc:136858 Zgc:136858 Dr.77512 678543 -1.531 4.00E-05 zgc:136878 Zgc:136878 Dr.80709 678521 -1.932 3.00E-05 zgc:136908 Zgc:136908 Dr.47664 563679 -1.525 3.14E-10 zgc:136933 Zgc:136933 Dr.89513 664699 -1.791 3.65E-10 zgc:136971 Zgc:136971 Dr.78531 678599 -1.537 3.00E-05 -2.409 1.47E-11 zgc:152710 Zgc:152710 Dr.85617 553394 -3.600 3.79E-23 zgc:152851 Zgc:152851 Dr.81073 334494 -1.673 5.89E-17 zgc:152901 Zgc:152901 Dr.79170 566352 -1.507 1.93E-09 zgc:152922 Zgc:152922 Dr.39279 751734 -2.032 8.55E-11 -2.616 2.51E-06 zgc:152924 Zgc:152924 Dr.75034 777606 -1.693 1.18E-10 zgc:152927 Zgc:152927 Dr.80765 767675 -2.071 1.44E-15 zgc:152930 Zgc:152930 Dr.107625 565633 -1.672 1.00E-05 zgc:152981 Zgc:152981 Dr.33396 558977 -2.714 9.92E-08 zgc:153031 Zgc:153031 Dr.45346 557552 -5.421 0.00E+00 zgc:153037 Zgc:153037 Dr.117474 751622 -1.866 2.95E-06 zgc:153077 Zgc:153077 Dr.85160 767760 -1.712 6.64E-06 zgc:153098 Zgc:153098 Dr.83369 767735 -2.345 0.00E+00 zgc:153105 Zgc:153105 Dr.89231 767643 -3.167 2.40E-07 zgc:153112 Zgc:153112 Dr.91154 767804 -2.792 5.54E-16 zgc:153181 Zgc:153181 Dr.133213 767702 -2.333 4.96E-19 zgc:153186 Zgc:153186 Dr.82256 751758 -1.677 2.24E-13 zgc:153208 Zgc:153208 Dr.30300 564838 -2.733 1.13E-10 zgc:153225 Zgc:153225 Dr.76979 559769 -1.719 1.11E-10 zgc:153235 Zgc:153235 Dr.87269 767640 -2.515 7.53E-06 zgc:153260 Zgc:153260 Dr.51949 751643 -2.215 5.07E-17 zgc:153290 Zgc:153290 Dr.6242 751752 -1.593 1.09E-14 zgc:153333 Zgc:153333 Dr.87215 555376 -1.627 3.49E-06 -1.812 3.84E-06 zgc:153349 Zgc:153349 Dr.37104 555269 -1.817 6.26E-10 zgc:153351 Zgc:153351 Dr.81133 768153 -1.687 5.23E-09 zgc:153369 Zgc:153369 Dr.115735 767751 -2.016 4.21E-12 zgc:153372 Zgc:153372 Dr.79513 767695 -1.553 2.00E-05 zgc:153376 Zgc:153376 Dr.81124 767772 -2.285 2.25E-10 zgc:153425 Zgc:153425 Dr.13292 751740 -1.517 4.73E-09 zgc:153522 Zgc:153522 Dr.22379 768162 -1.988 9.65E-08 zgc:153607 Zgc:153607 Dr.74472 768182 -1.859 1.61E-09 zgc:153638 Zgc:153638 Dr.89616 777740 -2.015 1.00E-05 zgc:153652 Zgc:153652 Dr.15734 768149 -1.722 3.02E-11 zgc:153671 Zgc:153671 Dr.84999 768140 -1.927 1.42E-30 zgc:153675 Zgc:153675 Dr.78097 768179 -3.662 0.00E+00 zgc:153703 Zgc:153703 Dr.85855 751729 -2.142 1.00E-05 zgc:153704 Zgc:153704 Dr.87016 767759 -2.607 1.69E-22 zgc:153753 Zgc:153753 Dr.91561 767716 -1.894 2.73E-07 zgc:153845 Zgc:153845 Dr.90843 553052 -2.596 2.72E-23 zgc:153863 Zgc:153863 Dr.37700 566132 -1.587 2.97E-11 -2.522 0.00E+00 zgc:153878 Zgc:153878 Dr.133285 393967 -1.772 3.20E-14 zgc:153878 Zgc:153878 Dr.9343 393967 -1.677 1.14E-06 zgc:153888 Zgc:153888 Dr.83167 768164 -1.806 1.00E-05 -2.442 2.87E-09 -3.330 3.39E-15 -3.020 2.71E-15 -3.679 1.06E-25 zgc:154009 Zgc:154009 Dr.78362 768287 -2.591 4.86E-10 zgc:154012 Zgc:154012 Dr.116109 768124 -1.523 1.76E-06 zgc:154064 Zgc:154064 Dr.108555 791699 -2.307 3.08E-20 zgc:154077 Zgc:154077 Dr.52561 777745 -1.514 5.00E-05 zgc:154079 Zgc:154079 Dr.82865 777750 -1.554 2.48E-07 zgc:154104 Zgc:154104 Dr.72364 751654 -2.055 5.03E-10 zgc:154106 Zgc:154106 Dr.22552 777632 -1.731 3.00E-05 zgc:158130 Zgc:158130 Dr.85699 571876 -2.229 2.25E-14 zgc:158254 Zgc:158254 Dr.9582 791209 -1.642 1.81E-27 zgc:158367 Zgc:158367 Dr.116845 571403 -1.921 5.00E-05 zgc:158400 Zgc:158400 Dr.90312 780844 -2.907 1.22E-08 zgc:158407 Zgc:158407 Dr.140700 64884 -3.768 7.44E-06 zgc:158409 Zgc:158409 Dr.140553 567263 -2.031 0.00E+00 zgc:158414 Zgc:158414 Dr.78271 791144 -2.038 2.57E-14 zgc:158423 Zgc:158423 Dr.115718 790938 -5.975 0.00E+00 zgc:158435 Zgc:158435 Dr.80128 791185 -1.958 9.00E-05 zgc:158455 Zgc:158455 Dr.78061 790928 -1.551 3.00E-05 zgc:158463 Zgc:158463 Dr.27261 100037361 -1.831 2.00E-10 zgc:158531 Zgc:158531 Dr.82156 561352 -2.153 1.83E-06 zgc:158607 Zgc:158607 Dr.79190 569294 -1.538 9.88E-06 zgc:158612 Zgc:158612 Dr.132523 567505 -1.769 3.17E-07 zgc:158695 Zgc:158695 Dr.40378 791134 -1.584 5.00E-05 -1.618 6.76E-10 zgc:158742 Zgc:158742 Dr.110521 571626 -1.541 2.00E-05 zgc:158780 Zgc:158780 Dr.38076 503773 -2.431 4.35E-22 zgc:158782 Zgc:158782 Dr.117229 100009640 -2.036 6.63E-08 -2.000 1.69E-10 zgc:158838 Zgc:158838 Dr.82485 492549 -1.645 1.02E-12 zgc:158869 Zgc:158869 Dr.132780 791191 -2.127 1.00E-05 zgc:162029 Zgc:162029 Dr.76608 337595 -1.908 1.70E-28 zgc:162162 Zgc:162162 Dr.84274 568747 -2.661 1.04E-09 zgc:162166 Zgc:162166 Dr.80678 100005551 -1.890 1.00E-05 zgc:162186 Zgc:162186 Dr.85351 567714 -4.552 2.71E-07 zgc:162191 Zgc:162191 Dr.77158 322373 -1.620 2.00E-05 zgc:162235 Zgc:162235 Dr.86308 563648 -17.857 1.00E-05 -22.334 3.41E-06 zgc:162280 Zgc:162280 Dr.92706 799608 -1.631 1.49E-06 zgc:162290 Zgc:162290 Dr.16985 100007897 -1.520 2.12E-06 zgc:162301 Zgc:162301 Dr.84698 797343 -4.456 7.39E-07 zgc:162335 Zgc:162335 Dr.7178 326908 -1.650 9.29E-15 zgc:162425 Zgc:162425 Dr.105157 568244 -1.980 4.00E-05 zgc:162544 Zgc:162544 Dr.952 337076 -1.837 3.15E-12 zgc:162600 Zgc:162600 Dr.132975 100037331 -1.685 9.47E-10 zgc:162613 Zgc:162613 Dr.83339 555936 -1.818 2.15E-29 zgc:162623 Zgc:162623 Dr.90794 100038768 -2.042 2.20E-23 zgc:162651 Zgc:162651 Dr.115655 323364 -3.635 1.56E-07 zgc:162895 Zgc:162895 Dr.91606 100037341 -1.764 6.23E-11 zgc:162898 Zgc:162898 Dr.91619 100003490 -1.623 2.75E-09 zgc:162989 Zgc:162989 Dr.87045 100037351 -2.036 3.97E-17 zgc:163027 Zgc:163027 Dr.9025 326845 -2.430 6.00E-05 zgc:163057 Zgc:163057 Dr.87319 563335 -3.442 2.49E-06 zgc:163098 Zgc:163098 Dr.2575 100037380 -1.612 2.83E-09 zgc:165461 Zgc:165461 Dr.108135 497419 -1.539 4.00E-05 zgc:165530 Zgc:165530 Dr.48738 336737 -2.824 0.00E+00 zgc:55311 Zgc:55311 Dr.75452 406852 -1.953 0.00E+00 zgc:55317 Zgc:55317 Dr.13677 393094 -1.584 2.26E-22 zgc:55340 Zgc:55340 Dr.76862 321738 -1.739 1.01E-25 zgc:55375 Zgc:55375 Dr.75129 406834 -1.748 4.15E-18 zgc:55389 Zgc:55389 Dr.78078 406837 -1.607 2.71E-14 zgc:55392 Zgc:55392 Dr.80566 333999 -2.155 3.74E-38 zgc:55398 Zgc:55398 Dr.80443 394023 -2.167 6.71E-13 -1.861 9.04E-14 -1.906 5.21E-13 -1.994 1.49E-06 -2.664 6.23E-09 -6.141 5.28E-16 zgc:55404 Zgc:55404 Dr.75296 322815 -1.565 0.00E+00 zgc:55418 Zgc:55418 Dr.14064 334109 -1.531 4.98E-07 -8.704 0.00E+00 zgc:55429 Zgc:55429 Dr.76170 394074 -2.030 2.60E-23 zgc:55461 Zgc:55461 Dr.4248 406811 -2.486 0.00E+00 zgc:55520 Zgc:55520 Dr.96990 322786 -1.575 1.00E-05 zgc:55521 Zgc:55521 Dr.118843 406778 -1.694 6.44E-12 zgc:55523 Zgc:55523 Dr.10172 327196 -1.632 2.03E-09 -1.541 5.66E-11 zgc:55548 Zgc:55548 Dr.122051 393131 -1.629 2.00E-05 zgc:55587 Zgc:55587 Dr.6680 334167 -1.747 2.58E-25 zgc:55665 Zgc:55665 Dr.79522 335642 -1.671 0.00E+00 zgc:55697 Zgc:55697 Dr.76977 406354 -2.400 1.25E-28 zgc:55701 Zgc:55701 Dr.20495 406352 -1.824 7.18E-19 zgc:55764 Zgc:55764 Dr.116955 324211 -1.782 1.02E-09 -1.945 2.30E-13 zgc:55794 Zgc:55794 Dr.80343 327593 -1.691 5.63E-08 -1.865 1.82E-09 zgc:55803 Zgc:55803 Dr.80333 393111 -1.723 5.36E-24 zgc:55809 Zgc:55809 Dr.4165 321872 -1.556 1.03E-08 zgc:55865 Zgc:55865 Dr.76006 336998 -1.501 1.01E-07 zgc:55868 Zgc:55868 Dr.113860 337489 -1.825 3.24E-19 zgc:55870 Zgc:55870 Dr.78049 393112 -1.547 2.67E-25 zgc:55871 Zgc:55871 Dr.82635 393914 -2.683 4.99E-26 zgc:55876 Zgc:55876 Dr.77943 323700 -1.500 3.33E-20 zgc:55889 Zgc:55889 Dr.116061 393115 -1.697 7.69E-11 zgc:55943 Zgc:55943 Dr.20974 406337 -2.179 0.00E+00 zgc:55970 Zgc:55970 Dr.29150 394151 -1.644 1.06E-14 zgc:56005 Zgc:56005 Dr.107323 393155 -2.104 1.07E-09 zgc:56036 Zgc:56036 Dr.5520 406325 -2.330 0.00E+00 zgc:56068 Zgc:56068 Dr.4501 393213 -1.884 2.81E-10 zgc:56085 Zgc:56085 Dr.11252 327506 -1.727 1.46E-11 -10.398 0.00E+00 zgc:56095 Zgc:56095 Dr.47533 406286 -1.698 1.03E-25 zgc:56104 Zgc:56104 Dr.78312 393284 -3.762 0.00E+00 zgc:56106 Zgc:56106 Dr.85028 393163 -1.773 2.97E-25 zgc:56126 Zgc:56126 Dr.106084 394043 -3.134 0.00E+00 zgc:56140 Zgc:56140 Dr.8018 406278 -1.885 2.81E-06 zgc:56183 Zgc:56183 Dr.83492 393947 -2.092 0.00E+00 zgc:56259 Zgc:56259 Dr.85121 393188 -2.095 4.35E-16 zgc:56280 Zgc:56280 Dr.107413 393191 -2.767 0.00E+00 zgc:56310 Zgc:56310 Dr.83502 393196 -1.649 4.21E-10 zgc:56326 Zgc:56326 Dr.77434 394142 -2.606 6.15E-09 zgc:56363 Zgc:56363 Dr.116610 394103 -2.882 4.23E-07 zgc:56390 Zgc:56390 Dr.114415 394058 -1.779 2.00E-05 zgc:56409 Zgc:56409 Dr.80164 393295 -1.685 0.00E+00 zgc:56429 Zgc:56429 Dr.16405 393247 -3.158 4.58E-32 zgc:56466 Zgc:56466 Dr.84051 393234 -2.652 6.40E-30 zgc:56476 Zgc:56476 Dr.29131 334956 -2.086 1.99E-33 zgc:56517 Zgc:56517 Dr.78805 393248 -1.649 0.00E+00 zgc:56518 Zgc:56518 Dr.78105 406736 -2.221 1.40E-45 zgc:56547 Zgc:56547 Dr.132979 393266 -1.531 1.12E-11 zgc:56548 Zgc:56548 Dr.9906 393989 -4.123 3.22E-44 zgc:56559 Zgc:56559 Dr.3685 393239 -1.898 1.28E-30 zgc:56719 Zgc:56719 Dr.79369 386899 -1.704 1.11E-12 zgc:63479 Zgc:63479 Dr.80412 327496 -1.639 7.00E-05 zgc:63486 Zgc:63486 Dr.106780 393421 -1.841 4.76E-08 zgc:63497 Zgc:63497 Dr.7329 334316 -2.071 4.44E-15 zgc:63528 Zgc:63528 Dr.82465 394007 -1.615 3.83E-13 zgc:63546 Zgc:63546 Dr.82416 386638 -1.782 6.00E-05 -5.558 2.27E-41 zgc:63557 Zgc:63557 Dr.82352 393978 -2.294 2.92E-17 zgc:63561 Zgc:63561 Dr.82369 393577 -1.679 2.80E-15 zgc:63568 Zgc:63568 Dr.83764 393427 -1.871 1.61E-06 zgc:63592 Zgc:63592 Dr.84922 394133 -2.072 0.00E+00 zgc:63632 Zgc:63632 Dr.85103 393441 -1.732 4.14E-08 zgc:63633 Zgc:63633 Dr.26592 393366 -2.041 4.00E-05 zgc:63636 Zgc:63636 Dr.85429 393442 -4.159 7.44E-23 zgc:63637 Zgc:63637 Dr.117991 406674 -1.705 7.81E-23 zgc:63647 Zgc:63647 Dr.85801 394052 -1.800 1.00E-05 zgc:63663 Zgc:63663 Dr.118336 393586 -1.697 3.11E-13 zgc:63673 Zgc:63673 Dr.117470 393452 -1.907 3.01E-11 zgc:63722 Zgc:63722 Dr.6819 327165 -1.778 6.46E-17 zgc:63734 Zgc:63734 Dr.76950 324244 -3.309 7.93E-08 zgc:63736 Zgc:63736 Dr.132778 393458 -1.860 1.18E-10 zgc:63791 Zgc:63791 Dr.141522 406759 -1.616 9.85E-13 zgc:63827 Zgc:63827 Dr.106741 394175 -1.744 1.34E-17 zgc:63842 Zgc:63842 Dr.11469 337193 -1.894 1.85E-30 zgc:63849 Zgc:63849 Dr.77787 323487 -1.855 2.49E-12 zgc:63860 Zgc:63860 Dr.80253 335830 -2.160 0.00E+00 zgc:63871 Zgc:63871 Dr.88317 394080 -1.851 5.76E-06 zgc:63934 Zgc:63934 Dr.26462 393316 -1.620 8.00E-05 zgc:63943 Zgc:63943 Dr.88347 393375 -2.582 4.85E-15 zgc:63960 Zgc:63960 Dr.83273 393322 -2.810 0.00E+00 zgc:63977 Zgc:63977 Dr.95079 406646 -1.735 2.32E-07 zgc:63982 Zgc:63982 Dr.48970 337376 -1.643 9.13E-09 zgc:64043 Zgc:64043 Dr.14219 393341 -1.647 2.46E-06 zgc:64050 Zgc:64050 Dr.118663 406432 -1.525 3.40E-31 zgc:64106 Zgc:64106 Dr.78121 393348 -2.274 2.00E-05 zgc:64114 Zgc:64114 Dr.82488 378866 -2.495 5.75E-13 -2.642 8.24E-07 -1.796 6.68E-10 zgc:64141 Zgc:64141 Dr.78662 393353 -1.557 4.31E-16 -1.650 1.22E-07 -1.584 1.56E-09 zgc:64190 Zgc:64190 Dr.80953 335628 -1.771 4.43E-06 zgc:64220 Zgc:64220 Dr.87876 394082 -1.876 1.55E-12 zgc:64222 Zgc:64222 Dr.75577 336231 -1.853 9.25E-12 zgc:65781 Zgc:65781 Dr.113394 323208 -1.667 6.94E-10 zgc:65824 Zgc:65824 Dr.116909 327237 -1.950 3.47E-12 zgc:65831 Zgc:65831 Dr.12437 393541 -1.518 4.80E-11 zgc:65851 Zgc:65851 Dr.82707 321113 -2.426 9.07E-22 zgc:65873 Zgc:65873 Dr.132836 393514 -1.545 8.55E-06 zgc:65884 Zgc:65884 Dr.26980 394171 -2.541 4.24E-07 zgc:65893 Zgc:65893 Dr.6427 406389 -2.054 0.00E+00 zgc:65894 Zgc:65894 Dr.6173 335798 -2.652 0.00E+00 zgc:65897 Zgc:65897 Dr.28183 335836 -1.889 9.00E-05 zgc:65908 Zgc:65908 Dr.82749 393517 -1.976 0.00E+00 zgc:65909 Zgc:65909 Dr.75861 393504 -2.234 4.18E-21 -1.587 2.47E-06 zgc:65942 Zgc:65942 Dr.80303 393651 -2.827 2.18E-18 zgc:65964 Zgc:65964 Dr.76586 393556 -2.057 2.38E-44 zgc:65996 Zgc:65996 Dr.18197 336641 -2.037 9.11E-08 -1.535 8.00E-05 zgc:66097 Zgc:66097 Dr.77609 393530 -6.282 0.00E+00 zgc:66168 Zgc:66168 Dr.75903 337810 -1.910 1.00E-05 zgc:66317 Zgc:66317 Dr.78704 386792 -3.108 9.79E-25 zgc:66343 Zgc:66343 Dr.121289 393944 -1.511 3.51E-06 zgc:66350 Zgc:66350 Dr.29708 393493 -3.085 1.50E-12 zgc:66359 Zgc:66359 Dr.133834 393494 -1.847 1.74E-14 zgc:66385 Zgc:66385 Dr.77684 393663 -1.647 2.87E-08 zgc:66409 Zgc:66409 Dr.23608 335407 -3.225 1.35E-28 -2.987 1.15E-27 -1.547 8.30E-10 -2.502 2.55E-06 -3.748 1.30E-37 -13.612 3.06E-09 zgc:66441 Zgc:66441 Dr.26610 327348 -1.567 2.02E-06 zgc:66448 Zgc:66448 Dr.78406 327401 -1.645 5.25E-16 zgc:66472 Zgc:66472 Dr.77648 327494 -2.011 1.19E-16 zgc:73144 Zgc:73144 Dr.82521 393702 -2.428 5.30E-22 zgc:73153 Zgc:73153 Dr.82827 393801 -2.742 1.22E-14 zgc:73210 Zgc:73210 Dr.78630 393722 -1.794 2.94E-16 zgc:73213 Zgc:73213 Dr.12451 393724 -3.265 0.00E+00 zgc:73225 Zgc:73225 Dr.11342 323326 -1.864 4.32E-21 zgc:73273 Zgc:73273 Dr.110684 393744 -2.087 7.27E-17 zgc:73275 Zgc:73275 Dr.83353 393746 -1.909 9.00E-05 zgc:73293 Zgc:73293 Dr.2860 406301 -2.387 0.00E+00 zgc:73310 Zgc:73310 Dr.115522 393758 -1.533 1.95E-06 -2.436 2.58E-10 zgc:73327 Zgc:73327 Dr.85366 393763 -1.626 4.05E-17 zgc:73329 Zgc:73329 Dr.114727 393764 -1.553 3.00E-05 zgc:73351 Zgc:73351 Dr.76881 393774 -1.539 6.73E-18 zgc:73355 Zgc:73355 Dr.12760 393776 -2.219 5.73E-06 zgc:73373 Zgc:73373 Dr.28291 335335 -1.733 1.92E-29 zgc:76917 Zgc:76917 Dr.5585 323447 -1.524 1.29E-08 zgc:76977 Zgc:76977 Dr.4206 406620 -1.597 3.91E-26 zgc:77058 Zgc:77058 Dr.119953 405836 -2.607 4.40E-28 zgc:77059 Zgc:77059 Dr.106930 405809 -1.876 4.21E-08 zgc:77076 Zgc:77076 Dr.86370 405825 -1.558 1.19E-15 -5.376 0.00E+00 zgc:77082 Zgc:77082 Dr.25699 405806 -3.131 1.64E-10 zgc:77086 Zgc:77086 Dr.77817 405841 -2.427 9.90E-20 zgc:77093 Zgc:77093 Dr.115727 337552 -2.135 2.79E-30 zgc:77115 Zgc:77115 Dr.828 406455 -2.164 6.51E-15 zgc:77126 Zgc:77126 Dr.77320 322780 -1.957 1.75E-16 zgc:77144 Zgc:77144 Dr.88773 402954 -1.692 1.75E-06 zgc:77222 Zgc:77222 Dr.80117 404631 -1.506 5.44E-17 zgc:77262 Zgc:77262 Dr.6046 402952 -2.032 1.85E-35 zgc:77292 Zgc:77292 Dr.105826 327566 -1.584 2.70E-26 zgc:77294 Zgc:77294 Dr.79271 325319 -1.664 9.45E-12 zgc:77326 Zgc:77326 Dr.119027 403006 -1.918 4.60E-10 zgc:77366 Zgc:77366 Dr.75559 323529 -2.528 3.95E-39 zgc:77387 Zgc:77387 Dr.6336 324010 -2.381 6.00E-05 zgc:77398 Zgc:77398 Dr.74345 402963 -1.641 9.94E-14 zgc:77409 Zgc:77409 Dr.133674 403005 -1.790 1.15E-31 zgc:77439 Zgc:77439 Dr.132305 378987 -2.277 0.00E+00 zgc:77462 Zgc:77462 Dr.114378 336227 -1.745 0.00E+00 zgc:77479 Zgc:77479 Dr.83187 404618 -2.067 0.00E+00 zgc:77481 Zgc:77481 Dr.76642 406363 -3.356 0.00E+00 zgc:77511 Zgc:77511 Dr.75544 405807 -1.521 4.08E-15 zgc:77517 Zgc:77517 Dr.76027 393540 -1.963 1.81E-06 zgc:77529 Zgc:77529 Dr.78222 406610 -1.515 0.00E+00 zgc:77531 Zgc:77531 Dr.77070 322073 -1.616 1.61E-06 zgc:77556 Zgc:77556 Dr.82081 335176 -2.050 2.91E-06 zgc:77560 Zgc:77560 Dr.78498 324238 -1.701 1.00E-05 zgc:77614 Zgc:77614 Dr.113810 393868 -1.945 0.00E+00 zgc:77636 Zgc:77636 Dr.121750 402985 -2.173 2.13E-14 zgc:77651 Zgc:77651 Dr.29076 406530 -1.575 2.00E-05 -3.939 9.16E-10 zgc:77675 Zgc:77675 Dr.3345 393827 -1.910 0.00E+00 zgc:77708 Zgc:77708 Dr.141518 325402 -1.586 3.07E-17 zgc:77713 Zgc:77713 Dr.113568 402894 -1.793 6.03E-16 zgc:77739 Zgc:77739 Dr.51340 393870 -1.706 4.25E-06 zgc:77748 Zgc:77748 Dr.80756 393832 -2.550 1.20E-30 zgc:77767 Zgc:77767 Dr.75371 334717 -1.500 1.78E-09 zgc:77784 Zgc:77784 Dr.118146 402947 -1.646 3.73E-06 zgc:77862 Zgc:77862 Dr.132662 406474 -1.962 1.00E-05 -1.571 3.10E-06 zgc:77905 Zgc:77905 Dr.81416 393867 -1.829 1.17E-07 -1.760 4.01E-14 -2.765 1.73E-13 zgc:77929 Zgc:77929 Dr.17501 402944 -1.806 7.31E-18 zgc:77938 Zgc:77938 Dr.82540 402939 -3.218 1.48E-14 zgc:85611 Zgc:85611 Dr.85105 406368 -2.114 4.99E-07 zgc:85615 Zgc:85615 Dr.80820 406357 -2.032 0.00E+00 zgc:85644 Zgc:85644 Dr.78880 406605 -1.584 6.09E-06 zgc:85682 Zgc:85682 Dr.85679 406588 -1.812 4.07E-33 zgc:85683 Zgc:85683 Dr.78313 405854 -1.699 3.95E-06 zgc:85685 Zgc:85685 Dr.28547 405863 -1.882 9.05E-35 zgc:85702 Zgc:85702 Dr.23665 321718 -1.586 8.00E-05 -1.639 0.00E+00 zgc:85718 Zgc:85718 Dr.15126 405882 -1.503 3.89E-09 zgc:85736 Zgc:85736 Dr.107591 406540 -2.113 4.61E-41 zgc:85746 Zgc:85746 Dr.82666 407988 -1.527 2.00E-05 zgc:85772 Zgc:85772 Dr.75308 406462 -2.208 1.26E-34 zgc:85777 Zgc:85777 Dr.6416 405871 -1.514 2.24E-11 zgc:85818 Zgc:85818 Dr.76787 406567 -1.868 6.23E-08 zgc:85829 Zgc:85829 Dr.76876 406561 -2.160 8.53E-26 zgc:85851 Zgc:85851 Dr.113781 402899 -1.507 3.18E-11 zgc:85882 Zgc:85882 Dr.30352 405878 -4.609 0.00E+00 zgc:85888 Zgc:85888 Dr.87130 405860 -2.657 0.00E+00 zgc:85890 Zgc:85890 Dr.78211 335821 -1.733 2.21E-14 zgc:85900 Zgc:85900 Dr.85843 406544 -6.828 0.00E+00 zgc:85932 Zgc:85932 Dr.134080 405875 -1.509 1.23E-15 zgc:85942 Zgc:85942 Dr.140429 405866 -1.582 5.00E-05 zgc:85946 Zgc:85946 Dr.84990 406520 -1.770 4.11E-13 zgc:85960 Zgc:85960 Dr.782 321556 -1.532 3.46E-40 zgc:86610 Zgc:86610 Dr.86979 415139 -3.329 0.00E+00 zgc:86619 Zgc:86619 Dr.18870 436995 -1.804 1.71E-16 zgc:86635 Zgc:86635 Dr.84043 436590 -1.854 2.06E-34 zgc:86648 Zgc:86648 Dr.5098 447869 -1.560 1.62E-08 zgc:86661 Zgc:86661 Dr.79279 415149 -10.990 0.00E+00 zgc:86714 Zgc:86714 Dr.77083 415237 -2.010 1.14E-24 zgc:86722 Zgc:86722 Dr.132343 415233 -2.334 6.39E-10 zgc:86723 Zgc:86723 Dr.140916 415232 -4.098 1.32E-27 zgc:86755 Zgc:86755 Dr.139347 415224 -1.989 1.71E-16 zgc:86755 Zgc:86755 Dr.79838 415224 -1.642 5.38E-12 zgc:86762 Zgc:86762 Dr.1191 415221 -1.581 3.49E-06 zgc:86806 Zgc:86806 Dr.90714 415211 -1.525 7.22E-08 zgc:86807 Zgc:86807 Dr.35741 415210 -1.553 3.86E-32 zgc:86830 Zgc:86830 Dr.32623 415203 -1.704 1.34E-09 zgc:86841 Zgc:86841 Dr.78259 436954 -1.974 6.79E-12 zgc:86896 Zgc:86896 Dr.104783 415190 -3.374 0.00E+00 zgc:86898 Zgc:86898 Dr.661 415189 -1.766 1.51E-06 zgc:86900 Zgc:86900 Dr.28317 436951 -2.270 6.91E-14 zgc:86902 Zgc:86902 Dr.116391 436950 -2.045 1.04E-21 zgc:86915 Zgc:86915 Dr.132283 415182 -2.545 1.10E-17 zgc:86924 Zgc:86924 Dr.83592 415180 -2.471 5.74E-22 zgc:91823 Zgc:91823 Dr.134563 431753 -4.426 2.61E-11 zgc:91844 Zgc:91844 Dr.77924 445079 -1.810 2.50E-17 zgc:91851 Zgc:91851 Dr.6003 445077 -2.641 8.08E-16 zgc:91853 Zgc:91853 Dr.83481 431743 -1.550 2.94E-06 zgc:91858 Zgc:91858 Dr.134253 436606 -2.983 1.44E-13 zgc:91861 Zgc:91861 Dr.36960 449541 -1.630 6.63E-15 zgc:91872 Zgc:91872 Dr.14775 445072 -1.954 3.20E-10 zgc:91875 Zgc:91875 Dr.133214 445476 -2.265 4.74E-22 zgc:91915 Zgc:91915 Dr.84836 436595 -2.909 5.00E-05 zgc:91925 Zgc:91925 Dr.87009 445060 -1.742 3.40E-09 zgc:91928 Zgc:91928 Dr.83263 445058 -1.791 1.47E-21 zgc:91931 Zgc:91931 Dr.81756 436945 -1.565 8.38E-14 zgc:91938 Zgc:91938 Dr.82677 445114 -3.687 3.82E-17 zgc:91944 Zgc:91944 Dr.31493 436941 -2.398 3.32E-42 zgc:91951 Zgc:91951 Dr.30833 493604 -1.756 4.23E-20 zgc:91963 Zgc:91963 Dr.85722 445108 -1.733 8.74E-06 zgc:91968 Zgc:91968 Dr.82020 431714 -1.846 1.00E-05 zgc:91973 Zgc:91973 Dr.79291 436931 -1.787 3.00E-05 zgc:92004 Zgc:92004 Dr.14860 445478 -1.544 3.49E-24 zgc:92030 Zgc:92030 Dr.32775 436918 -2.676 0.00E+00 zgc:92039 Zgc:92039 Dr.79910 445092 -1.554 7.50E-11 zgc:92043 Zgc:92043 Dr.34117 445090 -2.030 3.95E-13 zgc:92053 Zgc:92053 Dr.75696 402809 -1.669 1.00E-04 zgc:92072 Zgc:92072 Dr.29881 447800 -4.608 1.65E-18 zgc:92090 Zgc:92090 Dr.83602 436640 -1.718 2.72E-12 zgc:92109 Zgc:92109 Dr.81623 492328 -1.588 7.00E-05 zgc:92139 Zgc:92139 Dr.4044 436628 -2.544 1.64E-20 zgc:92161 Zgc:92161 Dr.114476 447817 -1.645 2.34E-07 zgc:92183 Zgc:92183 Dr.75305 436617 -1.627 6.36E-06 zgc:92191 Zgc:92191 Dr.33969 445029 -1.522 6.00E-05 -1.883 8.03E-09 zgc:92205 Zgc:92205 Dr.87576 492344 -2.050 2.92E-26 zgc:92247 Zgc:92247 Dr.12486 436897 -1.783 3.56E-36 zgc:92252 Zgc:92252 Dr.81006 436895 -2.415 7.75E-06 zgc:92261 Zgc:92261 Dr.134501 494494 -4.084 2.21E-17 zgc:92275 Zgc:92275 Dr.31637 436885 -1.686 2.00E-05 zgc:92287 Zgc:92287 Dr.84500 436879 -2.237 2.16E-41 zgc:92337 Zgc:92337 Dr.17697 447838 -2.024 1.45E-15 zgc:92356 Zgc:92356 Dr.15687 436717 -2.394 1.70E-37 zgc:92379 Zgc:92379 Dr.81719 415167 -1.824 1.44E-12 zgc:92380 Zgc:92380 Dr.78136 445086 -1.850 1.67E-07 zgc:92406 Zgc:92406 Dr.105274 445281 -29.668 0.00E+00 zgc:92411 Zgc:92411 Dr.84825 445280 -3.170 8.01E-22 zgc:92420 Zgc:92420 Dr.28514 445069 -1.710 6.77E-06 zgc:92423 Zgc:92423 Dr.141054 445067 -1.590 2.65E-09 zgc:92446 Zgc:92446 Dr.115939 445112 -1.732 3.00E-05 zgc:92447 Zgc:92447 Dr.79436 436940 -1.974 1.05E-11 zgc:92456 Zgc:92456 Dr.86760 445287 -1.809 5.68E-08 -1.752 1.50E-06 -4.172 2.16E-12 zgc:92463 Zgc:92463 Dr.81803 431771 -2.031 4.54E-19 zgc:92470 Zgc:92470 Dr.82440 447867 -1.966 1.21E-33 zgc:92533 Zgc:92533 Dr.132195 445051 -3.964 1.69E-20 zgc:92534 Zgc:92534 Dr.83868 445050 -1.799 1.00E-05 zgc:92591 Zgc:92591 Dr.18405 436997 -5.726 1.00E-05 zgc:92605 Zgc:92605 Dr.89642 436981 -2.124 5.13E-10 zgc:92621 Zgc:92621 Dr.32039 436974 -10.142 1.69E-21 zgc:92630 Zgc:92630 Dr.30709 436969 -1.844 5.66E-06 zgc:92638 Zgc:92638 Dr.83811 436711 -1.542 3.82E-35 zgc:92647 Zgc:92647 Dr.29795 436707 -1.856 5.00E-05 -2.189 1.77E-06 -4.063 2.45E-08 -2.314 8.85E-08 zgc:92648 Zgc:92648 Dr.117139 436706 -1.931 9.00E-05 zgc:92650 Zgc:92650 Dr.86107 436704 -2.235 6.98E-29 zgc:92652 Zgc:92652 Dr.108758 436703 -2.370 2.97E-10 zgc:92656 Zgc:92656 Dr.118605 436700 -1.973 2.09E-11 zgc:92688 Zgc:92688 Dr.32100 436683 -1.893 6.80E-20 zgc:92689 Zgc:92689 Dr.82744 436682 -1.554 2.58E-06 zgc:92692 Zgc:92692 Dr.116432 436681 -3.951 0.00E+00 zgc:92696 Zgc:92696 Dr.12803 436679 -1.776 3.18E-43 zgc:92704 Zgc:92704 Dr.83858 436673 -5.083 8.20E-32 zgc:92710 Zgc:92710 Dr.85854 436669 -1.937 1.40E-45 zgc:92720 Zgc:92720 Dr.29899 436859 -1.840 6.51E-16 zgc:92724 Zgc:92724 Dr.116415 436855 -8.460 0.00E+00 zgc:92735 Zgc:92735 Dr.35470 436851 -1.506 7.07E-15 zgc:92739 Zgc:92739 Dr.75381 436849 -2.301 9.81E-45 zgc:92742 Zgc:92742 Dr.79916 436847 -2.974 5.84E-12 zgc:92753 Zgc:92753 Dr.2050 436841 -1.972 2.00E-05 zgc:92763 Zgc:92763 Dr.76489 436833 -3.404 0.00E+00 zgc:92770 Zgc:92770 Dr.27215 436829 -1.604 8.01E-42 zgc:92772 Zgc:92772 Dr.84381 436828 -1.910 1.32E-23 zgc:92778 Zgc:92778 Dr.81357 436823 zgc:92783 Zgc:92783 Dr.85013 436822 -2.076 2.88E-11 zgc:92799 Zgc:92799 Dr.86887 436809 -1.539 1.17E-06 zgc:92802 Zgc:92802 Dr.89635 436796 -1.926 2.37E-22 zgc:92806 Zgc:92806 Dr.36552 447829 -1.845 2.13E-11 zgc:92833 Zgc:92833 Dr.109068 436776 -1.935 9.33E-13 -1.661 2.00E-05 zgc:92854 Zgc:92854 Dr.90519 436764 -1.761 7.85E-15 zgc:92857 Zgc:92857 Dr.90484 436762 -2.072 2.00E-05 zgc:92867 Zgc:92867 Dr.80280 447826 -2.045 0.00E+00 zgc:92871 Zgc:92871 Dr.18200 436753 -2.463 2.75E-27 zgc:92880 Zgc:92880 Dr.33889 445037 -2.299 5.00E-05 zgc:92895 Zgc:92895 Dr.79071 436738 -1.590 5.56E-25 zgc:92905 Zgc:92905 Dr.79499 449651 -2.809 0.00E+00 zgc:92913 Zgc:92913 Dr.115549 436804 -1.921 5.34E-06 -2.410 7.33E-06 zgc:92916 Zgc:92916 Dr.33726 436803 -1.950 1.09E-15 zic6 Zic family member 6 Dr.22887 415097 -1.519 3.72E-14 znf207a Zinc finger protein 207, a Dr.75339 406478 -1.682 1.54E-34 znf207b Zinc finger protein 207, b Dr.3517 335437 -2.162 1.60E-07 Zona pellucida glycoprotein 2, like zp2l1 1 Dr.75593 555180 -1.557 4.93E-07 -1.515 7.00E-05 zp3.2 Zona pellucida glycoprotein 3.2 Dr.132632 574007 -2.023 8.63E-11 Zinc finger, SWIM-type containing zswim6 6 Dr.134316 403057 -1.673 5.59E-25 ZW10 homolog, centromere/kinetochore protein zw10 (Drosophila) Dr.119861 393110 -2.260 1.03E-20 *Significance cut off values were set to p<10-4 and fold changes ≥ 1.5 Supplementary Table III. Comparison to the Common Host Response gene set
A. Common host response gene list
Human Common Host Internal GENEID HUGO IDLocusLink ID Gene Zebrafish UniGene Identifier present on custom Gene symbol of (putative) zebrafish homolog† Response Genes* name (build #105) Agilent microarray
21 ABCG1 9619 "ATP-binding cassette, sub-family ABCG1 abcg1a - NO G (WHITE), member 1" ABCG1 abcg1b - NO ABCG1 abcg2a Dr.52856 YES ABCG1 abcg2b Dr.113423 YES ABCG1 abcg2c Dr.40859 YES ABCG1 Hypothetical LOC557408 Dr.91613 YES ABCG1 hypothetical protein LOC794238 - NO ACP2 49 ACP2 53 "acid phosphatase 2, lysosomal" acp5 Dr.1508 YES ACP2 zgc:113200 (wu:fi35e03) Dr.39091 YES 54 ACSL1 2180 acyl-CoA synthetase long-chain ACSL1 acsl1 Dr.79066 YES family member 1 ACSL1 zgc:101071 Dr.80184 NO ADA 74 ADA 100 adenosine deaminase ada Dr.120392 YES ADA ada Dr.88169 NO
ADM 101 ADM 133 adrenomedullin adm-like: Similar to preproadrenomedullin (LOC556502) Dr.43797 YES
ADORA2A 103 ADORA2A135 adenosine A2a receptor adora2a.1 Dr.79527 NO ADORA2A adora2a.2 Dr.94487 NO ADORA2A adora2b Dr.141253 YES
Transcribed locus, strongly similar to XP_707817.1 similar to ADORA2A Dr.52797 NO adenosine receptor 2b isoform 2 [Danio rerio]
113 ADRB2 154 "adrenergic, beta-2-, receptor, ADRB2 zgc:162188 (PREDICTED: similar to beta2-adrenergic receptor) Dr.134232 NO surface" ADRM1 116 ADRM1 11047 adhesion regulating molecule 1 adrm1a Dr.32615 NO ADRM1 adrm1b Dr.104406 YES wu:fk12d04 (PREDICTED: similar to non-lens beta gamma- AIM1 140 AIM1 202 absent in melanoma 1 Dr.81776 YES crystallin like protein) AK3 143 AK3 205 adenylate kinase 3 ak2 Dr.61277 YES AK3 ak3l1 Dr.132750 YES AK3 ak5 Dr.122428 YES AK3 ak7 Dr.88408 YES
AK3 wu:fa02c11 (PREDICTED: similar to Adenylate kinase 3-like 1) Dr.75392 YES ALAS1 157 ALAS1 211 "aminolevulinate, delta-, synthase 1" alas1 Dr.4829 YES 164 ALDH3A1218 "aldehyde dehydrogenase 3 ALDH3A1 aldh3a2 Dr.78348 YES family, memberA1" ALDH3A1 LOC100007092 similar to aldehyde dehydrogenase - NO ALDH3A1 Similar to aldehyde dehydrogenase (LOC100004071) Dr.118251 NO ALDH3A1 Similar to aldehyde dehydrogenase (LOC573907) Dr.118247 NO ALDH3A1 Similar to Aldh3a2 protein (LOC100000026) Dr.118151 NO ALDH3A1 Similar to Aldh3a2 protein (LOC565524) Dr.117362 NO ALDH3A1 Similar to Aldh3a2 protein (LOC799948) Dr.118150 NO 195 AMPD3 272 adenosine monophosphate AMPD3 ampd3 Dr.11670 YES deaminase (isoform E) AMPD3 Hypothetical LOC556578 (LOC556578) Dr.115964 NO ANKRD15 205 ANKRD1523189 ankyrin repeat domain 15 Hypothetical LOC561164 Dr.15355 NO APCS 240 APCS 325 "amyloid P component, serum" zgc:152809 Dr.133720 YES 248 APOB 338 apolipoprotein B (including Ag(x) APOB apob (wu:fb30e06) Dr.76846 YES antigen) 250 APOBEC3B 9582 "apolipoprotein B mRNA APOBEC3B - - NO editing enzyme, catalytic polypeptide-like 3B" 291 ARHGAP25 9938 Rho GTPase activating ARHGAP25 hypothetical LOC562468 - NO protein 25 296 ARHGDIG398 Rho GDP dissociation inhibitor ARHGDIG arhgdig Dr.76282 YES (GDI) gamma 304 ARID3A 1820 AT rich interactive domain 3A ARID3A arid2 Dr.79170 YES (BRIGHT- like) ARID3A hypothetical LOC562799 - NO
Novel protein similar to vertebrate AT rich interactive domain 3A ARID3A Dr.106046 NO (BRIGHT-like) (ARID3A) (CH211-113N10.6)
306 ARID5A 10865 AT rich interactive domain 5A ARID5A Hypothetical LOC567361 Dr.85807 YES (MRF1-like) ARL4A 309 ARL4A 10124 ADP-ribosylation factor-like 4A arl4a Dr.76805 YES ARL4A arl4l ADP-ribosylation factor-like 4, like Dr.82824 YES ATF3 340 ATF3 467 activating transcription factor 3 atf3 Dr.77523 YES 341 ATF4 468 activating transcription factor 4 (tax- ATF4 atf4 Dr.5846 YES responsive enhancer element B67) zgc:171702, LOC556410 similar to activating transcription factor 4 ATF4 Dr.104781 YES (wu:fb08f07) ATP1B1 350 ATP1B1 481 "ATPase, Na+/K+ transporting, atp1b1a Dr.76046 YES beta 1 polypeptide" ATP1B1 atp1b1b Dr.132414 YES 356 ATP2B1 490 "ATPase, Ca++ transporting, ATP2B1 atp2b3 Dr.133601 YES plasma membrane 1" ATP2B1 si:dkey-18o7.1 Dr.76148 YES 358 ATP2B4 493 "ATPase, Ca++ transporting, ATP2B4 - - NO plasma membrane 4" 359 ATP4A 495 "ATPase, H+/K+ exchanging, alpha ATP4A - - NO polypeptide" 395 B4GALT12683 "UDP-Gal:betaGlcNAc beta 1,4- B4GALT1 b4galt1 Dr.134220 YES galactosyltransferase, polypeptide 1" B4GALT1 zgc:154116 Dr.78291 YES BAG1 398 BAG1 573 BCL2-associated athanogene LOC558108 Dr.108594 YES 402 BAMBI 25805 BMP and activin membrane- BAMBI bambi Dr.78230 YES bound inhibitor homolog (Xenopus laevis) 409 BATF 10538 "basic leucine zipper transcription BATF si:ch211-153j24.4 Dr.134419 NO factor, ATF-like" BBC3 410 BBC3 27113 BCL2 binding component 3 bbc3 Dr.26003 YES BCL2A1 418 BCL2A1 597 BCL2-related protein A1 - - NO BCL3 422 BCL3 602 B-cell CLL/lymphoma 3 bcl3 (LOC565656 similar to B-cell CLL/lymphoma 3) Dr.93306 NO 423 BCL6 604 B-cell CLL/lymphoma 6 (zinc finger BCL6 bcl6 Dr.115290 YES protein 51) LOC100000143 similar to B-cell CLL/lymphoma 6 (zinc finger BCL6 Dr.115284 NO protein 51) LOC554528 similar to B-cell CLL/lymphoma 6 (zinc finger protein BCL6 Dr.28218 YES 51) BF 435 BF 629 "B-factor, properdin" cfb Dr.75096 YES BF LOC100006461 similar to complement factor B/C2-A3 Dr.78007 NO BF LOC792472 similar to complement factor B/C2-A3 Dr.119903 YES 440 BIK 638 BCL2-interacting killer (apoptosis- BIK bik Dr.82304 YES inducing) BIRC2 443 BIRC2 329 baculoviral IAP repeat-containing 2 birc2 Dr.77093 YES BIRC3 444 BIRC3 330 baculoviral IAP repeat-containing 3 - - NO 451 BLR1 643 "Burkitt lymphoma receptor 1, GTP BLR1 binding protein (chemokine (C-X-C motif) receptor blr1 - NO 5)" BLR1 cxcr3.2 Dr.82754 YES BLVRA 452 BLVRA 644 biliverdin reductase A blvrb Dr.32015 YES BLVRA zgc:153046 Dr.85100 YES BMP1 456 BMP1 649 bone morphogenetic protein 1 bmp1a Dr.132686 YES BMP1 bmp1b Dr.22363 YES BMP2 457 BMP2 650 bone morphogenetic protein 2 bmp2a Dr.75781 YES BMP2 bmp2b Dr.568 YES BPGM 473 BPGM 669 "2,3-bisphosphoglycerate mutase" - - NO BRD2 479 BRD2 6046 bromodomain containing 2 brd2a Dr.10549 YES BRD2 brd2a Dr.75177 YES BRD2 brd2a Dr.121030 NO BST2 489 BST2 684 bone marrow stromal cell antigen 2 - - NO 495 BTG1 694 "B-cell translocation gene 1, anti- BTG1 btg1 Dr.68835 YES proliferative" BTG1 btg1 Dr.75505 YES BTG2 496 BTG2 7832 "BTG family, member 2" btg2 Dr.76624 YES BTG3 497 BTG3 10950 "BTG family, member 3" btg3 (zgc:103463) Dr.81837 YES BTG3 Hypothetical LOC573143 (similar to btg3 protein) Dr.121363 NO 500 BTN2A1 11120 "butyrophilin, subfamily 2, BTN2A1 hypothetical protein LOC100000001 - NO member A1" 519 C1ORF2910964 chromosome 1 open reading C1ORF29 - - NO frame 29 533 C3AR1 719 complement component 3a receptor C3AR1 LOC794255 similar to c3a anaphylatoxin chemotactic receptor - NO 1 C4A 534 C4A 720 complement component 4A LOC100007355 similar to complement C4-1 [ - NO C4A LOC566261 similar to complement C4-1 Dr.111094 NO 566 CACNA1C775 "calcium channel, voltage- CACNA1C cacna1c Dr.83683 YES dependent, L type, alpha 1C subunit" CAPN2 599 CAPN2 824 "calpain 2, (m/II) large subunit" capn1 Dr.105407 YES CAPN2 capn3 Dr.36430 YES CAPN2 capn9 Dr.77287 YES zgc:112420 novel protein similar to vertebrate calpain 2, (m/II) CAPN2 Dr.1945 YES large subunit (CAPN2, zgc:112420) 606 CASP1 834 "caspase 1, apoptosis-related CASP1 casp2 Dr.106034 YES cysteine protease (interleukin 1, beta, convertase)" CASP1 caspa Dr.76374 YES 609 CASP3 836 "caspase 3, apoptosis-related CASP3 casp3 Dr.11726 YES cysteine protease" 610 CASP4 837 "caspase 4, apoptosis-related CASP4 zgc:171731 Dr.89295 NO cysteine protease" 611 CASP5 838 "caspase 5, apoptosis-related CASP5 casp6 Dr.79640 YES cysteine protease" CASP5 casp6l1 Dr.90030 YES CASP5 casp6l2 Dr.89539 YES 613 CASP7 840 "caspase 7, apoptosis-related CASP7 casp7 Dr.88746 NO cysteine protease" CASP7 casp8 Dr.10334 YES CASP7 casp9 Dr.78866 YES CASP7 caspb Dr.81726 YES CASP7 caspc Dr.38422 YES CCIN 633 CCIN 881 calicin - - NO CCL17 641 CCL17 6361 chemokine (C-C motif) ligand 17 Chemokine CCL-C10b Dr.112968 YES CCL19 Similar to CC chemokine SCYA101 Dr.113952 YES CCL19 642 CCL19 6363 chemokine (C-C motif) ligand 19 similar to CC chemokine SCYA106 (CH211-89F7.4) Dr.133987 YES Transcribed locus, weakly similar to XP_001338456.1 similar to CCL19 Dr.125570 YES CC chemokine-1 CCL20 (MIP3alpha/LARC) 643 CCL20 6364 chemokine (C-C motif) ligand 20 Similar to chemokine CK-1 Dr.133624 YES CCL22 (MDC) 645 CCL22 6367 chemokine (C-C motif) ligand 22 - - NO CCL3 (MIP1alpha 648 CCL3 6348 chemokine (C-C motif) ligand 3 - - NO CCL4 (MIP1beta) 649 CCL4 6351 chemokine (C-C motif) ligand 4 LOC100000034 similar to CCL4 - NO CCL4 (MIP1beta) LOC568326 similar to CCL4 Dr.93495 NO CCL4 (MIP1beta) LOC799962 similar to CCL4 - NO CCL5 650 CCL5 6352 chemokine (C-C motif) ligand 5 - - NO CCL8 (MCP2) si:dkeyp-59a8.2 Dr.84529 YES CCL8 (MCP2) 652 CCL8 6355 chemokine (C-C motif) ligand 8 si:dkeyp-59a8.3 Dr.134147 YES CCL8 (MCP2) Similar to CC chemokine SCYA116 Dr.92223 YES CCNA1 654 CCNA1 8900 cyclin A1 ccna1 Dr.78675 YES CCR7 671 CCR7 1236 chemokine (C-C motif) receptor 7 ccr7 - NO CCR7 zgc:165629 Dr.90195 NO 674 CCRL2 9034 chemokine (C-C motif) receptor- CCRL2 - - NO like 2 CD38 700 CD38 952 CD38 antigen (p45) - - NO 705 CD44 960 CD44 antigen (homing function and CD44 - - NO Indian blood group system) 707 CD48 962 CD48 antigen (B-cell membrane CD48 - - NO protein) CD53 709 CD53 963 CD53 antigen - - NO 711 CD59 966 "CD59 antigen p18-20 (antigen CD59 identified by monoclonal antibodies 16.3A5, EJ16, - - NO EJ30, EL32 and G344)" CD6 712 CD6 923 CD6 antigen - - NO 720 CD80 941 "CD80 antigen (CD28 antigen ligand CD80 (B7-1) cd80 - NO 1, B7-1 antigen)" 722 CD83 9308 "CD83 antigen (activated B CD83 CD83, Hypothetical LOC561001 Dr.74671 YES lymphocytes, immunoglobulin superfamily)" 723 CD86 942 "CD86 antigen (CD28 antigen ligand CD86 (B7-2) cd86 (wu:fb70b03) (similar to B7-H4 protein (LOC100003677)) Dr.75380 YES 2, B7-2 antigen)" CD86 (B7-2) cd86 Similar to B7-H4 protein (LOC100003432) Dr.120213 NO CD97 728 CD97 976 CD97 antigen hypothetical protein LOC100003607 Dr.89252 NO CD97 Similar to CD97 antigen (LOC792970) Dr.89541 NO 784 CEACAM1634 carcinoembryonic antigen- CEACAM related cell adhesion molecule 1 (biliary ceacam1 Dr.76456 YES glycoprotein) 793 CEBPG 1054 "CCAAT/enhancer binding protein CEBPG cebpg Dr.15663 YES (C/EBP), gamma" 812 CFLAR 8837 CASP8 and FADD-like apoptosis CFLAR (FLIP) cflar Dr.82387 YES regulator CHIT1 Zgc:55406 Dr.77170 YES CHIT1 Zgc:55941 Dr.77121 YES CHIT1 Zgc:56053 Dr.33222 YES CHIT1 Zgc:63792 Dr.75976 YES CHIT1 Zgc:65788 Dr.77223 YES CHIT1 830 CHIT1 1118 chitinase 1 (chitotriosidase) Zgc:73328 Dr.76938 YES CHKA 831 CHKA 1119 choline kinase alpha chka Dr.108026 NO 857 CITED2 10370 "Cbp/p300-interacting CITED2 transactivator, with Glu/Asp-rich carboxy-terminal cited3 Dr.75365 YES domain, 2" CITED2 zgc:103418 Dr.40045 YES CKAP4 859 CKAP4 10970 cytoskeleton-associated protein 4 ckap5 Dr.132252 YES CKAP4 zgc:85975 (wu:fa66a08) Dr.76007 YES CKB 860 CKB 1152 "creatine kinase, brain" ckb Dr.75625 YES CLCNKA 872 CLCNKA 1187 chloride channel Ka zgc:64141 Dr.78662 YES 877 CLECSF29976 "C-type (calcium dependent, CLELCSF carbohydrate-recognition domain) lectin, superfamily LOC100002541 Dr.116475 YES member 2 (activation-induced)" CLELCSF LOC563797 Dr.118442 YES CLELCSF LOC565753 Dr.112828 YES CLELCSF LOC566620 Dr.116491 YES CLELCSF si:ch211-154o6.6 Dr.73909 YES CLELCSF si:dkey-241l7.2 Dr.133177 YES CLELCSF si:dkey-241l7.6 Dr.119664 YES CLELCSF Similar to asialoglycoprotein receptor (LOC795698) Dr.87512 YES 889 CLU 1191 "clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, CLU clu Dr.80246 YES testosterone-repressed prostate message 2, apolipoprotein J)" 900 CNP 1267 "2',3'-cyclic nucleotide 3' CNP cnpl (cnp-like) - NO phosphodiesterase" 940 COPEB 1316 core promoter element binding COPEB copeb Dr.77265 YES protein 948 COX17 10063 "COX17 homolog, cytochrome c COX17 cox17 Dr.116425 YES oxidase assembly protein (yeast)" 992 CREM 1390 cAMP responsive element LOC555432 similar to cAMP response element modulator tau CREM Dr.20584 YES modulator alpha gamma ((wu:fk66d05) CRISP3 1001 CRISP3 10321 cysteine-rich secretory protein 3 - - NO 1019 CSF1 1435 colony stimulating factor 1 CSF1 - - NO (macrophage) 1021 CSF2 1437 colony stimulating factor 2 CSF2 - - NO (granulocyte-macrophage) 1024 CSF3 1440 colony stimulating factor 3 CSF3 (GCSF) - - NO (granulocyte) 1062 CTNNB1 1499 "catenin (cadherin-associated CTNNB1 ctnnb1 Dr.10259 YES protein), beta 1, 88kDa" CTNNB1 ctnnbl1 (catenin, beta like 1) Dr.77271 YES CTSE 1071 CTSE 1510 cathepsin E - - NO CTSK 1074 CTSK 1513 cathepsin K (pycnodysostosis) ctsk Dr.76224 YES CTSK ctskl (cathepsin k like) Dr.110795 YES CTSS 1077 CTSS 1520 cathepsin S ctssa Dr.81560 YES CTSS ctssb.1 Dr.66967 NO CTSS ctssb.2 Dr.132688 YES CTSS ctssl (cathepsin s like) Dr.75553 YES 1089 CX3CL1 6376 chemokine (C-X3-C motif) CX3CL1 (fractalkine) - - NO ligand 1 1092 CXCL1 2919 "chemokine (C-X-C motif) ligand CXCL1 (GRO1) - - NO 1 (melanoma growth stimulating activity, alpha)" 1093 CXCL10 3627 chemokine (C-X-C motif) ligand CXCL10 (IP10) Similar to interleukin-8 (LOC567537) Dr.111760 YES 10 1094 CXCL11 6373 chemokine (C-X-C motif) ligand CXCL11 (I-TAC) LOC795785 Dr.113696 YES 11 CXCL11 (I-TAC) Similar to CXC chemokine (LOC563964) Dr.111133 YES 1096 CXCL2 2920 chemokine (C-X-C motif) ligand CXCL2 (MIP2alpha/GRO2) - - NO 2 1097 CXCL3 2921 chemokine (C-X-C motif) ligand CXCL3 (MIP2beta/GRO3) - - NO 3 1100 CXCL9 4283 chemokine (C-X-C motif) ligand CXCL9 (MIG) Similar to chemokine CXC-like protein (LOC562246) Dr.117585 YES 9 1102 CXCR4 7852 chemokine (C-X-C motif) CXCR4 cxcr4a Dr.84258 YES receptor 4 CXCR4 cxcr4b Dr.75485 YES 1104 CXORF6 10046 chromosome X open reading CXORF6 - - NO frame 6 1113 CYLC2 1539 "cylicin, basic protein of sperm CYLC2 - - NO head cytoskeleton 2" 1122 CYP21A21589 "cytochrome P450, family 21, CYP21A2 LOC100006759 similar to cytochrome P450 21-hydroxylase - NO subfamily A, polypeptide 2"
CYP21A2 LOC793249 similar to cytochrome P450 21-hydroxylase - NO
CYP21A2 LOC793827 similar to cytochrome P450 21-hydroxylase - NO
1128 CYP2B6 1555 "cytochrome P450, family 2, CYP2B6 - - NO subfamily B, polypeptide 6" 1133 CYP2J2 1573 "cytochrome P450, family 2, CYP2J2 cyp2j27 (Cytochrome P450, family 2, subfamily J, polypeptide 2) Dr.85615 YES subfamily J, polypeptide 2" DAXX 1151 DAXX 1616 death-associated protein 6 daxx Dr.73516 YES 1183 DDX39 10212 DEAD (Asp-Glu-Ala-Asp) box DDX39 ddx39a Dr.1111 YES polypeptide 39 DDX39 ddx39b Dr.75872 YES 1205 DGCR6 8214 DiGeorge syndrome critical DGCR6 zgc:101841 Dr.133716 YES region gene 6 1224 DIA1 1727 diaphorase (NADH) (cytochrome b- DIA1 dia1 Dr.3433 YES 5 reductase) DIA1 zgc:77071 Dr.4481 YES DLX2 1236 DLX2 1746 distal-less homeo box 2 dlx2a Dr.2 YES DLX2 dlx2b Dr.136 YES 1252 DNAJC7 7266 "DnaJ (Hsp40) homolog, DNAJC7 dnajc7 Dr.10575 YES subfamily C, member 7" LOC793229 similar to DnaJ (Hsp40) homolog, subfamily C, DNAJC7 Dr.114196 NO member 7 LOC793297 similar to DnaJ (Hsp40) homolog, subfamily C, DNAJC7 Dr.114464 NO member 7 1293 DSCR1 1827 Down syndrome critical region DSCR1 LOC100004614 similar to Dscr1 protein Dr.113406 YES gene 1 DSCR1 rcan1 (Regulator of calcineurin 1) Dr.31451 YES DSCR1 zgc:100963 Dr.77660 YES 1303 DTR 1839 diphtheria toxin receptor (heparin- DTR Hypothetical protein LOC797938 Dr.16053 YES binding epidermal growth factor-like growth factor) DUSP1 1305 DUSP1 1843 dual specificity phosphatase 1 dusp1 Dr.2413 YES DUSP2 1306 DUSP2 1844 dual specificity phosphatase 2 zgc:91929 Dr.81043 YES DUSP4 1308 DUSP4 1846 dual specificity phosphatase 4 dusp4 (zgc:55423) Dr.35017 YES DUSP5 1309 DUSP5 1847 dual specificity phosphatase 5 dusp5 Dr.120234 YES DUSP6 1310 DUSP6 1848 dual specificity phosphatase 6 dusp6 Dr.16301 YES DUSP6 dusp6 (zgc:77211) Dr.116871 YES DUSP6 Similar to MAP kinase phosphatase 3; DUSP6 (LOC572990) Dr.120762 NO
DUSP8 1312 DUSP8 1850 dual specificity phosphatase 8 zgc:77593 Dr.81134 NO 1326 EBI2 1880 Epstein-Barr virus induced gene 2 EBI2 zgc:165579 Dr.111220 NO (lymphocyte-specific G protein-coupled receptor) EBI3 1327 EBI3 10148 Epstein-Barr virus induced gene 3 LOC100008384 similar to LOC733364 protein - NO EBI3 LOC570668 similar to LOC733364 protein Dr.42025 NO ECE1 1330 ECE1 1889 endothelin converting enzyme 1 zgc:154079 Dr.82865 YES 1335 EDEM1 9695 "ER degradation enhancer, EDEM1 edem1 Dr.11486 YES mannosidase alpha-like 1" EDN1 1338 EDN1 1906 endothelin 1 edn1 Dr.4076 YES EFNA1 1352 EFNA1 1942 ephrin-A1 efna1 Dr.104284 YES EFNA1 zgc:63493 Dr.132777 YES EFNB2 1356 EFNB2 1948 ephrin-B2 efnb2a Dr.75819 YES EFNB2 efnb2b Dr.122593 YES EGR4 1363 EGR4 1961 early growth response 4 - - NO 1370 EIF2S2 8894 "eukaryotic translation initiation EIF2S2 eif2s2 Dr.25507 YES factor 2, subunit 2 beta, 38kDa" 1385 EIF5 1983 eukaryotic translation initiation EIF5 eif5 Dr.76842 YES factor 5 1396 ELF4 2000 E74-like factor 4 (ets domain ELF4 ef1 Dr.76289 YES transcription factor) ELF4 elf2 Dr.2328 YES ELF4 elf3 Dr.76707 YES EMP1 1406 EMP1 2012 epithelial membrane protein 1 - - NO EMP3 1408 EMP3 2014 epithelial membrane protein 3 LOC796607 hypothetical protein Dr.112821 NO 1409 EMR1 2015 "egf-like module containing, EMR1 similar to EMR1 Dr.113943 NO mucin-like, hormone receptor-like 1" EMR1 similar to EMR1 Dr.114184 NO EPHA5 1427 EPHA5 2044 EphA5 ek1 eph-like kinase 1 Dr.75760 YES 1464 ETS2 2114 v-ets erythroblastosis virus E26 ETS2 ets1a Dr.43005 NO oncogene homolog 2 (avian) ETS2 ets1b Dr.47591 YES ETS2 zgc:92106 Dr.7710 YES ETV6 1469 ETV6 2120 ets variant gene 6 (TEL oncogene) etv6 Dr.121185 YES 1475 EWSR1 2130 Ewing sarcoma breakpoint region EWSR1 wu:fc04c01 Dr.5648 YES 1 1487 EZH2 2146 enhancer of zeste homolog 2 EZH2 ezh2 Dr.76424 YES (Drosophila) F3 1497 F3 2152 "coagulation factor III (thromboplastin, Similar to tissue factor (LOC567257) Dr.89542 NO tissue factor)" FAP 1520 FAP 2191 "fibroblast activation protein, alpha" - - NO 1533 FCER1G 2207 "Fc fragment of IgE, high FCER1G fcer1g - NO affinity I, receptor for; gamma polypeptide" FCER1G fcer1gl (fcer1g like) - NO 1560 FGF7 2252 fibroblast growth factor 7 FGF7 fgf7 Dr.92905 YES (keratinocyte growth factor) 1571 FGR 2268 Gardner-Rasheed feline sarcoma FGR yrk (yes-related kinase) (hypothetical protein LOC792089) Dr.79866 YES viral (v-fgr) oncogene homolog FOSL2 1611 FOSL2 2355 FOS-like antigen 2 fos Dr.12986 YES FOSL2 fosl1 - NO FOSL2 LOC558921 similar to fra2 protein (wu:fl03b09) Dr.10410 YES FRK 1630 FRK 2444 fyn-related kinase FYN oncogene related to SRC, FGR, YES (fyn) Dr.118812 YES FRK fyna Dr.118811 YES FRK fynb (zgc:109996) Dr.134137 NO FRK hypothetical LOC567549 (wu:fc51c01) Dr.132532 YES 1640 FUBP1 8880 far upstream element (FUSE) FUBP1 fubp1 Dr.76240 YES binding protein 1 G1P2 (ISG15) isg15 Dr.114892 YES 1664 G1P2 9636 "interferon, alpha-inducible protein G1P3 - - NO (clone IFI-15K)" 1665 G1P3 2537 "interferon, alpha-inducible protein GADD45A gadd45a Dr.83410 YES (clone IFI-6-16)" 1684 GADD45A1647 "growth arrest and DNA- GADD45A gadd45al Dr.27107 YES damage-inducible, alpha" Similar to Growth arrest and DNA-damage-inducible, alpha GADD45A Dr.116314 NO (LOC793665) GARS 1702 GARS 2617 glycyl-tRNA synthetase wu:fb02f03 Dr.76009 YES GARS wu:fb02f03 Dr.120532 NO GARS wu:fb02f03 Dr.132231 NO 1717 GBP1 2633 "guanylate binding protein 1, GBP1 LOC795835 similar to guanylate binding protein 1 - NO interferon-inducible, 67kDa"
si:ch211-250m6.1 (novel protein similar to human guanylate GBP1 Dr.84911 YES binding protein 1, interferon-inducible, 67kDa (GBP1))
Si:dkey-61p9.3 (novel protein similar to vertebrate guanylate GBP1 Dr.114765 NO nucleotide binding protein family) GBP1 Similar to guanylate binding protein 1 (LOC570622) Dr.65465 NO GBP1 Zgc:103512 Dr.79955 YES GBP1 zgc:158270 Dr.80265 YES GBP2 1718 GBP2 2634 "guanylate binding protein 2, LOC795035 hypothetical protein LOC795035 - (XM_001332906) NO interferon-inducible" GBP2 zgc:92185 (Wu:fd36d06) Dr.79870 YES 1724 GCH1 2643 GTP cyclohydrolase 1 (dopa- GCH1 gch1 - no unigene NO responsive dystonia) GCH1 gch2 Dr.75259 YES GDI1 1740 GDI1 2664 GDP dissociation inhibitor 1 gdi1 Dr.18113 YES GDI1 Similar to GDP dissociation inhibitor 1 (LOC554985) Dr.120407 YES 1743 GEM 2669 GTP binding protein overexpressed GEM gem Dr.45197 NO in skeletal muscle 1760 GIPR 2696 gastric inhibitory polypeptide GIPR gipr - no unigene NO receptor GIPR Similar to glucagon receptor (LOC562510) Dr.118316 NO 1766 GJB2 2706 "gap junction protein, beta 2, 26kDa GJB2 cx27.5 Dr.15721 YES (connexin 26)" GK 1767 GK 2710 glycerol kinase LOC558302 Dr.78304 YES GK Similar to Gk2-prov protein (LOC568815) Dr.90487 YES GK Similar to Gk2-prov protein (LOC568815) Dr.90487 YES 1771 GLDC 2731 "glycine dehydrogenase GLDC (decarboxylating; glycine decarboxylase, glycine gldc Dr.76732 YES cleavage system protein P)" 1780 GLRA1 2741 "glycine receptor, alpha 1 (startle GLRA1 glra1 Dr.75842 YES disease/hyperekplexia, stiff man syndrome)" GLRX 1783 GLRX 2745 glutaredoxin (thioltransferase) glrx Dr.76464 YES 1789 GMPR 2766 guanosine monophosphate GMPR gmpr2 Dr.49103 YES reductase GMPR zgc:110617 Dr.45532 YES 1806 GNG10 2790 "guanine nucleotide binding GNG10 - NO protein (G protein), gamma 10" 1813 GNRHR 2798 gonadotropin-releasing hormone LOC100001586 gonadotropin-releasing hormone receptor GnRH- GNRHR Dr.119232 NO receptor R4SHS LOC564687 gonadotropin-releasing hormone receptor GnRH- GNRHR Dr.141222 NO R3PEY 1817 GOLGA4 2803 "golgi autoantigen, golgin GOLGA4 golga5 Dr.79972 YES subfamily a, 4" GPC3 1829 GPC3 2719 glypican 3 gpc3 Dr.90210 NO GPC3 similar to glypican 3 (LOC792490) - NO 1840 GPR109B8843 G protein-coupled receptor GPR109B Hypothetical LOC570755 Dr.116817 NO 109B GRAP 1867 GRAP 10750 GRB2-related adaptor protein Zgc:110202 ( hypothetical protein LOC791535 ) Dr.86832 YES 1868 GRB10 2887 growth factor receptor-bound GRB10 grb10 Dr.105808 YES protein 10 GRB10 Similar to growth factor receptor-bound protein 10 (LOC562032) Dr.134992 NO 1870 GRB2 2885 growth factor receptor-bound GRB2 grb2 Dr.114331 YES protein 2 GRB2 grb2 Dr.74564 YES GTF2B 1914 GTF2B 2959 general transcription factor IIB gtf2b Dr.78599 YES 1939 GYPC 2995 glycophorin C (Gerbich blood GYPC gypc (wu:fj41h10) Dr.132823 YES group) GYPC gypc (wu:fj41h10) Dr.79624 YES HAS2 1966 HAS2 3037 hyaluronan synthase 2 has2 Dr.82516 YES HBG1 1970 HBG1 3047 "hemoglobin, gamma A" hbbe3 (Hemoglobin beta embryonic-3) Dr.29153 YES HCK 1975 HCK 3055 hemopoietic cell kinase LOC569951 similar to src-family tyrosine kinase SCK - NO HCP5 1977 HCP5 10866 HLA complex P5 - - NO 2001 HIF1A 3091 "hypoxia-inducible factor 1, alpha HIF1A hif1a Dr.75612 YES subunit (basic helix-loop-helix transcription factor)" HIST1H2AC 2010 HIST1H2AC 8334 "histone 1, H2ac" similar to Mid1ip1 protein (LOC563177) - NO HIST1H2BE 2018 HIST1H2BE 8344 "histone 1, H2be" hist2h2l Dr.24294 YES HIST2H2AA 2037 HIST2H2AA 8337 "histone 2, H2aa" similar to Mid1ip1 protein (LOC560822) - NO HIST2H2AC 2038 HIST2H2AC 8338 "histone 2, H2ac" zgc:101846 Dr.4738 YES 2039 HIVEP1 3096 human immunodeficiency virus HIVEP1 Hypothetical protein LOC100000517 Dr.81728 NO type I enhancer binding protein 1 si:ch211-157m21.1 (novel protein similar to vertebrate human 2040 HIVEP2 3097 human immunodeficiency virus HIVEP2 immunodeficiency virus type I enhancer binding protein 2 Dr.89852 YES type I enhancer binding protein 2 (HIVEP2) 2057 HLA-E 3133 "major histocompatibility HLA-E mhc1uba Dr.75075 YES complex, class I, E" HLA-E mhc1uea Dr.11010 YES HLA-E mhc1ufa Dr.33261 YES HLA-E mhc1uxa2 Dr.88352 YES HLA-E mhc1uxa2 Dr.125529 NO HLA-E mhc1ze Dr.118701 YES HLA-E mhc1ze Dr.114137 NO HLA-E mhc1ze Dr.118700 NO HLA-E mhc1ze Dr.121171 NO 2058 HLA-F 3134 "major histocompatibility HLA-F - - NO complex, class I, F" 2059 HLA-G 3135 "HLA-G histocompatibility HLA-G zgc:111893 Dr.132739 YES antigen, class I, G" HOXA1 2093 HOXA1 3198 homeo box A1 hoxa1a Dr.83046 YES 2116 HPN 3249 "hepsin (transmembrane protease, HPN si:dkey-33i11.3 Dr.94246 NO serine 1)" 2131 HSD11B13290 hydroxysteroid (11-beta) HSD11B1 hsd11b2 Dr.80613 YES dehydrogenase 1 HSD11B1 hsd11b3 Dr.78218 YES Similar to 11-beta-hydroxysteroid dehydrogenase type 3 HSD11B1 Dr.120175 NO (LOC100006793) Similar to 11-beta-hydroxysteroid dehydrogenase-like protein HSD11B1 Dr.112312 NO (LOC572358) HSPA1A 2143 HSPA1A 3303 heat shock 70kDa protein 1A hsp70 Dr.114305 YES HSPA1A hypothetical protein LOC791520 (wu:fb18c05) Dr.75519 NO HSPA1A LOC100001456 similar to Hsp70 protein Dr.114299 NO HSPA1A LOC560210 similar to Hsp70 protein Dr.115994 YES HSPA1A Dr.115994 YES HSPA1A Dr.134277 YES HSPA1B 2144 HSPA1B 3304 heat shock 70kDa protein 1B hsp70 Dr.114305 YES HSPA1B hypothetical protein LOC791520 (wu:fb18c05) Dr.75519 NO HSPA1B LOC100001456 similar to Hsp70 protein Dr.114299 NO HSPA1B LOC560210 similar to Hsp70 protein Dr.115994 YES Novel protein similar to vertebrate heat shock 70kDa protein 1B HSPA1B Dr.116131 YES (HSPA1B) (RP71-15H20.7) HSPA1B Dr.115994 YES HSPA1B Dr.134277 YES 2149 HSPA6 3310 heat shock 70kDa protein 6 HSPA6 - - NO (HSP70B') HSPB2 2152 HSPB2 3316 heat shock 27kDa protein 2 zgc:112532 Dr.42170 NO 2180 ICAM1 3383 "intercellular adhesion molecule 1 ICAM1 - - NO (CD54), human rhinovirus receptor" IER2 2197 IER2 9592 immediate early response 2 - - NO IER3 2198 IER3 8870 immediate early response 3 - - NO 2200 IFI16 3428 "interferon, gamma-inducible IFI16 - - NO protein 16" 2201 IFI27 3429 "interferon, alpha-inducible protein IFI27 - - NO 27" IFI35 2203 IFI35 3430 interferon-induced protein 35 Hypothetical LOC559610 Dr.80189 YES IFI44 2204 IFI44 10561 interferon-induced protein 44 hypothetical LOC565664 Dr.89538 NO 2205 IFIT1 3434 interferon-induced protein with IFIT1 ifit1 (zgc:123282) Dr.44424 YES tetratricopeptide repeats 1 IFIT1 Similar to interferon-inducible protein IFI58 (LOC100001239) Dr.92790 NO 2206 IFIT2 3433 interferon-induced protein with IFIT2 ifit2 Dr.34411 YES tetratricopeptide repeats 2 IFIT2 Similar to Ifit2 protein (LOC794786) Dr.118852 NO 2207 IFIT4 3437 interferon-induced protein with IFIT4 - - NO tetratricopeptide repeats 4 2208 IFIT5 24138 interferon-induced protein with IFIT5 LOC567441 similar to interferon-inducible protein IFI58 - NO tetratricopeptide repeats 5 2209 IFITM1 8519 interferon induced IFITM1 - - NO transmembrane protein 1 (9-27) 2210 IFITM2 10581 interferon induced IFITM2 - - NO transmembrane protein 2 (1-8D) IFNA1 2211 IFN1@ 3438 "interferon, type 1, cluster" ifn Dr.85981 YES IFNB1 2223 IFNB1 3456 "interferon, beta 1, fibroblast" - - NO IFNG 2224 IFNG 3458 "interferon, gamma" ifng1-1 Dr.94028 YES IFNG ifng1-2 Dr.90633 YES 2228 IFRD1 3475 interferon-related developmental IFRD1 ifrd1 Dr.74180 YES regulator 1 IFRD1 zgc:154080 Dr.114798 YES 2238 IGFBP4 3487 insulin-like growth factor binding IGFBP4 igfbp1 Dr.76315 YES protein 4 IGFBP4 igfbp1b Dr.16095 YES IGFBP4 igfbp2 Dr.115492 YES IGFBP4 igfbp3 Dr.12583 YES IGFBP4 igfbp5 Dr.24976 YES IGFBP4 similar to igfbp3 Dr.116545 NO IGFBP4 similar to igfpb2 Dr.78120 NO 2240 IGFBP6 3489 insulin-like growth factor binding IGFBP6 hypothetical LOC564803 - NO protein 6 IL10 2262 IL10 3586 interleukin 10 IL10 Dr.135567 YES IL10 IL10 family member Dr.94073 YES IL11 2265 IL11 3589 interleukin 11 - - NO 2268 IL12B 3593 "interleukin 12B (natural killer cell IL12B stimulatory factor 2, cytotoxic lymphocyte IL12B (zgc:152789) Dr.135198 YES maturation factor 2, p40)" IL12RB2 2270 IL12RB23595 "interleukin 12 receptor, beta 2" - - NO IL15 2275 IL15 3600 interleukin 15 il15 Dr.85620 YES IL15 il15l (il15-2/-3) Dr.37800 YES IL15RA 2276 IL15RA 3601 "interleukin 15 receptor, alpha" - - NO IL1A 2281 IL1A 3552 "interleukin 1, alpha" - - NO IL1B 2282 IL1B 3553 "interleukin 1, beta" il1b Dr.30443 YES IL1RN 2287 IL1RN 3557 interleukin 1 receptor antagonist - - NO IL2 2288 IL2 3558 interleukin 2 Hypothetical LOC560598 Dr.115578 YES IL2RA 2290 IL2RA 3559 "interleukin 2 receptor, alpha" - - NO 2293 IL3 3562 "interleukin 3 (colony-stimulating IL3 - - NO factor, multiple)" IL4 2295 IL4 3565 interleukin 4 - - NO 2297 IL5 3567 "interleukin 5 (colony-stimulating IL5 - - NO factor, eosinophil)" IL6 2299 IL6 3569 "interleukin 6 (interferon, beta 2)" - - NO IL7R 2303 IL7R 3575 interleukin 7 receptor - - NO IL8 2304 IL8 3576 interleukin 8 LOC100003911 Dr.92011 YES IL8 LOC567083 similar to interleukin 8 Dr.112992 NO 2318 INDO 3620 "indoleamine-pyrrole 2,3 INDO indo - NO dioxygenase" 2320 INHBA 3624 "inhibin, beta A (activin A, INHBA inhbaa Dr.107692 YES activin AB alpha polypeptide)" INHBA inhbab (zgc:158348) Dr.83838 NO 2322 INPP1 3628 inositol polyphosphate-1- INPP1 hypothetical LOC555899 Dr.92947 NO phosphatase IRF1 2341 IRF1 3659 interferon regulatory factor 1 IRF1 Dr.119956 YES
IRF4 2344 IRF4 3662 interferon regulatory factor 4 LOC100002070 similar to interferon regulatory factor 4 Dr.113779 NO
IRF7 2346 IRF7 3665 interferon regulatory factor 7 IRF7 Dr.82280 YES ISG20 (HEM45) 2350 ISG20 3669 interferon stimulated gene 20kDa - - NO 2351 ISGF3G 10379 "interferon-stimulated ISGF3G zgc:92097 Dr.133138 YES transcription factor 3, gamma 48kDa" 2357 ITGA5 3678 "integrin, alpha 5 (fibronectin ITGA5 itga5 Dr.80637 YES receptor, alpha polypeptide)" 2366 ITGAX 3687 "integrin, alpha X (antigen ITGAX Similar to Mac-1 alpha subunit (LOC563782) Dr.117117 NO CD11C (p150), alpha polypeptide)" ITGB8 2376 ITGB8 3696 "integrin, beta 8" itgb8 Dr.109624 YES 2386 ITPKC 80271 "inositol 1,4,5-trisphosphate 3- ITPKC itpkc Dr.77443 YES kinase C" 2389 ITPR3 3710 "inositol 1,4,5-triphosphate ITPR3 Similar to inositol 1,4,5-triphosphate receptor, type 3 (LOC568010) Dr.82196 YES receptor, type 3"
ITPR3 Similar to inositol 1,4,5-triphosphate receptor, type 3 (LOC794666) Dr.82244 NO
JAG1 2393 JAG1 182 jagged 1 (Alagille syndrome) jag1a Dr.83677 YES JAG1 jag1b Dr.12589 YES 2400 JUN 3725 v-jun sarcoma virus 17 oncogene JUN jun Dr.1064 YES homolog (avian) JUNB 2401 JUNB 3726 jun B proto-oncogene junb Dr.10326 YES KIAA0082 2444 KIAA0082 23070 KIAA0082 zgc:55336 Dr.78030 YES KIF5A 2467 KIF5A 3798 kinesin family member 5A Similar to kinesin family member 5A (LOC799274) Dr.115447 NO KLF4 2479 KLF4 9314 Kruppel-like factor 4 (gut) Hypothetical LOC562155 Dr.82009 YES KLF4 klf4 Dr.77887 YES 2487 KLRC3 3823 "killer cell lectin-like receptor KLRC3 - - NO subfamily C, member 3" 2495 KPNA2 3838 "karyopherin alpha 2 (RAG KPNA2 kpna2 Dr.75709 YES cohort 1, importin alpha 1)" 2498 KPNA5 3841 karyopherin alpha 5 (importin KPNA5 zgc:110662 Dr.38262 NO alpha 6) KPNB1 2499 KPNB1 3837 karyopherin (importin) beta 1 kpnb1 Dr.77142 YES KRTHB1 2525 KRTHB1 3887 "keratin, hair, basic, 1" - - NO 2531 KYNU 8942 kynureninase (L-kynurenine KYNU Hypothetical LOC572053 Dr.81635 NO hydrolase) LAD1 2532 LAD1 3898 ladinin 1 lad1 Dr.74509 YES LAG3 2534 LAG3 3902 lymphocyte-activation gene 3 - - NO LAMB3 2541 LAMB3 3914 "laminin, beta 3" - - NO LAMC2 2543 LAMC2 3918 "laminin, gamma 2" - - NO 2554 LCP2 3937 lymphocyte cytosolic protein 2 LCP2 hypothetical protein LOC100004840 - NO (SH2 domain containing leukocyte protein of 76kDa) LCP2 zgc:101809 Dr.81080 YES 2559 LDLR 3949 low density lipoprotein receptor LDLR ldlr Dr.87513 YES (familial hypercholesterolemia) 2567 LGALS3BP 3959 "lectin, galactoside-binding, LGALS3BP lgals3bp Dr.89547 YES soluble, 3 binding protein" LGALS3BP zgc:77059 Dr.106930 YES 2571 LGALS9 3965 "lectin, galactoside-binding, LGALS9 lgalsgl1 Dr.4573 YES soluble, 9 (galectin 9)" LGALS9 zgc:92326 Dr.78702 YES 2574 LHFPL2 10184 lipoma HMGIC fusion partner- LHFPL2 zgc:77456 Dr.14573 YES like 2 LHX2 2575 LHX2 9355 LIM homeobox 2 lhx2 Dr.16318 NO 2576 LIF 3976 leukemia inhibitory factor LIF lif Dr.110395 NO (cholinergic differentiation factor) 2583 LILRB4 11006 "leukocyte immunoglobulin- LILRB4 like receptor, subfamily B (with TM and ITIM - - NO domains), member 4" LIMK2 2585 LIMK2 3985 LIM domain kinase 2 limk2 Dr.76343 YES 2591 LITAF 9516 lipopolysaccharide-induced TNF LITAF litaf Dr.76612 YES factor LMO4 2600 LMO4 8543 LIM domain only 4 lmo4 Dr.107376 YES LMO4 lmo4l (lmo4 like) Dr.78922 YES LOR 2603 LOR 4014 loricrin - - NO 2628 LTA 4049 "lymphotoxin alpha (TNF Ltalpha (TNFbeta) lta Dr.94014 NO superfamily, member 1)" 2643 LY6E 4061 "lymphocyte antigen 6 complex, LY6E - - NO locus E" 2646 LYN 4067 v-yes-1 Yamaguchi sarcoma viral LYN lyn (LOC561155) Dr.22190 YES related oncogene homolog LYN zgc:92124 Dr.79867 YES MAD (MXD1) 2652 MAD 4084 MAX dimerization protein 1 Similar to MAX dimerization protein 1 (LOC570082) Dr.93215 NO MAD2L1 2655 MAD2L1BP 9587 MAD2L1 binding protein mad2l1 Dr.75744 YES MAML1 2669 MAML1 9794 mastermind-like 1 (Drosophila) Similar to Mastermind1 (LOC567335) Dr.58762 NO MAOA 2675 MAOA 4128 monoamine oxidase A mao Dr.77508 YES 2681 MAP2K3 5606 mitogen-activated protein MAP2K3 map2k3 Dr.117346 YES kinase kinase 3 2690 MAP3K4 4216 mitogen-activated protein MAP3K4 map3k4 Dr.109650 YES kinase kinase kinase 4 MAP3K4 map3k4 Dr.75420 NO
MAP3K4 Mitogen-activated protein kinase kinase 4B (LOC568951) Dr.88531 NO 2693 MAP3K8 1326 mitogen-activated protein MAP3K8 map3k8 Dr.117254 YES kinase kinase kinase 8 MAP4 2694 MAP4 4134 microtubule-associated protein 4 hypothetical LOC563727 Dr.117254 YES MAP4 Zgc:113974 (similar to map2) Dr.48570 YES 2716 MARCKS 4082 myristoylated alanine-rich MARCKS marcks Dr.75599 YES protein kinase C substrate MARCKS zgc:109978 (wu:fc34g03) Dr.78590 YES 2742 MCL1 4170 myeloid cell leukemia sequence 1 MCL1 mcl1a Dr.33208 YES (BCL2-related) MCL1 mcl1b Dr.26893 YES 2753 MDK 4192 midkine (neurite growth-promoting MDK mdka Dr.115861 YES factor 2) MDK mdka Dr.31448 YES MDK mdkb Dr.104705 YES 2759 ME3 10873 "malic enzyme 3, NADP(+)- ME3 im:7151680 Dr.80696 YES dependent, mitochondrial" ME3 me2 Dr.34030 YES MGLL 2789 MGLL 11343 monoglyceride lipase mgll Dr.106158 YES 2792 MGST1 4257 microsomal glutathione S- MGST1 zgc:92357 Dr.76590 YES transferase 1 2797 MICB 4277 MHC class I polypeptide-related MMP1 mmp2 Dr.76397 YES sequence B 2818 MMP1 4312 matrix metalloproteinase 1 MMP10 mmp9 Dr.76275 YES (interstitial collagenase) 2819 MMP10 4319 matrix metalloproteinase 10 MMP10 mmp9 Dr.123521 NO (stromelysin 2) MMP10 zgc:136396 Dr.78814 YES MMP12 mmp13 Dr.81475 YES 2821 MMP12 4321 matrix metalloproteinase 12 MMP12 Similar to LOC495372 protein (LOC100003328) Dr.135681 NO (macrophage elastase) MMP12 Similar to LOC495372 protein (LOC100004468) Dr.118289 NO 2823 MMP14 4323 matrix metalloproteinase 14 MMP14 mmp14a Dr.29852 YES (membrane-inserted) MMP14 mmp14b Dr.81778 YES Similar to membrane-type matrix metalloproteinase 1 beta MMP14 Dr.113978 NO (LOC566945) MMP19 2827 MMP19 4327 matrix metalloproteinase 19 Hypothetical protein LOC792703 (LOC792703) Dr.116878 NO 2830 MMP7 4316 "matrix metalloproteinase 7 MMP7 - - NO (matrilysin, uterine)" MORF4L2 2840 MORF4L29643 mortality factor 4 like 2 - - NO 2867 MS4A1 931 "membrane-spanning 4-domains, MS4A1 ms4a4a Dr.40434 YES subfamily A, member 1" MSMB 2873 MSMB 4477 "microseminoprotein, beta-" Similar to beta-microseminoprotein Dr.77131 YES MSMB Similar to beta-microseminoprotein (LOC793284) Dr.113263 YES MSMB Similar to beta-microseminoprotein (LOC793833) Dr.111514 NO MT1E 2882 MT1E 4493 metallothionein 1E (functional) mt Dr.20068 YES MT1G 2884 MT1G 4495 metallothionein 1G - - NO MT1H 2885 MT1H 4496 metallothionein 1H - - NO MT2A 2887 MT2A 4502 metallothionein 2A mt2 Dr.132573 YES MT2A mt2 Dr.132711 YES MT2A mt2 Dr.121290 NO 2892 MTF1 4520 metal-regulatory transcription MTF1 mtf1 Dr.118403 YES factor 1 2894 MTHFD2 10797 "methylene tetrahydrofolate LOC100004977 similar to Methylenetetrahydrofolate MTHFD2 dehydrogenase (NAD+ dependent), dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate Dr.76909 NO methenyltetrahydrofolate cyclohydrolase" cyclohydrolase (wu:fb38b11) MTHFD2 mthfd2 Dr.105864 YES 2895 MTHFS 10588 "5,10-methenyltetrahydrofolate MTHFS Similar to MTHFS protein (LOC100003075) Dr.16718 YES synthetase (5-formyltetrahydrofolate cyclo-ligase)"
MTMR3 2900 MTMR3 8897 myotubularin related protein 3 Similar to myotubularin related protein 3 (LOC799620) Dr.116032 NO
MTMR3 zgc:77875 Dr.88810 YES 2913 MX1 4599 "myxovirus (influenza virus) MX1 resistance 1, interferon-inducible protein p78 mxa Dr.80859 YES (mouse)" 2914 MX2 4600 myxovirus (influenza virus) MX2 mxb Dr.88505 YES resistance 2 (mouse) MX2 mxc Dr.26703 YES MX2 mxe Dr.26920 YES MX2 mxg Dr.88631 YES 2926 MYCPBP 10260 c-myc promoter binding MYCPBP (DENND4A) dennd4a (LOC562586) Dr.87366 NO protein 2927 MYD88 4615 myeloid differentiation primary MYD88 myd88 Dr.134592 YES response gene (88) 2961 NAB2 4665 NGFI-A binding protein 2 (EGR1 NAB2 Hypothetical protein LOC100005680 Dr.116874 NO binding protein 2) NAB2 si:dkeyp-84a8.1 Dr.83971 YES 2977 NCF1 4687 "neutrophil cytosolic factor 1 NCF1 (p47phox) (47kDa, chronic granulomatous disease, autosomal ncf1 Dr.2973 YES 1)" 2978 NCF2 4688 "neutrophil cytosolic factor 2 NCF2 (p67phox) (65kDa, chronic granulomatous disease, autosomal Zgc:158405 (similar to neutrophil cytosolic factor 2 (LOC562473)) Dr.66415 YES 2)" 2979 NCF4 4689 "neutrophil cytosolic factor 4, NCF4 (p40phox) LOC798729 similar to neutrophil cytosolic factor 4 Dr.82765 YES 40kDa" NCF4 (p40phox) ncf4 Dr.120228 YES NDP 2988 NDP 4693 Norrie disease (pseudoglioma) hypothetical protein LOC100003793 Dr.76577 NO 3019 NFATC1 4772 "nuclear factor of activated T- NFATC1 si:ch211-198c22.2 Dr.89152 NO cells, cytoplasmic, calcineurin-dependent 1" 3027 NFIL3 4783 "nuclear factor, interleukin 3 NFIL3 nfil3 Dr.83959 NO regulated" 3029 NFKB1 4790 nuclear factor of kappa light NFKB1 nfkb1 Dr.47468 YES polypeptide gene enhancer in B-cells 1 (p105) 3030 NFKB2 4791 nuclear factor of kappa light NFKB2 nfkb2 Dr.117553 YES polypeptide gene enhancer in B-cells 2 (p49/p100) Similar to Nuclear factor of kappa light polypeptide gene enhancer NFKB2 Dr.13012 NO in B-cells 2, p49/p100 (LOC570902) 3031 NFKBIA 4792 "nuclear factor of kappa light NFKBIA nfkbiaa Dr.79912 YES polypeptide gene enhancer in B-cells inhibitor, alpha" NFKBIA nfkbiab Dr.77409 YES NFKBIA nfkbil1 Dr.140367 YES 3032 NFKBIB 4793 "nuclear factor of kappa light NFKBIB sb:cb606 Dr.114993 YES polypeptide gene enhancer in B-cells inhibitor, beta" Similar to nuclear factor of kappa light polypeptide gene enhancer NFKBIB Dr.78065 NO in B-cells inhibitor, beta (LOC797834) 3033 NFKBIE 4794 "nuclear factor of kappa light NFKBIE polypeptide gene enhancer in B-cells inhibitor, zgc:158276 Dr.121145 NO epsilon" 3041 NGFB 4803 "nerve growth factor, beta NGFB ngfb Dr.76849 YES polypeptide" NINJ1 3045 NINJ1 4814 ninjurin 1 LOC799267 similar to Ninjurin 1 [ Danio rerio ] Dr.112815 NO NMI 3054 NMI 9111 N-myc (and STAT) interactor nmi Dr.80228 YES NOV 3065 NOV 4856 nephroblastoma overexpressed gene - - NO NPTX1 3079 NPTX1 4884 neuronal pentraxin I LOC556906 similar to Nptx2 protein - NO NPTX1 nptx2 Dr.18755 YES NPTX1 zgc:85889 Dr.121407 YES 3099 NR3C1 2908 "nuclear receptor subfamily 3, NR3C1 zgc:113038 Dr.140739 YES group C, member 1 (glucocorticoid receptor)" 3103 NR4A3 8013 "nuclear receptor subfamily 4, NR4A3 nr4a3 Dr.76117 NO group A, member 3" NRG1 3110 NRG1 3084 neuregulin 1 LOC796461 similar to neuregulin Dr.133124 NO 3144 OAS1 4938 "2',5'-oligoadenylate synthetase 1, NRG1 nrg1 Dr.108127 YES 40/46kDa" 3145 OAS2 4939 "2'-5'-oligoadenylate synthetase 2, OAS1 - - NO 69/71kDa" OAS2 3146 OASL 8638 2'-5'-oligoadenylate synthetase-like - - NO 3164 OPN1LW 5956 "opsin 1 (cone pigments), long- OASL - - NO wave-sensitive (color blindness, protan)" OPN1LW opn1lw1 Dr.81279 YES OPN1LW opn1lw2 Dr.116975 YES OSM 3180 OSM 5008 oncostatin M - - NO 3192 P2RX7 5027 "purinergic receptor P2X, ligand- P2RX7 p2rx7 Dr.89527 YES gated ion channel, 7" 3223 PBEF1 10135 pre-B-cell colony enhancing PBEF1 Similar to pre-B cell enhancing factor (LOC568720) Dr.107484 YES factor 1 PBEF1 zgc:55764 Dr.116955 YES PCTK3 3256 PCTK3 5129 PCTAIRE protein kinase 3 hypothetical LOC565835 - NO
Wu:fc22a06 similar to Serine/threonine-protein kinase PCTAIRE-1 PCTK3 Dr.42419 NO (PCTAIRE-motif protein kinase 1) (CRK5) [ Danio rerio ]
3272 PDE4B 5142 "phosphodiesterase 4B, cAMP- LOC565706 similar to cyclic AMP specific phosphodiesterase PDE4B specific (phosphodiesterase E4 dunce homolog, Dr.79148 YES (wu:fj87g04) Drosophila)" 3294 PDLIM7 9260 PDZ and LIM domain 7 PDLIM7 LOC100007487 similar to PDZ and LIM domain 7 Dr.121531 NO (enigma) PDLIM7 pdlim7 Dr.121170 YES PDLIM7 pdlim7 Dr.85085 YES PDLIM7 Similar to PDZ and LIM domain 7 (LOC100000054) Dr.118064 NO 3298 PEA15 8682 phosphoprotein enriched in PEA15 hypothetical LOC557745 - NO astrocytes 15 3322 PGAM1 5223 phosphoglycerate mutase 1 PGAM1 pgam1 Dr.945 YES (brain) PGAM1 pgam1l (pgam1 like) Dr.27123 YES 3344 PHLDA2 7262 "pleckstrin homology-like PHLDA2 Hypothetical protein LOC100007316 Dr.113728 NO domain, family A, member 2" PHLDA2 phlda3 Dr.120320 YES PHLDA2 zgc:110459 Dr.78179 YES 3351 PIGA 5277 "phosphatidylinositol glycan, class PIGA zgc:56589 Dr.86116 YES A (paroxysmal nocturnal hemoglobinuria)" PIM1 3368 PIM1 5292 pim-1 oncogene pim1 Dr.78102 YES PIM1 zgc:153997 Dr.67670 YES PIM2 3369 PIM2 11040 pim-2 oncogene pim1 Dr.78102 YES 3397 PLA2R1 22925 "phospholipase A2 receptor 1, PLA2R1 Hypothetical LOC571993 Dr.98482 NO 180kDa" PLA2R1 Phospholipase A2, group IB (pancreas) (pla2g1b) Dr.116339 NO 3400 PLAGL2 5326 pleiomorphic adenoma gene-like PLAGL2 plagl2 Dr.82515 YES 2 3403 PLAUR 5329 "plasminogen activator, PLAUR - - NO urokinase receptor" 3409 PLCG2 5336 "phospholipase C, gamma 2 PLCG2 plcg2 Dr.11512 YES (phosphatidylinositol-specific)" PLEK 3414 PLEK 5341 pleckstrin plek Dr.29086 YES 3415 PLEKHC110979 "pleckstrin homology domain PLEKHC1 containing, family C (with FERM domain) member pleckhc1 (im:7145859) Dr.83795 YES 1" PLK3 3418 PLK3 1263 polo-like kinase 3 (Drosophila) plk3 Dr.78613 YES 3428 PMAIP1 5366 phorbol-12-myristate-13-acetate- PMAIP1 pmaip1 Dr.82255 YES induced protein 1 PML 3430 PML 5371 promyelocytic leukemia - - NO 3450 PNRC1 10957 proline-rich nuclear receptor PNRC1 - - NO coactivator 1 3457 POLG 5428 "polymerase (DNA directed), POLG Similar to DNA polymerase gamma (LOC560613) Dr.86310 NO gamma" 3458 POLR2A 5430 "polymerase (RNA) II (DNA POLR2A polr2A Dr.79109 YES directed) polypeptide A, 220kDa" PON1 3473 PON1 5444 paraoxonase 1 zgc:112374 Dr.133455 YES PON1 zgc:77556 Dr.82081 YES PON1 zgc:91887 Dr.118552 YES 3488 PPAP2B 8613 phosphatidic acid phosphatase PPAP2B Similar to Phosphatidic acid phosphatase type 2B Dr.88199 YES type 2B 3521 PPP2R2A5520 "protein phosphatase 2 PPP2R2A (formerly 2A), regulatory subunit B (PR 52), alpha ppp2r2a Dr.24755 YES isoform" 3532 PPP3CC 5533 "protein phosphatase 3 (formerly PPP3CC 2B), catalytic subunit, gamma isoform (calcineurin A LOC557926 similar to MGC81043 protein (sb:cb767) Dr.78670 YES gamma)" 3552 PRELP 5549 proline arginine-rich end leucine- PRELP - - NO rich repeat protein 3586 PRKR 5610 "protein kinase, interferon- PRKR prkri ((zgc:110608) Dr.115707 YES inducible double stranded RNA dependent" 3619 PSCD2L 9224 "pleckstrin homology, Sec7 and PSCD2L - - NO coiled-coil domains 2-like" PSEN1 3622 PSEN1 5663 presenilin 1 (Alzheimer disease 3) psen1 Dr.75852 YES 3632 PSMA4 5685 "proteasome (prosome, PSMA4 psma4 Dr.80643 YES macropain) subunit, alpha type, 4" 3636 PSMB10 5699 "proteasome (prosome, PSMB10 psma10 Dr.132259 YES macropain) subunit, beta type, 10" PSMB10 zgc:92791 Dr.85452 YES 3643 PSMB8 5696 "proteasome (prosome, PSMB8 macropain) subunit, beta type, 8 (large psmb8 Dr.7957 YES multifunctional protease 7)" 3644 PSMB9 5698 "proteasome (prosome, PSMB9 macropain) subunit, beta type, 9 (large psmb9a Dr.76004 YES multifunctional protease 2)" PSMB9 psmb9b Dr.80224 YES 3661 PSME2 5721 "proteasome (prosome, PSME2 psme2 Dr.76266 YES macropain) activator subunit 2 (PA28 beta)" 3674 PTGER4 5734 prostaglandin E receptor 4 LOC794873 similar to Prostaglandin E receptor 4 (subtype EP4)- PTGER4 Dr.115990 YES (subtype EP4) like PTGER4 ptger4l Dr.52834 NO PTGER4 Similar to prostaglandin E2 receptor (LOC100005416) Dr.114977 NO 3676 PTGIR 5739 prostaglandin I2 (prostacyclin) PTGIR Similar to prostacyclin receptor (LOC561406) Dr.118215 YES receptor (IP) 3679 PTGS2 5743 prostaglandin-endoperoxide PTGS2 synthase 2 (prostaglandin G/H synthase and ptgs2a Dr.113864 YES cyclooxygenase) PTGS2 ptgs2b Dr.48719 YES 3684 PTK2B 2185 PTK2B protein tyrosine kinase 2 PTK2B ptk2b Dr.20985 YES beta 3690 PTN 5764 "pleiotrophin (heparin binding PTN ptn Dr.88108 YES growth factor 8, neurite growth-promoting factor 1)" 3693 PTPN1 5770 "protein tyrosine phosphatase, PTPN1 ptp1b (protein tyrosine phosphatase 1b) Dr.8290 YES non-receptor type 1" 3696 PTPN14 5784 "protein tyrosine phosphatase, PTPN14 - - NO non-receptor type 14" 3698 PTPN2 5771 "protein tyrosine phosphatase, PTPN2 ptpn2 Dr.76595 YES non-receptor type 2" PTPN2 ptpn2l Dr.77918 YES 3703 PTPN7 5778 "protein tyrosine phosphatase, PTPN7 - - NO non-receptor type 7" PTPRA 3705 PTPRA 5786 "protein tyrosine phosphatase, ptpra Dr.8174 YES receptor type, A" 3712 PTPRH 5794 "protein tyrosine phosphatase, Similar to protein tyrosine phosphatase, receptor type, H PTPRH Dr.41182 NO receptor type, H" (LOC569071) 3725 PTX3 5806 "pentaxin-related gene, rapidly PTX3 Hypothetical LOC566001 Dr.113961 NO induced by IL-1 beta" 3746 RAB13 5872 "RAB13, member RAS oncogene RAB13 rab13 Dr.20822 YES family" 3749 RAB21 23011 "RAB21, member RAS RAB21 zgc:154045 Dr.74240 YES oncogene family" 3800 RARRES15918 retinoic acid receptor responder RARRES1 - - NO (tazarotene induced) 1 RASA2 3804 RASA2 5922 RAS p21 protein activator 2 - - NO RBBP8 3815 RBBP8 5932 retinoblastoma binding protein 8 zgc:113143 Dr.134012 NO 3831 RCN1 5954 "reticulocalbin 1, EF-hand calcium RCN1 wu:fa06h02 Dr.41005 YES binding domain" 3842 REL 5966 v-rel reticuloendotheliosis viral REL rel Dr.86023 YES oncogene homolog (avian) 3843 RELA 5970 "v-rel reticuloendotheliosis viral RELA oncogene homolog A, nuclear factor of kappa light rela Dr.84126 YES polypeptide gene enhancer in B-cells 3, p65 (avian)" RELB relb Dr.118176 YES 3844 RELB 5971 "v-rel reticuloendotheliosis viral RELB oncogene homolog B, nuclear factor of kappa light relb Dr.118173 NO polypeptide gene enhancer in B-cells 3 (avian)" RGS1 3861 RGS1 5996 regulator of G-protein signalling 1 hypothetical protein LOC792554 - NO 3862 RGS16 6004 regulator of G-protein signalling RGS16 zgc:110206 Dr.92097 NO 16 LOC557360 similar to regulator of G protein signaling 3 RGS3s RGS3 3865 RGS3 5998 regulator of G-protein signalling 3 Dr.86623 YES (im:7137300) 3874 RHOB 388 "ras homolog gene family, member RHOB rhoaa Dr.32765 YES B" 3878 RHOH 399 "ras homolog gene family, member RHOH rhoh Dr.80325 YES H" RHOH similar to ras-like protein Rhoh (LOC795808) - NO RHOH similar to ras-like protein Rhoh (LOC797214) - NO 3990 RRAD 6236 Ras-related associated with RRAD Hypothetical LOC573168 Dr.115853 NO diabetes RRAD zgc:63471 Dr.80392 YES 3999 RSC1A1 6248 "regulatory solute carrier RSC1A1 - - NO protein, family 1, member 1" SAA1 4027 SAA1 6288 serum amyloid A1 saal1 Dr.12883 YES 4040 SAT 6303 spermidine/spermine N1- SAT1 sat1 Dr.120559 YES acetyltransferase SAT1 zgc:114142 Dr.107550 NO 4050 SCARF1 8578 "scavenger receptor class F, SCARF1 scarf1 Dr.74559 YES member 1" 4070 SDC4 6385 "syndecan 4 (amphiglycan, SDC4 sdc4l (syndecan 4-like) Dr.74531 YES ryudocan)" SECTM1 4084 SECTM1 6398 secreted and transmembrane 1 - - NO 4102 SERPINA1 5265 "serine (or cysteine) SERPINA1 proteinase inhibitor, clade A (alpha-1 antiproteinase, serpina1 Dr.75688 YES antitrypsin),member 1" 4107 SERPINB1 1992 "serine (or cysteine) SERPINB1 serpinb1 Dr.77198 YES proteinase inhibitor, clade B (ovalbumin), member 1" SERPINB1 serpinb1l1 Dr.82062 YES 4109 SERPINB2 5055 "serine (or cysteine) SERPINB2 - - NO proteinase inhibitor, clade B (ovalbumin), member 2" 4114 SERPINB8 5271 "serine (or cysteine) SERPINB8 - - NO proteinase inhibitor, clade B (ovalbumin), member 8" 4131 SFPQ 6421 splicing factor proline/glutamine SFPQ sfpq Dr.122050 YES rich (polypyrimidine tract binding protein associated) SFPQ sfpq Dr.32607 YES 4160 SHB 6461 SHB (Src homology 2 domain SHB - - NO containing) adaptor protein B 4171 SIAT4A 6482 "sialyltransferase 4A (beta- SIAT4A siat4a-r3 Dr.94003 NO galactoside alpha-2,3-sialyltransferase)" 4181 SIX1 6495 sine oculis homeobox homolog 1 SIX1 six1 Dr.27681 YES (Drosophila) SKIIP 4184 SKIIP 22938 SKI interacting protein snw1 (skiip) Dr.31414 YES SKIIP snw1 (skiip) Dr.74868 YES 4190 SLAMF1 6504 signaling lymphocytic SLAMF1 - - NO activation molecule family member 1 4196 SLC11A24891 "solute carrier family 11 SLC11A2 (proton-coupled divalent metal ion transporters), slc11a2 Dr.208 YES member 2" 4214 SLC1A2 6506 "solute carrier family 1 (glial SLC1A2 zgc:65897 Dr.28183 YES high affinity glutamate transporter), member 2" 4215 SLC1A3 6507 "solute carrier family 1 (glial SLC1A3 slc1a3 Dr.76752 YES high affinity glutamate transporter), member 3" 4234 SLC2A1 6513 "solute carrier family 2 SLC2A1 similar to glucose transporter 1A (LOC571494) - NO (facilitated glucose transporter), member 1" SLC2A1 slc2a1 Dr.132485 YES 4240 SLC31A21318 "solute carrier family 31 (copper SLC31A2 sb:cb797 Dr.31604 YES transporters), member 2" SLC31A2 slc31a2 Dr.79948 YES 4263 SLC6A126539 "solute carrier family 6 SLC6A12 (neurotransmitter transporter, betaine/GABA), slc6a13 Dr.36663 YES member 12" 4271 SLC7A5 8140 "solute carrier family 7 (cationic Similar to blood-brain barrier large neutral amino acid transporter SLC7A5 Dr.120797 YES amino acid transporter, y+ system), member 5" (LOC569909) SLC7A5 similar to MGC130976 protein (LOC797250) - NO 4274 SLC8A2 6543 "solute carrier family 8 (sodium- SLC8A2 si:dkeyp-109h9.1 - NO calcium exchanger), member 2" SLC8A2 slc8a2 - NO 4280 SLCO1A26579 "solute carrier organic anion SLCO1A - - NO transporter family, member 1A2" 4291 SMAD7 4092 "SMAD, mothers against DPP SMAD7 smad7 Dr.52521 YES homolog 7 (Drosophila)" SMAD7 smad7 Dr.124891 NO SMS 4306 SMS 6611 spermine synthase Similar to spermine synthase (LOC796131) Dr.119853 NO SMS sms Dr.79631 YES 4336 SOD2 6648 "superoxide dismutase 2, SOD2 sod2 Dr.6314 YES mitochondrial" 4345 SOX4 6659 SRY (sex determining region Y)- SOX4 sox4a Dr.76585 YES box 4 SOX4 sox4b Dr.29160 YES SP110 4351 SP110 3431 SP110 nuclear body protein - - NO 4405 SSA1 6737 "Sjogren syndrome antigen A1 SSA1 - - NO (52kDa, ribonucleoprotein autoantigen SS-A/Ro)" 4407 SSB 6741 Sjogren syndrome antigen B SSB ssb Dr.3463 YES (autoantigen La) SSTR2 4416 SSTR2 6752 somatostatin receptor 2 Similar to somatostatin receptor type two (LOC566521) Dr.117108 NO
4432 STAT1 6772 "signal transducer and activator of STAT1 stat1a Dr.120105 YES transcription 1, 91kDa" 4435 STAT4 6775 signal transducer and activator of STAT4 stat4 Dr.34491 YES transcription 4 4436 STAT5A 6776 signal transducer and activator STAT5A stat5.1 Dr.133576 YES of transcription 5A STAT5A stat5.2 Dr.140952 YES STATH 4439 STATH 6779 statherin - - NO STIM1 4442 STIM1 6786 stromal interaction molecule 1 si:dkey-24p1.5 Dr.81385 YES 4445 STK3 6788 "serine/threonine kinase 3 (STE20 Similar to Serine/threonine kinase 3 (STE20 homolog, yeast) STK3 Dr.119357 NO homolog, yeast)" (LOC100005228) Similar to Serine/threonine kinase 3 (STE20 homolog, yeast) STK3 Dr.119365 NO (LOC100006113) STK3 stk3 Dr.24253 YES STOM 4450 STOM 2040 stomatin stom Dr.75837 YES 4512 TANK 10010 TRAF family member-associated TANK zgc:153048 Dr.89901 YES NFKB activator 4513 TAP1 6890 "transporter 1, ATP-binding TAP1 tap1a Dr.75450 YES cassette, sub-family B (MDR/TAP)" TAP1 tap1b Dr.75461 YES 4514 TAP2 6891 "transporter 2, ATP-binding TAP2 tap2 or tap3 similar Dr.88570 YES cassette, sub-family B (MDR/TAP)" TAP2 tap2 similar Dr.96241 YES TBX5 4531 TBX5 6910 T-box 5 tbx5 Dr.81302 YES 4549 TCF7L2 6934 "transcription factor 7-like 2 (T- TCF7L2 tcf7l2 Dr.67692 YES cell specific, HMG-box)" 4554 TCN1 6947 "transcobalamin I (vitamin B12 TCN1 - - NO binding protein, R binder family)" 4561 TCTEL1 6993 t-complex-associated-testis- TCTEL1 (DYNLT1) dynlt3 Dr.4843 YES expressed 1-like 1 TCTEL1 (DYNLT1) hypothetical LOC558449 - NO TCTEL1 (DYNLT1) Hypothetical protein LOC100005084 Dr.92255 YES 4567 TEAD1 7003 TEA domain family member 1 TEAD1 zgc:63696 Dr.96129 YES (SV40 transcriptional enhancer factor) 4580 TFAP2B 7021 transcription factor AP-2 beta TFAP2B tfap2b Dr.83177 YES (activating enhancer binding protein 2 beta) 4587 TFF1 7031 "trefoil factor 1 (breast cancer, TFF1 zgc:111913 (zona pellucida glycoprotein 2) Dr.23435 YES estrogen-inducible sequence expressed in)" TFF1 zgc:114014 (zona pellucida glycoprotein 2-like) Dr.132175 NO TFF1 zgc:162961 Dr.75678 YES TFPI2 4591 TFPI2 7980 tissue factor pathway inhibitor 2 LOC796294 similar to Tfpib protein Dr.114810 YES TFPI2 tfpi2 Dr.90243 NO TFPI2 tfpia Dr.33137 YES 4593 TGFA 7039 "transforming growth factor, TGFalpha - - NO alpha" TGFB1I4 (TSC22D1 TSC22 4595 TGFB1I48848 transforming growth factor beta Hypothetical LOC569765 Dr.80480 NO domain family, member 1) 1 induced transcript 4 TGFB1I4 (TSC22D1 TSC22 zgc:65895 (tgfb1i4) Dr.84822 YES domain family, member 1) 4602 TGIF 7050 TGFB-induced factor (TALE family TGIF zgc:55852 (tgif) Dr.139 YES homeobox) THBD 4609 THBD 7056 thrombomodulin hypothetical LOC561910 - NO 4621 THRSP 7069 "thyroid hormone responsive THRSP - - NO (SPOT14 homolog, rat)" TJP2 4636 TJP2 9414 tight junction protein 2 (zona wu:fb10a11 Dr.76695 YES occludens 2) 4640 TLE1 7088 "transducin-like enhancer of split 1 TLE1 - - NO (E(sp1) homolog, Drosophila)" TLK2 4645 TLK2 11011 tousled-like kinase 2 Hypothetical protein LOC100003933 Dr.114260 NO TLK2 hypothetical protein LOC100006003 (wu:fi16h09) Dr.106683 YES TLK2 zgc:136697 Dr.79789 YES 4666 TNF 7124 "tumor necrosis factor (TNF TNF tnfa Dr.89727 YES superfamily, member 2)" TNF tnfb Dr.94015 YES 4668 TNFAIP27127 "tumor necrosis factor, alpha- TNFAIP2 si:dkeyp-72h1.2 Dr.84196 NO induced protein 2" Similar to Tumor necrosis factor, alpha-induced protein 3 (Putative 4669 TNFAIP37128 "tumor necrosis factor, alpha- TNFAIP3 (A20) DNA-binding protein A20) (Zinc finger protein A20) Dr.41090 NO induced protein 3" (LOC564497) 4670 TNFAIP67130 "tumor necrosis factor, alpha- TNFAIP6 zgc:136830 Dr.81845 YES induced protein 6" 4675 TNFRSF1B 7133 "tumor necrosis factor TNFRSF1B fas (TNF receptor superfamily, member 6) Dr.82180 YES receptor superfamily, member 1B" TNFRSF1B tnfrsfa Dr.10712 YES TNFRSF1B zgc:163064 Dr.90354 NO 4678 TNFRSF5958 "tumor necrosis factor receptor TNFRSF5 (CD40) - - NO superfamily, member 5" 4682 TNFRSF93604 "tumor necrosis factor receptor TNFRSF9 (CD137) zgc:136557 Dr.91558 NO superfamily, member 9" 4683 TNFSF108743 "tumor necrosis factor (ligand) TNFSF10 (TRAIL) tnsf10l Dr.10736 YES superfamily, member 10" TNFSF10 (TRAIL) tnsf10l Dr.10736 YES TNFSF10 (TRAIL) tnsf10l2 Dr.86839 YES TNFSF10 (TRAIL) tnsf10l4 Dr.86302 YES 4689 TNFSF9 8744 "tumor necrosis factor (ligand) TNFSF9 - - NO superfamily, member 9" TNIP1 4690 TNIP1 10318 TNFAIP3 interacting protein 1 tnip1 Dr.16192 YES 4701 TNP2 7142 transition protein 2 (during histone TNP2 - - NO to protamine replacement) 4717 TP53BP27159 "tumor protein p53 binding TP53BP2 tp53bp2 Dr.117439 YES protein, 2" TP53BP2 tp53bp2 Dr.32621 YES 4732 TRADD 8717 TNFRSF1A-associated via death TRADD tradd Dr.105498 YES domain TRAF1 4733 TRAF1 7185 TNF receptor-associated factor 1 - - NO TRAF6 4737 TRAF6 7189 TNF receptor-associated factor 6 traf6 Dr.74618 YES TRG 4746 TRG@ 6965 T cell receptor gamma locus Similar to T-cell receptor gamma (LOC100003700) Dr.135057 NO TRIB1 4749 TRIB1 10221 tribbles homolog 1 (Drosophila) - - NO TRIM14 4752 TRIM14 9830 tripartite motif-containing 14 - - NO TRIM22 4753 TRIM22 10346 tripartite motif-containing 22 - - NO TRIM25 4755 TRIM25 7706 tripartite motif-containing 25 zgc:55773 Dr.81374 YES TRIM26 4756 TRIM26 7726 tripartite motif-containing 26 trim25l Dr.32140 YES TRIM31 4759 TRIM31 11074 tripartite motif-containing 31 - - NO TRIM38 4761 TRIM38 10475 tripartite motif-containing 38 - - NO 4763 TRIP10 9322 thyroid hormone receptor TRIP10 sb:cb1091 Dr.36299 YES interactor 10 4776 TSFM 10102 "Ts translation elongation factor, TSFM Hypothetical protein LOC799150 Dr.84965 YES mitochondrial" TSFM zgc:158429 Dr.133507 YES 4826 UBE2H 7328 "ubiquitin-conjugating enzyme UBE2H ube2h Dr.17520 YES E2H (UBC8 homolog, yeast)" UPP1 4859 UPP1 7378 uridine phosphorylase 1 uppl (uridine phosphorylase like) Dr.83717 YES 4897 VEGFC 7424 vascular endothelial growth VEGFC vegfc Dr.88903 YES factor C VRK2 4912 VRK2 7444 vaccinia related kinase 2 vrk2 Dr.77483 YES WARS 4916 WARS 7453 tryptophanyl-tRNA synthetase wars Dr.79691 YES 4927 WNT5A 7474 "wingless-type MMTV WNT5A wnt5a Dr.108590 YES integration site family, member 5A" WTAP 4932 WTAP 9589 Wilms tumor 1 associated protein wtap Dr.6973 YES XBP1 4936 XBP1 7494 X-box binding protein 1 xbp1 Dr.76130 YES 4961 ZCWCC3 23515 "zinc finger, CW-type with ZCWCC3 zgc:152774 Dr.90976 NO coiled-coil domain 3" 4979 ZNF140 7699 zinc finger protein 140 (clone ZFN140 - - NO pHZ-39) 4966 ZFP36L2678 "zinc finger protein 36, C3H type- ZFP36 sb:cb81 Dr.34611 YES like 2" 4964 ZFP36 7538 "zinc finger protein 36, C3H type, ZFP36L2 Hypothetical protein LOC100004129 Dr.117256 NO homolog (mouse)" ZFP36L2 zfp36l1 Dr.105582 YES ZFP36L2 zfp36l2 Dr.76498 YES ZFP36L2 zgc:76924 Dr.80547 YES ZFX 4967 ZFX 7543 "zinc finger protein, X-linked" wu:fb15e12 Dr.76738 YES ZNF197 4997 ZNF197 10168 zinc finger protein 197 - - NO ZNF274 5009 ZNF274 10782 zinc finger protein 274 - - NO ZNF6 5025 ZNF6 7552 zinc finger protein 6 (CMPX1) Similar to Zinc finger protein 711 (LOC799975) Dr.91240 NO ZNF6 Zinc finger protein (LOC562505) Dr.117742 YES ZNF6 znf6 - NO
B. microarray data of common host response gene set
Zebrafish human common Gene symbol of UniGene Ra 2h Ra 5h Ra 8h Ra 24h wt 2h wt 5h wt 8h wt 24h Ra 2h Ra 5h Ra 8h Ra 24h wt 2h wt 5h wt 8h wt 24h host response (putative) zebrafish Identifier Fold Fold Fold Fold Fold Fold Fold Fold P-value P-value P-value P-value P-value P-value P-value P-value genes* homolog† (build Change Change Change Change Change Change Change Change #105)
ADA ada Dr.120392 -2.04 4.64E-02 2.26 1.70E-04 3.74 2.49E-12 1.20 5.63E-01 -1.14 1.79E-01 2.00 1.19E-03 3.86 6.58E-13 1.79 4.79E-02 ATF3 atf3 Dr.77523 2.13 4.46E-20 1.46 2.85E-06 2.50 2.00E-05 2.72 4.97E-21 2.72 0.00E+00 1.23 3.75E-01 7.88 5.23E-20 33.67 0.00E+00
LOC792472 similar to BF complement factor Dr.119903 1.89 9.27E-03 2.71 5.07E-23 2.19 8.44E-15 1.13 3.64E-01 1.24 3.68E-01 2.13 1.10E-07 2.37 3.45E-10 -4.30 5.89E-17 B/C2-A3
BF cfb Dr.75096 1.22 9.20E-04 1.69 1.91E-20 2.21 2.17E-07 2.68 0.00E+00 1.14 5.45E-03 1.59 1.20E-11 2.20 3.32E-09 1.98 5.35E-14
ccl19c (Transcribed locus, weakly similar CCL19 to XP_001338456.1 Dr.125570 2.47 1.73E-03 3.27 7.69E-19 6.31 8.40E-08 2.60 5.65E-02 3.32 1.14E-06 5.10 1.01E-20 12.95 1.10E-30 1.03 9.01E-01 similar to CC chemokine-1)
ccl19b (similar to CC CCL19 chemokine SCYA106 Dr.133987 1.01 8.95E-01 2.39 2.14E-16 2.67 2.94E-09 4.88 1.23E-41 1.06 6.28E-01 2.52 5.40E-20 6.83 0.00E+00 11.22 0.00E+00 (CH211-89F7.4)
similar to ccl8a CCL8 (MCP2) Dr.84529 1.59 1.06E-01 2.10 4.72E-11 1.32 1.25E-01 2.78 8.54E-23 1.36 2.06E-01 2.92 3.41E-12 2.72 1.71E-09 3.14 1.01E-17 (si:dkeyp-59a8.2)
cd83 (Hypothetical CD83 Dr.74671 4.63 0.00E+00 1.00 9.99E-01 1.31 1.00E-04 6.85 4.83E-43 3.60 3.42E-35 1.07 6.13E-01 3.64 2.37E-29 60.22 0.00E+00 LOC561001)
CHIT1 clp-Dr.831 Dr.75976 1.25 1.15E-01 1.52 6.01E-06 2.05 8.00E-05 2.64 7.61E-07 -1.03 8.45E-01 1.56 1.18E-03 4.48 4.69E-10 13.13 4.35E-09 CHIT1 clp-Dr1995 Dr.77223 1.17 1.68E-01 2.51 1.09E-35 5.06 0.00E+00 5.11 0.00E+00 1.20 1.13E-02 2.69 6.74E-12 9.95 1.97E-31 33.66 0.00E+00 CTSK ctsk Dr.76224 -2.47 6.10E-04 1.45 1.80E-01 3.60 6.16E-09 1.99 4.75E-02 -1.28 6.54E-02 1.59 3.88E-02 2.75 7.32E-06 1.67 1.44E-01
cxcl10 (Similar to CXCL10 (IP10) interleukin-8 Dr.111760 1.27 2.29E-02 2.29 0.00E+00 1.85 2.30E-12 1.61 4.44E-06 1.42 5.43E-08 2.22 3.30E-42 3.05 0.00E+00 4.11 0.00E+00 (LOC567537)
cxcl11a CXCL11 (I-TAC) Dr.113696 3.75 9.05E-10 1.26 2.28E-01 3.10 7.65E-10 4.46 6.49E-14 4.26 0.00E+00 1.61 8.74E-03 7.75 1.39E-39 33.69 0.00E+00 ((LOC795785)
cxcl9 (Similar to CXCL9 (MIG) chemokine CXC-like Dr.117585 1.24 1.46E-02 1.61 1.27E-19 4.39 0.00E+00 1.66 1.99E-10 1.31 3.52E-02 1.89 1.21E-40 5.34 0.00E+00 4.74 0.00E+00 protein (LOC562246)
ELF4 elf3 Dr.76707 1.46 1.15E-10 1.15 2.78E-01 1.54 3.46E-21 1.54 2.38E-07 1.61 6.82E-12 1.84 9.33E-03 3.29 4.10E-07 7.91 2.70E-06
LOC558921 similar to FOSL2 fra2 protein Dr.10410 2.58 0.00E+00 1.44 4.29E-23 1.89 2.41E-17 1.86 3.13E-08 2.50 0.00E+00 2.04 2.13E-35 4.53 0.00E+00 11.74 0.00E+00 (wu:fl03b09)
FOSL2 fos Dr.12986 1.65 3.82E-23 -1.39 6.00E-05 1.79 3.72E-08 2.02 2.53E-02 1.87 1.05E-15 1.30 2.78E-01 5.35 6.40E-22 25.04 2.48E-43 IL10 IL10 Dr.135567 3.59 2.28E-03 2.42 3.95E-17 3.51 5.21E-10 1.50 7.11E-03 2.96 8.01E-08 3.47 2.47E-26 3.12 4.05E-14 -1.08 5.74E-01 IL1B il1b Dr.30443 6.31 0.00E+00 -1.61 5.26E-17 2.58 1.51E-14 8.46 0.00E+00 4.50 1.53E-29 1.42 1.84E-07 10.15 0.00E+00 85.97 0.00E+00
IL8 il8 (LOC100003911) Dr.92011 1.15 7.83E-01 1.03 4.90E-01 1.74 1.07E-07 3.33 1.56E-13 1.27 5.57E-01 1.63 1.34E-02 4.18 1.09E-24 31.47 0.00E+00
IRF1 IRF1 Dr.119956 8.66 0.00E+00 1.29 3.00E-05 3.13 0.00E+00 4.97 6.86E-26 6.90 0.00E+00 1.78 3.99E-31 12.25 0.00E+00 51.02 0.00E+00 JUNB junb Dr.10326 2.51 9.98E-38 -1.13 9.00E-05 1.43 7.33E-08 1.22 2.02E-02 2.01 9.79E-31 1.33 5.69E-09 4.38 0.00E+00 10.23 0.00E+00 MMP10 mmp9 Dr.76275 4.75 0.00E+00 2.59 0.00E+00 6.49 0.00E+00 14.74 0.00E+00 3.76 0.00E+00 4.44 0.00E+00 22.53 0.00E+00 278.66 0.00E+00 MMP12 mmp13 Dr.81475 1.40 3.47E-20 -1.78 1.64E-10 2.14 1.17E-41 7.51 2.50E-30 -1.05 3.68E-01 1.47 5.20E-04 9.50 0.00E+00 131.72 0.00E+00 NCF1 (p47phox) ncf1 Dr.2973 2.69 2.11E-36 1.23 1.16E-03 1.34 1.00E-05 1.77 5.48E-41 2.30 0.00E+00 2.09 0.00E+00 1.87 4.21E-21 3.66 0.00E+00 NFKB2 nfkb2 Dr.117553 2.28 1.07E-06 -1.04 4.24E-01 1.05 3.60E-01 1.32 7.27E-06 2.09 2.71E-08 1.27 1.30E-04 1.90 2.06E-11 5.52 2.51E-37 NFKBIA nfkbiab Dr.77409 2.12 7.96E-27 1.12 6.17E-07 1.26 6.00E-05 1.46 3.30E-23 1.62 1.37E-11 1.13 1.18E-03 2.01 7.34E-21 5.50 0.00E+00 NMI nmi Dr.80228 1.02 9.08E-01 2.15 5.10E-07 2.21 2.90E-22 1.59 8.28E-03 -1.37 2.60E-02 2.06 1.25E-06 2.61 6.18E-31 5.32 4.12E-41 PIM1 pim1 Dr.78102 1.75 1.13E-17 -1.36 2.86E-09 1.00 9.85E-01 1.16 6.29E-02 1.77 0.00E+00 1.15 3.96E-02 1.06 3.20E-01 3.24 0.00E+00 PIM2 pim1 Dr.78102 1.75 1.13E-17 -1.36 2.86E-09 1.00 9.85E-01 1.16 6.29E-02 1.77 0.00E+00 1.15 3.96E-02 1.06 3.20E-01 3.24 0.00E+00 PLEK plek Dr.29086 1.89 1.63E-08 1.87 2.60E-14 1.70 3.05E-19 1.72 7.01E-17 1.85 7.65E-09 2.59 3.84E-20 2.80 2.83E-28 -1.35 4.54E-02 PSME2 psme2 Dr.76266 1.15 3.57E-01 2.87 8.18E-08 3.15 2.67E-06 2.10 4.96E-06 -1.44 3.20E-03 2.63 1.04E-07 3.66 6.11E-07 8.71 9.83E-15 REL rel Dr.86023 2.51 4.40E-23 1.07 9.18E-02 1.17 1.36E-01 1.39 4.73E-26 1.88 0.00E+00 1.39 1.47E-13 2.25 4.82E-09 4.59 0.00E+00 SCARF1 scarf1 Dr.74559 -1.57 1.20E-02 1.05 7.32E-01 1.77 3.00E-05 1.48 5.86E-02 1.15 4.38E-01 1.24 5.05E-03 1.80 1.31E-07 1.54 3.96E-02 SERPINB1 serpinb1l1 Dr.82062 1.27 2.79E-01 3.02 5.44E-11 3.28 1.71E-24 2.17 8.08E-08 -1.05 8.53E-01 2.43 7.61E-08 3.35 1.45E-28 5.07 0.00E+00 STAT4 stat4 Dr.34491 1.43 4.00E-05 1.54 8.00E-05 1.15 5.29E-02 1.20 2.25E-01 1.54 2.35E-03 1.56 1.07E-07 1.64 2.68E-19 3.68 3.97E-15
TAP2 tap2 or tap3 similar Dr.88570 -1.45 3.62E-01 4.49 3.45E-09 7.62 2.45E-39 6.01 1.93E-11 -1.02 9.07E-01 4.11 1.49E-25 12.15 2.80E-45 33.98 0.00E+00
TAP2 tap2 similar Dr.96241 1.24 3.38E-02 1.52 2.75E-03 1.65 1.56E-06 1.27 5.65E-02 1.14 1.79E-01 2.07 3.04E-07 1.96 6.93E-22 3.30 2.69E-37 TNF tnfa Dr.89727 6.37 3.85E-12 1.61 2.61E-03 1.90 2.65E-02 4.04 1.00E-05 5.08 2.74E-09 3.45 6.71E-06 7.30 2.00E-05 15.97 5.28E-07 TNF tnfb Dr.94015 2.64 8.33E-27 1.03 6.30E-01 2.13 1.14E-18 5.55 0.00E+00 2.67 2.02E-18 1.87 9.71E-03 11.54 0.00E+00 35.90 0.00E+00 TNFSF10 (TRAIL) tnsf10l2 Dr.86839 1.16 2.91E-01 1.28 1.05E-01 2.11 1.18E-30 1.08 6.62E-01 1.02 8.76E-01 1.68 7.00E-05 1.88 6.07E-07 -2.10 7.87E-07 ZFP36L2 zfp36l1 Dr.105582 -1.00 9.96E-01 1.41 3.69E-03 2.07 1.99E-13 -1.04 7.50E-01 1.35 2.00E-01 1.52 2.67E-03 2.04 4.62E-12 -1.36 1.12E-01 G1P2 (ISG15) isg15 Dr.114892 1.26 3.70E-02 1.76 1.18E-02 1.93 6.00E-05 2.21 3.75E-02 1.19 2.32E-03 2.13 3.97E-02 4.43 6.00E-04 57.15 2.69E-06 GMPR zgc:110617 Dr.45532 -2.13 3.66E-02 1.69 3.21E-10 1.10 4.82E-01 -1.07 5.38E-01 -1.04 9.04E-01 1.40 6.60E-04 -1.06 6.36E-01 -1.27 7.81E-03 MTF1 mtf1 Dr.118403 -1.47 6.75E-02 1.23 1.80E-01 1.66 7.00E-05 1.14 5.46E-01 1.09 6.85E-01 1.10 5.23E-01 1.47 7.86E-03 -1.19 3.66E-01 CCL20 ccl20 (Similar to Dr.133624 1.66 2.62E-02 1.35 3.52E-01 1.28 2.64E-01 3.19 3.98E-09 1.74 5.50E-04 1.34 1.57E-01 11.36 1.25E-07 8.76 1.58E-08 (MIP3alpha/LARC) chemokine CK-1) GADD45A gadd45a Dr.83410 1.17 6.60E-02 1.05 2.90E-01 -1.10 3.68E-02 1.63 1.38E-22 1.11 1.70E-01 1.21 7.51E-02 1.57 5.63E-13 5.47 0.00E+00 IFNA1 ifn Dr.85981 -1.15 3.46E-01 1.31 1.30E-02 1.27 3.30E-02 5.20 1.80E-19 1.04 7.61E-01 2.55 4.00E-06 7.61 1.20E-29 36.11 0.00E+00 IGFBP4 igfbp1 Dr.76315 -1.04 6.82E-01 -1.12 3.92E-02 1.10 1.84E-01 2.60 1.79E-24 1.03 6.78E-01 1.96 5.00E-04 2.01 1.77E-08 31.24 0.00E+00 ISGF3G zgc:92097 Dr.133138 1.41 7.38E-06 1.33 3.58E-13 1.43 7.38E-07 1.67 1.30E-20 1.47 1.40E-26 1.49 7.60E-13 2.12 6.26E-13 5.84 0.00E+00 MX1 mxa Dr.80859 1.01 9.58E-01 1.27 5.97E-03 1.05 7.02E-01 2.13 8.53E-11 1.07 7.68E-01 1.61 4.00E-05 1.34 9.92E-03 3.98 1.57E-26 NFKBIA nfkbiaa Dr.79912 2.45 5.30E-03 1.18 2.35E-02 1.76 3.86E-02 2.12 5.00E-05 1.90 3.66E-08 1.17 1.74E-02 7.66 5.10E-04 8.67 0.00E+00 BCL6 bcl6 Dr.115290 -1.15 3.65E-01 1.18 1.12E-01 1.46 5.00E-05 1.13 4.02E-01 1.02 8.49E-01 1.29 2.84E-03 1.74 5.01E-09 1.11 4.72E-01 BMP2 bmp2b Dr.568 1.58 2.70E-02 -1.01 9.40E-01 -1.18 2.97E-01 1.15 4.70E-01 1.56 5.78E-12 1.28 2.49E-01 1.30 3.54E-01 1.67 4.18E-06 CEBPG cebpg Dr.15663 1.03 7.49E-01 1.03 7.75E-01 1.18 2.17E-01 1.26 4.96E-02 1.08 6.02E-01 1.23 4.66E-02 1.78 3.00E-05 4.24 0.00E+00 HLA-E mhc1uea Dr.11010 -1.58 4.50E-04 1.57 3.00E-04 1.47 4.13E-03 -1.09 5.55E-01 1.08 5.74E-01 2.06 2.51E-03 2.28 2.87E-10 1.25 1.07E-01 HLA-E mhc1ufa Dr.33261 -1.28 5.21E-01 2.46 9.00E-04 1.77 2.00E-04 1.69 2.31E-02 1.29 5.13E-01 2.10 4.80E-04 2.93 1.06E-08 4.77 0.00E+00 INHBA inhbaa Dr.107692 -1.45 7.16E-02 1.17 1.99E-01 1.22 4.54E-01 1.25 2.86E-02 -1.13 3.25E-01 1.55 1.62E-06 2.14 8.10E-03 6.60 5.18E-44 MS4A1 ms4a4a Dr.40434 1.21 4.25E-02 1.36 4.40E-04 1.44 8.18E-07 1.26 6.83E-03 1.24 2.61E-02 1.23 7.96E-03 1.79 5.25E-18 2.33 8.22E-23 Similar to beta- MSMB microseminoprotein Dr.113263 -1.66 2.35E-02 1.61 2.10E-04 -1.12 5.58E-01 1.06 8.33E-01 -1.20 3.84E-01 1.85 1.04E-09 1.24 3.08E-01 1.56 5.62E-02 (LOC793284) MTHFD2 mthfd2 Dr.105864 -1.06 4.98E-01 1.16 1.80E-03 1.22 3.09E-03 1.08 3.97E-02 -1.06 5.59E-01 1.45 3.50E-04 1.87 3.31E-06 3.70 6.25E-43 MX2 mxe Dr.26920 1.84 1.79E-01 3.53 1.74E-02 2.94 7.20E-04 1.41 2.67E-01 2.51 5.41E-06 5.10 6.92E-03 6.71 2.00E-05 3.17 7.51E-02 NFKBIB sb:cb606 Dr.114993 1.34 2.65E-02 1.02 9.02E-01 1.30 2.18E-06 1.35 6.93E-03 1.77 4.20E-04 1.48 7.07E-03 2.34 3.65E-07 2.55 7.30E-13 PHLDA2 phlda3 Dr.120320 -1.37 2.98E-02 1.17 2.53E-01 1.72 1.00E-04 1.27 2.10E-01 -1.08 6.03E-01 1.18 1.17E-01 1.96 6.00E-05 5.34 1.59E-20 PHLDA2 zgc:110459 Dr.78179 -1.03 8.04E-01 1.23 8.53E-02 1.38 9.00E-05 1.65 2.60E-04 1.02 8.66E-01 1.47 5.40E-04 2.06 9.74E-08 7.83 0.00E+00 PSMB10 zgc:92791 Dr.85452 -1.66 1.45E-02 1.50 1.90E-02 1.64 1.10E-04 1.27 3.99E-01 -1.24 3.03E-01 1.43 5.11E-03 1.68 1.00E-05 3.01 9.00E-05 PTGS2 ptgs2a Dr.113864 1.22 2.31E-01 1.08 6.09E-01 1.14 5.19E-01 1.61 5.80E-04 1.53 8.24E-15 1.31 1.06E-02 1.59 1.25E-02 4.83 1.89E-26 RELA rela Dr.84126 -2.07 1.35E-01 3.63 1.93E-03 1.63 2.36E-01 -1.45 3.57E-01 1.17 5.10E-01 3.50 2.33E-03 3.95 5.85E-09 2.28 7.01E-03 fas (TNF receptor TNFRSF1B superfamily, member Dr.82180 1.89 1.19E-03 1.52 4.00E-02 1.65 3.18E-03 1.92 9.77E-02 1.16 4.14E-01 2.05 1.69E-02 3.66 1.00E-19 12.54 5.29E-18 6) PSMB9 psmb9a Dr.76004 1.01 9.46E-01 1.31 2.43E-02 1.38 1.04E-01 1.77 1.06E-08 -1.12 4.74E-01 1.42 2.95E-03 1.85 3.08E-02 2.40 4.77E-06
LOC557360 similar to regulator of G protein RGS3 Dr.86623 1.57 1.98E-01 1.88 2.12E-03 1.84 2.80E-04 3.90 2.66E-06 1.13 7.11E-01 2.64 3.20E-04 2.24 2.64E-02 9.25 1.86E-07 signaling 3 RGS3s (im:7137300)
zgc:113200 ACP2 Dr.39091 -1.01 8.97E-01 -1.07 3.51E-01 -1.06 5.04E-01 -1.00 9.93E-01 -1.14 3.31E-01 -1.10 2.18E-01 -1.16 1.06E-01 1.79 6.82E-08 (wu:fi35e03)
adm-like: Similar to ADM preproadrenomedullin Dr.43797 1.08 4.47E-01 1.08 2.44E-01 1.26 4.95E-03 1.18 5.06E-02 1.08 3.86E-01 1.25 2.36E-02 1.42 1.06E-03 4.04 0.00E+00 (LOC556502)
ADORA2A adora2b Dr.141253 -1.06 9.04E-01 1.06 8.83E-01 1.28 1.98E-01 1.15 5.24E-01 -1.64 2.83E-01 -2.55 1.39E-03 1.30 4.50E-01 4.10 1.82E-11 ALAS1 alas1 Dr.4829 1.06 1.37E-01 -1.10 6.60E-03 -1.20 3.84E-07 -1.04 6.62E-01 -1.02 6.53E-01 -1.00 9.42E-01 -1.06 2.10E-01 2.56 0.00E+00 AMPD3 ampd3 Dr.11670 1.14 9.45E-03 1.01 8.07E-01 -1.18 1.04E-02 -1.01 9.09E-01 1.17 1.92E-02 -1.01 7.76E-01 -1.23 1.43E-06 1.84 1.32E-12
zgc:171702, LOC556410 similar to ATF4 activating Dr.104781 1.08 2.63E-01 1.21 7.01E-02 1.10 4.94E-01 -1.01 9.05E-01 -1.26 3.19E-01 -1.04 8.00E-01 1.59 1.15E-01 1.78 1.78E-08 transcription factor 4 (wu:fb08f07)
B4GALT1 zgc:154116 Dr.78291 -1.06 5.72E-01 -1.06 4.46E-01 -1.16 7.89E-02 -1.04 6.91E-01 -1.08 4.61E-01 -1.06 3.97E-01 -1.09 4.23E-01 1.63 2.18E-07 BBC3 bbc3 Dr.26003 -1.39 4.32E-01 -1.32 5.53E-01 -1.14 6.13E-01 1.63 1.16E-01 -2.16 6.81E-02 -1.08 8.13E-01 -1.19 5.10E-01 5.72 8.14E-10 BIK bik Dr.82304 1.26 6.55E-02 1.14 2.07E-01 -1.13 4.07E-01 1.09 4.07E-01 -1.07 4.93E-01 -1.22 7.95E-02 -1.22 3.09E-02 2.73 5.00E-05 BIRC2 birc2 Dr.77093 1.14 1.09E-01 1.00 9.50E-01 1.11 2.64E-01 1.15 1.38E-02 -1.00 9.92E-01 1.12 3.09E-02 1.32 7.44E-07 2.21 1.74E-26 BTG1 btg1 Dr.75505 1.34 1.53E-01 -1.23 1.23E-01 -1.21 7.15E-02 -1.05 7.70E-01 1.27 2.13E-01 -1.11 3.71E-01 -1.03 7.56E-01 2.54 3.97E-10 BTG2 btg2 Dr.76624 -1.32 1.13E-03 1.05 7.02E-01 1.17 3.18E-01 1.25 8.21E-02 1.14 1.40E-01 -1.01 9.14E-01 1.65 3.35E-03 1.85 3.00E-05 BTG3 btg3 (zgc:103463) Dr.81837 1.08 1.91E-01 -1.11 1.32E-06 -1.13 2.14E-01 1.08 5.11E-03 1.12 1.31E-03 -1.00 9.13E-01 -1.20 2.88E-02 2.01 0.00E+00 CASP5 casp6l1 Dr.90030 -1.37 1.95E-03 1.07 6.20E-01 1.48 1.50E-03 1.80 2.17E-03 -1.16 5.08E-01 1.22 2.12E-02 1.74 1.73E-03 1.96 1.18E-06 CASP7 casp8 Dr.10334 1.01 9.22E-01 1.08 4.89E-01 1.25 1.46E-01 1.26 7.98E-03 1.19 2.37E-03 1.34 6.94E-03 1.33 8.11E-02 6.30 0.00E+00 CASP7 casp9 Dr.78866 1.08 3.47E-01 1.01 9.10E-01 1.12 2.34E-01 1.23 4.58E-02 1.04 6.62E-01 1.28 1.25E-01 1.68 6.76E-03 5.21 2.23E-13 CFLAR (FLIP) cflar Dr.82387 1.48 2.00E-05 1.07 3.86E-01 -1.12 1.36E-01 1.07 4.65E-01 1.43 6.00E-05 1.30 2.67E-03 1.26 1.02E-03 2.22 5.75E-14 CITED2 zgc:103418 Dr.40045 -1.04 6.51E-01 -1.36 1.72E-06 -1.03 7.14E-01 1.16 1.79E-01 -1.03 6.75E-01 -1.24 2.30E-03 -1.23 3.47E-03 2.01 1.88E-32 CLELCSF LOC100002541 Dr.116475 -1.51 8.44E-02 1.29 3.86E-02 1.08 7.53E-01 1.35 8.13E-02 -1.40 4.49E-02 1.25 7.88E-02 1.30 2.36E-01 5.48 4.00E-05 CLELCSF si:ch211-154o6.6 Dr.73909 -1.04 1.70E-01 1.12 8.00E-05 1.06 4.32E-01 1.24 1.79E-14 -1.12 2.90E-03 1.11 1.66E-01 1.08 5.58E-02 2.71 0.00E+00 COPEB copeb Dr.77265 1.32 2.32E-03 1.03 6.99E-01 1.04 7.29E-01 1.12 2.01E-01 1.27 5.87E-03 1.21 1.00E-01 1.37 2.10E-04 2.60 2.10E-33 COX17 cox17 Dr.116425 -1.13 3.71E-01 -1.01 7.42E-01 -1.17 2.81E-03 1.09 1.28E-02 -1.08 5.09E-01 1.01 8.54E-01 -1.13 3.43E-03 2.33 0.00E+00 CTSS ctssb.2 Dr.132688 -1.23 7.44E-02 1.08 4.19E-01 -1.15 1.13E-01 -1.06 3.70E-01 -1.29 2.63E-03 1.13 2.80E-01 -1.16 1.33E-01 2.30 3.95E-20 DIA1 dia1 Dr.3433 1.03 6.27E-01 -1.09 4.81E-02 -1.09 2.80E-04 1.01 8.64E-01 -1.07 3.05E-01 1.04 5.56E-01 -1.01 7.18E-01 1.75 1.94E-24 DUSP1 dusp1 Dr.2413 -1.01 9.07E-01 -1.17 7.59E-03 -1.03 6.04E-01 1.25 3.85E-02 1.11 3.04E-01 1.05 2.38E-01 -1.01 7.76E-01 2.66 1.73E-27 DUSP2 zgc:91929 Dr.81043 -1.03 7.67E-01 -1.06 3.93E-01 -1.27 6.10E-04 1.21 2.23E-02 -1.09 3.91E-01 1.17 6.10E-02 1.37 1.30E-04 4.97 0.00E+00 DUSP4 dusp4 (zgc:55423) Dr.35017 1.14 3.57E-01 -1.20 5.35E-02 -1.15 3.66E-01 1.09 5.98E-01 1.28 7.67E-02 -1.08 3.68E-01 1.03 8.63E-01 4.83 2.19E-09 DUSP5 dusp5 Dr.120234 1.46 9.36E-03 -1.02 8.32E-01 1.05 5.88E-01 1.46 9.00E-04 1.20 1.79E-01 1.26 1.03E-01 1.38 3.00E-04 6.54 1.40E-45 DUSP6 dusp6 (zgc:77211) Dr.116871 1.05 7.09E-01 1.09 4.48E-01 -1.10 5.75E-01 1.08 3.89E-01 -1.04 6.08E-01 1.11 2.59E-01 -1.05 7.23E-01 1.59 8.14E-06 DUSP6 dusp6 Dr.16301 1.10 5.04E-02 -1.01 7.59E-01 1.11 1.87E-01 1.23 2.56E-09 1.07 3.39E-01 1.15 3.33E-08 1.18 5.87E-02 2.75 0.00E+00 EDEM1 edem1 Dr.11486 -1.05 5.29E-01 1.10 4.80E-02 1.22 3.50E-04 1.07 8.31E-02 1.12 8.96E-02 1.20 7.67E-08 1.28 4.50E-04 1.85 7.56E-42 EFNA1 efna1 Dr.104284 1.04 5.51E-01 -1.15 6.27E-03 -1.08 3.99E-01 1.01 7.25E-01 1.11 1.28E-02 -1.10 5.73E-02 -1.16 2.25E-02 1.73 7.52E-28 EIF2S2 eif2s2 Dr.25507 1.05 4.61E-01 1.01 8.76E-01 1.03 3.79E-01 1.07 1.86E-02 -1.04 2.53E-01 1.05 3.85E-01 1.05 4.42E-01 1.85 1.36E-25 ELF4 ef1 Dr.76289 1.14 5.55E-02 -1.05 5.43E-01 -1.05 5.40E-01 1.08 5.39E-01 1.17 9.35E-02 1.18 1.34E-02 1.22 1.30E-04 2.72 1.61E-09 ETS2 zgc:92106 Dr.7710 1.42 5.00E-05 -1.23 5.42E-02 -1.10 2.65E-01 1.13 3.58E-01 1.02 8.13E-01 -1.13 2.10E-01 1.44 2.78E-03 5.03 1.91E-35 ETV6 etv6 Dr.121185 -1.04 8.00E-01 1.07 4.47E-01 1.31 4.00E-05 1.07 5.40E-01 -1.01 9.46E-01 1.20 1.46E-02 1.47 1.20E-04 1.96 2.74E-22 GADD45A gadd45al Dr.27107 1.05 7.07E-01 1.12 5.23E-02 1.31 1.68E-01 1.27 4.00E-04 1.16 1.17E-02 1.11 1.41E-01 1.45 2.53E-02 12.00 0.00E+00 GBP1 Zgc:103512 Dr.79955 -1.02 8.88E-01 -1.13 1.44E-01 1.08 5.33E-01 1.02 7.86E-01 1.08 6.88E-02 -1.22 8.00E-02 1.01 9.25E-01 1.77 1.67E-13
Zgc:110202 ( GRAP hypothetical protein Dr.86832 1.07 5.48E-01 1.01 9.48E-01 -1.06 6.13E-01 1.07 6.67E-01 1.12 4.05E-01 1.07 6.24E-01 1.06 4.96E-01 2.28 2.63E-10 LOC791535 )
HAS2 has2 Dr.82516 1.12 1.51E-01 1.00 9.52E-01 1.05 4.38E-01 -1.00 9.40E-01 1.13 5.82E-02 1.22 1.67E-02 1.24 1.57E-02 1.57 2.54E-08 HSPA1A hsp70 Dr.114305 -1.76 5.23E-09 -1.09 5.34E-01 1.02 9.22E-01 1.02 8.84E-01 1.28 7.25E-02 1.37 2.08E-02 -1.19 2.87E-01 16.17 0.00E+00
LOC560210 similar to HSPA1A Dr.115994 -1.25 5.65E-02 -1.34 2.00E-05 1.02 8.89E-01 1.07 4.76E-01 -1.01 8.90E-01 1.04 7.08E-01 -1.08 6.78E-01 15.85 0.00E+00 Hsp70 protein
HSPA1A Dr.115994 -1.25 5.65E-02 -1.34 2.00E-05 1.02 8.89E-01 1.07 4.76E-01 -1.01 8.90E-01 1.04 7.08E-01 -1.08 6.78E-01 15.85 0.00E+00 HSPA1A Dr.134277 -1.78 1.40E-04 1.11 4.33E-01 1.57 1.34E-02 1.29 1.55E-01 1.47 1.96E-02 1.66 1.40E-04 1.04 7.87E-01 20.71 1.42E-42 HSPA1B hsp70 Dr.114305 -1.76 5.23E-09 -1.09 5.34E-01 1.02 9.22E-01 1.02 8.84E-01 1.28 7.25E-02 1.37 2.08E-02 -1.19 2.87E-01 16.17 0.00E+00
LOC560210 similar to HSPA1B Dr.115994 -1.25 5.65E-02 -1.34 2.00E-05 1.02 8.89E-01 1.07 4.76E-01 -1.01 8.90E-01 1.04 7.08E-01 -1.08 6.78E-01 15.85 0.00E+00 Hsp70 protein
HSPA1B Dr.115994 -1.25 5.65E-02 -1.34 2.00E-05 1.02 8.89E-01 1.07 4.76E-01 -1.01 8.90E-01 1.04 7.08E-01 -1.08 6.78E-01 15.85 0.00E+00 Novel protein similar to vertebrate heat HSPA1B shock 70kDa protein Dr.116131 1.24 4.50E-04 -1.22 8.62E-02 -1.42 2.90E-04 -1.16 1.12E-01 1.13 1.59E-02 -1.07 6.54E-01 -1.08 5.30E-01 1.73 5.00E-05 1B (HSPA1B) (RP71- 15H20.7)
HSPA1B Dr.134277 -1.78 1.40E-04 1.11 4.33E-01 1.57 1.34E-02 1.29 1.55E-01 1.47 1.96E-02 1.66 1.40E-04 1.04 7.87E-01 20.71 1.42E-42 Hypothetical IFI35 Dr.80189 1.31 1.47E-01 1.38 2.22E-03 1.03 8.02E-01 1.17 2.52E-01 1.07 7.98E-01 1.28 1.69E-03 1.30 2.85E-02 3.34 6.83E-06 LOC559610
IL10 IL10 family member Dr.94073 -1.60 4.35E-02 1.23 2.60E-01 -1.19 2.47E-01 1.39 1.40E-02 -1.86 6.42E-03 1.63 8.72E-02 -1.01 9.63E-01 6.24 3.61E-09
ITGA5 itga5 Dr.80637 -1.02 8.51E-01 1.11 7.25E-02 1.05 5.81E-01 1.14 1.35E-01 1.09 2.32E-01 1.02 7.11E-01 1.19 2.58E-02 2.31 4.94E-30 JUN jun Dr.1064 1.32 6.71E-19 -1.13 8.80E-04 -1.00 9.47E-01 1.16 1.41E-01 1.29 1.55E-10 1.22 2.00E-05 1.32 2.50E-16 3.63 0.00E+00 LGALS9 zgc:92326 Dr.78702 1.26 6.25E-12 1.06 1.11E-01 1.04 4.15E-01 1.06 2.49E-01 1.04 3.93E-01 1.17 2.40E-04 1.23 2.00E-05 1.75 1.13E-14 MCL1 mcl1b Dr.26893 -1.04 5.16E-01 -1.22 1.23E-02 -1.09 4.39E-01 1.33 5.42E-07 1.17 2.45E-02 1.09 4.17E-01 -1.21 7.47E-03 3.88 0.00E+00 MCL1 mcl1a Dr.33208 -1.08 5.86E-01 1.20 2.36E-01 1.26 2.02E-01 1.08 5.85E-01 1.04 7.46E-01 1.34 1.01E-01 1.34 7.61E-02 3.22 3.78E-44 MT2A mt2 Dr.132573 1.01 8.92E-01 -1.04 6.19E-01 1.09 2.06E-01 1.10 4.00E-02 -1.28 6.89E-03 -1.25 3.00E-05 -1.30 9.00E-05 2.00 5.97E-22 MYD88 myd88 Dr.134592 1.14 1.84E-02 1.03 5.50E-01 -1.03 8.03E-01 1.13 6.71E-03 1.16 2.00E-05 1.05 4.41E-01 1.31 9.97E-03 2.56 0.00E+00 NRG1 nrg1 Dr.108127 1.36 5.49E-02 -1.08 6.20E-01 1.10 2.43E-01 -1.21 1.76E-02 1.46 3.20E-02 1.17 4.58E-01 1.36 8.99E-02 4.74 4.49E-09 PGAM1 pgam1 Dr.945 -1.16 7.21E-02 1.08 7.73E-02 1.07 4.71E-01 1.02 7.12E-01 -1.13 7.21E-02 1.07 2.30E-01 -1.06 2.77E-01 2.48 1.30E-25 PIM1 zgc:153997 Dr.67670 1.36 4.81E-03 -1.02 8.82E-01 -1.01 9.09E-01 1.21 2.30E-01 1.09 7.89E-01 1.20 4.53E-02 1.21 4.99E-02 1.77 7.00E-05 PLK3 plk3 Dr.78613 1.16 2.46E-01 1.08 4.08E-01 1.04 7.43E-01 1.12 2.30E-01 1.10 6.52E-02 1.25 1.92E-02 1.25 3.23E-02 3.46 0.00E+00 PSMB8 psmb8 Dr.7957 -1.12 4.61E-01 1.35 2.54E-01 1.79 2.22E-02 1.38 2.00E-01 1.19 3.00E-01 1.53 1.57E-01 1.98 1.44E-02 5.54 5.80E-07 PTGS2 ptgs2b Dr.48719 -1.20 5.20E-01 -1.06 4.89E-01 -1.35 2.90E-01 2.23 1.23E-02 1.08 8.36E-01 1.11 5.49E-01 1.25 4.30E-01 12.38 4.96E-13 RELB relb Dr.118176 2.18 2.26E-03 1.25 1.12E-01 -1.04 7.14E-01 1.44 8.48E-03 1.78 8.38E-02 1.43 3.48E-02 1.33 1.76E-02 4.16 3.26E-15 RRAD zgc:63471 Dr.80392 1.02 9.21E-01 1.22 9.11E-02 1.13 3.07E-01 1.30 2.40E-04 -1.09 4.65E-01 1.33 9.48E-03 1.50 2.00E-05 5.44 3.19E-40 sdc4l (syndecan 4- SDC4 Dr.74531 1.20 1.13E-01 1.07 4.70E-01 1.20 6.56E-02 1.15 5.40E-02 1.20 9.56E-02 1.43 5.46E-06 1.40 1.19E-03 4.25 0.00E+00 like) SERPINB1 serpinb1 Dr.77198 -1.08 2.98E-01 -1.03 5.06E-01 -1.27 4.24E-08 1.20 9.70E-04 -1.25 1.03E-01 -1.04 4.41E-01 -1.22 1.04E-03 2.09 0.00E+00 SLC31A2 sb:cb797 Dr.31604 -1.13 3.49E-01 1.21 1.55E-02 -1.05 7.24E-01 1.25 5.50E-03 -1.03 6.13E-01 1.18 3.78E-02 -1.04 7.87E-01 3.01 2.86E-21 SLC31A2 slc31a2 Dr.79948 -1.13 1.13E-01 1.10 6.98E-02 1.22 1.07E-01 1.16 1.23E-02 -1.08 3.41E-01 1.06 1.61E-01 1.12 2.27E-01 1.60 4.74E-20 STAT1 stat1a Dr.120105 1.16 1.74E-03 1.04 2.57E-01 1.18 2.56E-02 1.15 5.53E-03 1.17 7.00E-05 1.21 7.56E-09 1.18 8.80E-04 2.43 0.00E+00 TEAD1 zgc:63696 Dr.96129 -1.03 7.26E-01 -1.06 2.36E-01 1.04 7.80E-01 1.19 1.86E-02 -1.15 4.82E-03 -1.02 6.70E-01 1.06 6.37E-01 1.85 8.00E-05 TNFAIP6 zgc:136830 Dr.81845 1.10 5.87E-01 -1.17 2.17E-01 -1.46 3.70E-04 1.08 5.16E-01 1.03 8.56E-01 -1.13 3.17E-01 -1.42 3.81E-03 1.84 2.57E-10 TNFSF10 (TRAIL) tnsf10l4 Dr.86302 1.56 2.73E-03 1.20 2.34E-01 1.20 1.00E-01 1.25 1.38E-01 1.37 4.01E-02 1.42 1.38E-01 1.45 4.00E-05 1.81 2.96E-06 TNIP1 tnip1 Dr.16192 1.21 2.47E-01 1.00 9.97E-01 -1.13 2.70E-01 1.09 4.00E-01 1.01 8.35E-01 -1.06 4.42E-01 1.05 6.38E-01 2.75 2.13E-17 TP53BP2 tp53bp2 Dr.117439 -1.21 6.51E-02 1.03 7.51E-01 1.14 5.15E-02 1.16 4.87E-02 -1.18 6.29E-02 1.05 6.48E-01 1.08 4.46E-01 1.84 1.57E-17 TP53BP2 tp53bp2 Dr.32621 -1.07 3.59E-01 1.04 5.70E-01 1.15 1.22E-02 1.16 6.74E-02 -1.12 1.77E-01 1.04 4.90E-01 1.08 3.48E-01 1.75 1.46E-07 TRADD tradd Dr.105498 1.01 8.80E-01 1.03 7.22E-01 -1.08 3.98E-01 1.05 5.54E-01 1.00 9.78E-01 1.06 5.67E-01 -1.00 9.80E-01 2.01 2.08E-19 TRAF6 traf6 Dr.74618 1.08 4.32E-01 1.11 2.07E-02 1.01 8.85E-01 1.17 6.27E-02 1.07 4.50E-01 1.12 2.81E-03 1.21 8.98E-02 2.28 7.46E-09 TRIM25 zgc:55773 Dr.81374 -1.13 7.13E-01 1.20 1.87E-01 1.00 9.85E-01 1.18 4.23E-01 -1.12 3.22E-01 1.32 3.39E-02 1.09 6.84E-01 2.97 1.12E-15 VRK2 vrk2 Dr.77483 1.01 9.67E-01 1.06 5.70E-01 -1.04 6.60E-01 1.18 2.01E-01 -1.26 3.13E-01 1.09 4.61E-01 -1.11 1.57E-01 2.17 1.46E-06 WARS wars Dr.79691 1.11 1.22E-01 -1.07 1.75E-01 -1.20 6.00E-05 -1.03 6.20E-01 -1.15 1.65E-01 -1.16 2.97E-02 -1.05 4.13E-01 1.98 1.51E-25 XBP1 xbp1 Dr.76130 1.09 1.96E-01 1.06 2.81E-01 1.06 4.30E-01 1.02 4.36E-01 1.06 4.38E-01 1.14 4.14E-02 1.34 5.50E-04 1.98 3.99E-28
*A set of 511 human common host response genes described by Jenner and Young (42) †Genes were manually identified by searching ZFIN (http://zfin.org) and the Gene and HomoloGene databases of the National Centre for Biotechnology Information (NCBI) (Supplementary table III). Homologs of human cytokines were identified based on phylogeny reconstructions to be reported elsewhere. Direct or putative homologs could be identified for 397 out of the 511 human common host response genes (78%) and 322 of these (63%) were represented on our zebrafish microarray. Since some genes are duplicated in zebrafish and since sometimes there was more than one putative homolog, there were 473 zebrafish UniGenes corresponding to the 322 human genes represented on the array. Supplementary Table IV. Toll-like Receptor GenMapp analysis*
2 hpi: S. typhimurium wt vs. 5 hpi: S. typhimurium wt vs. 8 hpi: S. typhimurium wt vs. 24 hpi: S. typhimurium wt vs. control control control control GenMapp UniGene Gene Symbol Fold Change P-value Fold Change P-value Fold Change P-value Fold Change P-value Name Code ikbkb Dr.101105 1.04256 0.53022 -1.26422 0.01072 -1.09398 0.1485 1.18492 0.0479 casp8 Dr.10334 1.19478 0.00237 1.33747 0.00694 1.33123 0.08112 6.30185 0 ripk1l Dr.103967 -1.16267 0.19667 -1.17063 0.01032 -1.27388 0.02264 1.15026 0.19779 mapk1 Dr.10452 -1.005 0.94862 -1.16632 0.00267 -1.34442 5.65654E-08 1.01246 0.77517 zgc:171702 atf4 Dr.104781 -1.26188 0.31915 -1.0361 0.79958 1.58983 0.11533 1.77667 1.78116E-08 ecsit Dr.105286 1.3244 0.19333 -1.22271 0.03746 -1.43998 0.00126 -2.03538 2.53871E-10 jun Dr.1064 1.28878 1.54822E-10 1.21593 0.00002 1.32368 2.49854E-16 3.63285 0 map2k1 Dr.107100 -1.04307 0.43054 1.06407 0.07271 1.4784 0.00006 1.19855 0.00963 atf2l Dr.108551 defbl1 Dr.113373 2.49107 0.06584 -1.2132 0.62798 1.42498 0.39779 1.08982 0.83468 ptgs2a cox2a Dr.113864 1.52511 8.23613E-15 1.30856 0.01062 1.58932 0.01247 4.8336 1.88653E-26 mapk3 Dr.114298 -1.08908 0.25144 -1.1793 0.02841 1.49662 0.09642 1.00904 0.96337 ube2nl Dr.114603 -1.04971 0.54678 -1.1772 0.001 -1.19564 0.04492 -1.74046 2.7088E-27 si:dkey-127j5.5 atf5 Dr.114932 1.00296 0.98129 1.48648 0.02081 2.05607 0.00455 13.91212 0 atf7b Dr.115347 1.02279 0.89197 1.05508 0.20003 1.04776 0.58624 -1.21455 0.11656 LOC561737 pik3ca Dr.117016 1.10546 0.01317 1.10314 0.00561 1.01557 0.78834 1.25222 8.3645E-15 LOC564854 irf3 Dr.117120 -1.09438 0.27667 1.09314 0.56511 2.36576 0.01342 8.69248 7.3795E-16 LOC563727 tpl2 Dr.117254 1.1105 0.35741 -1.00595 0.96386 1.02035 0.85049 1.54222 0.00548 map2k6 Dr.117346 1.23272 0.00095 -1.09667 0.06071 -1.19123 0.00629 -2.54896 0 nfkb2 Dr.117553 2.09054 2.70923E-08 1.26554 0.00013 1.90158 2.06108E-11 5.5238 2.51213E-37 tlr21 Dr.118435 -1.05165 0.68871 -1.60723 0.00278 -1.34032 0.04196 -1.74799 0.00139 tlr19 Dr.118544 -1.10105 0.35564 -1.0671 0.62816 -1.14979 0.23814 -1.54628 0.00051 maf Dr.120867 -1.06779 0.60324 1.0152 0.87691 -1.08051 0.42816 -2.18881 4.36183E-09 zgc:158276 nfkbie Dr.121145 fos Dr.12986 1.8661 1.05275E-15 1.30179 0.27794 5.34759 6.40335E-22 25.04027 2.4803E-43 zgc:123326 ube2v1 Dr.132817 -1.15443 0.12968 -1.13765 0.08084 -1.28783 0.02929 -1.51342 2.71837E-06 myd88 Dr.134592 1.16144 0.00002 1.05078 0.44127 1.30521 0.00997 2.56356 0 traf1 Dr.134981 1.17836 0.01529 1.33465 0.00028 1.73041 0.00032 5.49396 3.47152E-17 zgc:152789 il12b Dr.135198 -1.13767 0.45086 -1.01637 0.90953 -1.06289 0.69194 1.08387 0.5426 il12a Dr.135199 -1.08054 0.37522 -1.22565 0.01552 1.40694 0.00536 7.70602 1.85048E-20 il17c Dr.135566 1.20912 0.22379 1.11066 0.64154 2.40355 1.87704E-06 8.20021 2.81026E-29 il10 Dr.135567 2.95659 8.0104E-08 3.47421 2.47382E-26 3.12185 4.05161E-14 -1.07593 0.57438 chuk ikka Dr.14012 1.08279 0.20734 -1.03098 0.517 1.08403 0.38048 1.38138 2.35645E-13 traf4b Dr.15893 -1.12232 0.0285 1.10757 0.18888 1.52105 0.01191 3.22265 0 tnip1 tnfaip3 Dr.16192 1.01287 0.83452 -1.05988 0.44185 1.05275 0.63844 2.75362 2.12577E-17 zgc:77033 pik3cg Dr.23613 1.61706 6.83631E-09 1.90945 1.91535E-11 1.83993 2.13917E-06 1.30777 0.00001 dusp1 Dr.2413 1.11209 0.30361 1.04851 0.23794 -1.01185 0.776 2.66094 1.72983E-27 zgc:76869 nap1 Dr.29829 tlr2 Dr.30180 -1.11521 0.21811 -1.22169 0.14648 -1.28672 0.06948 -1.03883 0.66752 tlr22 Dr.30190 -1.20624 0.17003 -1.22533 0.26486 -1.15416 0.41209 -1.15061 0.41295 tlr20f Dr.30196 -1.37662 0.0105 1.24949 0.13599 -1.20001 0.18248 1.01828 0.87652 il1b pro - il1b Dr.30443 4.49887 1.5326E-29 1.41885 1.84174E-07 10.14997 0 85.9683 0 il15l Dr.37800 -1.42963 0.00002 1.00397 0.95766 -1.0343 0.63768 1.06428 0.09406 rac1a Dr.4711 1.10499 0.03443 -1.00338 0.94215 1.06345 0.40476 1.13169 0.0133 nfkb1 Dr.47468 1.14796 0.41364 -1.04876 0.55434 1.12763 0.50183 2.12672 0.04647 ptgs2b cox2b Dr.48719 1.0774 0.83584 1.11065 0.54921 1.24812 0.43044 12.37783 4.96105E-13 socs3a Dr.6431 3.06767 0 2.08143 6.15696E-14 7.25716 2.58374E-35 20.28269 0 ikbkg Dr.69759 1.02722 0.74056 1.08219 0.11561 1.16223 0.00184 1.8083 7.77899E-12 crebbpa Dr.69932 mapk14a mapk14a (p38a) Dr.72252 1.08754 0.40256 1.04367 0.46632 1.18814 0.00008 2.00684 5.88915E-12 traf6 Dr.74618 1.06526 0.45031 1.11562 0.00281 1.21227 0.0898 2.27878 7.45567E-09 atf1 Dr.75537 -1.02499 0.59019 -1.09386 0.04263 1.00655 0.94396 1.10599 0.01948 crebbpb Dr.76145 1.05384 0.47828 1.07929 0.4969 -1.23855 0.0284 1.03861 0.64688 caspa Dr.76374 -1.12943 0.11031 1.15618 0.12805 1.23675 0.2852 1.14698 0.11172 pik3r2 Dr.76491 -1.07717 0.37662 -1.20276 0.01462 1.21431 0.26132 -1.56331 0.02491 pik3r1 Dr.77293 1.04933 0.67153 -1.13597 0.07887 -1.09005 0.34015 -1.42988 0.00024 nfkbiab Dr.77409 1.62337 1.36519E-11 1.13404 0.00118 2.00734 7.34426E-21 5.49966 0 atf3 Dr.77523 2.72083 0 1.22522 0.37479 7.88186 5.23099E-20 33.66506 0 irf5 Dr.7758 -1.01363 0.85297 1.09915 0.04152 1.12821 0.17761 1.12189 0.03472 si:dkeyp-110c7.1 nfkbib Dr.78065 irak1 Dr.79642 ep300a Dr.79844 -1.18389 0.381 -1.03128 0.68277 -1.52397 0.02207 1.27521 0.05246 tollip Dr.79855 -1.18504 0.00015 1.01834 0.50377 1.00833 0.91722 1.2414 3.78025E-20 nfkbiaa Dr.79912 1.90493 3.66385E-08 1.17233 0.01738 7.66285 0.00051 8.67451 0 socs1 Dr.79974 1.62445 0.00005 1.349 0.01104 2.14612 3.32552E-19 2.27002 4.21012E-17 LOC559441 TRIAD3 like Dr.80082 -1.12592 0.2452 -1.1129 0.37533 -1.03925 0.66289 1.43947 0.01858 tak1 Dr.80386 1.17039 0.03023 -1.06455 0.19385 -1.13538 0.00057 -1.66617 7.11619E-15 si:ch211-199m3.9 atf6 Dr.80406 1.24891 0.6278 -1.56977 0.02855 1.01768 0.90232 1.33191 0.60873 zgc:91929 dusp2 Dr.81043 -1.08565 0.39055 1.17126 0.06097 1.3655 0.00013 4.97386 0 maf Dr.81288 -1.08395 0.27612 1.08188 0.3875 1.05101 0.81173 -1.28916 0.00395 wu:fj85b02 relb Dr.81541 1.63454 0.00018 -1.08279 0.60443 1.47688 0.00097 4.5104 8.48608E-17 traf3 Dr.81587 1.61339 3.72615E-06 1.20841 0.0394 1.49115 0.00429 3.2613 5.17062E-12 socs3b Dr.81607 2.49134 0 1.83205 2.0277E-23 3.98056 0 8.90033 0 mapk14b mapk14b (p38b) Dr.81640 1.17873 0.09272 1.18388 0.15036 -1.00216 0.98694 1.45797 3.31671E-07 irak4 Dr.81680 -1.11536 0.00325 1.03172 0.56711 1.09124 0.33639 2.84509 1.34666E-32 traf4a Dr.81750 1.13377 0.03353 -1.04576 0.295 -1.01072 0.92456 1.84849 8.92986E-35 tbk1 Dr.82024 -1.87275 0.31852 -2.00675 0.00084 1.17049 0.427 1.44248 0.21008 map3k7ip2 tab2 Dr.82175 -1.08964 0.28737 -1.05183 0.14131 -1.0953 0.15713 -1.08164 0.22738 ticam1 trif Dr.82215 -1.15069 0.0182 -1.05375 0.05519 1.00858 0.88204 1.53743 2.49156E-29 irf7 Dr.82280 1.16731 0.1404 1.07528 0.7361 1.98791 0.0093 4.8795 0.05816 tlr3 Dr.82491 -1.03273 0.62754 1.02226 0.6659 -1.14797 0.08415 -1.06873 0.08281 mapk8 mapk8 (JNK) Dr.82505 -1.06107 0.56311 -1.13664 0.04001 -1.29603 0.01361 1.08734 0.34212 map2k4 map2k4a Dr.82506 -1.03984 0.71425 -1.16594 0.09932 -1.23145 0.00013 1.34967 0.02115 map3k7ip3l tab3 Dr.82674 -1.57074 0.02025 -1.08098 0.33829 1.26751 0.04747 -1.3737 0.01089 rela Dr.84126 1.17009 0.51018 3.49677 0.00233 3.95209 5.84657E-09 2.28163 0.00701 il15 Dr.85620 -1.06443 0.0262 1.09327 0.05783 1.02619 0.75712 1.31372 2.94546E-06 sc:d148 SIGIRR like Dr.85895 -1.05366 0.51154 -1.25427 0.00191 -1.19368 0.00314 -1.45139 1.47311E-22 ifn1 ifn Dr.85981 1.03956 0.76057 2.54986 4.00267E-06 7.61326 1.19836E-29 36.10717 0 rel Dr.86023 1.88475 0 1.39305 1.47215E-13 2.25131 4.82017E-09 4.59284 0 map3k7ip1 tab1 Dr.86078 -1.10209 0.13346 -1.01908 0.68474 -1.12937 0.08651 2.08032 4.48302E-25 atf7a Dr.87401 -1.139 0.15833 -1.1559 0.15913 -1.26176 0.19451 1.75426 0.00881 tirap Dr.87438 -1.39774 0.0094 -1.02595 0.76286 -1.53301 0.00465 -1.0591 0.6092 zgc:194486 map2k4b Dr.88531 tlr5a Dr.89423 2.21851 1.37578E-23 2.07168 9.49867E-13 2.07697 1.35599E-14 4.49968 1.31249E-36 tlr4b Dr.89442 -1.11624 0.12907 1.0878 0.35583 -1.06925 0.32645 1.42651 0.16171 sarm1 Dr.89697 -1.02143 0.74511 1.10885 0.00267 -1.12581 9.56237E-06 -2.76289 2.8026E-45 tlr20a Dr.89701 -1.41088 0.00332 1.33599 0.02373 1.12411 0.41018 1.19616 0.07116 tlr18 Dr.89702 1.07446 0.61268 -1.5436 0.00003 -1.63234 1.28196E-26 -1.46244 1.13551E-12 tlr9 Dr.89703 -1.09006 0.51288 -1.08927 0.4747 -1.28794 0.16887 -1.15398 0.468 tlr8b Dr.89704 -1.69432 0.00003 -1.027 0.81752 -1.64512 0.00604 -1.10798 0.42687 tlr7 Dr.89705 1.04864 0.60747 -1.09394 0.31876 -1.07783 0.28794 1.15522 0.17246 tlr8a Dr.89705 1.04864 0.60747 -1.09394 0.31876 -1.07783 0.28794 1.15522 0.17246 tlr5b Dr.89707 2.18962 0 2.11568 3.23718E-12 2.20429 4.74724E-06 3.70717 0 tlr4a Dr.89708 1.00785 0.94343 1.05507 0.52893 -1.08367 0.5897 1.82382 0.00011 tlr1 Dr.89709 -1.37035 0.02064 -1.35946 2.00231E-08 -1.42097 0.00231 -1.01296 0.88357 tnfa Dr.89727 5.07738 2.74143E-09 3.44562 6.70849E-06 7.30244 0.00002 15.97348 5.28202E-07 zgc:153048 tank Dr.89901 irak3 Dr.90054 2.19764 0.00071 2.29213 0.00886 4.03355 0.00001 8.32927 0.00171 ifng1-2 Dr.90633 -1.17993 0.29645 1.02627 0.83303 -1.01183 0.91766 1.10232 0.10724 arrb1 Dr.91022 -1.05383 0.73885 -1.22117 0.1209 -1.22023 0.20937 -1.01159 0.94747 ikbke Dr.91202 -1.09544 0.77464 1.00417 0.98294 1.31879 0.14883 1.93829 0.00037 chemokine CXCL- il8 Dr.92011 1.26671 0.55691 1.62564 0.01342 4.18116 1.09249E-24 31.47287 0 C13d il17a/f2 Dr.92970 -1.23066 0.04138 1.07092 0.3749 -1.10003 0.4848 1.48251 0.06774 ep300b Dr.93038 -1.11943 0.58426 1.00529 0.97519 1.0386 0.86046 -1.08559 0.294 tnfb Dr.94015 2.66874 2.01872E-18 1.87294 0.00971 11.54441 0 35.90272 0 il26 Dr.94027 ifng1-1 Dr.94028 -1.3739 0.09801 1.61486 0.03627 1.03878 0.70193 -1.00437 0.9507 il22 Dr.94029 il17d Dr.94032 -1.25229 0.15702 -1.10802 0.37958 -1.16637 0.24923 -1.33374 0.03112 il17a/f1 Dr.94033 il34 Dr.94073 -1.85834 0.00642 1.63458 0.08716 -1.00749 0.96328 6.24459 3.60815E-09 fadd Dr.94478 2 hpi: S. typhimurium Ra vs. 5 hpi: S. typhimurium Ra vs. 8 hpi: S. typhimurium Ra vs. 24 hpi: S. typhimurium Ra vs. control control control control GenMapp UniGene Fold Gene Symbol Fold Change P-value Fold Change P-value Fold Change P-value P-value Name Code Change ikbkb Dr.101105 1.32996 0.00056 -1.09498 0.08547 -1.10702 0.19853 -1.00433 0.94186 casp8 Dr.10334 1.01018 0.92194 1.08196 0.48934 1.24856 0.14569 1.25972 0.00798 ripk1l Dr.103967 -1.03237 0.76788 1.02603 0.77341 -1.11987 0.27737 -1.00215 0.98116 mapk1 Dr.10452 1.15908 0.01796 -1.2488 1.78306E-09 -1.28683 6.72895E-10 -1.00078 0.98587 zgc:171702 atf4 Dr.104781 1.07815 0.26298 1.21027 0.07011 1.10168 0.49384 -1.00859 0.90452 ecsit Dr.105286 1.42988 0.09755 -1.16703 0.11392 -1.46881 3.60104E-15 -1.23612 0.10704 jun Dr.1064 1.32183 6.70963E-19 -1.1258 0.00088 -1.0027 0.94671 1.1595 0.1409 map2k1 Dr.107100 -1.02989 0.72757 1.08078 0.05192 1.20641 0.02273 1.05934 0.13495 atf2l Dr.108551 defbl1 Dr.113373 2.73127 0.04971 1.23129 0.60722 1.05769 0.89485 1.00356 0.99287 ptgs2a cox2a Dr.113864 1.21574 0.2313 1.0786 0.60889 1.14164 0.51877 1.61492 0.00058 mapk3 Dr.114298 -1.32789 0.16623 1.25028 0.44736 2.58345 0.00645 1.32479 0.07614 ube2nl Dr.114603 -1.01097 0.89345 -1.08893 0.12951 -1.16352 0.06035 -1.06557 0.08679 si:dkey-127j5.5 atf5 Dr.114932 -1.08444 0.6353 -1.015 0.90545 1.06793 0.47918 1.36905 0.00819 atf7b Dr.115347 1.05705 0.76528 1.45128 0.06148 1.17185 0.3691 1.18898 0.33205 LOC561737 pik3ca Dr.117016 -1.03723 0.40454 1.04117 0.27135 -1.04699 0.49292 -1.07639 0.13568 LOC564854 irf3 Dr.117120 1.06012 0.71785 1.04777 0.70431 -1.05323 0.63365 1.57673 0.01422 LOC563727 tpl2 Dr.117254 1.31441 0.09317 -1.04345 0.67609 -1.20751 0.14497 1.17489 0.18949 map2k6 Dr.117346 1.26941 0.00011 -1.10448 0.02793 -1.16024 0.00112 -1.05815 0.27615 nfkb2 Dr.117553 2.28081 1.07453E-06 -1.03989 0.42383 1.05103 0.35969 1.31718 7.26526E-06 tlr21 Dr.118435 1.23415 0.14699 -1.47764 0.01574 -1.26082 0.22118 -1.57989 0.0212 tlr19 Dr.118544 -1.00629 0.95539 -1.03175 0.60699 1.10198 0.07381 -1.43198 8.55165E-11 maf Dr.120867 -1.14987 0.1309 1.00768 0.93486 -1.14343 0.00643 -1.15585 0.20002 zgc:158276 nfkbie Dr.121145 fos Dr.12986 1.6481 3.81972E-23 -1.39115 0.00006 1.79453 3.7247E-08 2.02471 0.02527 zgc:123326 ube2v1 Dr.132817 -1.06753 0.37692 -1.0774 0.19212 -1.23057 0.00224 1.00183 0.97763 myd88 Dr.134592 1.14085 0.0184 1.03003 0.55044 -1.02606 0.80279 1.12806 0.00671 traf1 Dr.134981 1.06013 0.43389 1.0765 0.28451 -1.02114 0.75532 1.34797 0.00023 zgc:152789 il12b Dr.135198 -1.04321 0.77092 1.01559 0.91729 1.0213 0.82472 1.03817 0.81066 il12a Dr.135199 1.33779 0.00589 -1.70965 8.70234E-10 1.08952 0.25339 1.65687 0.00005 il17c Dr.135566 1.79411 5.76901E-07 1.0335 0.65321 1.03065 0.67718 1.4495 0.00484 il10 Dr.135567 3.58995 0.00228 2.41884 3.95489E-17 3.51325 5.20774E-10 1.50002 0.00711 chuk ikka Dr.14012 1.0591 0.51948 -1.03792 0.58258 -1.06932 0.51582 -1.07065 0.21163 traf4b Dr.15893 -1.21649 0.06034 1.03263 0.65858 1.17041 0.43051 1.14919 0.08039 tnip1 tnfaip3 Dr.16192 1.21151 0.2466 1.00021 0.99748 -1.12589 0.26983 1.08811 0.39969 zgc:77033 pik3cg Dr.23613 1.12635 0.19106 1.35033 0.00001 1.68755 0.00001 1.11287 0.15845 dusp1 Dr.2413 -1.01448 0.90735 -1.17157 0.00759 -1.032 0.60425 1.24504 0.03848 zgc:76869 nap1 Dr.29829 tlr2 Dr.30180 1.2031 0.1307 -1.10078 0.24707 -1.0889 0.37309 1.06054 0.52239 tlr22 Dr.30190 1.04661 0.67337 -1.02621 0.85126 -1.06773 0.67901 1.03312 0.78254 tlr20f Dr.30196 -1.24067 0.09854 1.46663 0.00858 -1.08456 0.26525 1.14217 0.59811 il1b pro - il1b Dr.30443 6.30935 0 -1.61242 5.26176E-17 2.5813 1.50833E-14 8.45729 0 il15l Dr.37800 -1.61133 6.32463E-10 -1.0342 0.63706 -1.05471 0.43418 -1.00768 0.83761 rac1a Dr.4711 1.09581 0.06801 1.01557 0.77764 1.00351 0.95778 1.00705 0.85038 nfkb1 Dr.47468 1.35113 0.10699 -1.02773 0.80635 1.14408 0.43177 1.08035 0.54759 ptgs2b cox2b Dr.48719 -1.19826 0.51979 -1.05669 0.48899 -1.35488 0.29043 2.22801 0.01226 socs3a Dr.6431 2.91123 0 1.37366 0.00006 3.58077 6.18476E-21 3.67807 1.48266E-36 ikbkg Dr.69759 1.17475 0.07481 1.03227 0.56045 1.1308 0.03821 1.05758 0.47732 crebbpa Dr.69932 mapk14a mapk14a (p38a) Dr.72252 1.09575 0.30679 -1.109 0.20034 1.01098 0.77299 1.12568 0.02176 traf6 Dr.74618 1.07527 0.4321 1.10669 0.02066 1.00842 0.88467 1.16865 0.06266 atf1 Dr.75537 1.0406 0.559 -1.11992 0.05319 -1.00261 0.97104 1.03722 0.50654 crebbpb Dr.76145 1.08015 0.43948 1.13873 0.31618 -1.20496 0.08951 -1.02621 0.75003 caspa Dr.76374 -1.1232 0.31715 1.21523 0.02108 1.23939 0.27156 1.04105 0.54987 pik3r2 Dr.76491 -1.43453 0.00008 1.00692 0.96952 1.49596 0.23231 1.32498 0.13995 pik3r1 Dr.77293 -1.06416 0.71596 -1.07942 0.26049 -1.22357 0.00131 -1.11834 0.15696 nfkbiab Dr.77409 2.11649 7.95797E-27 1.12125 6.16979E-07 1.26218 0.00006 1.46372 3.30042E-23 atf3 Dr.77523 2.1341 4.45763E-20 1.46107 2.85457E-06 2.50129 0.00002 2.72001 4.97467E-21 irf5 Dr.7758 -1.00541 0.94014 1.02658 0.51656 1.04406 0.62877 1.04699 0.62402 si:dkeyp-110c7.1 nfkbib Dr.78065 irak1 Dr.79642 ep300a Dr.79844 1.17174 0.52141 -1.00032 0.99825 -1.26296 0.01492 1.10225 0.31561 tollip Dr.79855 -1.08631 0.2008 1.04871 0.0595 1.00044 0.99507 1.03275 0.17408 nfkbiaa Dr.79912 2.44553 0.0053 1.17855 0.02347 1.75663 0.0386 2.11931 0.00005 socs1 Dr.79974 1.33984 0.00051 1.1186 0.23049 1.18385 0.00847 1.45112 0.00183 LOC559441 TRIAD3 like Dr.80082 1.05024 0.63146 -1.18527 0.17063 -1.29847 0.0286 -1.05232 0.77565 tak1 Dr.80386 1.17914 0.00142 -1.05917 0.22851 -1.16766 0.00706 -1.09317 0.08575 si:ch211-199m3.9 atf6 Dr.80406 1.26815 0.62302 -1.4014 0.50699 -1.09216 0.74136 1.91145 0.24304 zgc:91929 dusp2 Dr.81043 -1.03016 0.76685 -1.05614 0.39286 -1.26915 0.00061 1.20601 0.02229 maf Dr.81288 -1.18755 0.3015 1.04675 0.52375 1.05296 0.76325 -1.01097 0.92929 wu:fj85b02 relb Dr.81541 2.65971 3.48834E-07 -1.19262 0.05939 1.11079 0.37486 1.3608 0.0862 traf3 Dr.81587 1.99063 1.78764E-15 1.01711 0.69104 1.04301 0.51019 1.16448 0.00598 socs3b Dr.81607 2.19332 5.93891E-37 1.22816 0.00519 1.69905 1.48759E-17 2.08835 1.50433E-22 mapk14b mapk14b (p38b) Dr.81640 1.08416 0.55898 1.08758 0.45267 -1.15514 0.2168 -1.10754 0.44273 irak4 Dr.81680 -1.04477 0.51688 1.02996 0.45468 -1.02966 0.78441 1.14555 0.00043 traf4a Dr.81750 -1.00549 0.959 -1.04363 0.47646 1.06474 0.57705 -1.07828 0.13161 tbk1 Dr.82024 1.0577 0.88819 2.16989 0.01777 1.42483 0.05786 1.42705 0.11941 map3k7ip2 tab2 Dr.82175 1.02087 0.76191 -1.02793 0.23173 -1.10989 0.06092 -1.03753 0.38399 ticam1 trif Dr.82215 -1.15979 3.58029E-06 -1.12322 6.31222E-06 -1.17419 0.01849 -1.02141 0.7214 irf7 Dr.82280 1.21426 0.00124 1.0133 0.77073 -1.04802 0.68592 1.36473 0.15279 tlr3 Dr.82491 1.07739 0.43643 1.1021 0.00786 -1.05548 0.3819 -1.00927 0.82708 mapk8 mapk8 (JNK) Dr.82505 1.03793 0.79609 -1.02978 0.63614 -1.14586 0.09991 -1.11515 0.0524 map2k4 map2k4a Dr.82506 1.04864 0.55763 -1.05416 0.34014 -1.15986 0.02832 -1.06442 0.45854 map3k7ip3l tab3 Dr.82674 -1.14118 0.50069 1.0089 0.91459 1.12161 0.25486 1.05761 0.65016 rela Dr.84126 -2.06625 0.1349 3.63127 0.00193 1.63443 0.23647 -1.45036 0.3569 il15 Dr.85620 -1.18492 0.15419 1.07145 0.2327 1.08935 0.18135 1.09832 0.00022 sc:d148 SIGIRR like Dr.85895 -1.15973 0.09493 1.11575 0.02706 -1.02341 0.55417 -1.05149 0.35975 ifn1 ifn Dr.85981 -1.14894 0.34629 1.31156 0.01295 1.26606 0.033 5.20402 1.80323E-19 rel Dr.86023 2.50709 4.39523E-23 1.07273 0.09175 1.1701 0.13605 1.39219 4.73197E-26 map3k7ip1 tab1 Dr.86078 -1.10044 0.25538 -1.04731 0.32739 -1.31349 0.01872 1.02593 0.52503 atf7a Dr.87401 1.07086 0.40371 -1.00635 0.92466 -1.14433 0.4117 -1.08819 0.30218 tirap Dr.87438 -1.49406 0.01481 1.19472 0.09475 1.05991 0.40662 1.09417 0.31039 zgc:194486 map2k4b Dr.88531 tlr5a Dr.89423 2.34157 2.69888E-10 1.60139 0.00002 1.5642 1.98998E-09 1.37602 0.00377 tlr4b Dr.89442 -1.06232 0.58937 1.07862 0.55473 -1.05769 0.33346 1.12294 0.18502 sarm1 Dr.89697 1.03382 0.7161 1.05509 0.39985 -1.11636 0.04496 -1.22683 0.00209 tlr20a Dr.89701 -1.33023 0.03699 1.56533 0.00095 -1.06944 0.42454 1.80438 0.00203 tlr18 Dr.89702 -1.14681 0.25679 -1.18249 0.04736 -1.128 0.05046 -1.39357 0.00188 tlr9 Dr.89703 -1.07884 0.67899 -1.01767 0.85603 -1.12603 0.49006 -1.18426 0.21494 tlr8b Dr.89704 -1.15166 0.13654 -1.10298 0.15455 -1.45266 0.02338 -1.07913 0.54595 tlr7 Dr.89705 1.13144 0.37393 -1.03602 0.62247 -1.12451 0.08603 1.1079 0.32274 tlr8a Dr.89705 1.13144 0.37393 -1.03602 0.62247 -1.12451 0.08603 1.1079 0.32274 tlr5b Dr.89707 2.3163 2.58385E-41 1.63931 2.90251E-13 1.80769 9.57148E-06 1.36974 4.03916E-06 tlr4a Dr.89708 1.12341 0.10259 1.0099 0.91829 -1.20028 0.30252 1.02262 0.8671 tlr1 Dr.89709 1.31924 0.00038 -1.06068 0.09372 -1.16841 0.13943 1.07053 0.49331 tnfa Dr.89727 6.37206 3.8466E-12 1.61363 0.00261 1.90246 0.02645 4.03899 0.00001 zgc:153048 tank Dr.89901 irak3 Dr.90054 2.18217 0.00143 1.35376 0.03159 2.47116 0.00001 2.44697 0.00948 ifng1-2 Dr.90633 -1.26923 0.24241 1.02913 0.77795 1.07917 0.55925 1.08489 0.25629 arrb1 Dr.91022 1.07409 0.59441 -1.21775 0.23813 -1.3101 0.00002 1.03608 0.66338 ikbke Dr.91202 1.09892 0.78915 1.07115 0.84357 1.01179 0.95715 -1.12602 0.63017 chemokine CXCL- C13d il8 Dr.92011 1.15386 0.78278 1.03351 0.4898 1.74276 1.07485E-07 3.333 1.56109E-13 il17a/f2 Dr.92970 -1.07108 0.55558 1.06995 0.3647 -1.07449 0.51033 1.28686 0.10826 ep300b Dr.93038 -1.20529 0.49245 1.02005 0.72221 1.10584 0.52161 -1.13635 0.20928 tnfb Dr.94015 2.6438 8.32786E-27 1.02724 0.63033 2.12886 1.14245E-18 5.55431 0 il26 Dr.94027 ifng1-1 Dr.94028 -1.30794 0.37539 1.36677 0.12403 -1.15084 0.1631 1.16429 0.46903 il22 Dr.94029 il17d Dr.94032 -1.17347 0.31877 1.02368 0.79066 -1.04916 0.67687 -1.04095 0.62155 il17a/f1 Dr.94033 il34 Dr.94073 -1.60118 0.04354 1.23159 0.26025 -1.18851 0.24662 1.39382 0.01399 fadd Dr.94478
* Gene list of the Toll-like receptor pathway analysis by GenMapp. Genes are indicated by their gene symbol. If a different name was used in the GenMapp figure (Fig. 6 and supplementary Fig. 2) the name is indicated in the GenMapp Name column. Genes lacking expression values were not present on the micro array platform used in this study. Supplementary Table V. 2D Hierarchical Cluster gene list
# (Sub) Cluster Gene Symbol Description UniGene Code Entrez GeneID 2 hpi: S. typhimurium Ra vs. control 2 hpi: S. typhimurium wt vs. control 5 hpi: S. typhimurium Ra vs. control 5 hpi: S. typhimurium wt vs. control 8 hpi: S. typhimurium Ra vs. control 8 hpi: S. typhimurium wt vs. control Fold Fold Fold Fold (build#105) Ratio Fold Change P-Value Ratio P-Value Ratio P-Value Ratio P-Value Ratio Fold Change P-Value Ratio P-Value Change Change Change Change 1 1 wu:fk86g11 Wu:fk86g11 Dr.10031 335194 1.335 1.335 1.28E-02 0.916 -1.091 5.28E-01 0.702 -1.425 2.87E-02 0.653 -1.531 5.75E-06 0.706 -1.416 9.80E-04 0.523 -1.912 5.00E-05 Insulin-like growth factor 2 1 LOC793907 Dr.16095 793907 1.432 1.432 7.80E-04 0.967 -1.034 8.65E-01 0.746 -1.341 6.65E-02 0.633 -1.580 2.00E-03 0.762 -1.313 1.69E-01 0.444 -2.255 1.53E-27 binding protein-1b 3 1 wu:fj60h04 Wu:fj60h04 Dr.107128 336273 1.461 1.461 3.19E-02 0.738 -1.355 8.05E-02 0.752 -1.329 4.62E-02 0.713 -1.403 1.63E-02 0.713 -1.403 6.82E-02 0.514 -1.946 4.63E-06 4 1 mt Metallothionein Dr.20068 30282 1.284 1.284 4.23E-03 0.772 -1.296 1.08E-01 0.750 -1.333 2.49E-03 0.745 -1.342 1.83E-03 0.724 -1.381 4.20E-04 0.546 -1.832 9.22E-08 5 1 Dr.122669 Transcribed locus Dr.122669 1.633 1.633 6.00E-05 0.833 -1.201 1.53E-01 0.795 -1.257 1.92E-01 0.641 -1.559 1.27E-07 0.669 -1.495 2.04E-02 0.433 -2.311 9.80E-14 6 1 zgc:123047 Zgc:123047 Dr.20771 553283 1.740 1.740 7.00E-05 0.785 -1.274 7.96E-02 0.786 -1.271 1.16E-01 0.694 -1.440 5.27E-09 0.661 -1.513 5.74E-03 0.434 -2.305 1.48E-14 7 1 wu:fb59d03 Wu:fb59d03 Dr.77126 322381 1.348 1.348 1.55E-03 0.833 -1.201 5.92E-02 0.874 -1.144 3.12E-03 0.819 -1.221 2.78E-02 0.770 -1.299 5.72E-03 0.547 -1.827 2.93E-09 8 1 Dr.84423 Transcribed locus Dr.84423 1.374 1.374 1.37E-02 0.813 -1.231 1.93E-01 0.855 -1.169 3.15E-01 0.754 -1.327 5.00E-03 0.688 -1.454 3.31E-02 0.583 -1.715 3.79E-09 9 1 im:6901964 Im:6901964 Dr.40830 552973 1.184 1.184 1.01E-01 0.867 -1.153 4.77E-02 0.853 -1.173 3.03E-01 0.757 -1.320 3.73E-03 0.737 -1.356 4.50E-02 0.606 -1.650 8.38E-13 Hypothetical protein 10 1 LOC100003605 Dr.87657 100003605 1.193 1.193 1.42E-01 0.931 -1.074 5.33E-01 0.874 -1.144 3.72E-01 0.779 -1.283 6.71E-02 0.812 -1.232 9.06E-02 0.657 -1.521 1.49E-07 LOC100003605 11 1 zgc:123304 Zgc:123304 Dr.79607 556136 1.227 1.227 2.44E-01 0.841 -1.189 2.95E-01 0.883 -1.133 2.19E-01 0.752 -1.329 3.22E-03 0.819 -1.221 1.64E-01 0.602 -1.660 2.00E-05 12 1 mtnr1c Melatonin receptor 1C Dr.88563 30661 1.289 1.289 6.76E-02 0.867 -1.154 2.33E-01 0.839 -1.192 1.95E-01 0.744 -1.345 5.90E-03 0.797 -1.255 2.40E-01 0.540 -1.851 4.84E-10 13 1 tbl2 Transducin (beta)-like 2 Dr.116733 337068 1.298 1.298 1.15E-01 0.898 -1.114 3.40E-01 0.921 -1.086 5.67E-01 0.877 -1.140 3.00E-01 0.668 -1.498 1.00E-05 0.538 -1.859 1.13E-12 Similar to AW554918 14 1 LOC563289 Dr.7346 563289 1.339 1.339 1.20E-04 0.920 -1.087 5.21E-01 0.852 -1.173 3.01E-01 0.813 -1.230 2.89E-02 0.679 -1.473 5.02E-03 0.581 -1.721 2.35E-08 protein 15 1 zgc:154079 Zgc:154079 Dr.82865 777750 1.270 1.270 1.26E-01 0.966 -1.035 8.19E-01 0.892 -1.122 2.83E-01 0.844 -1.185 1.03E-01 0.762 -1.313 6.82E-02 0.643 -1.554 2.48E-07 Similar to chromosome 6 16 1 LOC562251 Dr.83183 562251 1.176 1.176 2.50E-01 0.974 -1.027 8.49E-01 0.889 -1.125 2.30E-01 0.883 -1.133 2.10E-01 0.785 -1.273 7.91E-02 0.645 -1.550 1.00E-05 open reading frame 84 17 1 Dr.84380 Transcribed locus Dr.84380 1.255 1.255 9.98E-02 0.937 -1.067 7.47E-01 0.847 -1.180 3.12E-01 0.759 -1.318 1.74E-02 0.688 -1.453 2.79E-02 0.487 -2.055 6.61E-12 18 1 zgc:63546 Zgc:63546 Dr.82416 790959 1.138 1.138 3.96E-01 0.892 -1.121 4.19E-01 0.784 -1.276 5.53E-02 0.767 -1.304 8.02E-02 0.696 -1.436 9.00E-04 0.561 -1.782 6.00E-05 19 1 Dr.86075 Transcribed locus Dr.86075 1.226 1.226 2.06E-02 0.963 -1.038 8.50E-01 0.801 -1.249 1.38E-01 0.845 -1.184 2.19E-01 0.771 -1.297 1.40E-02 0.650 -1.538 2.59E-13 Similar to Si:dkey-2n12.1 20 1 LOC795015 Dr.114986 795015 1.492 1.492 5.84E-06 1.042 1.042 6.48E-01 0.823 -1.216 1.78E-01 0.717 -1.395 1.49E-03 0.683 -1.464 1.89E-03 0.554 -1.806 3.94E-06 protein 21 1 zgc:158782 Zgc:158782 Dr.117229 100009640 1.646 1.646 1.20E-02 1.013 1.013 9.01E-01 0.857 -1.167 1.44E-01 0.710 -1.409 5.41E-02 0.670 -1.493 1.34E-03 0.491 -2.036 6.63E-08 22 1 wu:fc19f02 Wu:fc19f02 Dr.22472 324127 1.311 1.311 8.67E-02 0.959 -1.042 7.45E-01 0.915 -1.093 3.70E-01 0.741 -1.349 1.72E-03 0.760 -1.317 1.30E-04 0.591 -1.692 2.40E-20 23 1 zgc:153351 Zgc:153351 Dr.81133 768153 1.505 1.505 1.53E-03 0.903 -1.108 1.50E-01 0.879 -1.138 9.67E-02 0.746 -1.340 2.97E-03 0.695 -1.438 1.30E-04 0.593 -1.687 5.23E-09 24 1 wu:fb40f06 Wu:fb40f06 Dr.27293 322002 1.362 1.362 8.14E-02 1.054 1.054 8.20E-01 0.873 -1.145 4.99E-01 0.825 -1.211 1.99E-01 0.785 -1.274 1.79E-01 0.537 -1.862 2.73E-10 Similar to C-type natriuretic 25 1 LOC567953 Dr.39424 567953 1.695 1.695 7.00E-05 0.997 -1.003 9.87E-01 0.887 -1.127 4.00E-01 0.735 -1.361 4.30E-02 0.788 -1.268 2.00E-01 0.463 -2.159 2.20E-04 peptide 3 26 1 wu:fc21a03 Wu:fc21a03 Dr.106313 324170 1.132 1.132 3.08E-01 0.843 -1.186 1.08E-01 0.863 -1.159 3.21E-01 0.916 -1.091 1.27E-01 0.722 -1.385 3.00E-05 0.604 -1.655 5.97E-14 27 1 ruvbl2 RuvB-like 2 (E. coli) Dr.35479 333992 1.158 1.158 1.12E-01 0.856 -1.168 3.09E-01 0.786 -1.272 1.52E-03 0.845 -1.183 3.12E-02 0.693 -1.444 5.80E-20 0.558 -1.793 1.54E-19 28 1 im:7145273 Im:7145273 Dr.133223 492655 1.117 1.117 3.83E-01 0.794 -1.259 1.11E-01 0.783 -1.277 1.77E-01 0.867 -1.154 2.71E-01 0.743 -1.346 7.02E-02 0.603 -1.658 1.00E-05 29 1 si:ch211-201b11.2 Si:ch211-201b11.2 Dr.35714 565458 1.162 1.162 2.77E-01 0.823 -1.215 3.98E-02 0.731 -1.369 6.00E-04 0.908 -1.101 4.35E-01 0.681 -1.469 1.35E-03 0.602 -1.661 6.89E-12 Hypothetical protein 30 1 LOC100003370 Dr.132943 100003370 1.254 1.254 8.32E-02 0.820 -1.220 9.24E-02 0.839 -1.192 2.02E-01 0.926 -1.080 4.25E-01 0.787 -1.271 2.86E-03 0.536 -1.864 1.55E-13 LOC100003370 Zona pellucida 31 1 zp3.2 Dr.132632 574007 1.282 1.282 2.42E-01 0.706 -1.417 9.13E-02 0.894 -1.119 5.89E-01 0.945 -1.059 7.93E-01 0.519 -1.927 5.20E-04 0.494 -2.023 8.63E-11 glycoprotein 3.2 32 1 LOC566198 Hypothetical LOC566198 Dr.34220 566198 1.168 1.168 1.79E-01 0.874 -1.145 5.78E-01 0.929 -1.076 5.77E-01 0.923 -1.084 5.69E-01 0.657 -1.522 3.00E-05 0.619 -1.616 4.82E-02 33 1 zgc:158455 Zgc:158455 Dr.78061 790928 1.215 1.215 5.29E-02 0.736 -1.359 5.10E-04 0.842 -1.187 9.69E-02 0.857 -1.167 1.63E-01 0.645 -1.551 3.00E-05 0.630 -1.587 2.30E-04 Similar to MGC130935 34 1 LOC797836 Dr.6283 797836 1.135 1.135 4.86E-01 0.759 -1.317 8.66E-02 0.936 -1.068 6.21E-01 0.936 -1.069 4.89E-01 0.777 -1.287 5.72E-02 0.642 -1.558 1.59E-09 protein
Similar to NOL1/NOP2/Sun 35 1 LOC100003762 Dr.84872 100003762 1.189 1.189 2.86E-01 0.725 -1.380 3.89E-02 0.920 -1.087 5.11E-01 0.887 -1.127 3.17E-01 0.689 -1.451 2.30E-03 0.501 -1.996 2.98E-14 domain family, member 7
Methyl CpG binding protein 36 1 mecp2 Dr.82151 335250 1.368 1.368 3.18E-02 0.704 -1.420 2.61E-02 0.924 -1.082 6.36E-01 0.950 -1.053 8.28E-01 0.636 -1.573 2.81E-03 0.536 -1.866 1.03E-14 2 Polymerase (RNA) I 37 1 polr1a Dr.101226 327078 1.524 1.524 1.80E-04 1.107 1.107 2.07E-01 0.935 -1.069 2.52E-01 0.750 -1.333 1.00E-05 0.569 -1.758 2.50E-15 0.535 -1.869 7.95E-20 polypeptide A Similar to LOC559853 38 1 LOC100007887 Dr.113957 100007887 1.476 1.476 1.70E-01 1.039 1.039 8.93E-01 0.821 -1.218 3.95E-01 0.843 -1.187 4.61E-01 0.633 -1.580 5.28E-03 0.569 -1.757 1.32E-11 protein
Transcribed locus, weakly similar to XP_001112288.1 39 1 Dr.121588 similar to actin-related Dr.121588 2.047 2.047 3.04E-03 1.186 1.186 3.91E-01 0.722 -1.384 2.60E-04 0.641 -1.559 4.20E-04 0.424 -2.361 5.71E-27 0.353 -2.831 2.48E-40 protein M2 isoform 2 [Macaca mulatta]
Transcribed locus, weakly similar to NP_066962.1 40 1 Dr.42665 glycosyltransferase 2 Dr.42665 1.294 1.294 2.03E-01 1.043 1.043 8.02E-01 0.864 -1.158 3.45E-01 0.835 -1.198 2.21E-01 0.743 -1.346 2.80E-03 0.660 -1.515 2.43E-07 family, polypeptide B4 [Homo sapiens]
41 1 LOC796842 Similar to Cpb1 protein Dr.120514 796842 1.295 1.295 9.00E-05 1.051 1.051 4.44E-01 0.871 -1.148 3.54E-03 0.828 -1.208 1.53E-06 0.657 -1.523 5.41E-07 0.657 -1.522 1.08E-10 42 1 zgc:154077 Zgc:154077 Dr.52561 777745 1.464 1.464 2.71E-03 1.083 1.083 5.21E-01 0.818 -1.222 1.81E-01 0.798 -1.253 2.33E-02 0.698 -1.433 4.90E-04 0.660 -1.514 5.00E-05 Hypothetical protein 43 1 LOC793374 Dr.86757 793374 2.096 2.096 2.38E-03 1.119 1.119 3.86E-01 0.645 -1.549 7.12E-03 0.715 -1.399 4.08E-02 0.517 -1.935 4.00E-05 0.438 -2.285 1.17E-06 LOC793374 Vascular endothelial zinc 44 1 vezf1 Dr.103946 556915 1.294 1.294 1.66E-01 1.229 1.229 3.15E-01 0.761 -1.314 4.57E-02 0.762 -1.312 3.33E-02 0.552 -1.813 6.94E-10 0.579 -1.727 1.06E-14 finger 1 Transcribed locus, strongly similar to XP_001087479.1 45 1 Dr.132723 similar to RNA binding Dr.132723 1.185 1.185 2.61E-01 1.140 1.140 3.90E-01 0.778 -1.285 1.25E-01 0.801 -1.248 1.01E-01 0.661 -1.513 9.00E-05 0.701 -1.427 2.20E-04 motif protein 25 isoform 3 [Macaca mulatta]
Structural maintenance of 46 1 smc4 Dr.77769 192332 1.259 1.259 2.03E-01 1.083 1.083 6.60E-01 0.825 -1.212 2.65E-03 0.844 -1.184 5.40E-02 0.688 -1.453 3.90E-04 0.634 -1.578 7.00E-05 chromosomes 4 MAD homolog 2 47 1 smad2 Dr.79140 30639 1.193 1.193 3.48E-02 1.104 1.104 1.35E-01 0.829 -1.207 4.05E-06 0.852 -1.174 6.80E-04 0.717 -1.394 5.92E-13 0.632 -1.582 9.23E-13 (Drosophila) 48 1 si:ch211-192k9.1 Si:ch211-192k9.1 Dr.91260 445293 1.390 1.390 1.22E-03 1.155 1.155 5.29E-02 0.705 -1.419 6.89E-06 0.809 -1.235 2.83E-02 0.651 -1.536 5.00E-05 0.608 -1.646 1.09E-08 49 1 wu:fb93c02 Wu:fb93c02 Dr.121775 323247 1.432 1.432 2.88E-03 1.260 1.260 8.74E-02 0.843 -1.186 1.84E-01 0.735 -1.360 2.99E-03 0.724 -1.381 2.42E-03 0.612 -1.634 1.07E-11 50 1 LOC569014 Hypothetical LOC569014 Dr.89018 569014 1.373 1.373 6.97E-02 1.269 1.269 1.44E-01 0.834 -1.199 1.97E-01 0.747 -1.340 6.34E-03 0.724 -1.382 4.20E-04 0.646 -1.548 1.00E-04 51 1 zgc:110112 Zgc:110112 Dr.76556 550237 1.585 1.585 9.71E-02 1.253 1.253 4.33E-01 0.792 -1.262 1.93E-01 0.789 -1.267 4.96E-02 0.696 -1.438 6.50E-03 0.488 -2.048 2.87E-10 52 1 LOC571747 Similar to beta2-syntrophin Dr.84005 571747 1.675 1.675 6.52E-10 1.236 1.236 5.55E-02 0.802 -1.247 4.48E-02 0.791 -1.264 3.00E-05 0.626 -1.597 2.74E-23 0.470 -2.128 2.80E-45
Glycine C- 53 1 gcat Dr.79486 402822 1.333 1.333 2.09E-02 1.195 1.195 1.43E-01 0.909 -1.100 1.55E-03 0.824 -1.214 1.05E-09 0.739 -1.353 2.49E-22 0.636 -1.572 1.39E-15 acetyltransferase Hypothetical protein 54 1 LOC553343 Dr.78682 553343 1.511 1.511 1.03E-01 1.384 1.384 1.80E-01 0.781 -1.280 1.27E-01 0.877 -1.141 3.88E-01 0.626 -1.596 4.10E-04 0.577 -1.733 6.06E-10 LOC553343 55 1 si:ch211-238c15.1 Si:ch211-238c15.1 Dr.87397 560115 1.548 1.548 9.23E-02 1.307 1.307 3.06E-01 0.747 -1.338 8.96E-02 0.784 -1.275 1.94E-02 0.610 -1.639 5.70E-04 0.523 -1.911 5.66E-10 Catenin (cadherin- 56 1 ctnna2 associated protein), alpha Dr.86260 553258 1.250 1.250 6.31E-02 1.375 1.375 1.02E-02 0.879 -1.137 1.67E-01 0.873 -1.146 3.12E-01 0.752 -1.329 6.00E-04 0.602 -1.660 3.45E-22 2 57 1 zgc:55418 Zgc:55418 Dr.14064 334109 1.165 1.165 9.33E-02 1.082 1.082 2.80E-01 0.917 -1.091 2.75E-01 0.775 -1.290 1.26E-02 0.825 -1.212 1.48E-03 0.653 -1.531 4.98E-07 58 1 si:ch211-103f16.4 Si:ch211-103f16.4 Dr.78329 541445 1.177 1.177 2.06E-02 1.070 1.070 2.10E-01 0.794 -1.259 9.02E-09 0.739 -1.353 1.84E-13 0.708 -1.412 1.13E-17 0.570 -1.753 1.79E-13 59 1 si:dkey-9a20.6 Si:dkey-9a20.6 Dr.82226 335251 1.264 1.264 1.25E-02 1.175 1.175 1.52E-01 0.791 -1.264 5.87E-02 0.728 -1.373 5.11E-03 0.674 -1.484 1.85E-06 0.591 -1.692 9.00E-05 Transmembrane protein 60 1 tmem161a Dr.86254 492692 1.216 1.216 9.96E-02 1.117 1.117 3.89E-01 0.897 -1.115 1.08E-01 0.758 -1.319 1.13E-03 0.723 -1.383 2.00E-04 0.662 -1.510 7.00E-05 161A 61 1 zgc:110712 Zgc:110712 Dr.33453 550250 1.155 1.155 1.57E-01 1.156 1.156 5.42E-02 0.874 -1.144 3.71E-03 0.622 -1.608 1.46E-14 0.758 -1.320 6.00E-05 0.642 -1.557 2.28E-08 62 1 LOC572121 Similar to XL-INCENP Dr.104887 572121 1.106 1.106 5.20E-01 1.107 1.107 5.44E-01 0.783 -1.277 3.06E-02 0.767 -1.304 1.40E-02 0.586 -1.706 1.25E-15 0.548 -1.823 2.47E-20 63 1 Dr.123864 Transcribed locus Dr.123864 1.152 1.152 4.50E-01 1.113 1.113 4.98E-01 0.793 -1.260 5.98E-02 0.789 -1.268 4.19E-02 0.659 -1.518 1.43E-03 0.631 -1.584 3.52E-06 Neurological oncogenic 64 1 nova1a Dr.77006 553201 1.089 1.089 7.14E-01 1.145 1.145 4.94E-01 0.824 -1.214 1.03E-01 0.773 -1.294 4.69E-02 0.675 -1.482 8.75E-13 0.640 -1.562 7.00E-05 ventral antigen protein 65 1 LOC569516 Hypothetical LOC569516 Dr.114366 569516 1.134 1.134 3.44E-01 1.047 1.047 7.78E-01 0.721 -1.386 9.72E-03 0.713 -1.402 2.14E-02 0.610 -1.640 1.20E-04 0.586 -1.707 3.00E-05 Actin, alpha 1, skeletal 66 1 acta1 Dr.75552 58114 1.051 1.051 5.73E-01 0.997 -1.003 9.83E-01 0.771 -1.296 2.83E-03 0.728 -1.374 9.23E-07 0.615 -1.626 1.48E-02 0.614 -1.630 2.86E-11 muscle 67 1 wu:fb13g09 Wu:fb13g09 Dr.76665 336563 1.088 1.088 2.30E-01 1.025 1.025 8.33E-01 0.808 -1.237 1.32E-01 0.760 -1.316 4.81E-02 0.629 -1.589 7.00E-05 0.615 -1.627 3.00E-05 Hypothetical protein 68 1 LOC797833 Dr.84249 797833 1.024 1.024 8.35E-01 1.012 1.012 9.49E-01 0.814 -1.228 9.72E-02 0.790 -1.266 1.84E-02 0.660 -1.516 2.01E-08 0.618 -1.618 5.00E-04 LOC797833 69 1 zgc:162166 Zgc:162166 Dr.80678 100005551 1.065 1.065 5.53E-01 1.013 1.013 8.83E-01 0.760 -1.316 2.70E-03 0.759 -1.317 4.49E-02 0.644 -1.553 3.60E-03 0.529 -1.890 1.00E-05 70 1 LOC569234 Hypothetical LOC569234 Dr.11568 569234 1.177 1.177 2.39E-01 0.972 -1.029 8.12E-01 0.753 -1.328 7.33E-02 0.827 -1.209 1.34E-01 0.708 -1.413 5.76E-03 0.661 -1.513 2.46E-11 71 1 si:busm1-189a20.4 Si:busm1-189a20.4 Dr.87489 566732 1.486 1.486 5.50E-04 0.967 -1.034 6.59E-01 0.587 -1.703 1.40E-04 0.740 -1.352 3.16E-02 0.415 -2.410 2.17E-26 0.349 -2.866 0.00E+00 72 1 wu:fb69c03 Wu:fb69c03 Dr.4246 322653 1.140 1.140 2.03E-01 1.017 1.017 8.67E-01 0.688 -1.454 7.70E-04 0.818 -1.222 6.70E-02 0.601 -1.665 2.30E-04 0.619 -1.615 2.84E-06 Hypothetical protein 73 1 LOC794136 Dr.11446 794136 1.087 1.087 4.98E-01 1.000 1.000 9.99E-01 0.873 -1.145 1.84E-01 0.869 -1.150 1.24E-01 0.678 -1.475 1.38E-06 0.634 -1.577 1.29E-06 LOC794136 74 1 si:ch211-51l3.4 Si:ch211-51l3.4 Dr.82671 567716 1.086 1.086 2.01E-01 0.953 -1.050 5.03E-01 0.897 -1.115 4.61E-02 0.891 -1.122 5.81E-02 0.685 -1.460 7.08E-17 0.630 -1.587 1.28E-10 Leucine rich repeat 75 1 lrrc17 Dr.25268 321202 1.125 1.125 2.00E-01 0.983 -1.017 9.00E-01 0.890 -1.124 3.81E-02 0.829 -1.207 3.61E-02 0.682 -1.465 5.78E-18 0.617 -1.622 6.64E-14 containing 17 76 1 Dr.135072 Transcribed locus Dr.135072 1.130 1.130 1.76E-01 0.925 -1.082 6.63E-01 0.837 -1.195 3.85E-02 0.842 -1.188 6.64E-02 0.703 -1.423 4.50E-04 0.593 -1.686 2.34E-07 77 1 Dr.82902 Transcribed locus Dr.82902 1.174 1.174 3.54E-01 0.908 -1.102 3.31E-01 0.821 -1.218 1.21E-01 0.831 -1.203 1.29E-01 0.622 -1.607 1.60E-04 0.546 -1.832 2.36E-13 78 1 zgc:163098 Zgc:163098 Dr.2575 100037380 1.071 1.071 5.22E-01 0.905 -1.105 4.73E-01 0.858 -1.165 1.67E-01 0.897 -1.114 2.48E-01 0.698 -1.433 3.41E-03 0.620 -1.612 2.83E-09 79 1 Dr.16786 Transcribed locus Dr.16786 1.157 1.157 1.01E-02 0.981 -1.019 8.79E-01 0.899 -1.112 4.29E-01 0.922 -1.084 5.64E-01 0.622 -1.608 6.50E-07 0.604 -1.655 5.72E-03 80 1 zgc:55764 Zgc:55764 Dr.116955 324211 1.248 1.248 2.46E-01 1.022 1.022 9.11E-01 0.807 -1.240 2.20E-01 0.776 -1.289 9.05E-02 0.561 -1.782 1.02E-09 0.514 -1.945 2.30E-13 81 1 wu:fj22f09 Wu:fj22f09 Dr.80938 335576 1.153 1.153 4.27E-02 1.029 1.029 8.31E-01 0.819 -1.221 6.64E-02 0.825 -1.212 5.05E-02 0.635 -1.574 1.60E-04 0.613 -1.631 2.00E-05 82 1 Dr.15245 Transcribed locus Dr.15245 1.159 1.159 4.05E-02 1.002 1.002 9.87E-01 0.822 -1.216 7.58E-02 0.843 -1.186 8.44E-02 0.643 -1.554 2.58E-06 0.666 -1.501 1.50E-04 83 1 zgc:136228 Zgc:136228 Dr.76679 570276 1.230 1.230 3.28E-02 1.020 1.020 9.22E-01 0.839 -1.192 1.53E-01 0.843 -1.187 1.07E-01 0.585 -1.710 2.37E-06 0.615 -1.627 2.00E-05 84 1 LOC559603 Hypothetical LOC559603 Dr.77445 559603 1.401 1.401 2.63E-02 1.041 1.041 6.99E-01 0.742 -1.348 5.22E-02 0.770 -1.299 9.26E-02 0.485 -2.063 3.48E-27 0.524 -1.907 5.33E-19 85 1 LOC558498 Hypothetical LOC558498 Dr.74654 558498 1.106 1.106 5.84E-01 0.979 -1.021 8.97E-01 0.916 -1.092 4.15E-01 0.873 -1.145 1.12E-01 0.658 -1.519 2.00E-05 0.671 -1.490 1.31E-03 86 1 zgc:152901 Zgc:152901 Dr.79170 566352 1.121 1.121 9.56E-02 0.984 -1.016 8.71E-01 0.911 -1.097 1.19E-01 0.833 -1.201 4.67E-03 0.664 -1.507 1.93E-09 0.648 -1.543 8.53E-03 87 1 zgc:136971 Zgc:136971 Dr.78531 678599 1.125 1.125 2.01E-01 0.997 -1.003 9.71E-01 0.912 -1.096 3.81E-01 0.843 -1.186 9.31E-02 0.651 -1.537 3.00E-05 0.699 -1.431 1.40E-04 Ariadne ubiquitin- conjugating enzyme E2 88 1 arih1 Dr.75869 327005 1.146 1.146 4.13E-01 1.166 1.166 4.27E-01 0.832 -1.202 1.93E-01 0.823 -1.216 9.06E-02 0.533 -1.878 2.28E-16 0.562 -1.779 1.12E-14 binding protein homolog 1 (Drosophila) 89 1 wu:fj53a05 Wu:fj53a05 Dr.81170 336163 1.157 1.157 1.44E-01 1.086 1.086 4.39E-01 0.839 -1.191 2.45E-01 0.838 -1.193 2.35E-01 0.590 -1.695 8.00E-05 0.625 -1.600 2.70E-04 90 1 zgc:154064 Zgc:154064 Dr.108555 791699 1.345 1.345 3.23E-02 1.090 1.090 5.89E-01 0.841 -1.189 3.60E-01 0.845 -1.184 4.07E-01 0.563 -1.777 3.39E-03 0.434 -2.307 3.08E-20 RNA methyltransferase like 91 1 rnmtl1 Dr.84838 550390 1.144 1.144 3.79E-01 1.040 1.040 7.36E-01 0.920 -1.087 3.90E-01 0.909 -1.100 3.11E-01 0.751 -1.332 2.71E-03 0.666 -1.501 3.60E-06 1 Hypothetical protein 92 1 LOC791963 Dr.118394 791963 1.260 1.260 1.37E-01 1.008 1.008 9.40E-01 0.885 -1.130 3.15E-01 0.816 -1.226 3.72E-02 0.658 -1.520 8.80E-04 0.459 -2.180 4.29E-18 LOC791963 93 1 zgc:162191 Zgc:162191 Dr.77158 322373 1.135 1.135 4.38E-02 1.026 1.026 7.56E-01 0.890 -1.123 3.03E-01 0.907 -1.103 3.26E-01 0.777 -1.287 1.91E-03 0.617 -1.620 2.00E-05
Transcribed locus, strongly 94 1 Dr.78788 similar to NP_997849.1 2- Dr.78788 1.078 1.078 4.84E-01 1.066 1.066 6.35E-01 0.900 -1.111 5.71E-01 0.845 -1.184 3.42E-01 0.718 -1.393 2.73E-03 0.613 -1.632 1.65E-09 like [Danio rerio]
95 1 wu:fc22c09 Wu:fc22c09 Dr.74490 324234 1.121 1.121 2.24E-01 1.098 1.098 4.41E-01 0.849 -1.178 1.77E-01 0.902 -1.109 2.93E-01 0.770 -1.298 1.83E-03 0.577 -1.734 3.97E-16 Rhesus blood group, B 96 1 rhbg Dr.118521 337596 1.106 1.106 7.50E-02 0.942 -1.062 3.94E-01 0.981 -1.020 7.86E-01 0.822 -1.217 2.89E-02 0.736 -1.359 1.73E-03 0.649 -1.540 3.00E-05 glycoprotein 97 1 Dr.133501 Transcribed locus Dr.133501 1.116 1.116 2.90E-01 1.000 -1.000 9.98E-01 0.986 -1.014 9.28E-01 0.866 -1.154 2.25E-01 0.751 -1.332 2.75E-03 0.659 -1.519 8.13E-06 98 1 clock3 Clock homolog 3 (mouse) Dr.86747 352927 1.154 1.154 4.99E-01 1.113 1.113 4.56E-01 1.008 1.008 9.63E-01 0.835 -1.197 2.67E-01 0.729 -1.372 5.86E-02 0.627 -1.595 8.00E-05 99 1 zgc:136620 Zgc:136620 Dr.108105 678626 1.034 1.034 7.62E-01 1.154 1.154 2.90E-01 0.872 -1.146 3.32E-01 0.916 -1.092 5.37E-01 0.705 -1.419 3.11E-03 0.604 -1.655 1.73E-09 100 1 zgc:103635 Zgc:103635 Dr.133079 449554 1.106 1.106 5.89E-01 1.185 1.185 4.21E-01 0.888 -1.126 4.52E-01 0.895 -1.117 4.70E-01 0.740 -1.351 4.43E-02 0.628 -1.593 8.69E-07 101 1 Dr.122495 Transcribed locus Dr.122495 1.174 1.174 2.63E-01 1.176 1.176 3.85E-01 0.893 -1.120 5.20E-01 0.976 -1.024 8.58E-01 0.687 -1.455 6.87E-03 0.636 -1.572 1.00E-06 102 1 ek3 Eph-like kinase 3 Dr.28327 30313 1.152 1.152 3.39E-01 1.166 1.166 4.13E-01 0.927 -1.079 6.17E-01 0.984 -1.017 9.08E-01 0.661 -1.514 1.57E-03 0.577 -1.732 3.93E-23 103 1 zgc:158695 Zgc:158695 Dr.40378 791134 1.222 1.222 1.77E-01 1.201 1.201 2.98E-01 0.893 -1.120 4.00E-01 0.911 -1.098 4.73E-01 0.631 -1.584 5.00E-05 0.618 -1.618 6.76E-10 104 1 si:ch211-198b3.2 Si:ch211-198b3.2 Dr.42900 557836 1.284 1.284 4.64E-02 1.225 1.225 1.43E-01 0.777 -1.287 1.29E-01 0.864 -1.157 2.82E-01 0.589 -1.697 6.95E-06 0.565 -1.770 2.50E-04 105 1 Dr.124063 Transcribed locus Dr.124063 0.994 -1.006 9.50E-01 1.130 1.130 2.23E-01 0.960 -1.042 8.02E-01 0.848 -1.179 2.51E-01 0.759 -1.317 8.30E-02 0.660 -1.516 6.75E-06 Hypothetical protein 106 1 LOC797973 Dr.114131 797973 1.183 1.183 8.33E-02 1.060 1.060 5.12E-01 1.033 1.033 6.88E-01 0.836 -1.196 1.09E-01 0.861 -1.161 2.15E-02 0.614 -1.629 5.00E-05 LOC797973 107 1 zgc:110684 Zgc:110684 Dr.120368 553650 1.407 1.407 1.92E-01 1.104 1.104 6.48E-01 0.911 -1.097 6.24E-01 0.921 -1.086 4.17E-01 0.736 -1.359 2.75E-03 0.616 -1.624 2.00E-05 Thyroid transcription factor 108 1 titf1a Dr.82318 58112 1.459 1.459 7.10E-03 1.083 1.083 3.22E-01 0.884 -1.131 2.45E-01 0.926 -1.080 3.52E-01 0.796 -1.256 1.08E-02 0.609 -1.641 8.91E-07 1a Ankyrin repeat and SOCS 109 1 asb13 Dr.31363 436801 1.209 1.209 3.73E-02 1.021 1.021 7.90E-01 0.987 -1.013 8.62E-01 0.949 -1.054 4.38E-01 0.774 -1.292 1.88E-03 0.658 -1.520 5.29E-09 box-containing 13 110 1 wu:fj67f05 Wu:fj67f05 Dr.77690 337439 1.431 1.431 5.53E-02 1.074 1.074 4.12E-01 1.029 1.029 8.30E-01 0.801 -1.249 1.77E-01 0.695 -1.438 5.06E-02 0.549 -1.821 1.78E-09
Transcribed locus, strongly similar to XP_001343436.1 111 1 Dr.123153 Dr.123153 1.473 1.473 8.57E-03 0.846 -1.181 5.81E-01 1.018 1.018 9.14E-01 0.846 -1.182 2.72E-01 0.785 -1.274 3.29E-01 0.428 -2.337 2.66E-18 similar to ZNF318 protein [Danio rerio]
112 1 zgc:153349 Zgc:153349 Dr.37104 555269 1.523 1.523 1.97E-02 0.872 -1.146 4.52E-01 1.178 1.178 3.23E-01 0.894 -1.118 3.60E-01 0.781 -1.281 9.47E-02 0.550 -1.817 6.26E-10 113 1 wu:fa07c11 Wu:fa07c11 Dr.104432 334890 1.071 1.071 5.87E-01 0.818 -1.223 2.13E-01 0.898 -1.114 3.33E-01 0.827 -1.209 4.52E-02 0.770 -1.299 1.29E-01 0.639 -1.566 7.81E-09 Similar to CD2 antigen 114 1 LOC100001192 (cytoplasmic tail) binding Dr.114413 100001192 1.078 1.078 5.56E-01 0.842 -1.188 1.32E-01 0.877 -1.141 1.97E-01 0.740 -1.352 4.00E-05 0.698 -1.434 2.90E-04 0.581 -1.721 2.64E-16 protein 2 Pyruvate kinase, liver and 115 1 pklr Dr.132396 114551 1.121 1.121 4.32E-01 0.880 -1.137 4.44E-01 0.923 -1.084 5.75E-01 0.855 -1.170 3.23E-01 0.710 -1.408 2.64E-02 0.659 -1.517 2.06E-06 RBC Myxovirus (influenza virus) 116 1 mxc Dr.26703 282672 1.097 1.097 7.00E-01 0.858 -1.165 5.03E-01 0.892 -1.121 2.83E-01 0.798 -1.253 1.54E-01 0.661 -1.512 2.46E-03 0.584 -1.712 6.06E-06 resistance C 117 1 Dr.122581 Transcribed locus Dr.122581 1.173 1.173 2.79E-01 0.713 -1.403 8.25E-02 0.813 -1.230 2.61E-01 0.765 -1.306 1.52E-01 0.763 -1.311 1.14E-01 0.484 -2.065 3.00E-05 118 1 zgc:110639 Zgc:110639 Dr.134084 553642 1.096 1.096 6.33E-01 0.853 -1.172 4.14E-01 0.893 -1.119 2.92E-01 0.796 -1.256 3.67E-03 0.796 -1.257 6.61E-03 0.579 -1.728 2.90E-19 119 1 zgc:113011 Zgc:113011 Dr.42603 553737 1.259 1.259 1.40E-01 0.821 -1.218 4.69E-02 0.831 -1.203 2.99E-01 0.737 -1.357 4.74E-02 0.693 -1.443 5.37E-02 0.450 -2.220 3.57E-13 120 1 wu:fc30g11 Wu:fc30g11 Dr.105823 324493 1.045 1.045 4.73E-01 0.942 -1.062 6.62E-01 0.938 -1.067 4.09E-01 0.872 -1.147 4.95E-02 0.770 -1.298 2.37E-07 0.640 -1.563 1.97E-12 121 1 wu:fj86d02 Wu:fj86d02 Dr.79919 337602 1.047 1.047 3.94E-01 0.979 -1.021 7.08E-01 0.899 -1.112 2.41E-01 0.867 -1.153 5.68E-02 0.783 -1.277 6.39E-06 0.664 -1.505 1.57E-06 122 1 zgc:110829 Zgc:110829 Dr.121466 541427 0.986 -1.014 8.22E-01 0.924 -1.082 5.68E-01 0.900 -1.111 3.27E-01 0.857 -1.166 2.14E-01 0.778 -1.285 1.45E-03 0.592 -1.689 7.97E-21 123 1 wu:fb02f05 Wu:fb02f05 Dr.32313 337231 1.094 1.094 3.52E-01 0.939 -1.065 7.14E-01 0.929 -1.076 5.64E-01 0.805 -1.242 6.11E-02 0.685 -1.459 1.45E-03 0.412 -2.426 8.00E-05 Similar to Abhd6-prov 124 1 LOC799085 Dr.133048 799085 1.131 1.131 5.44E-01 0.977 -1.023 9.27E-01 0.783 -1.277 7.43E-02 0.741 -1.349 3.73E-02 0.726 -1.377 8.90E-02 0.484 -2.066 2.56E-17 protein 125 1 zgc:114101 Zgc:114101 Dr.81643 559198 1.052 1.052 4.97E-01 0.975 -1.025 8.11E-01 0.944 -1.059 7.46E-01 0.832 -1.202 2.07E-01 0.830 -1.205 1.07E-01 0.665 -1.504 4.00E-05 126 1 wu:fa95b08 Wu:fa95b08 Dr.104580 337012 0.954 -1.049 5.76E-01 0.798 -1.254 3.57E-02 0.739 -1.352 1.16E-03 0.602 -1.660 1.99E-14 0.700 -1.428 1.57E-02 0.477 -2.095 0.00E+00 Eph-like receptor tyrosine 127 1 rtk8 Dr.75829 30691 0.929 -1.076 2.93E-01 0.816 -1.226 5.00E-05 0.824 -1.213 9.21E-03 0.769 -1.300 5.00E-05 0.805 -1.242 1.62E-02 0.643 -1.555 1.42E-12 kinase 8 128 1 wu:fi48f03 Wu:fi48f03 Dr.119413 334410 0.973 -1.028 6.86E-01 0.721 -1.388 8.00E-05 0.823 -1.215 9.10E-02 0.722 -1.384 7.00E-05 0.708 -1.412 9.29E-03 0.569 -1.758 5.29E-09 129 1 zgc:55587 Zgc:55587 Dr.6680 334167 0.930 -1.076 3.04E-01 0.684 -1.463 1.82E-08 0.830 -1.205 1.00E-04 0.748 -1.338 1.00E-12 0.686 -1.457 3.46E-11 0.572 -1.747 2.58E-25 Neural cell adhesion 130 1 ncam1 Dr.75350 30447 0.990 -1.011 9.15E-01 0.811 -1.233 1.70E-03 0.850 -1.176 2.55E-01 0.788 -1.269 2.15E-02 0.760 -1.315 1.93E-03 0.606 -1.649 3.37E-07 molecule 1 131 1 si:dkey-7l12.1 Si:dkey-7l12.1 Dr.79856 553232 1.034 1.034 8.83E-01 0.780 -1.282 3.79E-01 0.868 -1.152 3.90E-01 0.716 -1.397 1.74E-02 0.774 -1.292 1.04E-01 0.595 -1.682 1.04E-13 Poly A binding protein, 132 1 pabpc1a Dr.24504 606498 0.873 -1.145 2.61E-01 0.730 -1.369 6.02E-02 0.739 -1.354 2.50E-02 0.592 -1.688 9.60E-04 0.614 -1.628 5.00E-05 0.566 -1.768 3.00E-05 cytoplasmic 1 a 133 1 cpa5 Carboxypeptidase A5 Dr.77201 246092 0.713 -1.402 6.70E-27 0.597 -1.674 3.81E-06 0.419 -2.387 0.00E+00 0.350 -2.853 0.00E+00 0.290 -3.450 7.16E-37 0.228 -4.389 0.00E+00 134 1 zgc:112226 Zgc:112226 Dr.75553 554157 1.124 1.124 7.56E-01 0.779 -1.284 4.16E-01 0.672 -1.489 1.00E-04 0.593 -1.685 1.00E-05 0.704 -1.421 6.31E-02 0.517 -1.933 5.80E-04 135 1 ctssa Cathepsin S, a Dr.81560 393398 1.138 1.138 5.56E-01 0.783 -1.276 1.14E-02 0.609 -1.643 2.98E-07 0.551 -1.816 1.94E-11 0.582 -1.719 9.55E-08 0.444 -2.251 1.99E-15 136 1 zgc:85946 Zgc:85946 Dr.84990 406520 1.093 1.093 6.27E-01 0.783 -1.277 6.71E-02 0.754 -1.326 5.46E-03 0.724 -1.380 1.48E-03 0.705 -1.418 2.18E-02 0.565 -1.770 4.11E-13 137 1 zgc:110773 Zgc:110773 Dr.109713 613246 1.095 1.095 4.44E-01 0.771 -1.298 7.17E-03 0.792 -1.262 1.03E-01 0.740 -1.351 8.03E-02 0.613 -1.632 8.38E-03 0.564 -1.774 6.07E-06
Transcribed locus, weakly similar to NP_001036068.1 138 1 Dr.40900 Dr.40900 1.019 1.019 8.52E-01 0.833 -1.201 1.12E-03 0.834 -1.199 1.51E-01 0.826 -1.211 9.22E-02 0.664 -1.506 6.00E-05 0.637 -1.571 4.20E-04 binding protein 2 isoform 1 [Homo sapiens]
139 1 zgc:152924 Zgc:152924 Dr.75034 777606 1.040 1.040 8.03E-01 0.853 -1.172 1.17E-01 0.779 -1.284 2.84E-02 0.799 -1.252 3.94E-02 0.679 -1.473 3.70E-04 0.591 -1.693 1.18E-10 140 1 wu:fj87c06 Wu:fj87c06 Dr.9554 337619 1.082 1.082 4.97E-01 0.829 -1.206 1.81E-02 0.758 -1.319 3.13E-08 0.821 -1.219 3.24E-03 0.660 -1.514 2.00E-05 0.600 -1.665 5.98E-15 Similar to cask-interacting 141 1 CH211-119C20.3 Dr.112790 564179 1.002 1.002 9.86E-01 0.794 -1.259 4.30E-03 0.787 -1.271 2.90E-01 0.712 -1.404 3.51E-02 0.665 -1.505 2.08E-06 0.609 -1.642 1.58E-06 protein 2 142 1 LOC569609 Hypothetical LOC569609 Dr.115454 569609 0.996 -1.004 9.32E-01 0.836 -1.196 4.78E-03 0.825 -1.212 1.80E-02 0.772 -1.295 4.00E-05 0.657 -1.523 2.97E-14 0.671 -1.490 2.78E-13 143 1 zgc:64141 Zgc:64141 Dr.78662 393353 0.950 -1.053 6.85E-01 0.821 -1.218 2.60E-04 0.763 -1.310 5.16E-07 0.798 -1.253 3.42E-08 0.642 -1.557 4.31E-16 0.606 -1.650 1.22E-07 144 1 zgc:162290 Zgc:162290 Dr.16985 100007897 1.033 1.033 6.56E-01 0.919 -1.088 2.28E-01 0.781 -1.281 2.27E-02 0.848 -1.179 1.99E-01 0.658 -1.520 2.12E-06 0.655 -1.526 1.00E-04 Similar to SH2 containing 145 1 LOC798772 Dr.115286 798772 0.922 -1.085 5.04E-01 0.908 -1.102 3.69E-01 0.899 -1.112 5.69E-01 0.718 -1.393 6.34E-02 0.635 -1.575 6.63E-06 0.497 -2.013 1.42E-14 inositol-5-phosphatase 146 1 wu:fb09h07 Wu:fb09h07 Dr.23437 336413 0.864 -1.158 2.69E-01 0.883 -1.132 3.80E-01 0.854 -1.172 4.55E-01 0.669 -1.495 1.29E-02 0.546 -1.832 5.58E-07 0.481 -2.080 2.45E-02 Hypothetical protein 147 1 LOC100000415 Dr.117055 100000415 0.954 -1.048 8.00E-01 0.955 -1.048 8.43E-01 0.811 -1.233 2.66E-01 0.807 -1.240 2.91E-01 0.705 -1.419 6.38E-03 0.528 -1.892 1.10E-26 LOC100000415 148 1 vcanb Versican b Dr.77767 323465 0.977 -1.023 6.81E-01 0.955 -1.047 3.17E-01 0.847 -1.181 6.65E-09 0.766 -1.305 6.30E-11 0.711 -1.406 3.37E-15 0.581 -1.720 5.97E-23 149 1 Dr.28585 Transcribed locus Dr.28585 0.953 -1.049 2.73E-01 0.908 -1.101 3.20E-01 0.861 -1.161 8.86E-02 0.840 -1.191 3.76E-02 0.662 -1.511 1.80E-06 0.661 -1.512 6.76E-07 150 1 wu:fj38c09 Wu:fj38c09 Dr.81028 335932 0.945 -1.058 4.80E-01 0.928 -1.078 5.20E-01 0.882 -1.133 1.77E-01 0.841 -1.189 4.83E-02 0.645 -1.550 3.00E-05 0.651 -1.536 3.00E-05 151 1 zgc:110133 Zgc:110133 Dr.37702 550229 1.009 1.009 9.22E-01 0.953 -1.049 6.02E-01 0.892 -1.121 1.92E-01 0.830 -1.204 3.55E-02 0.696 -1.437 4.90E-04 0.633 -1.580 9.00E-05 152 1 Dr.133159 Transcribed locus Dr.133159 0.923 -1.084 4.17E-01 0.929 -1.077 6.82E-01 0.846 -1.182 3.56E-01 0.892 -1.121 4.93E-01 0.723 -1.383 5.37E-02 0.649 -1.540 3.07E-09 Similar to Anaphase 153 1 LOC568795 promoting complex subunit Dr.81104 568795 0.938 -1.066 5.96E-01 0.893 -1.120 2.18E-01 0.828 -1.208 4.69E-02 0.866 -1.154 5.58E-02 0.728 -1.374 1.09E-02 0.628 -1.593 2.00E-05 1 Vesicle amine transport 154 1 vat1 protein 1 homolog (T Dr.63036 368752 0.838 -1.193 1.80E-01 0.953 -1.049 8.21E-01 0.827 -1.209 1.47E-01 0.930 -1.076 3.66E-01 0.653 -1.531 2.50E-04 0.581 -1.721 7.73E-07 californica) 155 1 zgc:158463 Zgc:158463 Dr.27261 100037361 0.874 -1.145 1.05E-01 0.822 -1.216 3.51E-02 0.920 -1.087 2.37E-02 0.813 -1.230 1.30E-04 0.711 -1.407 4.00E-05 0.546 -1.831 2.00E-10 156 1 zgc:103639 Zgc:103639 Dr.78106 447930 0.913 -1.095 7.13E-03 0.881 -1.135 3.20E-03 0.949 -1.053 3.95E-01 0.903 -1.107 1.38E-01 0.738 -1.354 5.14E-06 0.666 -1.502 3.59E-08 157 1 ins Preproinsulin Dr.75811 30262 0.865 -1.157 1.03E-02 0.783 -1.277 6.35E-03 0.945 -1.058 1.93E-01 0.800 -1.250 4.29E-07 0.629 -1.591 1.43E-12 0.587 -1.703 6.52E-32 158 1 hpx Hemopexin Dr.80362 327588 0.926 -1.080 3.26E-01 0.832 -1.202 3.11E-02 0.865 -1.156 1.68E-01 0.789 -1.267 3.99E-02 0.668 -1.497 2.30E-13 0.575 -1.741 1.43E-09 Purine-rich element 159 1 pura Dr.85924 415106 0.993 -1.008 9.50E-01 0.821 -1.218 1.00E-05 0.901 -1.110 3.20E-01 0.803 -1.246 3.16E-02 0.644 -1.553 1.70E-04 0.515 -1.941 1.38E-12 binding protein A Similar to Uncoupling 160 1 LOC798012 Dr.121079 798012 0.898 -1.113 2.94E-01 0.968 -1.033 7.77E-01 0.890 -1.124 3.82E-02 0.809 -1.236 2.30E-04 0.796 -1.256 1.72E-02 0.653 -1.532 1.00E-05 protein 2 161 1 wu:fb99e06 Wu:fb99e06 Dr.77781 323481 0.736 -1.358 8.18E-02 0.866 -1.155 2.69E-01 0.715 -1.399 1.30E-03 0.487 -2.055 4.35E-06 0.600 -1.667 3.33E-06 0.351 -2.851 2.94E-06 162 1 si:ch211-237l4.2 Si:ch211-237l4.2 Dr.48022 561047 0.826 -1.211 3.72E-01 0.742 -1.348 9.22E-02 0.712 -1.405 4.80E-04 0.531 -1.883 1.27E-10 0.532 -1.878 1.62E-15 0.294 -3.404 9.93E-08 Similar to Mitochondrial 163 1 LOC572907 Dr.11081 572907 1.104 1.104 6.24E-01 1.009 1.009 9.22E-01 0.891 -1.123 1.93E-01 0.751 -1.331 3.14E-06 0.745 -1.343 3.20E-04 0.662 -1.511 2.00E-05 ribosomal protein L23 164 1 LOC561985 Hypothetical LOC561985 Dr.83151 561985 1.168 1.168 9.83E-02 0.938 -1.067 3.80E-01 0.860 -1.162 1.40E-02 0.715 -1.399 1.00E-05 0.721 -1.388 1.00E-05 0.607 -1.648 2.00E-05 165 1 si:dkeyp-110c7.6 Si:dkeyp-110c7.6 Dr.25788 368326 1.151 1.151 1.99E-01 1.045 1.045 7.71E-01 0.713 -1.402 5.27E-13 0.611 -1.636 1.06E-28 0.664 -1.507 4.36E-07 0.575 -1.739 4.42E-07 166 1 zgc:152922 Zgc:152922 Dr.39279 751734 1.272 1.272 4.54E-01 0.986 -1.014 9.67E-01 0.661 -1.513 1.99E-02 0.609 -1.642 5.52E-03 0.591 -1.692 2.85E-03 0.492 -2.032 8.55E-11 167 1 si:ch211-168n16.2 Si:ch211-168n16.2 Dr.12904 562258 1.075 1.075 3.04E-01 0.979 -1.022 9.05E-01 0.768 -1.302 5.64E-02 0.645 -1.549 6.70E-04 0.662 -1.511 8.50E-04 0.585 -1.708 7.40E-11 Hypothetical protein 168 1 LOC793509 Dr.73230 793509 1.067 1.067 6.92E-01 0.937 -1.067 5.43E-01 0.849 -1.179 3.13E-02 0.736 -1.359 7.98E-06 0.745 -1.342 1.00E-05 0.644 -1.553 2.00E-05 LOC793509 169 1 zgc:110441 Zgc:110441 Dr.45818 449947 1.005 1.005 9.69E-01 0.975 -1.026 7.71E-01 0.807 -1.239 1.07E-03 0.704 -1.420 5.50E-04 0.774 -1.292 9.00E-05 0.644 -1.553 1.45E-08 170 1 myoc Myocilin Dr.77862 548602 1.012 1.012 9.16E-01 0.902 -1.109 3.78E-01 0.760 -1.316 1.85E-02 0.689 -1.451 1.78E-03 0.711 -1.407 5.20E-04 0.560 -1.786 3.43E-11 171 1 wu:fd59c01 Wu:fd59c01 Dr.52856 735312 0.932 -1.073 6.48E-01 0.957 -1.045 7.56E-01 0.572 -1.749 3.00E-05 0.530 -1.886 1.00E-05 0.503 -1.987 4.67E-12 0.424 -2.360 7.18E-15 172 1 bactin2 Bactin2 Dr.75125 57935 0.975 -1.025 7.35E-02 1.034 1.034 1.57E-02 0.799 -1.252 0.00E+00 0.745 -1.342 0.00E+00 0.726 -1.378 3.84E-43 0.659 -1.516 2.58E-32 Hypothetical protein 173 1 LOC100000306 Dr.116123 100000306 1.038 1.038 8.34E-01 0.835 -1.197 5.60E-02 0.744 -1.344 2.25E-02 0.629 -1.590 1.80E-04 0.620 -1.612 1.00E-05 0.609 -1.642 3.27E-06 LOC100000306 Neural adhesion molecule 174 1 nadl1.1 Dr.120298 30656 1.053 1.053 7.31E-01 0.981 -1.020 9.22E-01 0.720 -1.389 1.55E-02 0.583 -1.716 2.00E-05 0.614 -1.630 1.70E-02 0.664 -1.506 1.15E-02 L1.1 175 1 frzb Frizzled-related protein Dr.81280 30119 1.024 1.024 9.13E-01 0.919 -1.088 7.10E-01 0.816 -1.226 5.81E-03 0.626 -1.597 4.00E-05 0.717 -1.395 2.00E-05 0.707 -1.415 2.70E-04 176 1 zgc:112433 Zgc:112433 Dr.89507 550469 0.966 -1.035 7.97E-01 0.887 -1.127 6.35E-01 0.906 -1.104 4.40E-01 0.653 -1.530 2.78E-08 0.702 -1.424 1.13E-03 0.649 -1.542 1.30E-04 177 1 wu:fk34f03 Wu:fk34f03 Dr.104587 336960 1.120 1.120 3.83E-01 1.154 1.154 9.25E-02 0.785 -1.274 2.82E-02 0.802 -1.247 4.31E-02 0.585 -1.708 4.29E-16 0.715 -1.399 4.93E-03 178 1 wu:fe11h11 Wu:fe11h11 Dr.74223 556186 1.072 1.072 3.99E-01 1.152 1.152 8.58E-02 0.787 -1.270 1.29E-03 0.823 -1.215 1.12E-02 0.591 -1.691 1.00E-05 0.728 -1.374 2.30E-04 Cell adhesion molecule- 179 1 cdon related/down-regulated by Dr.121780 280652 1.115 1.115 5.07E-01 1.043 1.043 7.76E-01 0.871 -1.148 1.26E-01 0.857 -1.167 1.33E-01 0.655 -1.528 8.30E-06 0.808 -1.238 3.05E-02 oncogenes 180 1 zgc:158780 Zgc:158780 Dr.38076 503773 1.286 1.286 1.83E-01 1.058 1.058 7.44E-01 0.708 -1.413 1.63E-02 0.789 -1.268 7.48E-02 0.411 -2.431 4.35E-22 0.682 -1.465 4.42E-03 181 1 wu:fe05b03 Wu:fe05b03 Dr.80638 326679 1.139 1.139 4.02E-01 1.000 -1.000 9.97E-01 0.813 -1.230 2.37E-02 0.815 -1.228 5.69E-02 0.578 -1.730 2.59E-08 0.799 -1.251 3.92E-02 182 1 Dr.82462 Transcribed locus Dr.82462 1.131 1.131 3.22E-01 1.020 1.020 8.98E-01 0.775 -1.291 1.78E-02 0.864 -1.157 1.91E-01 0.638 -1.568 1.00E-05 0.879 -1.138 1.57E-01 183 1 zgc:77862 Zgc:77862 Dr.132662 406474 1.003 1.003 9.66E-01 1.005 1.005 9.69E-01 0.735 -1.361 7.10E-09 0.837 -1.194 7.47E-03 0.510 -1.962 1.00E-05 0.637 -1.571 3.10E-06 184 1 si:dkey-63j1.8 Si:dkey-63j1.8 Dr.79402 335416 1.013 1.013 8.96E-01 0.975 -1.026 8.64E-01 0.787 -1.271 3.28E-02 0.802 -1.247 6.42E-02 0.553 -1.807 3.39E-16 0.700 -1.429 3.18E-03 185 1 Dr.83752 Transcribed locus Dr.83752 0.980 -1.021 7.30E-01 0.967 -1.034 6.81E-01 0.768 -1.302 8.98E-03 0.859 -1.165 2.03E-01 0.643 -1.555 8.00E-05 0.708 -1.413 4.84E-02 186 1 rpsa Ribosomal protein SA Dr.75127 394027 1.023 1.023 8.18E-01 0.986 -1.014 8.87E-01 0.768 -1.302 3.40E-03 0.838 -1.194 3.54E-03 0.584 -1.713 3.15E-08 0.809 -1.237 5.93E-02 187 1 zgc:65909 Zgc:65909 Dr.75861 393504 1.126 1.126 5.22E-01 0.962 -1.040 8.31E-01 0.666 -1.501 1.70E-04 0.710 -1.409 3.70E-04 0.448 -2.234 4.18E-21 0.630 -1.587 2.47E-06 188 1 Dr.134582 Transcribed locus Dr.134582 1.088 1.088 5.73E-01 1.267 1.267 1.66E-01 0.777 -1.286 6.83E-02 0.934 -1.071 6.74E-01 0.402 -2.490 9.39E-15 0.501 -1.994 3.01E-09 189 1 wu:fj59a01 Wu:fj59a01 Dr.81226 336240 1.025 1.025 8.06E-01 1.086 1.086 5.13E-01 0.892 -1.121 2.12E-01 0.901 -1.110 1.99E-01 0.643 -1.556 6.42E-06 0.725 -1.380 8.00E-05 F-box and leucine-rich 190 1 fbxl5 Dr.76970 322181 1.139 1.139 1.60E-01 1.089 1.089 5.22E-01 0.772 -1.296 7.24E-03 0.890 -1.124 2.27E-01 0.509 -1.963 2.00E-15 0.622 -1.607 1.00E-05 repeat protein 5 191 1 Dr.84675 Transcribed locus Dr.84675 1.068 1.068 5.69E-01 1.037 1.037 8.43E-01 0.924 -1.082 4.02E-01 0.927 -1.079 2.80E-01 0.618 -1.617 2.17E-22 0.766 -1.306 1.20E-04 192 1 Dr.89553 Transcribed locus Dr.89553 1.075 1.075 3.36E-01 1.063 1.063 5.33E-01 0.931 -1.074 5.11E-01 0.901 -1.110 3.80E-01 0.522 -1.916 2.33E-20 0.638 -1.568 3.20E-04 193 1 LOC558698 Hypothetical LOC558698 Dr.77128 558698 1.095 1.095 4.77E-01 1.142 1.142 3.61E-01 0.885 -1.130 3.80E-01 0.986 -1.014 8.93E-01 0.651 -1.537 2.00E-05 0.773 -1.293 1.10E-03 Signal transducer and 194 1 stat5.1 activator of transcription Dr.133576 369197 0.969 -1.032 7.88E-01 1.144 1.144 2.41E-01 0.879 -1.138 2.13E-01 0.746 -1.341 5.52E-03 0.627 -1.595 4.00E-05 0.799 -1.252 1.89E-01 5.1
Zgc:91987growth factor 195 1 grb10 Dr.105808 446167 1.213 1.213 3.18E-01 0.955 -1.048 7.05E-01 0.657 -1.521 1.00E-02 0.915 -1.093 6.54E-01 0.465 -2.151 1.35E-14 0.497 -2.010 8.64E-36 receptor-bound protein 10
196 1 Dr.80221 Transcribed locus Dr.80221 1.153 1.153 2.72E-01 0.912 -1.097 2.20E-01 0.798 -1.253 1.10E-01 0.926 -1.080 4.98E-01 0.588 -1.701 6.00E-05 0.692 -1.446 2.64E-03 197 1 LOC569586 Hypothetical LOC569586 Dr.119007 569586 1.263 1.263 1.21E-01 0.868 -1.152 2.46E-01 0.877 -1.140 3.10E-01 0.870 -1.150 2.76E-01 0.611 -1.636 2.37E-15 0.698 -1.432 1.89E-02 Hypothetical protein 198 1 flj11749l Dr.77489 445397 1.189 1.189 8.88E-03 0.886 -1.129 4.46E-02 0.829 -1.206 2.97E-03 0.870 -1.149 7.86E-03 0.654 -1.530 1.95E-14 0.702 -1.424 7.00E-05 FLJ11749-like (H. sapiens)
199 1 myb Myeloblastosis oncogene Dr.80654 30484 1.231 1.231 8.81E-02 0.898 -1.113 3.60E-01 0.815 -1.227 1.94E-01 0.851 -1.175 2.35E-01 0.647 -1.545 6.50E-04 0.613 -1.632 9.29E-06 200 1 wu:fc32b08 Wu:fc32b08 Dr.21617 324544 1.098 1.098 4.23E-01 0.877 -1.140 8.22E-02 0.837 -1.195 1.68E-01 0.867 -1.154 1.80E-01 0.649 -1.541 1.00E-05 0.729 -1.372 1.35E-02 Similar to SEC14-like 1 (S. 201 1 LOC100002510 Dr.24948 100002510 1.065 1.065 4.92E-01 0.865 -1.157 3.40E-01 0.835 -1.197 6.25E-02 0.861 -1.161 9.19E-02 0.596 -1.678 7.06E-12 0.700 -1.428 1.47E-03 cerevisiae) Hypothetical protein 202 1 LOC794028 Dr.26626 794028 1.118 1.118 4.12E-01 0.835 -1.198 1.04E-01 0.853 -1.172 1.56E-01 0.838 -1.194 8.74E-02 0.642 -1.559 4.30E-07 0.697 -1.435 1.30E-02 LOC794028 203 1 zgc:100846 Zgc:100846 Dr.82328 402895 1.108 1.108 2.75E-01 0.922 -1.085 5.06E-01 0.855 -1.170 1.38E-03 0.854 -1.171 6.48E-03 0.596 -1.679 1.28E-08 0.717 -1.396 8.82E-06 204 1 wu:fc32g03 Wu:fc32g03 Dr.78845 324557 1.162 1.162 1.78E-01 0.790 -1.266 5.22E-03 0.859 -1.164 1.14E-01 0.867 -1.153 2.32E-01 0.488 -2.051 3.02E-10 0.649 -1.541 2.66E-03
Transcribed locus, weakly similar to XP_706569.2 205 1 Dr.107610 Dr.107610 0.992 -1.008 9.55E-01 0.752 -1.329 3.28E-03 0.788 -1.270 3.00E-05 0.839 -1.193 3.01E-01 0.633 -1.579 7.61E-06 0.678 -1.474 3.44E-03 hypothetical protein [Danio rerio] Death associated protein 206 1 dap1b Dr.76473 58094 1.011 1.011 8.36E-01 0.847 -1.180 2.86E-02 0.880 -1.137 4.64E-02 0.867 -1.153 1.13E-02 0.655 -1.527 2.19E-11 0.687 -1.455 4.00E-05 1b 207 1 LOC560138 Hypothetical LOC560138 Dr.84738 560138 0.981 -1.020 9.59E-01 0.692 -1.444 3.85E-01 0.829 -1.207 2.56E-01 0.835 -1.198 4.52E-01 0.534 -1.874 4.29E-07 0.589 -1.698 1.25E-06 Ubiquitin A-52 residue 208 1 uba52 ribosomal protein fusion Dr.35198 641289 0.980 -1.020 8.31E-01 0.731 -1.367 1.39E-02 0.782 -1.278 3.01E-02 0.941 -1.063 4.89E-01 0.417 -2.398 1.43E-08 0.485 -2.061 2.00E-05 product 1 Pleiomorphic adenoma 209 1 plagl2 Dr.82515 259255 1.075 1.075 2.93E-01 0.822 -1.217 8.30E-02 0.846 -1.182 1.05E-01 0.975 -1.026 7.96E-01 0.654 -1.528 2.41E-07 0.752 -1.329 1.00E-05 gene-like 2 Similar to Ribosomal 210 1 LOC560828 Dr.118752 560828 1.046 1.046 6.52E-01 0.731 -1.369 9.91E-02 0.957 -1.045 7.12E-01 0.894 -1.118 4.18E-01 0.541 -1.849 9.09E-06 0.686 -1.457 2.10E-10 protein L13a 211 1 zgc:92833 Zgc:92833 Dr.109068 436776 1.074 1.074 8.19E-01 0.761 -1.314 2.49E-01 0.786 -1.273 3.94E-01 0.671 -1.491 6.34E-03 0.517 -1.935 9.33E-13 0.602 -1.661 2.00E-05 Hypothetical protein 212 1 LOC553527 Dr.118110 553527 1.121 1.121 3.49E-01 0.750 -1.333 4.45E-03 0.825 -1.212 2.52E-01 0.680 -1.471 3.49E-03 0.495 -2.018 5.74E-29 0.610 -1.640 5.10E-04 LOC553527 Twisted gastrulation 213 1 twsg1b Dr.83049 259304 1.093 1.093 7.17E-01 0.731 -1.367 2.80E-02 0.732 -1.366 6.23E-02 0.607 -1.646 3.20E-04 0.478 -2.091 6.93E-24 0.659 -1.518 3.56E-02 homolog 1b (Drosophila) 214 1 LOC571608 Hypothetical LOC571608 Dr.75487 571608 1.020 1.020 8.51E-01 0.801 -1.248 2.11E-02 0.859 -1.164 1.12E-01 0.831 -1.203 5.86E-02 0.588 -1.702 3.43E-13 0.742 -1.347 4.10E-04 Similar to putative RNA 215 1 LOC100007780 Dr.3155 100007780 1.084 1.084 6.94E-01 0.800 -1.250 1.60E-02 0.801 -1.249 2.32E-02 0.851 -1.175 1.88E-01 0.664 -1.506 6.86E-06 0.731 -1.367 8.44E-03 methylase Interferon regulatory factor 216 1 irf6 Dr.81664 393570 1.115 1.115 4.92E-01 0.728 -1.373 4.00E-04 0.674 -1.485 4.30E-04 0.772 -1.295 2.11E-02 0.569 -1.757 3.32E-17 0.690 -1.448 1.23E-06 6 Hemoglobin beta 217 1 hbbe1 Dr.114511 81538 0.858 -1.165 2.80E-01 0.771 -1.297 5.11E-03 0.800 -1.250 4.07E-01 0.875 -1.143 5.47E-01 0.447 -2.235 1.41E-08 0.670 -1.491 2.26E-01 embryonic-1 218 1 rpl8 Ribosomal protein L8 Dr.4091 393686 0.962 -1.040 6.10E-01 0.831 -1.204 1.17E-01 0.788 -1.269 5.97E-03 0.925 -1.082 3.11E-01 0.549 -1.823 1.70E-06 0.705 -1.419 9.70E-04 219 1 zgc:66168 Zgc:66168 Dr.75903 337810 0.907 -1.102 6.43E-02 0.821 -1.218 1.11E-02 0.855 -1.170 2.00E-01 1.059 1.059 3.51E-01 0.524 -1.910 1.00E-05 0.777 -1.288 3.16E-03 Death effector domain- 220 1 dedd1 Dr.78368 58125 0.834 -1.200 1.05E-01 0.951 -1.051 4.24E-01 0.956 -1.046 7.37E-01 0.979 -1.021 8.94E-01 0.557 -1.795 2.93E-11 0.737 -1.357 8.00E-05 containing 1 221 1 Dr.122786 Transcribed locus Dr.122786 0.974 -1.027 8.72E-01 1.023 1.023 8.91E-01 0.860 -1.163 5.90E-02 0.930 -1.076 4.17E-01 0.662 -1.511 1.00E-05 0.624 -1.602 2.00E-05 Embryonic shield mRNA, 222 1 Dr.88294 Dr.88294 0.947 -1.056 6.73E-01 1.047 1.047 7.38E-01 0.823 -1.215 3.47E-01 0.993 -1.007 9.70E-01 0.672 -1.489 1.05E-02 0.605 -1.654 4.10E-11 complete sequence Hypothetical protein 223 1 LOC794073 Dr.15198 794073 0.995 -1.005 9.56E-01 0.967 -1.034 8.05E-01 0.881 -1.135 2.14E-01 0.931 -1.074 4.67E-01 0.605 -1.652 1.29E-17 0.723 -1.383 8.00E-05 LOC794073 224 1 pvalb2 Parvalbumin 2 Dr.460 58028 0.891 -1.122 3.46E-01 0.918 -1.089 4.94E-01 0.830 -1.205 1.84E-01 0.858 -1.166 3.11E-01 0.460 -2.176 2.74E-42 0.503 -1.989 5.44E-32 225 1 wu:fc59c03 Wu:fc59c03 Dr.8738 325201 0.920 -1.087 2.90E-01 0.946 -1.057 7.56E-01 0.898 -1.114 3.44E-01 0.922 -1.085 4.13E-01 0.653 -1.532 9.00E-05 0.723 -1.383 2.61E-03 226 1 Dr.124668 Transcribed locus Dr.124668 1.289 1.289 1.06E-01 0.929 -1.076 5.24E-01 0.904 -1.107 5.47E-01 0.944 -1.060 7.23E-01 0.610 -1.639 8.00E-05 0.754 -1.326 8.91E-03 227 1 wu:fi11e03 Wu:fi11e03 Dr.17505 327443 1.394 1.394 4.80E-04 0.927 -1.079 6.61E-01 0.914 -1.094 4.02E-01 1.098 1.098 4.71E-01 0.636 -1.572 8.00E-05 0.758 -1.319 2.08E-02 228 1 im:7156740 Im:7156740 Dr.105408 550315 1.275 1.275 2.69E-01 1.111 1.111 5.58E-01 0.787 -1.271 3.24E-02 0.813 -1.230 5.98E-02 0.615 -1.625 4.01E-06 0.750 -1.333 4.59E-02 229 1 Dr.78846 Transcribed locus Dr.78846 1.241 1.241 1.18E-01 1.145 1.145 3.46E-01 0.837 -1.194 1.50E-01 0.928 -1.077 5.36E-01 0.666 -1.501 3.00E-05 0.800 -1.250 5.34E-02 Similar to FLJ22611-like 230 1 LOC793171 Dr.97656 793171 1.463 1.463 6.21E-02 1.166 1.166 4.32E-01 0.819 -1.221 1.21E-01 0.738 -1.356 7.62E-03 0.654 -1.529 4.00E-05 0.730 -1.371 6.11E-02 protein Hypothetical protein 231 1 LOC793280 Dr.132611 793280 1.602 1.602 1.29E-01 1.073 1.073 8.23E-01 0.557 -1.797 8.40E-06 0.610 -1.638 1.80E-04 0.599 -1.669 2.74E-17 0.754 -1.327 7.00E-05 LOC793280 232 1 si:dkey-264g21.1 Si:dkey-264g21.1 Dr.74466 557132 1.397 1.397 3.23E-02 1.085 1.085 3.07E-01 0.585 -1.709 8.00E-05 0.658 -1.519 4.54E-03 0.548 -1.824 2.49E-14 0.665 -1.504 3.48E-07 233 1 cry1a Cryptochrome 1a Dr.82313 83777 1.428 1.428 1.06E-02 0.958 -1.043 7.49E-01 0.631 -1.585 9.94E-11 0.843 -1.186 5.04E-02 0.633 -1.580 3.00E-05 0.740 -1.351 8.20E-04 234 1 dcps MRNA decapping enzyme Dr.531 402850 1.239 1.239 3.36E-03 0.924 -1.082 5.99E-01 1.004 1.004 9.76E-01 0.781 -1.280 5.48E-03 0.587 -1.703 5.23E-13 0.856 -1.169 3.16E-01
Empty spiracles homeobox 235 1 emx3 Dr.75757 30536 1.232 1.232 8.74E-02 0.900 -1.112 1.95E-01 0.775 -1.290 3.50E-04 0.733 -1.363 1.14E-06 0.618 -1.618 1.00E-05 0.729 -1.372 3.21E-03 3 236 1 zgc:162280 Zgc:162280 Dr.92706 799608 1.264 1.264 1.09E-01 1.040 1.040 8.13E-01 0.864 -1.158 4.33E-01 0.649 -1.542 1.46E-02 0.613 -1.631 1.49E-06 0.777 -1.286 7.33E-02 Similar to glucose-6- 237 1 LOC563180 Dr.105165 563180 0.788 -1.269 7.78E-02 0.868 -1.152 4.46E-01 0.705 -1.417 1.05E-02 0.896 -1.116 9.10E-02 0.690 -1.449 2.21E-03 0.594 -1.682 5.48E-12 phosphatase 238 1 zgc:158367 Zgc:158367 Dr.116845 571403 0.771 -1.297 2.70E-02 0.762 -1.312 9.68E-02 0.521 -1.921 5.00E-05 0.732 -1.367 1.47E-10 0.614 -1.628 4.56E-03 0.674 -1.484 3.89E-03 239 1 zgc:66409 Zgc:66409 Dr.23608 335407 0.504 -1.983 1.63E-02 0.646 -1.547 8.30E-10 0.310 -3.225 1.35E-28 0.400 -2.502 2.55E-06 0.335 -2.987 1.15E-27 0.267 -3.748 1.30E-37 240 1 npsn Nephrosin Dr.79156 404039 0.648 -1.543 1.18E-02 0.730 -1.369 2.60E-02 0.491 -2.037 3.00E-05 0.510 -1.962 2.45E-03 0.473 -2.116 4.00E-05 0.437 -2.287 3.10E-02 241 1 zgc:112242 Zgc:112242 Dr.44274 553694 0.818 -1.222 1.30E-01 0.974 -1.026 8.45E-01 0.681 -1.469 2.02E-06 0.660 -1.516 3.18E-07 0.685 -1.459 3.12E-03 0.624 -1.604 3.71E-03 242 1 zgc:55398 Zgc:55398 Dr.80443 394023 0.774 -1.292 7.12E-08 0.893 -1.120 4.26E-01 0.461 -2.167 6.71E-13 0.502 -1.994 1.49E-06 0.537 -1.861 9.04E-14 0.375 -2.664 6.23E-09 243 1 Dr.123119 Transcribed locus Dr.123119 0.843 -1.186 1.09E-01 0.981 -1.019 8.63E-01 0.805 -1.242 1.86E-02 0.788 -1.270 6.00E-04 0.615 -1.627 1.41E-10 0.711 -1.407 1.80E-04 244 1 zgc:112172 Zgc:112172 Dr.90055 550415 0.866 -1.155 4.58E-01 1.051 1.051 7.63E-01 0.717 -1.395 2.09E-01 0.706 -1.417 1.65E-01 0.589 -1.697 1.83E-10 0.681 -1.468 2.29E-06 245 1 zgc:158607 Zgc:158607 Dr.79190 569294 0.970 -1.031 8.55E-01 0.938 -1.067 4.88E-01 0.701 -1.426 1.61E-02 0.765 -1.307 5.64E-02 0.650 -1.538 9.88E-06 0.746 -1.341 2.50E-02 246 1 Dr.84292 Transcribed locus Dr.84292 0.971 -1.029 9.14E-01 1.033 1.033 9.02E-01 0.673 -1.485 9.70E-04 0.640 -1.562 3.00E-05 0.621 -1.611 1.00E-05 0.687 -1.456 7.58E-03 247 1 zgc:64114 Zgc:64114 Dr.82488 378866 0.722 -1.386 1.26E-02 1.028 1.028 7.11E-01 0.401 -2.495 5.75E-13 0.788 -1.270 4.47E-02 0.378 -2.642 8.24E-07 0.557 -1.796 6.68E-10 248 1 rdh1 Retinol dehydrogenase 1 Dr.97099 378440 1.010 1.010 9.50E-01 0.856 -1.168 1.92E-01 0.692 -1.446 7.56E-03 0.900 -1.112 4.21E-01 0.666 -1.501 9.00E-05 0.794 -1.259 2.64E-02
Similar to solute carrier 249 1 LOC100004438 Dr.116159 100004438 0.589 -1.697 6.34E-02 0.987 -1.013 9.66E-01 0.439 -2.276 9.35E-08 0.670 -1.493 1.41E-01 0.726 -1.378 1.23E-01 0.613 -1.632 6.82E-07 family 26 member 6 b 250 1 si:dkeyp-38g8.3 Si:dkeyp-38g8.3 Dr.140675 567017 0.997 -1.003 9.89E-01 1.110 1.110 4.75E-01 0.663 -1.508 1.57E-09 0.662 -1.510 2.77E-17 0.745 -1.343 5.02E-03 0.800 -1.250 2.32E-02 Similar to MAM domain 251 1 LOC559790 Dr.82435 559790 1.033 1.033 8.97E-01 1.233 1.233 2.04E-01 0.647 -1.545 1.43E-01 0.437 -2.288 5.00E-05 0.604 -1.657 2.00E-04 0.607 -1.648 5.00E-05 containing 4 252 1 LOC100005148 Androgen receptor a Dr.75914 100005148 1.029 1.029 9.11E-01 0.998 -1.002 9.88E-01 0.625 -1.600 4.00E-05 0.730 -1.371 9.20E-04 0.831 -1.204 5.43E-02 0.687 -1.455 1.71E-02 253 1 ntn1b Netrin 1b Dr.75773 30192 1.002 1.002 9.86E-01 1.206 1.206 1.54E-01 0.682 -1.465 1.72E-03 0.787 -1.271 4.01E-03 0.639 -1.565 4.95E-09 0.706 -1.416 5.35E-08 254 1 LOC556467 Hypothetical LOC556467 Dr.77730 556467 1.316 1.316 7.97E-02 1.403 1.403 2.00E-03 0.477 -2.097 1.61E-07 0.673 -1.485 2.65E-01 0.520 -1.924 3.17E-16 0.409 -2.447 1.56E-34 255 1 zgc:55523 Zgc:55523 Dr.10172 327196 1.089 1.089 4.24E-01 0.865 -1.156 4.68E-01 0.991 -1.009 9.65E-01 0.747 -1.338 2.92E-03 0.883 -1.133 4.34E-01 0.613 -1.632 2.03E-09 256 1 LOC562146 Hypothetical LOC562146 Dr.83930 562146 1.298 1.298 1.49E-01 0.820 -1.219 3.59E-01 1.074 1.074 7.32E-01 0.655 -1.527 2.62E-01 0.878 -1.139 5.20E-01 0.417 -2.400 6.76E-07 257 1 wu:fi31e12 Wu:fi31e12 Dr.75996 334103 1.165 1.165 1.02E-01 0.877 -1.140 6.78E-01 0.891 -1.122 7.24E-01 0.709 -1.410 7.90E-03 0.903 -1.107 5.46E-01 0.629 -1.590 9.00E-05 258 1 zgc:77784 Zgc:77784 Dr.118146 402947 1.020 1.020 8.82E-01 0.809 -1.236 4.08E-02 0.986 -1.014 8.91E-01 0.739 -1.354 5.68E-03 0.800 -1.250 2.67E-02 0.607 -1.646 3.73E-06 259 1 zgc:136858 Zgc:136858 Dr.77512 678543 0.991 -1.009 9.71E-01 0.851 -1.176 5.06E-01 0.955 -1.047 4.57E-01 0.742 -1.348 7.00E-05 0.892 -1.121 3.74E-01 0.653 -1.531 4.00E-05 260 1 LOC560916 Hypothetical LOC560916 Dr.19538 560916 1.311 1.311 3.17E-02 0.740 -1.352 7.22E-03 0.925 -1.081 6.32E-01 0.808 -1.238 1.37E-01 0.922 -1.085 6.90E-01 0.519 -1.928 2.83E-14 Similar to diaphanous 261 1 LOC556029 Dr.87568 556029 1.254 1.254 1.90E-01 0.657 -1.521 5.96E-02 1.094 1.094 4.48E-01 0.807 -1.239 1.56E-01 0.967 -1.034 8.60E-01 0.494 -2.026 3.00E-05 homolog 2 (Drosophila) 262 1 zgc:123334 Zgc:123334 Dr.78614 677660 1.245 1.245 2.02E-01 0.765 -1.306 1.41E-01 0.920 -1.087 4.81E-01 0.799 -1.252 5.31E-02 0.807 -1.240 1.31E-01 0.649 -1.540 1.00E-05 263 1 si:dkey-202g15.7 Si:dkey-202g15.7 Dr.80560 333977 1.292 1.292 4.40E-02 0.680 -1.470 1.71E-02 0.960 -1.041 7.25E-01 0.703 -1.423 2.30E-08 0.828 -1.208 1.98E-02 0.609 -1.643 2.81E-06 Anti-dorsalizing 264 1 admp Dr.80639 140619 1.283 1.283 2.13E-01 0.641 -1.561 8.22E-03 0.954 -1.049 7.74E-01 0.717 -1.395 1.06E-02 0.900 -1.111 4.69E-01 0.518 -1.932 3.93E-08 morphogenic protein 265 1 Dr.84783 Transcribed locus Dr.84783 1.146 1.146 2.95E-01 0.745 -1.342 3.34E-02 0.962 -1.039 6.75E-01 0.760 -1.316 8.60E-03 0.864 -1.157 7.72E-02 0.622 -1.608 6.71E-17 266 1 Dr.80051 Transcribed locus Dr.80051 1.182 1.182 4.06E-01 0.744 -1.344 1.44E-01 0.975 -1.025 8.50E-01 0.810 -1.234 5.50E-04 0.773 -1.294 1.69E-02 0.562 -1.780 2.47E-15 267 1 crygs3 Crystallin, gamma S3 Dr.92878 550617 1.250 1.250 6.94E-02 0.816 -1.225 9.35E-02 1.031 1.031 6.74E-01 0.853 -1.172 1.93E-02 0.815 -1.227 2.01E-02 0.609 -1.642 6.40E-08 268 1 zgc:100960 Zgc:100960 Dr.111296 792270 1.015 1.015 8.60E-01 0.866 -1.155 2.46E-01 0.959 -1.043 6.49E-01 0.868 -1.152 3.60E-02 0.908 -1.101 5.53E-01 0.603 -1.659 4.59E-09 269 1 has1 Hyaluronan synthase 1 Dr.88031 403130 0.996 -1.004 9.67E-01 0.823 -1.215 2.80E-01 0.861 -1.161 1.57E-01 0.869 -1.150 1.35E-01 1.034 1.034 8.47E-01 0.633 -1.579 8.00E-05 270 1 Dr.19769 Transcribed locus Dr.19769 1.182 1.182 3.64E-01 0.833 -1.200 1.98E-01 0.816 -1.226 2.46E-01 0.854 -1.171 3.14E-01 1.185 1.185 2.07E-01 0.591 -1.693 8.00E-05 271 1 Dr.100635 Transcribed locus Dr.100635 0.893 -1.120 5.35E-01 0.602 -1.662 3.27E-08 0.906 -1.103 4.76E-01 0.844 -1.185 7.46E-02 0.693 -1.442 6.70E-04 0.494 -2.022 1.26E-14 272 1 LOC798774 Similar to SORD protein Dr.115985 798774 0.954 -1.048 8.54E-01 0.612 -1.633 3.58E-02 0.966 -1.035 8.06E-01 0.851 -1.175 3.10E-01 0.728 -1.374 2.50E-02 0.564 -1.773 6.00E-05 273 1 wu:fa06h02 Wu:fa06h02 Dr.41005 334876 0.957 -1.045 7.90E-01 0.657 -1.523 9.50E-02 0.940 -1.064 4.62E-01 0.835 -1.198 6.00E-05 0.773 -1.293 2.79E-03 0.605 -1.652 1.00E-04 274 1 LOC568839 Lysyl oxidase-like 3a Dr.117709 568839 1.129 1.129 6.68E-01 0.503 -1.989 8.95E-08 0.979 -1.022 9.20E-01 0.763 -1.311 2.97E-01 0.756 -1.324 4.04E-02 0.420 -2.382 2.70E-08 275 1 ak5 Adenylate kinase 5 Dr.81461 336312 1.006 1.006 9.61E-01 0.657 -1.522 1.36E-02 0.944 -1.059 3.84E-01 0.812 -1.231 1.79E-03 0.802 -1.247 1.21E-02 0.537 -1.862 4.79E-06 276 1 zgc:123251 Zgc:123251 Dr.75167 641503 1.003 1.003 9.89E-01 0.668 -1.498 1.36E-02 0.974 -1.027 8.22E-01 0.748 -1.337 2.67E-02 0.690 -1.449 9.58E-03 0.576 -1.735 6.00E-05 CCAAT/enhancer binding 277 1 cebp1 Dr.41318 114453 0.887 -1.127 3.04E-02 0.720 -1.388 8.20E-04 0.965 -1.036 8.09E-01 0.823 -1.216 2.32E-01 0.832 -1.201 2.03E-01 0.549 -1.821 1.59E-09 protein (C/EBP) 1 Gdnf family receptor alpha 278 1 gfra1b Dr.117284 79377 0.922 -1.085 7.28E-01 0.754 -1.327 7.00E-05 0.981 -1.019 8.53E-01 0.858 -1.166 1.03E-01 0.702 -1.425 7.65E-03 0.621 -1.610 3.00E-05 1b 279 1 si:ch211-214p16.2 Si:ch211-214p16.2 Dr.88124 368902 0.937 -1.067 4.37E-01 0.751 -1.332 2.70E-04 0.932 -1.073 2.36E-01 0.882 -1.134 6.85E-02 0.697 -1.435 3.00E-05 0.655 -1.527 3.25E-06 Protein tyrosine 280 1 ptpru phosphatase, receptor Dr.118674 335096 0.906 -1.103 2.38E-01 0.761 -1.315 5.20E-04 0.958 -1.044 5.99E-01 0.933 -1.072 2.98E-01 0.673 -1.487 1.18E-09 0.648 -1.543 1.13E-24 type, U Similar to Poly (ADP- 281 1 LOC100002364 ribose) polymerase family, Dr.120837 100002364 0.846 -1.182 1.90E-01 0.741 -1.349 1.91E-02 0.946 -1.057 5.36E-01 0.842 -1.187 6.84E-02 0.691 -1.446 7.90E-04 0.630 -1.587 9.00E-05 member 6 282 1 zgc:136908 Zgc:136908 Dr.47664 563679 0.854 -1.171 3.78E-01 0.709 -1.411 5.47E-03 0.951 -1.051 6.40E-01 0.891 -1.122 1.72E-01 0.735 -1.360 3.30E-04 0.656 -1.525 3.14E-10 283 1 Dr.90773 Transcribed locus Dr.90773 0.848 -1.179 2.70E-01 0.628 -1.592 2.05E-03 0.995 -1.005 9.75E-01 0.780 -1.281 6.93E-02 0.665 -1.504 6.00E-05 0.525 -1.906 8.63E-25 284 1 wu:fj17a09 Wu:fj17a09 Dr.77645 563496 0.857 -1.167 4.70E-01 0.731 -1.368 6.54E-02 1.016 1.016 9.14E-01 0.910 -1.099 4.84E-01 0.735 -1.360 2.18E-02 0.593 -1.687 6.33E-11 285 1 Dr.122741 Transcribed locus Dr.122741 0.988 -1.012 9.61E-01 0.768 -1.303 1.36E-01 0.946 -1.057 7.47E-01 0.970 -1.031 8.96E-01 0.758 -1.319 5.97E-02 0.650 -1.538 4.00E-05 Similar to LOC531489 286 1 LOC561119 Dr.94004 561119 0.976 -1.025 7.89E-01 0.792 -1.263 6.03E-03 0.974 -1.027 8.18E-01 0.918 -1.090 3.08E-01 0.799 -1.251 1.50E-02 0.648 -1.543 7.66E-07 protein
Transcribed locus, weakly similar to XP_001089735.1 similar to WW domain- 287 1 Dr.122772 Dr.122772 1.047 1.047 6.87E-01 0.777 -1.287 6.59E-03 0.864 -1.157 1.21E-01 0.878 -1.138 1.03E-01 0.706 -1.417 7.00E-05 0.518 -1.931 1.08E-25 containing binding protein 4 isoform 2 [Macaca mulatta]
288 1 tlr8b Toll-like receptor 8b Dr.89704 403136 0.868 -1.152 1.37E-01 0.590 -1.694 3.00E-05 0.907 -1.103 1.55E-01 0.974 -1.027 8.18E-01 0.688 -1.453 2.34E-02 0.608 -1.645 6.04E-03 Alkylglycerone phosphate 289 1 agps Dr.101140 386801 0.785 -1.274 2.14E-02 0.754 -1.326 4.69E-03 0.903 -1.107 1.20E-01 0.774 -1.292 2.00E-05 0.770 -1.299 1.40E-02 0.637 -1.570 2.00E-05 synthase 290 1 LOC793666 Similar to popeye 2 Dr.116424 793666 0.783 -1.277 4.92E-02 0.692 -1.444 1.54E-03 0.864 -1.158 3.45E-01 0.684 -1.462 1.37E-02 0.655 -1.526 3.44E-03 0.531 -1.885 1.00E-05 291 1 si:dkeyp-89c11.1 Si:dkeyp-89c11.1 Dr.114710 402867 0.721 -1.387 2.29E-03 0.722 -1.385 5.40E-04 0.779 -1.284 3.08E-01 0.687 -1.456 2.96E-01 0.645 -1.551 3.29E-03 0.573 -1.746 4.35E-10 292 1 Dr.135177 Transcribed locus Dr.135177 0.788 -1.270 7.33E-02 0.881 -1.135 3.11E-01 0.816 -1.226 6.70E-02 0.797 -1.255 2.18E-02 0.713 -1.402 7.96E-03 0.607 -1.648 9.00E-05 293 1 zgc:112304 Zgc:112304 Dr.41753 554050 0.783 -1.278 5.98E-02 0.786 -1.273 2.46E-02 0.780 -1.282 2.10E-03 0.669 -1.495 1.42E-06 0.582 -1.717 2.07E-12 0.532 -1.879 2.15E-10 294 1 lyz Lysozyme Dr.83681 246089 0.729 -1.372 4.02E-06 0.691 -1.448 6.77E-15 0.692 -1.445 4.40E-04 0.630 -1.586 7.17E-07 0.449 -2.225 2.00E-05 0.366 -2.731 1.55E-08 295 1 LOC563952 Similar to CC chemokine-1 Dr.29197 563952 0.492 -2.033 4.66E-03 0.443 -2.260 9.15E-08 0.647 -1.545 5.11E-02 0.529 -1.892 1.20E-04 0.320 -3.121 4.26E-08 0.379 -2.641 3.83E-09 296 1 zgc:136569 Zgc:136569 Dr.85861 692318 0.808 -1.238 7.93E-02 0.820 -1.220 1.38E-01 0.833 -1.200 7.95E-02 0.825 -1.212 8.74E-02 0.651 -1.537 1.00E-05 0.699 -1.430 8.44E-03 297 1 wu:fk56e01 Wu:fk56e01 Dr.81970 335690 0.798 -1.253 2.28E-01 0.889 -1.124 4.76E-01 0.992 -1.008 9.36E-01 0.859 -1.164 2.88E-02 0.658 -1.520 3.03E-03 0.644 -1.553 8.00E-05 Hypothetical protein 298 1 CH211-45M15.1 Dr.82864 556137 0.734 -1.362 1.23E-02 0.865 -1.156 1.46E-01 1.051 1.051 5.68E-01 0.785 -1.273 5.18E-03 0.736 -1.359 2.60E-04 0.642 -1.557 7.59E-12 LOC556137 Hypothetical protein 299 1 LOC799689 Dr.86988 799689 0.481 -2.078 3.00E-05 0.836 -1.196 2.97E-01 0.900 -1.111 4.23E-01 0.680 -1.471 4.30E-03 0.507 -1.974 5.00E-06 0.464 -2.156 2.90E-04 LOC799689 300 1 zgc:136734 Zgc:136734 Dr.103079 677744 0.577 -1.734 1.83E-03 0.773 -1.293 1.26E-02 0.831 -1.204 1.12E-02 0.762 -1.312 3.30E-04 0.645 -1.551 2.80E-04 0.445 -2.248 3.67E-11 Similar to ovary-specific 301 1 LOC567217 Dr.113963 567217 0.551 -1.816 1.59E-06 0.560 -1.786 5.46E-09 0.857 -1.166 5.47E-01 0.815 -1.227 5.36E-01 0.575 -1.740 1.07E-02 0.364 -2.750 8.79E-06 C1q-like factor
Transcribed locus, weakly similar to XP_001101217.1 302 1 Dr.122215 similar to contactin 4 Dr.122215 0.721 -1.387 8.24E-02 0.713 -1.402 6.56E-02 0.899 -1.113 4.66E-01 0.770 -1.298 1.04E-02 0.759 -1.317 1.78E-02 0.537 -1.863 2.66E-11 isoform a precursor isoform 2 [Macaca mulatta]
303 1 wu:fb15e04 Wu:fb15e04 Dr.32406 336624 0.683 -1.465 1.39E-03 0.740 -1.352 2.75E-02 0.849 -1.178 1.25E-01 0.868 -1.152 1.29E-01 0.829 -1.206 9.76E-02 0.637 -1.571 6.68E-10 304 1 si:rp71-36d5.1 Si:rp71-36d5.1 Dr.108558 368423 0.674 -1.485 1.74E-01 0.634 -1.577 8.45E-02 1.016 1.016 9.17E-01 0.913 -1.096 6.47E-01 0.627 -1.595 1.02E-02 0.494 -2.025 6.00E-05 305 1 crygm2d6 Crystallin, gamma M2d6 Dr.134350 415228 0.663 -1.508 8.90E-02 0.664 -1.505 4.20E-03 1.048 1.048 8.29E-01 0.865 -1.156 4.93E-01 0.660 -1.516 3.76E-09 0.578 -1.730 7.43E-03 306 1 LOC568832 Hypothetical LOC568832 Dr.83524 568832 0.638 -1.567 1.56E-01 0.624 -1.604 1.36E-01 0.998 -1.003 9.89E-01 0.846 -1.182 2.55E-02 0.707 -1.414 1.40E-03 0.599 -1.669 1.60E-14 Cytochrome P450, family 307 1 cyp2j30 2, subfamily J, polypeptide Dr.37032 492484 0.675 -1.481 5.75E-02 0.677 -1.478 1.38E-02 0.900 -1.111 4.14E-01 0.820 -1.219 1.47E-01 0.664 -1.507 7.37E-07 0.710 -1.409 8.38E-06 30 308 1 Dr.84371 Transcribed locus Dr.84371 0.682 -1.466 5.10E-03 0.594 -1.683 3.20E-04 0.860 -1.163 3.61E-01 0.850 -1.176 6.90E-02 0.723 -1.384 1.74E-07 0.660 -1.516 4.41E-11 309 1 Dr.107516 Transcribed locus Dr.107516 0.688 -1.455 9.50E-02 0.887 -1.128 5.72E-01 0.769 -1.301 1.41E-01 0.829 -1.207 2.01E-01 0.790 -1.266 1.47E-01 0.321 -3.112 1.06E-08 310 1 zgc:100950 Zgc:100950 Dr.91020 445325 0.645 -1.550 3.60E-04 1.022 1.022 8.90E-01 0.905 -1.104 2.70E-01 0.902 -1.109 3.59E-01 0.720 -1.389 7.29E-02 0.503 -1.989 2.00E-05 311 1 LOC565839 Hypothetical LOC565839 Dr.80657 565839 0.752 -1.330 3.33E-01 0.765 -1.307 1.95E-01 0.807 -1.239 5.43E-02 1.017 1.017 9.20E-01 0.908 -1.101 3.11E-01 0.606 -1.651 5.00E-05 312 1 wu:fc37c02 Wu:fc37c02 Dr.105731 324650 1.109 1.109 5.48E-01 0.932 -1.074 4.79E-01 1.022 1.022 8.34E-01 0.906 -1.103 3.60E-01 0.678 -1.474 4.40E-02 0.581 -1.720 9.00E-05 Nitric oxide synthase 1 313 1 nos1 Dr.88599 60658 1.159 1.159 1.53E-01 0.813 -1.231 2.10E-01 1.020 1.020 8.41E-01 0.900 -1.111 1.80E-01 0.610 -1.640 3.60E-04 0.474 -2.109 7.20E-24 (neuronal) 314 1 Dr.140672 Transcribed locus Dr.140672 1.146 1.146 5.98E-01 1.055 1.055 7.82E-01 1.109 1.109 3.27E-01 0.869 -1.150 2.28E-01 0.532 -1.878 2.00E-05 0.414 -2.415 5.94E-11 315 1 mg:ab01b07 Mg:ab01b07 Dr.41813 326968 1.017 1.017 9.08E-01 0.958 -1.044 7.90E-01 1.062 1.062 5.87E-01 1.001 1.001 9.93E-01 0.729 -1.373 2.25E-03 0.649 -1.540 6.00E-05 316 1 sb:cb55 Sb:cb55 Dr.117532 321067 1.047 1.047 6.72E-01 0.940 -1.064 7.82E-01 1.075 1.075 6.76E-01 0.865 -1.156 5.72E-02 0.573 -1.745 8.31E-02 0.637 -1.570 3.00E-05 317 1 Dr.14578 Transcribed locus Dr.14578 0.975 -1.025 8.26E-01 0.954 -1.048 6.64E-01 0.968 -1.033 7.18E-01 0.952 -1.050 4.84E-01 0.605 -1.653 1.00E-05 0.608 -1.645 6.00E-05 318 1 si:dkey-114f6.1 Si:dkey-114f6.1 Dr.56035 327573 1.000 1.000 1.00E+00 1.000 1.000 1.00E+00 0.867 -1.154 6.89E-01 0.867 -1.154 6.89E-01 0.068 -14.703 9.43E-06 0.068 -14.703 9.88E-06 Hypothetical protein 319 1 LOC798492 Dr.84868 798492 1.044 1.044 7.42E-01 0.955 -1.047 6.97E-01 1.034 1.034 6.76E-01 0.921 -1.086 3.45E-01 0.556 -1.800 1.00E-05 0.552 -1.812 1.29E-06 LOC798492 Transcribed locus, moderately similar to XP_001093326.1 similar 320 1 Dr.83204 Dr.83204 1.032 1.032 7.84E-01 1.006 1.006 9.71E-01 0.957 -1.045 7.37E-01 0.953 -1.049 7.41E-01 0.671 -1.491 3.30E-04 0.611 -1.635 4.17E-09 to WD repeat, SAM and U- box domain containing 1 [Macaca mulatta] 321 1 zgc:85702 Zgc:85702 Dr.23665 321718 0.895 -1.118 1.93E-01 0.850 -1.177 3.07E-02 1.033 1.033 6.22E-01 0.934 -1.071 2.03E-01 0.848 -1.179 6.12E-02 0.630 -1.586 8.00E-05 322 1 clstn1 Calsyntenin 1 Dr.53665 777737 0.796 -1.256 1.25E-01 0.824 -1.213 4.50E-01 1.032 1.032 8.40E-01 0.881 -1.135 4.39E-02 0.681 -1.468 9.06E-02 0.485 -2.061 2.22E-07
Similar to Solute carrier 323 1 LOC569735 organic anion transporter Dr.82736 569735 0.928 -1.077 5.77E-01 0.913 -1.095 5.12E-01 1.045 1.045 8.17E-01 0.846 -1.182 3.33E-01 0.784 -1.276 2.04E-01 0.595 -1.682 2.35E-06 family, member 3a1
324 1 zgc:101893 Zgc:101893 Dr.37833 494045 0.939 -1.065 3.69E-01 0.890 -1.124 1.53E-01 1.081 1.081 4.01E-01 0.977 -1.023 6.04E-01 0.768 -1.301 4.05E-03 0.601 -1.663 1.06E-06 325 1 zgc:101786 Zgc:101786 Dr.80728 492757 0.971 -1.030 7.22E-01 0.868 -1.152 1.42E-01 0.980 -1.020 7.84E-01 0.949 -1.053 5.40E-01 0.743 -1.346 1.92E-10 0.598 -1.672 3.26E-08 326 1 wu:fk59g12 Wu:fk59g12 Dr.81942 335723 1.017 1.017 9.15E-01 0.917 -1.091 6.94E-01 0.898 -1.114 5.76E-01 0.971 -1.030 8.78E-01 0.622 -1.607 1.41E-03 0.447 -2.235 2.89E-23 327 1 zgc:123203 Zgc:123203 Dr.92219 641583 0.958 -1.044 6.52E-01 0.984 -1.017 8.63E-01 1.008 1.008 9.30E-01 0.959 -1.042 6.65E-01 0.723 -1.384 5.62E-03 0.562 -1.780 4.15E-13 328 1 zgc:153186 Zgc:153186 Dr.82256 751758 0.966 -1.036 5.17E-01 0.965 -1.037 5.30E-01 1.127 1.127 1.66E-02 0.888 -1.126 2.80E-01 0.684 -1.462 8.64E-06 0.596 -1.677 2.24E-13 Secreted acidic cysteine 329 1 sparcl Dr.92040 567331 0.944 -1.059 5.28E-01 0.897 -1.115 7.36E-02 1.028 1.028 8.10E-01 0.894 -1.118 3.32E-01 0.709 -1.410 1.19E-21 0.649 -1.542 4.00E-05 rich glycoprotein-like 330 1 Dr.122492 Transcribed locus Dr.122492 1.054 1.054 7.57E-01 0.817 -1.224 2.64E-01 0.964 -1.037 7.94E-01 1.018 1.018 8.97E-01 0.717 -1.396 4.12E-03 0.604 -1.656 9.50E-16 331 1 wu:fk54a10 Wu:fk54a10 Dr.81960 335663 0.998 -1.002 9.74E-01 0.834 -1.199 1.09E-01 0.980 -1.021 8.79E-01 1.119 1.119 4.55E-01 0.640 -1.563 5.00E-05 0.626 -1.598 4.17E-03 332 1 wu:fj22b05 Wu:fj22b05 Dr.80845 335563 1.169 1.169 6.54E-01 0.753 -1.329 3.00E-01 1.184 1.184 2.43E-01 1.222 1.222 2.37E-01 0.468 -2.136 1.90E-07 0.575 -1.740 1.86E-02 333 1 zgc:112148 Zgc:112148 Dr.82236 550424 1.328 1.328 4.64E-01 1.033 1.033 9.09E-01 1.134 1.134 4.24E-01 1.103 1.103 6.97E-01 0.531 -1.885 2.00E-05 0.532 -1.879 1.17E-02 334 1 wu:fe24e09 Wu:fe24e09 Dr.106515 795458 0.773 -1.293 1.27E-01 0.750 -1.333 2.23E-03 1.329 1.329 4.10E-04 1.046 1.046 6.19E-01 0.638 -1.567 3.00E-05 0.658 -1.519 4.00E-05 335 1 Dr.86162 Transcribed locus Dr.86162 0.750 -1.333 9.29E-02 0.752 -1.329 1.60E-01 1.263 1.263 2.07E-01 0.954 -1.049 7.94E-01 0.652 -1.533 1.85E-03 0.546 -1.831 1.00E-05 336 1 wu:fb49h10 Wu:fb49h10 Dr.23738 322096 0.868 -1.152 6.36E-01 0.717 -1.394 3.79E-01 1.373 1.373 2.86E-01 1.114 1.114 7.09E-01 0.497 -2.012 8.00E-05 0.435 -2.297 6.70E-03 337 1 ela2 Elastase 2 Dr.82353 403061 0.906 -1.104 5.06E-01 0.891 -1.122 3.30E-01 1.238 1.238 7.53E-02 0.963 -1.038 5.91E-01 0.647 -1.547 1.29E-03 0.564 -1.773 5.91E-06 338 1 zgc:103594 Zgc:103594 Dr.76097 447942 0.863 -1.158 2.83E-01 0.783 -1.277 3.29E-01 1.098 1.098 5.74E-01 0.975 -1.026 7.97E-01 0.568 -1.759 1.14E-26 0.498 -2.008 1.54E-10 339 1 zgc:162235 Zgc:162235 Dr.86308 563648 0.429 -2.334 1.36E-01 0.420 -2.378 1.29E-01 1.231 1.231 5.87E-01 1.157 1.157 6.88E-01 0.056 -17.857 1.00E-05 0.045 -22.334 3.41E-06 340 1 rpl24 Ribosomal protein L24 Dr.1310 192301 0.908 -1.102 6.15E-01 0.720 -1.388 6.34E-02 1.038 1.038 7.64E-01 0.996 -1.004 9.75E-01 0.660 -1.514 2.74E-09 0.707 -1.415 7.49E-03 Hemoglobin beta 341 1 hbbe3 Dr.29153 30596 0.891 -1.123 2.56E-01 0.635 -1.574 2.85E-03 1.103 1.103 4.08E-01 1.016 1.016 8.61E-01 0.514 -1.946 5.76E-06 0.624 -1.602 2.67E-08 embryonic-3
Transcribed locus, weakly similar to NP_067009.1 342 1 Dr.121890 pellucida glycoprotein 4 Dr.121890 0.863 -1.158 3.61E-01 0.811 -1.234 1.06E-01 1.216 1.216 7.10E-02 0.826 -1.210 3.32E-01 0.915 -1.093 4.50E-01 0.550 -1.818 6.65E-07 preproprotein [Homo sapiens]
343 1 Dr.79979 Transcribed locus Dr.79979 0.881 -1.136 4.54E-01 0.786 -1.273 9.01E-02 1.187 1.187 3.01E-01 1.147 1.147 4.72E-01 0.822 -1.216 8.67E-02 0.585 -1.711 9.21E-09 Similar to KIAA1070 344 1 LOC100002610 Dr.86013 100002610 0.962 -1.040 7.31E-01 0.833 -1.200 1.09E-01 1.056 1.056 2.47E-01 0.987 -1.014 8.13E-01 0.887 -1.127 1.77E-01 0.639 -1.565 4.94E-07 protein 345 1 LOC562763 Hypothetical LOC562763 Dr.87477 562763 1.251 1.251 4.84E-01 0.657 -1.522 1.84E-01 1.348 1.348 1.73E-01 1.273 1.273 4.03E-01 0.928 -1.078 7.49E-01 0.383 -2.614 4.00E-05 346 1 id:ibd2861 Id:ibd2861 Dr.107890 57978 1.580 1.580 1.80E-02 1.381 1.381 9.43E-02 0.862 -1.161 1.79E-01 0.799 -1.252 4.29E-02 0.680 -1.471 1.00E-04 0.658 -1.519 8.11E-06 347 1 zgc:153333 Zgc:153333 Dr.87215 555376 1.738 1.738 8.30E-02 1.318 1.318 3.65E-01 0.923 -1.083 5.05E-01 0.865 -1.156 2.03E-01 0.678 -1.474 2.08E-03 0.615 -1.627 3.49E-06 348 1 zgc:110599 Zgc:110599 Dr.118208 550600 1.841 1.841 3.16E-02 1.613 1.613 9.38E-02 0.940 -1.064 7.13E-01 0.881 -1.136 4.10E-01 0.714 -1.401 1.09E-02 0.592 -1.689 9.47E-08 Glutamate receptor, 349 1 gria2a Dr.107958 170450 1.535 1.535 4.04E-03 1.267 1.267 1.67E-01 0.953 -1.049 7.83E-01 0.746 -1.340 1.13E-01 0.640 -1.561 5.20E-04 0.658 -1.519 7.00E-05 ionotropic, AMPA 2a Odorant receptor, family 350 1 or13.1 Dr.75767 58111 1.760 1.760 1.35E-01 1.204 1.204 6.12E-01 1.134 1.134 5.49E-01 0.675 -1.482 8.17E-02 0.513 -1.948 1.08E-06 0.522 -1.915 5.00E-05 13, member 1 351 1 sb:cb230 Sb:cb230 Dr.81902 321163 1.827 1.827 1.46E-06 1.135 1.135 3.74E-01 1.004 1.004 9.66E-01 0.981 -1.019 8.41E-01 0.756 -1.322 2.30E-02 0.695 -1.440 3.20E-03 352 1 Dr.83951 Transcribed locus Dr.83951 1.645 1.645 2.00E-05 1.026 1.026 9.19E-01 0.994 -1.006 9.70E-01 1.006 1.006 9.76E-01 0.741 -1.349 2.25E-02 0.728 -1.373 3.75E-02
Transcribed locus, weakly similar to XP_001096144.1 similar to non-metastatic 353 1 Dr.84926 Dr.84926 1.809 1.809 1.61E-02 1.231 1.231 4.14E-01 0.975 -1.026 8.59E-01 1.002 1.002 9.89E-01 0.646 -1.548 1.02E-03 0.626 -1.597 3.00E-05 cells 1, protein (NM23A) expressed in isoform a [Macaca mulatta]
354 1 LOC569954 Hypothetical LOC569954 Dr.114835 569954 1.229 1.229 9.82E-02 1.778 1.778 3.63E-06 0.717 -1.395 4.50E-04 0.909 -1.101 4.72E-01 0.651 -1.536 9.78E-03 0.660 -1.515 1.45E-02 355 1 wu:fj23b11 Wu:fj23b11 Dr.21044 335525 1.241 1.241 1.40E-01 1.430 1.430 3.49E-02 0.765 -1.308 1.85E-02 0.926 -1.080 4.66E-01 0.685 -1.459 6.70E-04 0.662 -1.510 1.51E-06 Transcribed locus, moderately similar to XP_001092092.1 similar 356 1 Dr.119089 Dr.119089 1.457 1.457 1.39E-01 1.442 1.442 1.89E-01 0.729 -1.371 2.52E-01 0.858 -1.165 2.51E-01 0.693 -1.442 5.80E-04 0.641 -1.559 4.41E-12 to DNA topoisomerase II, beta isozyme [Macaca mulatta] B-cell leukemia/lymphoma 357 1 bcl2 Dr.45607 570772 1.642 1.642 2.62E-01 1.550 1.550 2.97E-01 0.687 -1.456 2.71E-01 0.905 -1.104 7.53E-01 0.592 -1.690 7.00E-05 0.741 -1.349 1.86E-02 2 Similar to DEP domain 358 1 LOC100003959 Dr.78376 100003959 1.317 1.317 1.48E-01 1.300 1.300 1.98E-01 0.880 -1.136 4.13E-01 0.911 -1.097 5.08E-01 0.640 -1.562 1.71E-07 0.710 -1.409 2.00E-05 containing 1a 359 1 pcdha Protocadherin a Dr.88614 259184 1.252 1.252 2.64E-02 1.240 1.240 1.83E-01 0.910 -1.098 2.58E-01 0.950 -1.053 5.09E-01 0.657 -1.521 1.51E-11 0.710 -1.408 3.91E-02 360 1 LOC556395 Hypothetical LOC556395 Dr.78388 334287 1.501 1.501 5.80E-02 1.642 1.642 4.43E-02 0.764 -1.309 1.64E-02 0.787 -1.270 3.33E-02 0.472 -2.121 7.00E-05 0.547 -1.828 2.05E-03 361 1 LOC558933 Hypothetical LOC558933 Dr.81136 558933 1.338 1.338 1.70E-04 1.365 1.365 1.94E-03 0.881 -1.135 3.11E-01 1.022 1.022 8.54E-01 0.609 -1.643 3.25E-11 0.751 -1.332 1.56E-02 362 1 im:7140048 Im:7140048 Dr.108540 503899 1.450 1.450 1.64E-02 1.018 1.018 9.37E-01 0.825 -1.213 1.01E-01 0.616 -1.623 6.18E-14 0.706 -1.417 7.39E-03 0.743 -1.346 2.03E-02 363 1 Gpsm1 AGS3 Dr.115158 493623 1.467 1.467 2.62E-02 1.008 1.008 9.57E-01 0.821 -1.218 2.63E-01 0.610 -1.641 3.09E-07 0.822 -1.217 2.69E-01 0.793 -1.261 2.28E-02 364 1 im:6899804 Im:6899804 Dr.88215 552956 1.292 1.292 1.70E-01 1.145 1.145 2.76E-01 0.796 -1.257 4.99E-03 0.579 -1.728 2.42E-07 0.732 -1.366 1.05E-02 0.786 -1.272 2.11E-01 365 1 Dr.125752 Transcribed locus Dr.125752 1.444 1.444 8.46E-03 1.118 1.118 7.23E-01 0.724 -1.381 1.31E-01 0.565 -1.771 2.00E-05 0.823 -1.215 1.51E-01 0.605 -1.654 3.62E-02 366 1 LOC562343 Similar to NSP5beta3beta Dr.83172 562343 1.669 1.669 1.93E-01 1.034 1.034 9.33E-01 0.580 -1.725 3.00E-05 0.533 -1.878 2.11E-06 0.620 -1.612 3.50E-04 0.504 -1.983 5.10E-06 367 1 LOC559247 Hypothetical LOC559247 Dr.116367 559247 1.903 1.903 1.00E-05 0.896 -1.117 5.06E-01 0.479 -2.089 6.21E-16 0.487 -2.053 2.68E-10 0.885 -1.130 6.19E-01 0.710 -1.409 1.26E-01 Pbx/knotted 1 homeobox 368 1 pknox1.2 Dr.87714 170445 1.453 1.453 4.69E-02 0.914 -1.094 6.14E-01 0.578 -1.730 3.97E-10 0.534 -1.871 3.74E-29 0.827 -1.209 2.71E-01 0.671 -1.490 1.78E-03 1.2 ATPase, Class VI, type 369 1 atp11c Dr.132351 368385 1.405 1.405 1.33E-01 0.877 -1.140 5.56E-01 0.763 -1.310 1.26E-01 0.534 -1.874 2.56E-07 0.923 -1.084 6.56E-01 0.813 -1.230 1.10E-01 11C
Transcribed locus, weakly similar to XP_001107064.1 370 1 Dr.122894 similar to tripartite motif- Dr.122894 1.540 1.540 3.46E-02 0.734 -1.363 1.05E-01 0.742 -1.347 1.11E-01 0.567 -1.763 3.90E-07 0.759 -1.317 1.09E-03 0.617 -1.621 1.91E-07 containing 62 isoform 1 [Macaca mulatta]
371 1 dao.1 D-amino-acid oxidase 1 Dr.47162 619259 1.292 1.292 1.12E-01 0.814 -1.229 3.09E-01 0.727 -1.375 1.92E-03 0.605 -1.653 6.67E-03 0.725 -1.380 1.12E-02 0.591 -1.691 1.98E-09 372 1 zgc:136545 Zgc:136545 Dr.48052 692317 1.418 1.418 3.81E-02 0.703 -1.423 2.21E-03 0.833 -1.201 2.24E-01 0.620 -1.612 1.40E-04 0.930 -1.076 5.15E-01 0.590 -1.694 3.59E-08 Similar to FLJ39237 373 1 LOC797976 Dr.87039 797976 1.430 1.430 1.73E-01 0.726 -1.377 2.28E-01 0.775 -1.291 2.96E-01 0.459 -2.180 4.30E-04 0.988 -1.012 9.48E-01 0.554 -1.804 6.00E-05 protein 374 1 LOC562338 Similar to latrophilin 2 Dr.133176 562338 2.251 2.251 1.20E-03 0.715 -1.398 2.01E-01 0.810 -1.235 4.89E-01 0.537 -1.863 2.66E-03 1.002 1.002 9.93E-01 0.437 -2.288 1.00E-05 375 1 ptc2 Patched 2 Dr.81263 30189 1.575 1.575 3.29E-03 0.933 -1.072 7.44E-01 0.868 -1.152 2.15E-01 0.716 -1.397 1.05E-02 0.962 -1.040 7.90E-01 0.613 -1.631 6.00E-05 Hypothetical protein 376 1 LOC100002383 Dr.19812 100002383 1.865 1.865 4.30E-04 0.980 -1.021 9.13E-01 0.948 -1.055 8.18E-01 0.544 -1.838 1.10E-04 0.889 -1.125 4.81E-01 0.498 -2.009 2.65E-09 LOC100002383 Zona pellucida 377 1 zp2l1 Dr.75593 555180 1.502 1.502 4.46E-07 0.931 -1.074 4.10E-01 0.891 -1.123 1.16E-01 0.642 -1.557 4.93E-07 0.797 -1.255 7.83E-02 0.660 -1.515 7.00E-05 glycoprotein 2, like 1 Hypothetical protein 378 1 LOC795755 Dr.85828 795755 1.616 1.616 8.92E-03 0.943 -1.060 8.15E-01 0.915 -1.093 4.32E-01 0.571 -1.752 1.08E-02 0.767 -1.304 6.72E-02 0.535 -1.870 9.46E-06 LOC795755 379 1 LOC568734 Hypothetical LOC568734 Dr.116437 568734 1.669 1.669 4.20E-04 0.945 -1.058 8.24E-01 0.763 -1.310 1.15E-01 0.674 -1.484 8.50E-04 0.781 -1.280 1.38E-02 0.639 -1.565 2.36E-06 380 1 zgc:113516 Zgc:113516 Dr.79930 541449 1.696 1.696 7.46E-06 0.896 -1.116 3.99E-01 0.822 -1.216 7.04E-02 0.733 -1.364 7.10E-04 0.705 -1.418 9.10E-04 0.641 -1.559 6.00E-05 381 1 wu:fj19a05 Wu:fj19a05 Dr.22588 335520 1.737 1.737 5.14E-09 0.883 -1.132 3.07E-01 0.834 -1.200 1.22E-01 0.779 -1.283 2.67E-02 0.707 -1.414 6.50E-04 0.775 -1.291 1.01E-02 Hypothetical protein 382 1 LOC799825 Dr.77701 799825 1.937 1.937 1.34E-07 0.923 -1.083 6.19E-01 0.737 -1.356 1.12E-01 0.722 -1.384 3.32E-02 0.850 -1.177 3.16E-01 0.809 -1.235 3.05E-01 LOC799825 Similar to KIAA1410 383 1 LOC563682 Dr.83443 563682 1.714 1.714 9.00E-05 0.970 -1.031 7.76E-01 0.757 -1.322 3.67E-02 0.741 -1.350 2.73E-03 0.783 -1.277 9.29E-03 0.780 -1.282 5.05E-02 protein Gdnf family receptor alpha 384 1 gfra1a Dr.119737 79376 1.577 1.577 1.00E-05 1.048 1.048 7.97E-01 0.817 -1.225 1.72E-01 0.793 -1.261 1.33E-02 0.861 -1.161 3.74E-01 0.675 -1.481 3.39E-03 1a 385 1 rpl10 Ribosomal protein L10 Dr.75581 336712 1.831 1.831 3.23E-11 1.157 1.157 5.20E-01 0.905 -1.105 3.63E-01 0.721 -1.386 6.80E-04 0.829 -1.206 6.32E-02 0.545 -1.835 3.56E-11 386 1 zgc:112236 Zgc:112236 Dr.132927 553693 1.919 1.919 1.03E-06 1.344 1.344 5.78E-02 0.800 -1.249 2.50E-01 0.771 -1.297 7.76E-02 0.740 -1.351 1.64E-01 0.640 -1.562 2.58E-02 Bromodomain adjacent to 387 1 baz1a Dr.36447 334173 1.604 1.604 1.55E-13 1.333 1.333 1.20E-04 0.808 -1.237 8.90E-04 0.749 -1.335 2.46E-06 0.762 -1.312 1.18E-06 0.626 -1.597 2.11E-17 zinc finger domain, 1A
Transcribed locus, moderately similar to 388 1 Dr.133255 XP_001113107.1 similar Dr.133255 2.187 2.187 4.94E-03 1.629 1.629 8.90E-04 0.579 -1.728 1.43E-03 0.592 -1.689 4.20E-03 0.770 -1.298 1.19E-01 0.573 -1.744 3.00E-05 to fibrillin 1 precursor [Macaca mulatta]
Transcribed locus, weakly similar to XP_001344229.1 389 1 Dr.80672 Dr.80672 1.830 1.830 8.87E-06 1.274 1.274 4.39E-02 0.687 -1.456 1.16E-02 0.755 -1.325 7.40E-02 0.816 -1.225 1.83E-01 0.589 -1.696 7.68E-13 hypothetical protein [Danio rerio]
Transcribed locus, moderately similar to 390 1 Dr.130083 Dr.130083 2.012 2.012 4.76E-08 1.157 1.157 3.64E-01 0.780 -1.282 1.68E-01 0.656 -1.525 6.40E-04 0.650 -1.538 1.30E-02 0.819 -1.221 2.40E-01 XP_001334931.1 similar to cathepsin L [Danio rerio]
391 1 LOC556437 Hypothetical LOC556437 Dr.89132 556437 2.295 2.295 1.70E-04 1.388 1.388 6.90E-04 0.885 -1.130 4.38E-01 0.600 -1.668 4.57E-06 0.689 -1.452 2.23E-02 0.689 -1.452 5.64E-03 Similar to transmembrane 392 1 LOC570023 Dr.132685 30363 2.733 2.733 2.28E-02 2.694 2.694 5.00E-05 0.312 -3.210 3.70E-04 0.367 -2.723 3.81E-03 0.630 -1.588 3.22E-02 0.717 -1.394 2.00E-04 receptor 393 1 LOC572173 Hypothetical LOC572173 Dr.69573 572173 1.665 1.665 8.50E-04 1.497 1.497 8.14E-03 0.729 -1.372 4.57E-02 0.663 -1.509 2.00E-08 0.787 -1.271 1.90E-01 0.810 -1.235 3.14E-01 Growth/differentiation 394 1 gdf7 Dr.88610 30642 1.715 1.715 5.00E-05 1.261 1.261 5.61E-02 0.685 -1.460 2.00E-05 0.573 -1.747 6.26E-09 0.820 -1.219 2.69E-01 0.732 -1.365 1.59E-02 factor 7 Ral-A exchange factor 395 1 ralgps2 Dr.17213 393446 1.472 1.472 6.42E-02 1.579 1.579 2.15E-06 0.578 -1.731 1.25E-02 0.650 -1.538 5.12E-02 0.639 -1.566 2.80E-07 0.665 -1.504 9.20E-06 RalGPS2 Hypothetical protein 396 1 LOC100003661 Dr.115571 100003661 1.604 1.604 4.61E-03 0.968 -1.033 8.71E-01 0.778 -1.285 4.04E-02 0.926 -1.080 5.23E-01 1.028 1.028 8.31E-01 0.590 -1.695 5.80E-07 LOC100003661 397 1 si:ch211-14a17.7 Si:ch211-14a17.7 Dr.75717 368669 1.434 1.434 4.76E-02 0.844 -1.185 1.14E-01 0.966 -1.035 7.08E-01 0.999 -1.001 9.97E-01 1.035 1.035 6.89E-01 0.590 -1.695 6.00E-05 Transcribed locus, weakly 398 1 Dr.126413 similar to NP_066269.1 Dr.126413 1.427 1.427 1.06E-03 0.965 -1.036 7.56E-01 0.872 -1.147 2.46E-01 1.094 1.094 5.78E-01 0.751 -1.332 5.20E-04 0.564 -1.772 5.00E-05 gamma C [Homo sapiens]
Similar to conserved 399 1 LOC564674 Dr.79321 564674 1.397 1.397 1.13E-01 0.930 -1.076 7.78E-01 0.888 -1.126 4.35E-01 1.033 1.033 8.62E-01 0.900 -1.111 4.37E-01 0.614 -1.628 4.38E-06 hypothetical protein 400 1 zgc:152979 Zgc:152979 Dr.133940 767671 1.549 1.549 3.00E-05 0.768 -1.303 3.47E-02 1.089 1.089 6.08E-01 0.817 -1.225 1.68E-01 0.879 -1.138 2.96E-01 0.646 -1.548 1.36E-03 401 1 zgc:66449 Zgc:66449 Dr.13689 327407 1.573 1.573 9.18E-06 0.778 -1.286 3.46E-01 1.002 1.002 9.89E-01 0.884 -1.131 3.45E-01 0.921 -1.086 5.91E-01 0.799 -1.251 3.51E-02 402 1 LOC565649 Hypothetical LOC565649 Dr.14946 565649 1.619 1.619 5.43E-06 0.922 -1.084 5.67E-01 0.975 -1.025 7.79E-01 0.842 -1.187 1.37E-01 0.956 -1.046 6.17E-01 0.772 -1.296 2.09E-01 Transcribed locus, weakly similar to XP_001083232.1 similar to IQ motif 403 1 Dr.140871 Dr.140871 2.154 2.154 9.00E-05 0.835 -1.198 3.59E-01 1.210 1.210 2.60E-01 1.017 1.017 9.33E-01 1.025 1.025 8.72E-01 0.781 -1.281 2.69E-01 containing with AAA domain isoform 1 [Macaca mulatta]
Hypothetical protein 404 1 LOC795752 Dr.118941 795752 1.001 1.001 9.95E-01 1.014 1.014 9.25E-01 1.104 1.104 5.73E-01 1.083 1.083 5.44E-01 0.810 -1.234 1.37E-01 0.598 -1.673 2.65E-06 LOC795752 405 1 Dr.79067 Transcribed locus Dr.79067 0.975 -1.025 9.07E-01 1.001 1.001 9.98E-01 1.076 1.076 6.82E-01 1.099 1.099 6.50E-01 0.692 -1.446 5.19E-03 0.547 -1.829 9.01E-22 406 1 im:7153552 Im:7153552 Dr.75319 606595 0.986 -1.014 8.89E-01 1.315 1.315 4.90E-02 1.282 1.282 7.69E-02 1.041 1.041 7.91E-01 0.705 -1.418 8.25E-02 0.489 -2.043 5.00E-05 Similar to ring finger 407 1 LOC793536 Dr.119248 793536 1.265 1.265 6.13E-02 1.199 1.199 3.32E-02 1.056 1.056 4.73E-01 1.168 1.168 3.68E-02 0.768 -1.301 1.98E-03 0.648 -1.544 2.06E-07 protein 185 Solute carrier family 39 408 1 slc39a13 (zinc transporter), member Dr.75981 368686 1.158 1.158 1.13E-01 1.202 1.202 1.20E-04 1.065 1.065 5.85E-01 1.197 1.197 1.26E-01 0.871 -1.148 3.40E-01 0.629 -1.589 5.56E-13 13 409 1 wu:fj49c06 Wu:fj49c06 Dr.22759 336119 1.175 1.175 2.70E-01 1.175 1.175 4.10E-01 1.008 1.008 9.56E-01 1.124 1.124 4.88E-01 0.732 -1.367 2.44E-02 0.460 -2.176 2.00E-05 410 1 wu:fl02d04 Wu:fl02d04 Dr.122566 335264 0.904 -1.107 5.65E-01 1.049 1.049 8.21E-01 1.254 1.254 9.45E-02 1.506 1.506 2.66E-03 0.584 -1.713 4.00E-05 0.649 -1.542 5.77E-08 411 1 LOC562207 Hypothetical LOC562207 Dr.133880 562207 1.142 1.142 2.26E-01 0.944 -1.059 7.02E-01 1.006 1.006 8.72E-01 1.332 1.332 4.12E-02 0.621 -1.611 1.33E-10 0.581 -1.722 1.81E-17 Similar to cell adhesion 412 1 LOC566122 Dr.79668 566122 0.935 -1.070 8.26E-01 0.903 -1.107 7.38E-01 1.078 1.078 7.48E-01 1.447 1.447 1.16E-01 0.585 -1.710 9.68E-11 0.581 -1.722 1.31E-07 molecule NCAM Hypothetical protein 413 1 LOC553422 Dr.72102 553422 0.825 -1.212 1.99E-01 0.880 -1.136 3.99E-01 1.399 1.399 9.83E-03 1.117 1.117 4.34E-01 0.648 -1.542 1.05E-08 0.662 -1.512 2.07E-02 LOC553422 414 1 wu:fb67h05 Wu:fb67h05 Dr.77299 322620 0.664 -1.506 1.49E-01 0.773 -1.294 3.87E-01 2.067 2.067 3.76E-02 1.221 1.221 3.45E-01 0.400 -2.501 1.08E-09 0.679 -1.472 6.07E-03 415 1 zgc:112118 Zgc:112118 Dr.87575 550435 0.985 -1.015 9.67E-01 0.856 -1.168 6.50E-01 1.763 1.763 3.39E-02 1.182 1.182 5.67E-01 0.568 -1.760 1.78E-09 0.698 -1.433 5.32E-03 Similar to 5-3 416 1 LOC797698 Dr.10637 797698 1.201 1.201 1.59E-01 1.311 1.311 6.60E-02 0.897 -1.114 6.50E-01 0.814 -1.228 1.83E-01 0.936 -1.068 7.72E-01 0.664 -1.506 2.00E-05 exoribonuclease 2 417 1 zgc:92423 Zgc:92423 Dr.141054 445067 1.020 1.020 9.34E-01 1.646 1.646 2.85E-06 0.946 -1.057 4.89E-01 0.687 -1.455 1.80E-04 0.819 -1.221 4.00E-03 0.746 -1.341 8.00E-05 418 1 LOC563874 Hypothetical LOC563874 Dr.84665 563874 1.145 1.145 5.89E-01 3.282 3.282 1.24E-07 1.055 1.055 8.40E-01 0.630 -1.588 1.73E-01 0.662 -1.509 5.60E-02 0.681 -1.469 5.08E-02 ATPase, Na+/K+ 419 1 atp1a1a.3 transporting, alpha 1a.3 Dr.10713 245703 1.086 1.086 3.96E-01 0.998 -1.002 9.89E-01 0.777 -1.287 1.60E-03 0.702 -1.425 1.62E-07 0.842 -1.187 2.17E-01 0.544 -1.837 5.10E-08 polypeptide 420 1 LOC569006 Hypothetical LOC569006 Dr.115342 569006 1.131 1.131 5.83E-01 1.062 1.062 7.60E-01 0.761 -1.313 1.48E-01 0.582 -1.719 4.01E-03 0.783 -1.277 1.35E-01 0.523 -1.911 2.58E-14 421 1 zgc:110191 Zgc:110191 Dr.114250 553593 1.138 1.138 2.94E-01 0.978 -1.023 8.89E-01 0.727 -1.376 2.78E-02 0.616 -1.624 2.62E-07 0.973 -1.027 8.05E-01 0.601 -1.665 6.30E-04 422 1 wu:fl04a11 Wu:fl04a11 Dr.122575 335272 0.947 -1.056 8.44E-01 0.891 -1.122 7.48E-01 0.790 -1.266 2.62E-01 0.526 -1.901 1.84E-03 0.924 -1.083 6.75E-01 0.443 -2.258 5.00E-05 423 1 Dr.19055 Transcribed locus Dr.19055 0.886 -1.129 6.91E-01 1.058 1.058 8.91E-01 0.689 -1.451 1.36E-01 0.571 -1.751 4.44E-02 0.869 -1.151 6.16E-01 0.457 -2.186 1.00E-05 424 1 tlr18 Toll-like receptor 18 Dr.89702 403133 0.872 -1.147 2.57E-01 1.074 1.074 6.13E-01 0.846 -1.182 4.74E-02 0.648 -1.544 3.00E-05 0.887 -1.128 5.05E-02 0.613 -1.632 1.28E-26 Nephrosis 2, idiopathic, 425 1 nphs2l steroid-resistant (podocin)- Dr.12280 557914 0.840 -1.191 4.48E-01 1.127 1.127 5.42E-01 0.913 -1.095 3.07E-01 0.735 -1.361 3.70E-04 0.854 -1.171 4.99E-02 0.597 -1.676 7.00E-05 like 426 1 zgc:86648 Zgc:86648 Dr.5098 447869 0.834 -1.199 7.65E-02 1.092 1.092 4.38E-01 0.820 -1.220 2.71E-02 0.641 -1.560 1.62E-08 0.896 -1.116 4.16E-01 0.779 -1.284 8.82E-02 427 1 zgc:153638 Zgc:153638 Dr.89616 777740 0.871 -1.149 7.23E-01 1.117 1.117 7.74E-01 0.797 -1.254 9.20E-02 0.496 -2.015 1.00E-05 1.016 1.016 9.53E-01 0.721 -1.388 6.95E-02 Solute carrier organic 428 1 slco1c1 anion transporter family, Dr.83831 562772 0.881 -1.136 1.98E-01 0.958 -1.044 7.47E-01 0.661 -1.513 3.43E-03 0.557 -1.795 8.81E-18 1.113 1.113 3.59E-01 0.884 -1.132 3.94E-01 member 1C1 Rho-related BTB domain 429 1 rhobtb2a Dr.115039 553415 1.223 1.223 6.00E-05 0.648 -1.542 2.00E-05 0.619 -1.615 1.42E-15 0.569 -1.759 9.30E-06 0.987 -1.013 8.32E-01 0.726 -1.378 2.67E-11 containing 2a Amiloride-sensitive cation 430 1 accn2c Dr.120630 407670 1.250 1.250 1.04E-01 0.784 -1.276 4.48E-02 0.618 -1.617 5.31E-07 0.684 -1.461 2.15E-03 0.917 -1.090 6.85E-01 0.701 -1.427 4.30E-04 channel 2 c 431 1 wu:fb93g03 Wu:fb93g03 Dr.132381 323265 1.130 1.130 2.98E-01 0.558 -1.792 2.30E-08 0.738 -1.355 1.14E-01 0.576 -1.735 5.10E-08 0.919 -1.088 6.73E-01 0.771 -1.297 3.24E-01
Similar to Acetyl-coenzyme A synthetase, cytoplasmic (Acetate--CoA ligase) (Acyl- 432 1 LOC568763 Dr.83001 560020 1.272 1.272 2.40E-01 0.799 -1.252 3.28E-01 0.475 -2.107 2.03E-07 0.438 -2.282 8.58E-03 1.012 1.012 9.32E-01 0.976 -1.024 8.85E-01 activating enzyme) (Acetyl- CoA synthetase) (ACS) (AceCS)
Transcribed locus, weakly similar to XP_001112624.1 433 1 Dr.83157 similar to RUN domain Dr.83157 1.553 1.553 1.57E-01 1.062 1.062 8.46E-01 0.319 -3.134 8.30E-04 0.341 -2.934 5.00E-05 0.861 -1.162 5.70E-01 0.839 -1.191 5.87E-01 containing 1 [Macaca mulatta]
Calcium/calmodulin- 434 1 camk1g dependent protein kinase Dr.9874 335654 1.103 1.103 6.31E-01 0.804 -1.244 3.13E-01 0.646 -1.547 3.69E-06 0.592 -1.690 2.20E-04 0.795 -1.258 4.75E-02 0.998 -1.002 9.88E-01 IG Megalencephalic 435 1 mlc1 leukoencephalopathy with Dr.119073 559990 1.200 1.200 1.99E-01 1.068 1.068 7.75E-01 0.896 -1.117 3.62E-01 0.593 -1.686 1.33E-07 0.961 -1.040 7.47E-01 0.894 -1.119 4.30E-01 subcortical cysts 1 436 1 zgc:63633 Zgc:63633 Dr.26592 393366 1.273 1.273 5.96E-01 1.108 1.108 8.25E-01 0.902 -1.108 5.63E-01 0.490 -2.041 4.00E-05 1.011 1.011 9.61E-01 0.967 -1.034 9.27E-01 Hypothetical protein 437 1 LOC100004329 Dr.89636 100004329 1.104 1.104 2.96E-01 1.131 1.131 1.79E-01 0.850 -1.176 2.11E-02 0.594 -1.683 2.98E-13 0.974 -1.027 8.66E-01 0.951 -1.051 8.24E-01 LOC100004329
Transcribed locus, weakly similar to XP_222147.4 438 1 Dr.84861 Dr.84861 1.158 1.158 5.27E-01 1.166 1.166 4.44E-01 0.750 -1.334 1.30E-04 0.578 -1.731 4.33E-09 1.065 1.065 7.56E-01 0.817 -1.224 9.21E-02 hypothetical protein [Rattus norvegicus]
439 1 LOC559127 Similar to AWKS9372 Dr.86192 559127 1.444 1.444 9.19E-02 1.143 1.143 7.47E-01 0.649 -1.540 2.14E-02 0.422 -2.370 1.01E-10 0.830 -1.204 2.78E-01 0.745 -1.342 2.03E-01 440 1 zgc:103717 Zgc:103717 Dr.76782 492483 1.274 1.274 4.97E-01 0.880 -1.136 6.96E-01 1.018 1.018 9.11E-01 0.326 -3.066 9.89E-13 1.141 1.141 6.03E-01 0.662 -1.512 1.22E-01 Alpha(1,3)fucosyltransfera 441 1 ft1 Dr.85396 30683 1.202 1.202 5.39E-01 0.929 -1.077 8.05E-01 0.962 -1.040 7.49E-01 0.570 -1.755 4.33E-09 0.917 -1.090 5.68E-01 0.805 -1.242 2.97E-01 se gene 1 442 1 wu:fb77c07 Wu:fb77c07 Dr.132327 322936 2.073 2.073 1.40E-04 1.040 1.040 8.53E-01 0.604 -1.655 5.89E-03 0.497 -2.012 3.46E-07 1.303 1.303 3.35E-01 0.917 -1.090 8.03E-01 Ras homolog gene family, 443 1 rhoua Dr.84141 492802 1.465 1.465 5.01E-02 1.152 1.152 9.61E-02 0.754 -1.325 1.72E-02 0.646 -1.548 1.00E-05 1.040 1.040 6.56E-01 0.921 -1.086 4.01E-01 member Ua 444 1 wu:fc38d09 Wu:fc38d09 Dr.21497 324693 1.148 1.148 3.04E-01 1.340 1.340 1.19E-02 0.799 -1.252 9.54E-03 0.648 -1.543 3.26E-06 0.913 -1.095 5.23E-01 0.997 -1.003 9.83E-01 445 1 Dr.84613 Transcribed locus Dr.84613 1.052 1.052 8.47E-01 1.692 1.692 7.90E-04 0.687 -1.456 3.82E-02 0.586 -1.708 2.90E-09 0.958 -1.044 8.41E-01 0.861 -1.162 3.33E-01 446 1 id:ibd1152 Id:ibd1152 Dr.104509 338300 0.771 -1.297 1.43E-01 0.456 -2.195 3.00E-05 0.935 -1.069 6.66E-01 0.775 -1.291 1.05E-01 1.355 1.355 9.13E-02 0.603 -1.659 6.71E-02 447 1 wu:fb07d03 Wu:fb07d03 Dr.141511 336838 0.903 -1.108 1.92E-01 0.563 -1.777 1.08E-13 0.946 -1.057 6.73E-01 0.706 -1.416 3.22E-02 1.394 1.394 2.47E-02 0.719 -1.391 4.91E-03 448 1 Dr.68835 Transcribed locus Dr.68835 0.901 -1.109 3.38E-01 0.462 -2.162 1.71E-06 1.108 1.108 7.76E-01 0.820 -1.219 5.62E-01 1.550 1.550 4.14E-02 0.678 -1.475 1.24E-01 449 1 si:dkey-37m8.9 Si:dkey-37m8.9 Dr.107057 336081 0.858 -1.165 3.50E-01 0.656 -1.524 1.00E-05 1.122 1.122 1.71E-01 0.851 -1.175 1.47E-01 1.155 1.155 1.14E-01 0.856 -1.168 1.45E-03
Transcribed locus, weakly similar to XP_001111945.1 similar to Molybdenum 450 1 Dr.123433 Dr.123433 1.042 1.042 8.97E-01 0.518 -1.931 4.21E-02 1.340 1.340 1.75E-01 0.870 -1.149 5.26E-01 1.472 1.472 4.49E-02 0.639 -1.566 1.70E-08 cofactor synthesis protein cinnamon [Macaca mulatta]
451 1 Dr.80441 Transcribed locus Dr.80441 1.013 1.013 9.43E-01 0.544 -1.839 6.44E-22 1.428 1.428 2.82E-01 0.958 -1.044 8.94E-01 1.415 1.415 1.30E-01 0.700 -1.428 1.79E-01 452 1 si:ch211-31p3.2 Si:ch211-31p3.2 Dr.79497 325530 1.157 1.157 3.62E-01 0.428 -2.336 9.50E-07 1.102 1.102 6.03E-01 0.685 -1.459 1.79E-02 1.400 1.400 1.21E-01 0.666 -1.501 5.13E-02 453 1 wu:fk25e12 Wu:fk25e12 Dr.81805 336896 1.170 1.170 3.62E-01 0.484 -2.066 1.28E-07 1.188 1.188 5.80E-01 0.915 -1.093 7.61E-01 1.474 1.474 1.00E-01 0.616 -1.622 5.79E-02 454 1 Dr.83202 Transcribed locus Dr.83202 1.050 1.050 7.82E-01 0.538 -1.860 7.55E-07 1.180 1.180 3.30E-01 0.898 -1.113 5.12E-01 1.159 1.159 3.19E-01 0.742 -1.347 4.83E-02 Transcribed locus, moderately similar to 455 1 Dr.84084 XP_001332424.1 Dr.84084 1.061 1.061 7.93E-01 0.480 -2.084 8.58E-03 1.205 1.205 4.64E-01 0.798 -1.253 3.65E-01 1.300 1.300 3.79E-01 0.631 -1.586 2.00E-05 hypothetical protein [Danio rerio] Similar to pre-B cell 456 1 LOC568720 Dr.107484 568720 1.276 1.276 3.74E-01 0.642 -1.559 8.04E-02 0.904 -1.106 5.13E-01 1.018 1.018 9.24E-01 0.875 -1.142 5.30E-01 0.590 -1.696 4.00E-05 enhancing factor Hypothetical protein 457 1 LOC796865 Dr.116887 796865 1.158 1.158 4.33E-01 0.561 -1.782 2.29E-03 1.008 1.008 9.78E-01 1.012 1.012 9.67E-01 1.216 1.216 2.40E-01 0.545 -1.837 9.00E-05 LOC796865 458 1 LOC556362 Hypothetical LOC556362 Dr.17847 556362 1.153 1.153 2.94E-01 0.616 -1.623 2.00E-05 1.032 1.032 7.83E-01 0.921 -1.086 3.70E-01 1.054 1.054 7.92E-01 0.679 -1.473 1.54E-01 Zinc finger and BTB 459 1 zbtb22 Dr.79311 64809 1.225 1.225 8.67E-02 0.701 -1.427 3.03E-03 1.067 1.067 4.18E-01 0.863 -1.158 3.85E-01 1.099 1.099 3.00E-01 0.661 -1.513 1.99E-07 domain containing 22 460 1 Dr.123122 Transcribed locus Dr.123122 0.931 -1.074 5.74E-01 0.504 -1.983 7.00E-05 0.937 -1.068 7.31E-01 1.131 1.131 5.35E-01 1.203 1.203 4.50E-01 0.487 -2.052 1.36E-03 Estrogen-related receptor 461 1 esrrgl Dr.84786 407691 1.010 1.010 9.46E-01 0.666 -1.502 4.00E-05 1.055 1.055 5.97E-01 1.043 1.043 7.42E-01 1.055 1.055 5.12E-01 0.782 -1.278 6.55E-02 gamma-like 462 1 LOC571939 Hypothetical LOC571939 Dr.116371 571939 1.257 1.257 7.43E-02 0.446 -2.242 1.00E-05 0.900 -1.112 5.63E-01 0.710 -1.409 2.03E-02 0.833 -1.201 4.82E-01 0.641 -1.560 7.26E-02 463 1 si:ch211-225p5.3 Si:ch211-225p5.3 Dr.78676 327152 1.122 1.122 5.28E-01 0.479 -2.090 7.18E-07 0.899 -1.113 6.38E-01 0.870 -1.150 6.12E-01 0.838 -1.193 5.12E-01 0.655 -1.527 1.90E-02 SMEK homolog 2, 464 1 smek2 suppressor of mek1 Dr.121387 336198 0.930 -1.075 6.40E-01 0.460 -2.172 4.38E-07 0.776 -1.289 5.60E-02 0.812 -1.231 1.28E-01 (Dictyostelium) 465 1 wu:fi40b08 Wu:fi40b08 Dr.24020 334311 0.995 -1.005 9.69E-01 0.411 -2.435 4.44E-08 0.701 -1.427 3.14E-02 0.670 -1.492 3.82E-02 0.768 -1.303 1.04E-01 0.859 -1.164 3.67E-01 466 1 Dr.122673 Transcribed locus Dr.122673 1.068 1.068 7.29E-01 0.595 -1.679 1.00E-05 0.782 -1.279 7.49E-02 0.792 -1.263 1.33E-01 0.823 -1.215 3.05E-01 0.766 -1.305 1.31E-01 467 1 Dr.121574 Transcribed locus Dr.121574 0.758 -1.319 2.62E-03 0.593 -1.687 1.39E-07 0.923 -1.083 5.77E-01 0.963 -1.038 8.09E-01 0.865 -1.156 5.47E-01 0.715 -1.398 1.72E-02 468 1 LOC566092 Hypothetical LOC566092 Dr.133269 566092 0.784 -1.275 3.56E-02 0.479 -2.089 2.79E-13 0.890 -1.124 4.01E-01 0.900 -1.112 3.44E-01 0.842 -1.188 2.51E-01 0.808 -1.237 1.81E-01 469 1 Dr.76143 Transcribed locus Dr.76143 0.782 -1.278 8.09E-02 0.576 -1.736 2.00E-05 1.084 1.084 6.38E-01 0.905 -1.105 5.39E-01 0.836 -1.196 2.62E-01 0.723 -1.382 2.13E-02 G protein-coupled receptor 470 1 gpr34a Dr.82252 335288 0.818 -1.223 6.20E-01 0.414 -2.416 2.48E-02 1.192 1.192 3.43E-01 0.704 -1.421 3.10E-02 0.695 -1.440 1.42E-02 0.586 -1.705 8.00E-05 34a
Transcribed locus, strongly similar to XP_001088312.1 similar to Actin, alpha 471 1 Dr.125894 Dr.125894 0.951 -1.052 6.91E-01 0.589 -1.696 1.28E-09 0.935 -1.070 6.96E-01 0.685 -1.460 3.22E-02 0.921 -1.086 6.14E-01 0.532 -1.880 1.00E-04 cardiac (Alpha-cardiac actin) isoform 2 [Macaca mulatta]
Transcribed locus, weakly similar to XP_520327.2 472 1 Dr.133001 Dr.133001 0.841 -1.189 4.20E-01 0.541 -1.849 2.00E-05 0.989 -1.011 9.35E-01 0.594 -1.682 8.80E-04 0.936 -1.068 5.02E-01 0.674 -1.484 3.00E-05 hypothetical protein [Pan troglodytes]
Transcribed locus, moderately similar to 473 1 Dr.129805 XP_001084401.1 similar Dr.129805 0.859 -1.164 2.31E-01 0.514 -1.944 1.51E-07 1.185 1.185 3.98E-01 0.760 -1.316 1.11E-01 1.160 1.160 4.97E-01 0.584 -1.711 8.52E-06 to 60S ribosomal protein L26 [Macaca mulatta] Secreted frizzled-related 474 1 sfrp1b Dr.134623 798564 0.899 -1.113 1.18E-02 0.641 -1.559 1.03E-06 1.035 1.035 4.47E-01 0.837 -1.194 4.62E-02 0.996 -1.004 9.80E-01 0.683 -1.464 5.66E-03 protein 1b 475 1 Dr.83244 Transcribed locus Dr.83244 0.911 -1.098 3.05E-01 0.652 -1.533 3.00E-12 1.075 1.075 3.36E-01 0.824 -1.214 3.08E-02 1.035 1.035 7.75E-01 0.810 -1.235 3.32E-02 476 1 Dr.16097 Transcribed locus Dr.16097 1.057 1.057 6.67E-01 0.321 -3.116 4.30E-16 1.205 1.205 5.60E-02 0.779 -1.284 7.54E-02 0.968 -1.033 8.22E-01 0.693 -1.442 2.27E-03 477 1 Dr.104563 Transcribed locus Dr.104563 0.764 -1.309 1.05E-01 0.519 -1.926 3.55E-03 0.592 -1.691 3.45E-02 0.507 -1.972 1.90E-06 0.644 -1.552 5.15E-02 0.447 -2.239 3.28E-11 Coronin, actin binding 478 1 coro1a Dr.114363 337566 0.747 -1.338 3.80E-04 0.723 -1.383 5.14E-08 0.757 -1.320 4.28E-10 0.644 -1.554 2.47E-30 0.797 -1.254 2.44E-09 0.633 -1.580 5.99E-21 protein, 1A 479 1 zgc:153888 Zgc:153888 Dr.83167 768164 0.416 -2.406 2.20E-04 0.300 -3.330 3.39E-15 0.554 -1.806 1.00E-05 0.331 -3.020 2.71E-15 0.409 -2.442 2.87E-09 0.272 -3.679 1.06E-25 Gremlin 1 homolog, 480 1 grem1 cysteine knot superfamily Dr.119605 405778 0.943 -1.060 6.45E-01 0.620 -1.613 2.43E-02 0.738 -1.356 1.64E-01 0.767 -1.303 9.09E-02 0.745 -1.342 2.20E-02 0.579 -1.726 6.00E-05 (Xenopus laevis) 481 1 Dr.86131 Transcribed locus Dr.86131 0.955 -1.047 6.75E-01 0.637 -1.571 6.22E-03 0.826 -1.211 3.55E-02 0.678 -1.474 5.80E-04 0.825 -1.211 9.04E-02 0.645 -1.549 3.00E-05 482 1 zgc:77076 Zgc:77076 Dr.86370 405825 0.901 -1.110 1.81E-01 0.606 -1.651 2.14E-02 0.834 -1.199 2.48E-03 0.642 -1.558 1.19E-15 0.755 -1.325 6.71E-03 0.608 -1.646 2.34E-03 483 1 zgc:92647 Zgc:92647 Dr.29795 436707 0.661 -1.512 7.64E-03 0.457 -2.189 1.77E-06 0.462 -2.164 1.50E-04 0.246 -4.063 2.45E-08 0.539 -1.856 5.00E-05 0.432 -2.314 8.85E-08 Chemokine (C-X-C motif) 484 1 cxcr3.2 Dr.82754 492348 0.826 -1.211 9.30E-02 0.503 -1.988 1.40E-13 0.509 -1.964 0.00E+00 0.276 -3.618 0.00E+00 0.578 -1.729 3.93E-15 0.396 -2.528 3.06E-11 receptor 3.2 485 1 LOC557408 Hypothetical LOC557408 Dr.91613 557408 0.926 -1.080 6.25E-01 0.721 -1.387 2.25E-01 0.732 -1.365 1.35E-02 0.536 -1.867 1.54E-06 0.679 -1.472 3.41E-02 0.608 -1.644 2.23E-02 Hypothetical protein 486 1 LOC100006560 Dr.84920 100006560 0.974 -1.027 8.40E-01 0.810 -1.234 5.05E-02 0.733 -1.364 4.07E-06 0.655 -1.527 9.00E-05 0.778 -1.286 2.36E-02 0.703 -1.422 9.48E-08 LOC100006560 Similar to leukotriene B4 487 1 LOC100006321 Dr.87054 100006321 0.871 -1.148 4.24E-01 0.775 -1.290 9.26E-02 0.869 -1.150 5.39E-01 0.583 -1.716 6.88E-07 0.751 -1.331 2.41E-02 0.692 -1.445 2.60E-02 receptor 488 1 hoxc12a Homeobox c12a Dr.140970 562600 0.718 -1.392 3.65E-03 0.786 -1.272 2.25E-02 0.867 -1.153 1.15E-02 0.629 -1.590 2.97E-21 0.796 -1.256 2.64E-06 0.868 -1.152 1.74E-03 489 1 wu:fj59h10 Wu:fj59h10 Dr.22812 336261 0.691 -1.448 3.07E-02 0.674 -1.483 1.74E-02 0.757 -1.321 2.06E-02 0.658 -1.519 2.73E-06 0.704 -1.420 1.05E-03 0.749 -1.334 9.07E-02 490 1 LOC563053 Hypothetical LOC563053 Dr.78391 563053 0.619 -1.614 1.08E-02 0.674 -1.485 2.03E-01 0.740 -1.351 4.75E-01 0.556 -1.798 1.93E-07 0.692 -1.445 6.60E-04 0.708 -1.413 7.00E-05 Lymphocyte cytosolic 491 1 lcp1 Dr.25823 30583 0.790 -1.266 2.58E-02 0.689 -1.451 4.90E-04 0.781 -1.280 1.25E-02 0.660 -1.515 3.65E-06 0.929 -1.077 6.03E-01 0.744 -1.345 3.60E-02 plastin 1 492 1 zgc:77651 Zgc:77651 Dr.29076 406530 0.736 -1.358 2.10E-02 0.771 -1.297 4.94E-02 0.813 -1.230 1.83E-01 0.635 -1.575 2.00E-05 1.003 1.003 9.89E-01 0.716 -1.396 7.14E-03 493 1 zgc:136816 Zgc:136816 Dr.825 723996 0.512 -1.953 1.10E-06 0.528 -1.894 1.00E-05 0.680 -1.471 1.53E-08 0.490 -2.041 8.42E-06 0.937 -1.067 6.03E-01 0.544 -1.839 7.56E-07 Hypothetical protein 494 1 LOC100003446 Dr.94265 100003446 0.678 -1.476 7.11E-02 0.653 -1.531 1.67E-01 0.901 -1.110 6.05E-01 0.447 -2.239 9.47E-11 0.866 -1.154 4.44E-01 0.563 -1.777 1.82E-06 LOC100003446 495 1 zgc:56085 Zgc:56085 Dr.11252 327506 0.579 -1.727 1.46E-11 0.664 -1.506 1.90E-04 1.120 1.120 1.60E-01 0.806 -1.240 9.20E-04 0.803 -1.245 3.77E-02 0.802 -1.247 4.66E-02 496 1 LOC557257 Similar to autoantigen Dr.76578 557257 0.554 -1.805 4.02E-02 0.670 -1.492 1.45E-01 1.119 1.119 1.84E-01 0.796 -1.256 1.84E-01 0.684 -1.462 6.42E-03 0.611 -1.636 4.00E-05 497 1 zgc:111976 Zgc:111976 Dr.85177 553663 0.478 -2.091 5.49E-08 0.723 -1.383 6.18E-02 1.006 1.006 9.71E-01 0.841 -1.189 1.76E-01 0.691 -1.447 1.27E-02 0.657 -1.521 1.12E-03 498 1 im:6894100 Im:6894100 Dr.133462 552929 0.628 -1.594 1.48E-16 0.812 -1.232 4.17E-02 0.952 -1.050 6.41E-01 0.809 -1.236 2.10E-02 0.872 -1.146 7.80E-02 0.763 -1.310 2.20E-03 N-myc downstream 499 1 ndrg1l Dr.8090 393665 0.622 -1.607 9.00E-05 0.713 -1.403 2.18E-03 0.882 -1.134 2.75E-01 0.798 -1.254 3.50E-03 0.879 -1.138 3.42E-01 0.769 -1.300 1.14E-01 regulated gene 1, like Similar to tyrosine protein 500 1 LOC568653 Dr.133658 568653 0.540 -1.852 4.00E-05 0.673 -1.487 1.71E-02 0.776 -1.288 1.78E-01 0.781 -1.280 2.01E-01 0.700 -1.428 3.01E-02 0.719 -1.392 1.69E-01 kinase BTK 501 1 zgc:92252 Zgc:92252 Dr.81006 436895 0.414 -2.415 7.75E-06 0.497 -2.012 3.99E-03 0.844 -1.186 1.19E-01 0.681 -1.469 1.27E-02 0.676 -1.480 9.61E-06 0.820 -1.220 1.03E-01 Guanine nucleotide 502 1 gnb3l binding protein (G protein), Dr.32120 436710 0.550 -1.818 2.76E-07 0.630 -1.588 7.21E-08 1.012 1.012 9.47E-01 0.928 -1.078 5.97E-01 0.988 -1.012 9.63E-01 0.613 -1.630 5.98E-02 beta polypeptide 3, like
503 1 zgc:77905 Zgc:77905 Dr.81416 393867 0.547 -1.829 1.17E-07 0.568 -1.760 4.01E-14 0.881 -1.135 3.26E-01 0.844 -1.184 1.97E-01 0.984 -1.016 9.04E-01 0.648 -1.543 2.67E-03 CDNA clone 504 1 Dr.78245 Dr.78245 0.619 -1.614 1.74E-02 0.680 -1.470 4.97E-02 1.092 1.092 5.25E-01 0.819 -1.221 1.10E-01 0.938 -1.066 4.67E-01 0.641 -1.560 3.00E-05 IMAGE:7220766 Calcium channel, voltage- 505 1 cacna1c dependent, L type, alpha Dr.83683 170581 0.745 -1.343 4.32E-03 0.701 -1.426 7.48E-03 1.016 1.016 8.18E-01 0.855 -1.170 1.88E-02 0.924 -1.082 4.19E-01 0.614 -1.627 2.87E-09 1C subunit 506 1 LOC562744 Hypothetical LOC562744 Dr.120600 562744 0.454 -2.205 9.23E-07 0.479 -2.087 8.92E-07 0.909 -1.100 6.28E-01 0.642 -1.557 2.62E-02 0.831 -1.204 2.70E-01 0.604 -1.656 1.65E-06 507 1 LOC100000095 Similar to cholecystokinin Dr.83652 100000095 0.676 -1.480 2.52E-07 0.653 -1.531 4.84E-08 0.941 -1.063 5.50E-01 0.778 -1.286 1.36E-03 0.866 -1.155 6.16E-02 0.740 -1.352 2.20E-06 508 1 zgc:92191 Zgc:92191 Dr.33969 445029 0.725 -1.380 1.90E-04 0.657 -1.522 6.00E-05 0.997 -1.003 9.68E-01 0.821 -1.217 4.61E-03 0.878 -1.139 3.44E-01 0.822 -1.216 4.01E-02
Transcribed locus, weakly similar to XP_001111693.1 509 1 Dr.140791 hepatoma-derived growth Dr.140791 0.683 -1.465 1.00E-04 0.635 -1.575 2.97E-06 0.984 -1.016 8.51E-01 0.908 -1.101 1.64E-01 0.916 -1.092 6.66E-02 0.800 -1.250 6.00E-04 factor, related protein 3 [Macaca mulatta]
510 1 matn1 Matrilin 1 Dr.82373 403023 0.705 -1.418 5.08E-03 0.578 -1.731 6.00E-05 1.064 1.064 5.06E-01 0.854 -1.170 1.88E-01 0.890 -1.123 3.46E-01 0.824 -1.213 1.28E-01 511 1 im:7141573 Im:7141573 Dr.90963 492566 0.536 -1.865 7.30E-09 0.501 -1.996 1.93E-12 0.940 -1.064 6.07E-01 0.808 -1.238 1.55E-01 0.873 -1.145 4.31E-01 0.851 -1.175 3.46E-01 512 1 zgc:65831 Zgc:65831 Dr.12437 393541 0.704 -1.420 5.78E-12 0.659 -1.518 4.80E-11 0.882 -1.134 2.00E-01 0.767 -1.304 1.86E-03 0.950 -1.053 4.64E-01 0.898 -1.114 1.41E-01 513 1 zgc:113277 Zgc:113277 Dr.87180 553814 0.560 -1.787 9.66E-06 0.513 -1.950 1.20E-04 0.800 -1.249 2.45E-01 0.641 -1.559 4.20E-04 0.897 -1.115 4.94E-01 0.718 -1.393 4.86E-02 514 1 si:dkey-236e20.5 Si:dkey-236e20.5 Dr.36001 322415 0.575 -1.740 3.87E-10 0.420 -2.384 2.67E-09 0.842 -1.187 1.56E-01 0.711 -1.407 6.27E-03 0.750 -1.333 4.73E-02 0.811 -1.233 1.21E-01 515 1 zgc:103747 Zgc:103747 Dr.36931 334744 0.758 -1.320 2.70E-02 0.565 -1.770 5.99E-12 0.976 -1.025 7.06E-01 0.718 -1.394 1.00E-04 1.026 1.026 8.53E-01 0.867 -1.153 2.70E-01 516 1 zgc:85746 Zgc:85746 Dr.82666 407988 0.711 -1.406 1.11E-01 0.655 -1.527 2.00E-05 1.046 1.046 7.79E-01 0.783 -1.277 2.12E-01 0.957 -1.045 8.60E-01 0.911 -1.097 6.19E-01 517 1 zgc:92161 Zgc:92161 Dr.114476 447817 0.829 -1.206 4.48E-01 0.594 -1.684 1.42E-03 0.590 -1.694 3.50E-04 0.608 -1.645 2.34E-07 0.685 -1.460 3.05E-02 1.006 1.006 9.78E-01 518 1 LOC559097 Hypothetical LOC559097 Dr.85695 559097 0.892 -1.122 4.20E-01 0.554 -1.804 2.00E-05 0.670 -1.494 4.68E-02 0.640 -1.562 3.93E-06 0.711 -1.407 2.08E-02 1.010 1.010 9.36E-01 Novel immune-type 519 1 nitr2b Dr.83336 60647 0.646 -1.549 3.42E-02 0.655 -1.526 4.00E-05 0.753 -1.329 2.18E-02 0.686 -1.458 1.91E-03 0.711 -1.406 1.00E-04 1.182 1.182 4.27E-03 receptor 2b 520 1 zgc:73310 Zgc:73310 Dr.115522 393758 0.800 -1.250 7.22E-03 0.652 -1.533 1.95E-06 0.872 -1.147 2.51E-01 0.802 -1.248 1.09E-01 0.830 -1.204 3.99E-01 1.044 1.044 8.32E-01 521 1 Dr.134588 Transcribed locus Dr.134588 0.754 -1.326 2.90E-04 0.595 -1.680 1.36E-06 0.913 -1.095 2.35E-01 0.745 -1.343 7.20E-04 0.896 -1.116 1.39E-01 1.020 1.020 8.57E-01 522 1 sfxn1 Sideroflexin 1 Dr.33964 445143 0.825 -1.212 2.98E-01 0.526 -1.903 6.61E-06 0.897 -1.115 1.41E-01 0.602 -1.660 5.30E-02 0.845 -1.183 3.54E-01 1.102 1.102 4.64E-01 523 1 brd1 Bromodomain containing 1 Dr.91233 449908 0.664 -1.505 3.58E-01 0.529 -1.890 3.07E-02 1.029 1.029 9.49E-01 0.518 -1.931 1.79E-08 0.721 -1.387 1.82E-01 0.808 -1.238 3.72E-01 524 1 cry2a Cryptochrome 2a Dr.116325 83779 0.698 -1.433 2.22E-02 0.750 -1.333 3.96E-02 0.746 -1.341 8.05E-02 0.572 -1.748 9.15E-06 0.978 -1.022 8.49E-01 1.156 1.156 8.68E-02 Similar to Transducin-like 525 1 LOC564019 Dr.120150 564019 0.737 -1.356 6.31E-02 0.796 -1.256 2.11E-01 0.783 -1.276 2.84E-01 0.510 -1.962 6.09E-06 0.919 -1.088 5.69E-01 0.923 -1.084 6.07E-01 enhancer protein 4
Transcribed locus, weakly similar to XP_001116017.1 similar to phosphoinositide- 526 1 Dr.84832 Dr.84832 0.834 -1.200 6.29E-01 0.593 -1.686 1.47E-01 0.708 -1.412 1.21E-01 0.401 -2.492 9.63E-10 1.145 1.145 5.55E-01 0.860 -1.163 6.23E-01 specific phospholipase C beta 1 isoform a [Macaca mulatta]
527 1 LOC565701 Hypothetical LOC565701 Dr.78739 565701 0.655 -1.527 4.00E-05 0.785 -1.274 7.48E-02 0.871 -1.149 5.51E-01 0.759 -1.317 3.90E-04 1.107 1.107 1.67E-01 0.999 -1.001 9.88E-01 528 1 zgc:92109 Zgc:92109 Dr.81623 492328 0.611 -1.636 1.20E-04 0.630 -1.588 7.00E-05 0.774 -1.293 5.77E-02 0.713 -1.402 9.54E-03 1.197 1.197 1.41E-02 0.886 -1.128 5.77E-02 Hypothetical protein 529 1 LOC100003936 Dr.114594 100003936 0.567 -1.765 1.06E-01 0.856 -1.168 6.17E-01 0.795 -1.257 4.65E-01 1.054 1.054 8.76E-01 0.483 -2.072 1.98E-06 0.846 -1.183 4.39E-01 LOC100003936 530 1 LOC571991 Hypothetical LOC571991 Dr.77176 571991 0.943 -1.060 4.79E-01 0.733 -1.364 1.39E-03 0.914 -1.094 2.33E-01 1.188 1.188 2.46E-01 0.643 -1.554 4.89E-08 1.144 1.144 4.71E-01 Hypothetical protein 531 1 LOC100002043 Dr.121481 100002043 0.773 -1.293 1.35E-01 0.605 -1.653 6.10E-03 0.984 -1.016 8.90E-01 1.570 1.570 1.32E-03 0.580 -1.725 7.47E-11 0.704 -1.421 5.20E-04 LOC100002043 Retinoschisis (X-linked, 532 1 rs1 Dr.133096 445044 0.616 -1.623 6.00E-05 0.793 -1.261 1.23E-01 1.256 1.256 2.53E-03 1.022 1.022 7.70E-01 0.738 -1.356 8.41E-02 0.751 -1.332 4.97E-02 juvenile) 1 533 1 Dr.14167 Transcribed locus Dr.14167 0.645 -1.549 6.00E-05 0.695 -1.438 1.86E-01 1.148 1.148 2.63E-01 1.239 1.239 8.47E-03 0.692 -1.444 5.66E-09 0.774 -1.292 1.72E-03
Guanine nucleotide binding protein (G protein), 534 1 gngt2 Dr.19203 335655 0.647 -1.546 3.00E-05 0.605 -1.654 1.00E-05 1.235 1.235 5.40E-03 1.109 1.109 8.89E-02 0.898 -1.114 9.08E-03 0.823 -1.216 4.40E-04 gamma transducing activity polypeptide 2
FXYD domain containing 535 1 fxyd6 Dr.26591 333987 0.588 -1.701 8.24E-10 0.501 -1.995 3.50E-04 1.256 1.256 1.25E-01 1.297 1.297 1.67E-01 0.814 -1.229 2.89E-01 0.828 -1.208 2.41E-01 ion transport regulator 6 536 1 Dr.76725 Transcribed locus Dr.76725 0.343 -2.913 4.00E-05 0.397 -2.517 2.70E-04 1.793 1.793 5.47E-02 1.546 1.546 1.09E-01 0.732 -1.366 3.25E-02 0.686 -1.457 2.45E-01 Serpin peptidase inhibitor, clade A (alpha-1 537 1 serpina7 Dr.46572 449799 0.603 -1.658 8.80E-04 0.449 -2.229 6.03E-06 1.104 1.104 6.24E-01 1.304 1.304 8.53E-02 0.816 -1.226 2.22E-01 0.616 -1.622 2.60E-04 antiproteinase, antitrypsin), member 7 538 1 pcdh1a3 Protocadherin 1 alpha 3 Dr.47088 497127 0.646 -1.548 1.36E-01 0.503 -1.989 2.00E-05 1.019 1.019 9.23E-01 1.313 1.313 1.23E-01 0.877 -1.140 4.85E-01 0.558 -1.793 6.10E-07 539 1 Dr.84615 Transcribed locus Dr.84615 0.414 -2.417 6.60E-04 0.290 -3.442 5.00E-05 1.081 1.081 8.14E-01 2.776 2.776 1.76E-03 0.815 -1.227 5.67E-01 0.919 -1.088 7.59E-01 540 1 wu:fb58g10 Wu:fb58g10 Dr.77046 322355 0.784 -1.276 1.33E-01 0.658 -1.520 8.14E-10 1.054 1.054 6.52E-01 0.975 -1.025 8.36E-01 0.844 -1.185 6.18E-01 1.008 1.008 9.77E-01 541 1 zgc:162301 Zgc:162301 Dr.84698 797343 0.778 -1.285 4.61E-01 0.224 -4.456 7.39E-07 1.606 1.606 5.80E-02 1.442 1.442 1.93E-01 0.700 -1.429 3.93E-02 1.328 1.328 4.41E-01 Heat shock cognate 70-kd 542 1 hsp70 Dr.114305 30671 0.568 -1.761 5.23E-09 1.278 1.278 7.25E-02 0.919 -1.088 5.34E-01 1.369 1.369 2.08E-02 1.022 1.022 9.22E-01 0.840 -1.191 2.87E-01 protein 543 1 LOC562320 Hypothetical LOC562320 Dr.115891 562320 0.701 -1.426 3.34E-01 0.834 -1.199 6.75E-01 0.535 -1.870 9.43E-03 1.031 1.031 9.09E-01 1.255 1.255 2.62E-01 0.426 -2.349 3.00E-05 544 1 Dr.102711 Transcribed locus Dr.102711 0.794 -1.259 5.91E-01 0.403 -2.481 2.00E-05 0.444 -2.251 1.10E-03 0.521 -1.920 1.46E-01 1.052 1.052 8.59E-01 1.625 1.625 6.44E-02 POU domain, class 1, 545 1 pou1f1 Dr.89712 405777 0.777 -1.288 1.58E-01 0.518 -1.930 1.00E-04 0.616 -1.624 5.64E-07 0.736 -1.359 7.53E-03 1.052 1.052 7.34E-01 1.018 1.018 9.07E-01 transcription factor 1
Solute carrier family 16 546 1 slc16a9a (monocarboxylic acid Dr.7340 393382 0.558 -1.791 1.94E-07 0.468 -2.139 3.26E-17 0.235 -4.250 0.00E+00 0.260 -3.848 0.00E+00 1.234 1.234 7.50E-03 1.617 1.617 2.00E-05 transporters), member 9a
547 1 klhl Transcribed locus Dr.132373 323332 0.878 -1.139 4.62E-01 0.797 -1.255 2.45E-01 0.595 -1.681 2.45E-18 0.892 -1.121 2.28E-01 1.284 1.284 2.35E-01 1.186 1.186 4.27E-01 548 1 zgc:153863 Zgc:153863 Dr.37700 566132 1.030 1.030 7.95E-01 0.630 -1.587 2.97E-11 0.873 -1.145 1.67E-03 0.730 -1.370 1.00E-05 1.473 1.473 8.60E-04 1.102 1.102 4.66E-01 549 1 Dr.126534 Transcribed locus Dr.126534 0.509 -1.963 6.82E-02 0.758 -1.319 4.68E-01 0.481 -2.080 6.49E-06 0.955 -1.047 7.02E-01 0.740 -1.352 1.92E-01 1.612 1.612 1.51E-03 Similar to Solute carrier family 7 (cationic amino 550 1 LOC100005141 Dr.119870 100005141 0.999 -1.001 9.98E-01 0.904 -1.106 6.00E-01 0.712 -1.404 2.42E-01 0.788 -1.269 4.13E-01 0.722 -1.385 5.00E-05 1.640 1.640 1.00E-05 acid transporter, y+ system), member 3 551 1 wu:fc23d01 Wu:fc23d01 Dr.22938 793794 1.338 1.338 5.64E-02 1.001 1.001 9.97E-01 0.680 -1.470 2.38E-01 0.545 -1.835 4.63E-02 0.615 -1.625 1.27E-07 2.022 2.022 8.48E-09
Solute carrier family 16 552 1 slc16a9b (monocarboxylic acid Dr.140314 445158 1.333 1.333 4.04E-02 1.084 1.084 4.83E-01 0.588 -1.701 1.69E-03 0.648 -1.543 1.26E-02 0.628 -1.593 1.95E-09 1.190 1.190 8.14E-02 transporters), member 9b
553 1 il12a Interleukin 12a Dr.135199 445410 1.338 1.338 5.89E-03 0.925 -1.081 3.75E-01 0.585 -1.710 8.70E-10 0.816 -1.226 1.55E-02 1.090 1.090 2.53E-01 1.407 1.407 5.36E-03 554 1 Dr.132218 Transcribed locus Dr.132218 0.930 -1.076 8.23E-01 1.110 1.110 7.43E-01 0.584 -1.714 2.00E-05 0.828 -1.208 4.02E-01 0.990 -1.010 9.52E-01 0.954 -1.048 7.60E-01 Egl nine homolog 3 (C. 555 1 egln3 Dr.9457 406602 0.985 -1.015 9.24E-01 2.039 2.039 1.19E-03 0.157 -6.385 2.18E-27 0.510 -1.963 2.59E-02 1.200 1.200 6.52E-01 0.522 -1.917 4.60E-04 elegans) Hypothetical protein 556 1 LOC100007692 Dr.133450 100007692 1.332 1.332 4.34E-01 1.219 1.219 5.10E-01 0.356 -2.805 7.00E-05 0.664 -1.505 1.65E-01 0.865 -1.156 5.03E-01 1.104 1.104 7.14E-01 LOC100007692 557 1 Dr.82741 Transcribed locus Dr.82741 1.000 1.000 1.00E+00 1.000 1.000 1.00E+00 0.078 -12.849 4.02E-06 1.000 1.000 1.00E+00 1.000 1.000 1.00E+00 1.000 1.000 1.00E+00
558 2a wu:fd02c11 Wu:fd02c11 Dr.79060 325683 1.083 1.083 3.40E-01 1.252 1.252 1.40E-02 0.610 -1.640 1.00E-05 0.964 -1.037 8.12E-01 0.738 -1.354 1.71E-01 0.944 -1.060 6.80E-01 559 2a zgc:92851 Zgc:92851 Dr.10032 436766 1.258 1.258 1.56E-03 1.334 1.334 1.00E-05 1.009 1.009 8.79E-01 1.060 1.060 4.77E-01 1.030 1.030 7.57E-01 2.644 2.644 6.16E-31 560 2a LOC563152 Similar to chemokine CK-1 Dr.133624 563152 1.663 1.663 2.62E-02 1.743 1.743 5.50E-04 1.345 1.345 3.52E-01 1.342 1.342 1.57E-01 1.284 1.284 2.64E-01 11.361 11.361 1.25E-07
BRF1 homolog, subunit of RNA polymerase III 561 2a brf1 Dr.20342 334402 1.109 1.109 5.87E-01 1.484 1.484 1.82E-01 0.903 -1.107 7.92E-01 1.386 1.386 5.16E-02 1.117 1.117 7.03E-01 3.147 3.147 1.35E-33 transcription initiation factor IIIB Hypothetical protein 562 2a LOC553285 Dr.115906 553285 0.976 -1.025 8.33E-01 1.088 1.088 4.30E-02 0.961 -1.040 6.65E-01 1.032 1.032 6.53E-01 1.165 1.165 2.58E-01 1.992 1.992 9.87E-07 LOC553285 L-threonine 563 2a tdh Dr.10250 406528 1.027 1.027 6.65E-01 1.031 1.031 7.20E-01 1.049 1.049 3.51E-01 1.241 1.241 4.62E-03 1.179 1.179 2.27E-02 1.819 1.819 3.49E-13 dehydrogenase 564 2a wu:fb57f08 Wu:fb57f08 Dr.23725 322318 1.222 1.222 6.60E-01 1.255 1.255 2.34E-01 1.571 1.571 3.70E-01 3.143 3.143 2.92E-03 2.932 2.932 2.00E-05 30.249 30.249 6.75E-39 CCAAT/enhancer binding 565 2a cebpg Dr.15663 140816 1.027 1.027 7.49E-01 1.082 1.082 6.02E-01 1.029 1.029 7.75E-01 1.229 1.229 4.66E-02 1.175 1.175 2.17E-01 1.775 1.775 3.00E-05 protein (C/EBP), gamma
566 2a hig1 Hypoxia induced gene 1 Dr.76367 373084 1.105 1.105 4.23E-01 1.032 1.032 7.28E-01 1.039 1.039 4.79E-01 1.425 1.425 1.79E-06 1.546 1.546 1.55E-02 2.579 2.579 1.46E-08 Hypothetical protein 567 2a LOC100003911 Dr.92011 100003911 1.154 1.154 7.83E-01 1.267 1.267 5.57E-01 1.034 1.034 4.90E-01 1.626 1.626 1.34E-02 1.743 1.743 1.07E-07 4.181 4.181 1.09E-24 LOC100003911 568 2a zgc:114170 Zgc:114170 Dr.91502 557352 1.158 1.158 9.49E-02 1.183 1.183 1.38E-01 0.958 -1.044 6.72E-01 1.602 1.602 3.16E-02 1.361 1.361 1.60E-02 3.016 3.016 3.64E-27 Hypothetical protein 569 2a LOC100007403 Dr.119610 100007403 0.883 -1.132 5.25E-01 1.066 1.066 7.11E-01 1.088 1.088 3.57E-01 1.688 1.688 1.41E-01 1.632 1.632 7.17E-11 4.344 4.344 2.60E-16 LOC100007403 570 2a wu:fi38a11 Wu:fi38a11 Dr.20697 334257 0.856 -1.169 4.50E-01 0.972 -1.029 8.26E-01 1.206 1.206 2.11E-01 1.713 1.713 4.47E-06 1.675 1.675 1.60E-03 6.807 6.807 2.05E-10 571 2a si:busm1-57f23.1 Si:busm1-57f23.1 Dr.81717 368621 0.945 -1.058 4.64E-01 1.000 -1.000 9.99E-01 1.110 1.110 7.15E-02 1.353 1.353 9.06E-10 1.333 1.333 2.00E-05 2.490 2.490 5.64E-21 572 2a zgc:101688 Zgc:101688 Dr.82220 494109 0.972 -1.029 8.74E-01 0.963 -1.038 9.05E-01 1.397 1.397 3.00E-02 1.918 1.918 6.00E-05 2.444 2.444 4.41E-02 8.939 8.939 2.00E-05 573 2a si:ch211-199g17.7 Si:ch211-199g17.7 Dr.78777 324497 0.943 -1.060 6.40E-01 1.200 1.200 2.45E-01 1.105 1.105 4.13E-01 1.302 1.302 1.15E-02 1.336 1.336 1.12E-02 3.220 3.220 6.87E-17 574 2a fkbp5 FK506 binding protein 5 Dr.78793 368924 1.156 1.156 7.94E-02 0.972 -1.029 7.15E-01 1.194 1.194 1.52E-02 1.680 1.680 5.07E-08 1.297 1.297 9.00E-05 3.318 3.318 0.00E+00 Usher syndrome 1C 575 2a ush1c (autosomal recessive, Dr.80034 564412 1.040 1.040 6.68E-01 0.938 -1.066 5.61E-01 1.058 1.058 4.32E-01 1.230 1.230 2.73E-02 1.206 1.206 9.93E-02 1.801 1.801 2.37E-13 severe) 576 2a sb:cb474 Sb:cb474 Dr.77270 321271 1.001 1.001 9.95E-01 0.959 -1.042 7.19E-01 0.968 -1.033 8.20E-01 1.174 1.174 2.32E-01 1.353 1.353 7.00E-05 1.930 1.930 9.68E-07 Similar to ubquitin-like 577 2a LOC558956 Dr.114892 558956 1.265 1.265 3.70E-02 1.193 1.193 2.32E-03 1.759 1.759 1.18E-02 2.126 2.126 3.97E-02 1.934 1.934 6.00E-05 4.427 4.427 6.00E-04 protein 1 578 2a wu:fc25e04 Wu:fc25e04 Dr.21605 324319 1.063 1.063 4.92E-01 1.042 1.042 6.43E-01 1.147 1.147 5.27E-02 1.247 1.247 3.36E-02 1.269 1.269 7.48E-03 1.583 1.583 1.39E-12 Similar to Si:busm1-6a2.1 579 2a LOC799812 Dr.26143 799812 1.804 1.804 4.27E-02 1.476 1.476 2.26E-01 1.771 1.771 1.30E-01 2.677 2.677 4.08E-03 2.543 2.543 1.79E-02 7.421 7.421 5.24E-07 protein 580 2a wu:fa98e11 Wu:fa98e11 Dr.76350 337130 1.287 1.287 5.25E-03 1.285 1.285 3.50E-04 1.319 1.319 1.05E-03 1.765 1.765 7.02E-07 1.611 1.611 2.64E-09 2.359 2.359 1.21E-21 581 2a si:dkey-25e12.3 Si:dkey-25e12.3 Dr.78146 569300 1.214 1.214 7.56E-02 1.315 1.315 2.96E-02 1.572 1.572 6.60E-04 2.191 2.191 5.21E-07 1.875 1.875 8.88E-08 3.269 3.269 5.05E-30 582 2a wu:fj14f03 Wu:fj14f03 Dr.132807 335460 1.031 1.031 7.92E-01 1.121 1.121 3.71E-01 1.094 1.094 1.29E-01 1.379 1.379 2.15E-07 1.207 1.207 2.74E-02 1.780 1.780 1.52E-24 Pleckstrin homology domain containing, family 583 2a plekhf1 Dr.80998 393311 1.121 1.121 1.97E-01 1.155 1.155 1.65E-01 1.047 1.047 8.00E-01 1.781 1.781 1.46E-03 1.322 1.322 7.61E-03 2.550 2.550 3.13E-12 F (with FYVE domain) member 1 584 2a zgc:77882 Zgc:77882 Dr.78307 323671 1.065 1.065 5.78E-01 1.154 1.154 1.44E-01 1.029 1.029 4.02E-01 1.339 1.339 1.84E-20 1.227 1.227 3.70E-03 1.561 1.561 1.51E-06 Hypothetical protein 585 2a LOC407664 Dr.83237 407664 1.064 1.064 6.83E-01 1.112 1.112 4.92E-01 1.128 1.128 5.25E-01 1.498 1.498 1.19E-02 1.235 1.235 1.16E-02 1.671 1.671 7.00E-05 LOC407664 Hypothetical protein 586 2a LOC791930 Dr.79753 791930 1.094 1.094 4.50E-01 1.096 1.096 4.48E-01 1.054 1.054 6.72E-01 1.679 1.679 2.90E-04 1.592 1.592 4.00E-05 2.377 2.377 2.15E-07 LOC791930 Zinc finger protein 36, C3H 587 2a zfp36l1 Dr.31482 338213 1.137 1.137 1.80E-01 1.281 1.281 5.38E-09 1.052 1.052 1.70E-01 1.328 1.328 1.33E-35 1.192 1.192 2.96E-02 1.924 1.924 9.00E-05 type-like 1
E74-like factor 3 (ets 588 2a elf3 domain transcription factor, Dr.76707 336816 1.456 1.456 1.15E-10 1.609 1.609 6.82E-12 1.146 1.146 2.78E-01 1.843 1.843 9.33E-03 1.536 1.536 3.46E-21 3.289 3.289 4.10E-07 epithelial-specific )
589 2a si:dkeyp-20g2.4 Si:dkeyp-20g2.4 Dr.82396 334561 1.154 1.154 2.70E-04 1.187 1.187 4.12E-09 1.094 1.094 6.91E-03 1.308 1.308 7.71E-08 1.218 1.218 1.50E-03 1.590 1.590 1.43E-10 590 2a zgc:158404 Zgc:158404 Dr.89148 557029 1.824 1.824 3.00E-05 1.743 1.743 6.90E-04 1.194 1.194 2.35E-01 2.103 2.103 8.04E-12 1.845 1.845 1.07E-06 6.027 6.027 5.75E-23 591 2a zgc:101687 Zgc:101687 Dr.82189 450053 1.131 1.131 3.09E-01 1.288 1.288 7.76E-03 1.242 1.242 8.70E-04 1.513 1.513 4.00E-05 1.331 1.331 1.13E-03 2.389 2.389 1.92E-18 592 2a zgc:92762 Zgc:92762 Dr.84618 436834 1.250 1.250 9.28E-02 2.023 2.023 4.25E-14 1.359 1.359 1.36E-03 2.083 2.083 3.34E-38 1.787 1.787 8.40E-07 4.414 4.414 5.89E-15 593 2a wu:fb01b03 Wu:fb01b03 Dr.70656 337182 1.163 1.163 2.35E-01 1.173 1.173 3.83E-01 1.171 1.171 5.12E-02 1.270 1.270 1.70E-01 1.105 1.105 2.15E-01 1.975 1.975 4.45E-09 594 2a im:7140162 Im:7140162 Dr.109254 492532 1.104 1.104 6.40E-01 1.257 1.257 2.21E-01 1.231 1.231 1.23E-01 1.354 1.354 1.41E-02 1.890 1.890 1.90E-04 2.508 2.508 6.30E-08 595 2a wu:fk14g08 Wu:fk14g08 Dr.81512 337300 1.097 1.097 6.92E-01 1.293 1.293 9.55E-03 1.583 1.583 4.00E-04 1.790 1.790 1.74E-07 3.453 3.453 4.05E-34 7.209 7.209 1.18E-08 596 2a zgc:101739 Zgc:101739 Dr.80825 447890 1.240 1.240 1.81E-01 1.354 1.354 3.70E-04 1.514 1.514 2.02E-02 1.325 1.325 1.14E-01 3.034 3.034 0.00E+00 5.648 5.648 0.00E+00 Cholinergic receptor, 597 2a chrngl Dr.21772 325080 1.267 1.267 5.07E-02 1.344 1.344 9.12E-03 0.924 -1.083 4.11E-01 1.641 1.641 9.66E-07 2.275 2.275 3.60E-04 3.390 3.390 3.01E-07 nicotinic, gamma like 598 2a zgc:110152 Zgc:110152 Dr.27897 550551 1.603 1.603 8.36E-02 1.637 1.637 7.40E-04 1.448 1.448 1.34E-01 2.444 2.444 1.53E-06 3.626 3.626 6.70E-07 10.013 10.013 6.21E-23 CCAAT/enhancer binding 599 2a cebpb Dr.79988 140814 1.181 1.181 1.57E-01 1.456 1.456 4.46E-18 1.107 1.107 3.42E-01 1.463 1.463 9.52E-07 1.841 1.841 2.38E-06 3.285 3.285 1.61E-14 protein (C/EBP), beta
Similar to ankyrin 2, 600 2a LOC568926 Dr.113491 568926 1.226 1.226 6.28E-01 1.100 1.100 8.16E-01 1.028 1.028 9.16E-01 1.181 1.181 5.67E-01 1.984 1.984 2.27E-03 2.426 2.426 6.52E-08 neuronal 601 2a wu:fc58a04 Wu:fc58a04 Dr.121953 325179 1.021 1.021 8.85E-01 1.129 1.129 5.68E-01 0.991 -1.009 9.33E-01 1.016 1.016 9.17E-01 1.468 1.468 1.70E-04 1.730 1.730 4.62E-20 602 2a tnnt1 Troponin T1, skeletal, slow Dr.13906 353248 0.980 -1.021 8.24E-01 1.120 1.120 4.79E-01 1.014 1.014 8.57E-01 0.989 -1.011 9.01E-01 1.949 1.949 8.55E-06 2.390 2.390 6.00E-05 603 2a zgc:63792 Zgc:63792 Dr.75976 337333 1.250 1.250 1.15E-01 0.971 -1.030 8.45E-01 1.518 1.518 6.01E-06 1.557 1.557 1.18E-03 2.053 2.053 8.00E-05 4.475 4.475 4.69E-10 604 2a zgc:77891 Zgc:77891 Dr.78475 402993 1.222 1.222 7.15E-02 0.926 -1.080 3.37E-01 1.100 1.100 5.41E-01 1.163 1.163 3.50E-01 1.311 1.311 9.00E-03 1.577 1.577 4.32E-10 Methylenetetrahydrofolate dehydrogenase (NADP+ 605 2a mthfd2 dependent) 2, Dr.105864 431728 0.947 -1.056 4.98E-01 0.945 -1.058 5.59E-01 1.164 1.164 1.80E-03 1.448 1.448 3.50E-04 1.220 1.220 3.09E-03 1.867 1.867 3.31E-06 methenyltetrahydrofolate cyclohydrolase 606 2a zgc:76966 Zgc:76966 Dr.30396 405805 0.899 -1.112 5.36E-01 0.977 -1.024 8.63E-01 1.109 1.109 1.45E-02 1.465 1.465 3.54E-02 1.096 1.096 3.23E-01 1.752 1.752 1.69E-11 Hypothetical protein 607 2a LOC792591 Dr.80155 792591 0.908 -1.101 5.88E-01 0.959 -1.043 8.18E-01 1.230 1.230 2.69E-01 1.347 1.347 1.95E-02 1.070 1.070 3.43E-01 1.822 1.822 1.16E-11 LOC792591 Hypothetical protein 608 2a LOC794083 Dr.81713 794083 1.018 1.018 9.41E-01 1.077 1.077 7.41E-01 1.125 1.125 4.27E-01 1.678 1.678 1.68E-02 1.063 1.063 5.10E-01 2.808 2.808 2.00E-05 LOC794083 609 2a ifn Interferon Dr.85981 360134 0.870 -1.149 3.46E-01 1.040 1.040 7.61E-01 1.312 1.312 1.30E-02 2.550 2.550 4.00E-06 1.266 1.266 3.30E-02 7.613 7.613 1.20E-29 610 2a zgc:153057 Zgc:153057 Dr.13838 767798 1.032 1.032 7.87E-01 1.022 1.022 8.58E-01 1.093 1.093 1.99E-01 1.413 1.413 1.09E-03 1.022 1.022 8.71E-01 1.544 1.544 7.22E-06 ChaC, cation transport 611 2a chac1 Dr.76600 323237 0.988 -1.012 9.23E-01 0.815 -1.227 2.02E-02 1.024 1.024 8.71E-01 1.478 1.478 3.18E-01 0.983 -1.017 8.80E-01 2.764 2.764 1.65E-21 regulator-like 1 612 2a zgc:55813 Zgc:55813 Dr.80110 399488 0.944 -1.059 2.95E-01 0.879 -1.137 4.56E-02 0.924 -1.082 5.78E-01 1.202 1.202 2.35E-01 1.065 1.065 6.30E-01 1.919 1.919 3.18E-11 Novel protein containing a 613 2a CH211-244P18.4 Dr.119543 563855 0.481 -2.080 1.14E-01 1.439 1.439 2.54E-01 1.255 1.255 3.41E-01 2.200 2.200 5.20E-04 1.146 1.146 7.04E-01 8.751 8.751 1.15E-16 ChaC-like protein domain
614 2a zgc:77306 Zgc:77306 Dr.80127 406509 0.887 -1.127 1.71E-01 1.163 1.163 1.14E-01 1.171 1.171 2.46E-01 1.240 1.240 1.12E-01 1.148 1.148 4.72E-01 1.811 1.811 4.00E-05 Purinergic receptor P2X, 615 2a p2rx8 Dr.89526 387299 0.810 -1.235 6.61E-01 1.381 1.381 2.35E-01 1.139 1.139 5.65E-01 1.278 1.278 1.86E-01 1.061 1.061 8.20E-01 2.202 2.202 2.00E-05 ligand-gated ion channel, 8
616 2a pkd2 Polycystic kidney disease 2 Dr.92211 432387 0.547 -1.829 2.69E-01 2.004 2.004 9.12E-03 0.895 -1.118 8.46E-01 1.588 1.588 4.02E-01 1.520 1.520 4.70E-01 10.280 10.280 3.06E-08 617 2a Dr.90912 Transcribed locus Dr.90912 0.928 -1.077 6.86E-01 1.221 1.221 5.52E-01 1.077 1.077 5.34E-01 1.428 1.428 1.38E-06 1.054 1.054 6.27E-01 1.770 1.770 4.15E-07 618 2a si:busm1-6a2.1 Si:busm1-6a2.1 Dr.123332 368398 1.152 1.152 5.85E-01 1.013 1.013 9.60E-01 1.326 1.326 2.16E-02 2.653 2.653 1.59E-10 1.042 1.042 6.28E-01 1.966 1.966 3.31E-15 Myxovirus (influenza) 619 2a mxa Dr.80859 360142 1.012 1.012 9.58E-01 1.070 1.070 7.68E-01 1.272 1.272 5.97E-03 1.612 1.612 4.00E-05 1.047 1.047 7.02E-01 1.341 1.341 9.92E-03 resistance A 620 2a Dr.132086 Transcribed locus Dr.132086 0.945 -1.058 2.17E-01 0.956 -1.046 6.84E-01 1.090 1.090 5.78E-01 1.680 1.680 1.81E-16 1.228 1.228 6.66E-03 1.494 1.494 1.33E-02 Insulin-like growth factor 621 2a igfbp1 Dr.76315 317638 0.962 -1.039 6.82E-01 1.027 1.027 6.78E-01 0.896 -1.116 3.92E-02 1.962 1.962 5.00E-04 1.100 1.100 1.84E-01 2.012 2.012 1.77E-08 binding protein 1 622 2a junb Jun B proto-oncogene Dr.10326 407086 2.509 2.509 9.98E-38 2.012 2.012 9.79E-31 0.886 -1.129 9.00E-05 1.331 1.331 5.69E-09 1.427 1.427 7.33E-08 4.382 4.382 0.00E+00 623 2a il1b Interleukin 1, beta Dr.30443 405770 6.309 6.309 0.00E+00 4.499 4.499 1.53E-29 0.620 -1.612 5.26E-17 1.419 1.419 1.84E-07 2.581 2.581 1.51E-14 10.150 10.150 0.00E+00 624 2a wu:fc49d01 Wu:fc49d01 Dr.10914 562007 1.987 1.987 1.08E-02 1.672 1.672 5.00E-05 0.899 -1.113 1.05E-01 1.598 1.598 2.37E-02 1.691 1.691 1.47E-03 2.999 2.999 1.07E-06 Hypothetical protein 625 2a LOC795785 Dr.113696 795785 3.754 3.754 9.05E-10 4.262 4.262 0.00E+00 1.262 1.262 2.28E-01 1.609 1.609 8.74E-03 3.104 3.104 7.65E-10 7.748 7.748 1.39E-39 LOC795785 626 2a zgc:103566 Zgc:103566 Dr.119956 403071 8.661 8.661 0.00E+00 6.900 6.900 0.00E+00 1.286 1.286 3.00E-05 1.781 1.781 3.99E-31 3.132 3.132 0.00E+00 12.247 12.247 0.00E+00 627 2a LOC555974 Similar to Mknk1 protein Dr.99488 555974 1.482 1.482 3.90E-04 1.404 1.404 4.46E-06 0.922 -1.084 2.29E-01 1.290 1.290 3.31E-02 1.114 1.114 3.02E-02 1.590 1.590 3.79E-06 Prostaglandin- 628 2a ptgs2a Dr.113864 246227 1.216 1.216 2.31E-01 1.525 1.525 8.24E-15 1.079 1.079 6.09E-01 1.309 1.309 1.06E-02 1.142 1.142 5.19E-01 1.589 1.589 1.25E-02 endoperoxide synthase 2a
629 2a sb:cb606 Sb:cb606 Dr.114993 321320 1.340 1.340 2.65E-02 1.765 1.765 4.20E-04 1.016 1.016 9.02E-01 1.478 1.478 7.07E-03 1.303 1.303 2.18E-06 2.340 2.340 3.65E-07 630 2a LOC562205 Relaxin 3a Dr.84374 562205 1.865 1.865 1.03E-08 3.425 3.425 2.94E-26 0.930 -1.076 8.49E-01 2.244 2.244 1.76E-02 1.486 1.486 6.97E-02 8.751 8.751 5.00E-05 631 2a zgc:91868 Zgc:91868 Dr.79974 445073 1.340 1.340 5.10E-04 1.624 1.624 5.00E-05 1.119 1.119 2.30E-01 1.349 1.349 1.10E-02 1.184 1.184 8.47E-03 2.146 2.146 3.33E-19 Hypothetical protein 632 2a LOC796233 Dr.120930 796233 1.111 1.111 2.94E-01 1.785 1.785 7.85E-02 1.347 1.347 3.36E-01 1.265 1.265 5.38E-01 1.231 1.231 2.30E-01 2.010 2.010 1.21E-09 LOC796233 V-fos FBJ murine 633 2a fos osteosarcoma viral Dr.12986 394198 1.648 1.648 3.82E-23 1.866 1.866 1.05E-15 0.719 -1.391 6.00E-05 1.302 1.302 2.78E-01 1.795 1.795 3.72E-08 5.348 5.348 6.40E-22 oncogene homolog Nuclear factor of kappa light polypeptide gene 634 2a nfkbiaa Dr.79912 406463 2.446 2.446 5.30E-03 1.905 1.905 3.66E-08 1.179 1.179 2.35E-02 1.172 1.172 1.74E-02 1.757 1.757 3.86E-02 7.663 7.663 5.10E-04 enhancer in B-cells inhibitor, alpha a Tumor necrosis factor b 635 2a tnfb (TNF superfamily, member Dr.94015 554167 2.644 2.644 8.33E-27 2.669 2.669 2.02E-18 1.027 1.027 6.30E-01 1.873 1.873 9.71E-03 2.129 2.129 1.14E-18 11.544 11.544 0.00E+00 2) 636 2a wu:fb13b07 Wu:fb13b07 Dr.23569 336539 1.074 1.074 4.76E-01 1.245 1.245 1.48E-01 1.083 1.083 2.95E-01 1.086 1.086 1.46E-01 1.153 1.153 1.15E-01 1.557 1.557 6.19E-07 Nuclear factor, erythroid 637 2a nfe2l1 Dr.79857 405781 1.212 1.212 3.06E-01 2.143 2.143 4.80E-03 1.123 1.123 5.57E-01 1.194 1.194 4.50E-01 1.622 1.622 4.30E-04 3.359 3.359 3.91E-07 derived 2,-like 1 Activating transcription 638 2a atf3 Dr.77523 393939 2.134 2.134 4.46E-20 2.721 2.721 0.00E+00 1.461 1.461 2.85E-06 1.225 1.225 3.75E-01 2.501 2.501 2.00E-05 7.882 7.882 5.23E-20 factor 3 639 2a wu:fl03b09 Wu:fl03b09 Dr.10410 337704 2.580 2.580 0.00E+00 2.495 2.495 0.00E+00 1.442 1.442 4.29E-23 2.043 2.043 2.13E-35 1.888 1.888 2.41E-17 4.533 4.533 0.00E+00 640 2a zgc:77038 Zgc:77038 Dr.81607 406596 2.193 2.193 5.94E-37 2.491 2.491 0.00E+00 1.228 1.228 5.19E-03 1.832 1.832 2.03E-23 1.699 1.699 1.49E-17 3.981 3.981 0.00E+00 641 2a zgc:162897 Zgc:162897 Dr.132990 100049157 1.501 1.501 2.98E-03 2.043 2.043 5.59E-09 1.266 1.266 2.25E-01 1.703 1.703 1.49E-03 1.654 1.654 6.00E-04 2.830 2.830 3.70E-11 Hypothetical protein 642 2a LOC795305 Dr.116421 795305 3.196 3.196 2.05E-10 3.135 3.135 2.57E-09 1.971 1.971 5.59E-06 3.779 3.779 9.06E-35 4.937 4.937 9.38E-33 9.352 9.352 0.00E+00 LOC795305 Similar to Interleukin-1 receptor-associated kinase- 643 2a LOC567444 3 (IRAK-3) (IL-1 receptor- Dr.90054 567444 2.182 2.182 1.43E-03 2.198 2.198 7.10E-04 1.354 1.354 3.16E-02 2.292 2.292 8.86E-03 2.471 2.471 1.00E-05 4.034 4.034 1.00E-05 associated kinase M) (IRAK-M) 644 2a wu:fb10g03 Wu:fb10g03 Dr.27253 336442 1.269 1.269 1.41E-02 1.339 1.339 6.32E-03 1.213 1.213 3.54E-02 1.400 1.400 8.10E-04 1.397 1.397 7.61E-07 1.747 1.747 5.24E-08 Hepcidin antimicrobial 645 2a hamp1 Dr.89447 402837 4.178 4.178 0.00E+00 6.860 6.860 1.18E-24 2.803 2.803 1.50E-04 6.059 6.059 3.85E-07 9.168 9.168 2.03E-23 27.455 27.455 4.86E-38 peptide 1 646 2a zgc:92097 Zgc:92097 Dr.133138 403013 1.411 1.411 7.38E-06 1.474 1.474 1.40E-26 1.326 1.326 3.58E-13 1.487 1.487 7.60E-13 1.426 1.426 7.38E-07 2.116 2.116 6.26E-13 647 2a si:ch211-202c21.3 Si:ch211-202c21.3 Dr.87374 553387 3.131 3.131 1.30E-12 3.173 3.173 6.39E-13 2.402 2.402 4.82E-06 4.662 4.662 1.21E-10 3.769 3.769 3.62E-16 9.144 9.144 0.00E+00 648 2a Dr.123239 Transcribed locus Dr.123239 2.557 2.557 4.79E-07 2.089 2.089 3.50E-04 1.659 1.659 3.41E-02 3.313 3.313 9.94E-18 3.838 3.838 5.59E-12 10.070 10.070 1.07E-22 649 2a mmp9 Matrix metalloproteinase 9 Dr.76275 406397 4.751 4.751 0.00E+00 3.756 3.756 0.00E+00 2.592 2.592 0.00E+00 4.439 4.439 0.00E+00 6.487 6.487 0.00E+00 22.527 22.527 0.00E+00
CCAAT/enhancer binding 650 2a cebpd Dr.1280 140817 1.424 1.424 5.19E-09 1.659 1.659 7.92E-11 1.235 1.235 2.56E-02 1.527 1.527 6.90E-04 2.023 2.023 6.29E-30 2.844 2.844 3.01E-14 protein (C/EBP), delta
Similar to Jun dimerization 651 2a LOC100007087 Dr.81777 100007087 4.326 4.326 7.84E-03 6.042 6.042 3.53E-23 2.041 2.041 6.21E-03 3.712 3.712 2.75E-06 7.067 7.067 0.00E+00 40.441 40.441 1.57E-42 protein 1 JDP-1
Suppressor of cytokine 652 2a socs3 Dr.6431 335409 2.911 2.911 0.00E+00 3.068 3.068 0.00E+00 1.374 1.374 6.00E-05 2.081 2.081 6.16E-14 3.581 3.581 6.18E-21 7.257 7.257 2.58E-35 signaling 3 653 2a junbl Jun B proto-oncogene, like Dr.737 336038 1.583 1.583 5.55E-10 1.515 1.515 2.21E-09 1.306 1.306 2.18E-09 2.030 2.030 1.29E-16 1.537 1.537 1.00E-05 2.739 2.739 0.00E+00 654 2a LOC569249 Hypothetical LOC569249 Dr.87470 569249 1.282 1.282 4.91E-02 1.513 1.513 1.13E-03 1.256 1.256 2.43E-03 1.726 1.726 8.31E-07 1.445 1.445 6.22E-06 2.099 2.099 1.04E-07
Transcribed locus, weakly similar to XP_001338456.1 655 2a Dr.125570 Dr.125570 2.471 2.471 1.73E-03 3.323 3.323 1.14E-06 3.266 3.266 7.69E-19 5.097 5.097 1.01E-20 6.313 6.313 8.40E-08 12.947 12.947 1.10E-30 similar to CC chemokine-1 [Danio rerio]
656 2a zgc:92849 Zgc:92849 Dr.86222 436767 1.641 1.641 4.61E-10 1.870 1.870 1.72E-13 1.826 1.826 2.70E-17 2.160 2.160 6.17E-18 2.531 2.531 0.00E+00 3.376 3.376 0.00E+00 657 2a zgc:92137 Zgc:92137 Dr.33934 445049 3.059 3.059 3.96E-08 3.546 3.546 1.01E-07 4.138 4.138 2.50E-13 4.692 4.692 9.09E-12 7.372 7.372 0.00E+00 12.675 12.675 1.40E-45 Regulator of G-protein 658 2a rgs4 Dr.75538 321256 1.457 1.457 1.82E-03 2.307 2.307 4.41E-24 1.997 1.997 0.00E+00 2.472 2.472 0.00E+00 2.407 2.407 3.71E-43 3.229 3.229 0.00E+00 signalling 4 Membrane-spanning 4- 659 2a ms4a4a domains, subfamily A, Dr.40434 550363 1.214 1.214 4.25E-02 1.238 1.238 2.61E-02 1.359 1.359 4.40E-04 1.232 1.232 7.96E-03 1.437 1.437 8.18E-07 1.795 1.795 5.25E-18 member 4 BTB (POZ) domain 660 2a btbd2 Dr.107582 373096 1.771 1.771 7.34E-02 1.236 1.236 3.76E-01 1.616 1.616 1.70E-04 1.521 1.521 2.12E-02 1.706 1.706 1.46E-02 2.333 2.333 4.10E-06 containing 2 661 2a thbs1 Thrombospondin 1 Dr.78947 561901 1.369 1.369 8.68E-02 1.063 1.063 8.20E-01 1.327 1.327 3.25E-01 1.193 1.193 4.42E-01 1.510 1.510 4.75E-02 2.014 2.014 2.08E-19 662 2a wu:fb14c11 Wu:fb14c11 Dr.32415 336586 1.581 1.581 1.52E-10 1.346 1.346 1.02E-01 1.414 1.414 5.41E-07 1.475 1.475 5.12E-10 1.212 1.212 2.46E-02 2.532 2.532 1.91E-15 663 2a wu:fj53e10 Wu:fj53e10 Dr.80301 336172 1.737 1.737 8.29E-09 1.401 1.401 7.20E-04 1.376 1.376 1.05E-13 1.702 1.702 0.00E+00 1.349 1.349 3.57E-03 2.408 2.408 6.32E-15 Fas (TNF receptor 664 2a fas Dr.82180 768248 1.886 1.886 1.19E-03 1.164 1.164 4.14E-01 1.524 1.524 4.00E-02 2.054 2.054 1.69E-02 1.652 1.652 3.18E-03 3.662 3.662 1.00E-19 superfamily, member 6) Similar to TRAF2 binding 665 2a LOC560548 Dr.115738 560548 1.923 1.923 0.00E+00 1.764 1.764 7.95E-19 1.402 1.402 5.30E-04 2.201 2.201 1.82E-10 1.318 1.318 1.40E-02 2.449 2.449 9.07E-17 protein Hypothetical protein 666 2a LOC794621 Dr.116461 794621 1.556 1.556 3.84E-06 1.798 1.798 6.62E-10 1.328 1.328 1.06E-02 1.885 1.885 5.44E-07 1.332 1.332 1.66E-03 2.199 2.199 5.17E-17 LOC794621 Transforming growth 667 2a tgfb1 Dr.76626 359834 1.366 1.366 7.36E-11 1.357 1.357 7.05E-18 1.080 1.080 1.07E-02 1.426 1.426 6.80E-13 1.186 1.186 2.51E-02 1.651 1.651 2.14E-11 factor, beta 1 668 2a Dr.84041 Transcribed locus Dr.84041 1.519 1.519 4.36E-06 1.406 1.406 4.33E-06 1.039 1.039 5.53E-01 1.513 1.513 4.00E-05 1.115 1.115 2.14E-02 1.846 1.846 2.87E-07 669 2a wu:fc74e04 Wu:fc74e04 Dr.77547 445132 1.339 1.339 4.00E-04 1.448 1.448 1.27E-09 1.059 1.059 3.65E-01 1.651 1.651 2.28E-08 1.311 1.311 7.25E-02 1.614 1.614 1.94E-02 670 2a Dr.90383 Transcribed locus Dr.90383 1.273 1.273 1.23E-02 1.412 1.412 2.80E-04 1.194 1.194 6.24E-02 1.928 1.928 1.41E-17 1.101 1.101 1.65E-02 1.597 1.597 2.00E-05 671 2a Dr.122738 Transcribed locus Dr.122738 1.465 1.465 3.67E-03 1.570 1.570 5.40E-04 1.683 1.683 6.00E-10 1.958 1.958 3.54E-21 1.331 1.331 1.11E-06 1.897 1.897 7.99E-19 672 2a wu:fb66f11 Wu:fb66f11 Dr.77427 406400 1.423 1.423 2.99E-03 1.408 1.408 1.77E-03 1.397 1.397 4.90E-04 1.715 1.715 7.96E-07 1.247 1.247 3.29E-02 1.565 1.565 1.10E-04 673 2a plek Pleckstrin Dr.29086 393814 1.890 1.890 1.63E-08 1.849 1.849 7.65E-09 1.868 1.868 2.60E-14 2.592 2.592 3.84E-20 1.704 1.704 3.05E-19 2.798 2.798 2.83E-28 674 2a Dr.99729 Transcribed locus Dr.99729 2.122 2.122 4.40E-04 1.797 1.797 5.88E-03 2.248 2.248 3.65E-09 2.710 2.710 1.90E-11 2.070 2.070 6.00E-05 2.442 2.442 7.34E-07 Hypothetical protein 675 2a CH211-133N4.6 Dr.132691 797776 2.191 2.191 4.32E-17 2.741 2.741 6.89E-10 2.928 2.928 2.42E-14 4.250 4.250 4.10E-06 1.312 1.312 2.47E-02 4.097 4.097 1.03E-39 LOC797776
Signal transducer and 676 2a stat4 Dr.34491 368519 1.428 1.428 4.00E-05 1.536 1.536 2.35E-03 1.536 1.536 8.00E-05 1.563 1.563 1.07E-07 1.146 1.146 5.29E-02 1.642 1.642 2.68E-19 activator of transcription 4
677 2a Dr.140306 Transcribed locus Dr.140306 1.469 1.469 3.00E-05 1.379 1.379 3.00E-05 1.413 1.413 1.30E-04 1.655 1.655 9.15E-08 1.131 1.131 9.71E-02 1.426 1.426 1.44E-08 678 2a Dr.132109 Transcribed locus Dr.132109 8.059 8.059 2.00E-05 10.690 10.690 1.27E-12 4.839 4.839 6.19E-09 6.941 6.941 3.31E-08 7.957 7.957 1.37E-15 7.090 7.090 2.63E-15 679 2a Dr.133494 Transcribed locus Dr.133494 6.913 6.913 8.73E-12 7.865 7.865 1.79E-27 4.329 4.329 7.27E-06 5.838 5.838 3.54E-27 6.419 6.419 7.74E-17 6.871 6.871 8.50E-18 680 2a il10 Interleukin 10 Dr.135567 553957 3.590 3.590 2.28E-03 2.957 2.957 8.01E-08 2.419 2.419 3.95E-17 3.474 3.474 2.47E-26 3.513 3.513 5.21E-10 3.122 3.122 4.05E-14 681 2a wu:fd36h06 Wu:fd36h06 Dr.79872 325877 2.039 2.039 6.90E-04 1.970 1.970 8.00E-05 1.701 1.701 1.38E-01 1.747 1.747 1.99E-01 2.275 2.275 5.66E-10 1.973 1.973 3.02E-11 682 2a wu:fk31a07 Wu:fk31a07 Dr.23104 336938 1.775 1.775 1.21E-03 2.065 2.065 9.28E-06 1.665 1.665 3.42E-10 2.185 2.185 2.29E-11 1.881 1.881 1.94E-08 2.261 2.261 1.05E-12
Transcribed locus, weakly similar to NP_001074221.1 683 2a Dr.140503 Dr.140503 5.826 5.826 2.07E-26 6.410 6.410 3.15E-29 6.570 6.570 3.27E-10 5.799 5.799 1.28E-08 13.096 13.096 6.80E-34 12.410 12.410 0.00E+00 protein LOC559830 [Danio rerio]
684 2a zgc:152945 Zgc:152945 Dr.77704 767787 11.175 11.175 1.15E-10 15.064 15.064 9.06E-24 13.686 13.686 7.24E-39 24.618 24.618 0.00E+00 38.363 38.363 0.00E+00 35.986 35.986 0.00E+00 Complement component 685 2a c3c Dr.88584 30492 2.611 2.611 4.54E-22 1.907 1.907 2.33E-06 2.244 2.244 8.00E-05 2.281 2.281 2.22E-06 2.698 2.698 7.00E-04 2.776 2.776 3.40E-04 c3c 686 2a zgc:110354 Zgc:110354 Dr.88891 553612 4.056 4.056 9.00E-05 3.355 3.355 4.91E-03 2.128 2.128 5.19E-02 3.431 3.431 3.11E-03 2.990 2.990 3.04E-14 6.088 6.088 3.41E-23 687 2a zgc:153723 Zgc:153723 Dr.88985 767718 2.872 2.872 1.01E-10 2.482 2.482 3.27E-08 1.597 1.597 3.00E-05 2.578 2.578 6.71E-09 2.163 2.163 3.62E-21 3.277 3.277 8.74E-37 688 2a zgc:113527 Zgc:113527 Dr.88899 613245 2.075 2.075 2.20E-02 2.346 2.346 2.60E-03 1.775 1.775 2.74E-02 1.845 1.845 2.26E-06 1.834 1.834 2.71E-13 2.891 2.891 1.09E-15 689 2a tlr5a Toll-like receptor 5a Dr.89423 403138 2.342 2.342 2.70E-10 2.219 2.219 1.38E-23 1.601 1.601 2.00E-05 2.072 2.072 9.50E-13 1.564 1.564 1.99E-09 2.077 2.077 1.36E-14 690 2a tlr5b Toll-like receptor 5b Dr.89707 751829 2.316 2.316 2.58E-41 2.190 2.190 0.00E+00 1.639 1.639 2.90E-13 2.116 2.116 3.24E-12 1.808 1.808 9.57E-06 2.204 2.204 4.75E-06 Receptor-interacting serine- 691 2a ripk2 Dr.28180 373874 1.543 1.543 1.18E-14 1.741 1.741 3.02E-33 1.149 1.149 6.00E-05 1.309 1.309 9.86E-11 1.115 1.115 8.64E-02 1.569 1.569 1.77E-09 threonine kinase 2
692 2a wu:fb64e03 Wu:fb64e03 Dr.76413 322540 1.811 1.811 2.30E-07 1.636 1.636 1.37E-26 1.239 1.239 1.01E-02 1.498 1.498 7.30E-04 1.263 1.263 7.74E-02 1.647 1.647 3.80E-04 693 2a zgc:101811 Zgc:101811 Dr.77501 450028 2.622 2.622 1.14E-08 2.664 2.664 1.72E-07 1.481 1.481 2.00E-05 2.110 2.110 8.28E-08 1.484 1.484 3.70E-04 2.459 2.459 2.08E-11 694 2a zgc:77002 Zgc:77002 Dr.83170 405846 1.738 1.738 2.51E-11 1.678 1.678 1.73E-09 1.250 1.250 1.23E-03 1.491 1.491 4.00E-05 1.172 1.172 2.80E-04 1.781 1.781 1.57E-14 Tumor necrosis factor a 695 2a tnfa (TNF superfamily, member Dr.89727 405785 6.372 6.372 3.85E-12 5.077 5.077 2.74E-09 1.614 1.614 2.61E-03 3.446 3.446 6.71E-06 1.902 1.902 2.65E-02 7.302 7.302 2.00E-05 2) Neutrophil cytosolic factor 696 2a ncf1 Dr.2973 378966 2.690 2.690 2.11E-36 2.299 2.299 0.00E+00 1.235 1.235 1.16E-03 2.088 2.088 0.00E+00 1.336 1.336 1.00E-05 1.866 1.866 4.21E-21 1 697 2a Dr.81063 Transcribed locus Dr.81063 2.377 2.377 3.44E-41 2.067 2.067 8.36E-42 1.368 1.368 2.36E-06 2.017 2.017 6.32E-17 1.134 1.134 2.08E-01 1.825 1.825 4.47E-14 698 2a LOC569969 Hypothetical LOC569969 Dr.41215 569969 4.615 4.615 2.23E-30 2.708 2.708 3.32E-12 1.478 1.478 1.26E-02 2.241 2.241 2.09E-06 2.221 2.221 1.72E-08 3.077 3.077 2.09E-15 699 2a zgc:103575 Zgc:103575 Dr.85993 449806 1.708 1.708 9.14E-09 1.732 1.732 1.70E-11 1.277 1.277 1.74E-02 1.446 1.446 1.06E-03 1.406 1.406 5.00E-05 1.345 1.345 1.37E-02 Similar to complement 700 2a LOC570832 Dr.107751 570832 3.364 3.364 0.00E+00 3.872 3.872 0.00E+00 0.990 -1.010 9.70E-01 3.271 3.271 5.74E-11 2.720 2.720 1.13E-16 2.574 2.574 3.38E-06 protein component C7-1 701 2a Dr.129433 Transcribed locus Dr.129433 1.515 1.515 5.00E-05 1.578 1.578 1.83E-06 0.957 -1.044 4.69E-01 1.200 1.200 2.15E-02 1.397 1.397 2.80E-04 1.357 1.357 1.80E-04 702 2a Dr.28032 Transcribed locus Dr.28032 2.810 2.810 2.00E-05 3.065 3.065 3.52E-06 0.776 -1.289 1.81E-01 1.916 1.916 5.67E-02 1.823 1.823 2.41E-02 2.726 2.726 0.00E+00 703 2a znf313 Zinc finger protein 313 Dr.86280 414843 1.558 1.558 2.64E-01 3.074 3.074 3.74E-03 1.076 1.076 6.74E-01 1.602 1.602 1.04E-01 1.598 1.598 1.04E-02 2.164 2.164 1.42E-06 Similar to ovary-specific 704 2a LOC792601 Dr.17591 792601 5.697 5.697 1.90E-04 5.045 5.045 3.70E-04 1.137 1.137 6.20E-01 1.644 1.644 2.60E-01 8.968 8.968 6.74E-21 3.207 3.207 1.00E-05 C1q-like factor 705 2a fgl2 Fibrinogen-like 2 Dr.81522 565637 1.517 1.517 2.54E-01 1.810 1.810 3.74E-03 1.195 1.195 4.80E-02 1.297 1.297 2.39E-02 1.769 1.769 7.92E-15 1.760 1.760 4.00E-05 706 2a LOC564696 Similar to tubby-like protein Dr.121542 564696 1.187 1.187 5.02E-02 1.099 1.099 5.51E-01 1.082 1.082 3.26E-01 1.158 1.158 4.22E-02 1.610 1.610 8.49E-06 1.356 1.356 8.80E-03 707 2a Dr.122313 Transcribed locus Dr.122313 1.075 1.075 3.59E-01 1.634 1.634 2.00E-05 1.317 1.317 3.14E-01 1.132 1.132 5.53E-01 1.945 1.945 4.20E-04 1.581 1.581 2.28E-02 708 2a Dr.122944 Transcribed locus Dr.122944 1.145 1.145 1.08E-01 1.623 1.623 4.67E-06 1.303 1.303 2.41E-01 1.211 1.211 2.25E-01 1.693 1.693 1.47E-03 1.375 1.375 4.84E-02 709 2a wu:fc93f07 Transcribed locus Dr.28720 325624 1.184 1.184 3.16E-01 2.223 2.223 2.00E-05 1.437 1.437 3.24E-01 1.327 1.327 3.22E-01 1.801 1.801 2.15E-02 1.780 1.780 6.70E-04 710 2a Dr.31311 Transcribed locus Dr.31311 1.103 1.103 1.93E-01 1.820 1.820 3.11E-06 1.359 1.359 3.17E-01 1.172 1.172 5.89E-01 1.593 1.593 1.15E-02 1.158 1.158 4.30E-01 Similar to 711 2a LOC797020 replicase/helicase/endonuc Dr.118318 797020 1.110 1.110 6.77E-01 1.368 1.368 1.97E-01 1.098 1.098 5.00E-01 0.953 -1.049 8.31E-01 0.824 -1.213 2.78E-02 1.780 1.780 1.38E-08 lease 712 2a il17-3 Interleukin 17-3 Dr.135566 553960 1.794 1.794 5.77E-07 1.209 1.209 2.24E-01 1.034 1.034 6.53E-01 1.111 1.111 6.42E-01 1.031 1.031 6.77E-01 2.404 2.404 1.88E-06 713 2a si:dkey-170o10.1 Si:dkey-170o10.1 Dr.78607 557526 1.315 1.315 3.10E-04 1.215 1.215 1.25E-01 1.036 1.036 5.80E-01 1.159 1.159 1.30E-01 0.886 -1.129 2.95E-02 1.551 1.551 5.00E-05 714 2a wu:fj23a05 Wu:fj23a05 Dr.80855 335583 1.434 1.434 2.46E-06 1.212 1.212 1.09E-02 0.988 -1.012 9.09E-01 1.130 1.130 2.20E-01 0.911 -1.097 3.62E-01 1.747 1.747 8.68E-06 715 2a wu:fb09g03 Wu:fb09g03 Dr.76687 336411 1.290 1.290 9.90E-02 1.405 1.405 1.14E-02 0.951 -1.051 7.75E-01 1.411 1.411 2.96E-02 0.963 -1.039 6.58E-01 1.674 1.674 1.00E-05 716 2a wu:fi36g12 Wu:fi36g12 Dr.80708 334220 1.983 1.983 2.00E-04 1.713 1.713 1.18E-02 0.710 -1.409 9.09E-02 2.295 2.295 3.40E-04 1.251 1.251 3.06E-01 6.769 6.769 3.01E-22 717 2a zgc:110411 Zgc:110411 Dr.90104 571309 1.702 1.702 1.15E-02 1.559 1.559 3.54E-02 0.919 -1.088 6.10E-01 1.489 1.489 2.75E-01 1.007 1.007 9.73E-01 3.364 3.364 9.89E-11 718 2a si:ch211-132p20.4 Si:ch211-132p20.4 Dr.78433 566537 1.097 1.097 2.16E-02 1.048 1.048 5.51E-01 0.976 -1.025 7.30E-01 1.153 1.153 1.91E-01 0.842 -1.187 2.92E-02 1.648 1.648 7.21E-36 Growth arrest and DNA- 719 2a gadd45a Dr.83410 431763 1.168 1.168 6.60E-02 1.109 1.109 1.70E-01 1.048 1.048 2.90E-01 1.212 1.212 7.51E-02 0.909 -1.100 3.68E-02 1.572 1.572 5.63E-13 damage-inducible, alpha NADPH oxidase organizer 720 2a noxo1 Dr.42641 572245 1.954 1.954 4.01E-02 1.355 1.355 3.72E-01 0.637 -1.571 7.78E-03 0.945 -1.058 5.83E-01 1.068 1.068 6.44E-01 2.879 2.879 1.09E-30 1 721 2b sb:cb339 Sb:cb339 Dr.100378 321210 0.652 -1.533 3.03E-02 1.146 1.146 2.44E-01 1.356 1.356 6.70E-02 1.301 1.301 1.05E-01 1.939 1.939 1.96E-14 1.910 1.910 3.34E-13 722 2b zgc:66350 Zgc:66350 Dr.29708 393493 0.324 -3.085 1.50E-12 723 2b zgc:162162 Zgc:162162 Dr.84274 568747 0.376 -2.661 1.04E-09 724 2b zgc:77861 Zgc:77861 Dr.77739 393823 0.688 -1.453 6.81E-03 1.149 1.149 5.13E-02 1.386 1.386 8.30E-04 1.256 1.256 8.53E-03 1.898 1.898 1.22E-10 1.832 1.832 7.40E-06 Solute carrier family 25 725 2b slc25a12 (mitochondrial carrier, Dr.76801 337675 0.550 -1.819 4.26E-02 1.116 1.116 4.05E-01 1.525 1.525 7.28E-03 1.513 1.513 7.67E-03 2.973 2.973 2.08E-12 2.782 2.782 2.13E-11 Aralar), member 12 726 2b zgc:55292 Zgc:55292 Dr.1786 321491 0.709 -1.411 2.29E-02 1.098 1.098 2.91E-01 1.306 1.306 4.45E-02 1.302 1.302 2.94E-02 1.919 1.919 9.20E-33 1.705 1.705 2.72E-15
Transcribed locus, weakly similar to NP_065704.1 727 2b Dr.121765 Dr.121765 0.585 -1.710 6.56E-02 1.094 1.094 2.57E-01 1.789 1.789 5.40E-04 1.467 1.467 2.29E-02 2.931 2.931 1.37E-14 2.827 2.827 1.48E-11 finger protein 287 [Homo sapiens]
728 2b Dr.123175 Transcribed locus Dr.123175 0.533 -1.878 3.81E-02 1.085 1.085 7.37E-01 1.668 1.668 9.46E-02 1.501 1.501 1.83E-01 3.460 3.460 7.81E-10 2.528 2.528 1.00E-05 729 2b Dr.75197 Transcribed locus Dr.75197 0.462 -2.166 1.12E-02 1.185 1.185 5.28E-01 1.818 1.818 9.26E-03 1.653 1.653 3.35E-02 3.349 3.349 1.88E-18 2.554 2.554 5.45E-09 Hypothetical protein 730 2b LOC797263 Dr.115884 797263 0.673 -1.486 2.71E-02 1.061 1.061 7.23E-01 1.384 1.384 1.45E-01 1.259 1.259 2.20E-01 2.508 2.508 3.53E-15 2.389 2.389 1.03E-12 LOC797263 731 2b Dr.122052 Transcribed locus Dr.122052 0.451 -2.217 1.55E-03 1.145 1.145 6.12E-01 1.711 1.711 4.31E-02 1.527 1.527 1.11E-01 3.993 3.993 1.39E-35 4.122 4.122 1.22E-23 732 2b pdcd7 Programmed cell death 7 Dr.82365 445020 0.644 -1.552 2.84E-02 1.146 1.146 4.69E-01 1.346 1.346 2.16E-01 1.266 1.266 2.88E-01 2.332 2.332 1.10E-21 2.253 2.253 3.15E-30 733 2b tagln2 Transgelin 2 Dr.104755 259183 0.645 -1.550 6.16E-03 0.912 -1.097 6.10E-01 1.414 1.414 7.03E-02 1.209 1.209 3.98E-01 2.100 2.100 4.70E-04 2.109 2.109 3.00E-05 734 2b zgc:55396 Zgc:55396 Dr.115188 406835 0.825 -1.212 2.96E-02 1.007 1.007 9.36E-01 1.203 1.203 8.65E-02 1.138 1.138 2.06E-01 1.551 1.551 3.00E-05 1.452 1.452 2.94E-03 Hypothetical protein 735 2b LOC100000934 Dr.48801 100000934 0.382 -2.617 5.49E-02 0.830 -1.204 5.07E-01 2.486 2.486 1.80E-02 1.633 1.633 1.83E-01 6.823 6.823 2.22E-13 5.497 5.497 5.61E-10 LOC100000934 736 2b im:7151086 Im:7151086 Dr.66408 492698 0.722 -1.386 6.54E-02 0.918 -1.090 3.59E-01 1.352 1.352 3.95E-02 1.249 1.249 4.54E-02 2.123 2.123 3.22E-06 1.903 1.903 1.00E-05 737 2b wu:fc84c07 Wu:fc84c07 Dr.108582 325519 0.450 -2.222 7.71E-02 1.016 1.016 9.74E-01 1.640 1.640 1.68E-01 1.824 1.824 2.43E-02 2.864 2.864 6.00E-05 2.733 2.733 1.00E-05 738 2b zgc:101818 Zgc:101818 Dr.117252 494076 0.473 -2.113 1.79E-03 0.977 -1.024 8.51E-01 1.646 1.646 2.93E-03 1.689 1.689 1.45E-03 2.598 2.598 1.50E-14 2.429 2.429 3.01E-11 Similar to Acyl-CoA 739 2b LOC798073 Dr.120561 798073 0.593 -1.688 8.20E-04 0.962 -1.039 6.55E-01 1.470 1.470 1.05E-03 1.465 1.465 1.05E-03 2.096 2.096 4.55E-15 2.196 2.196 3.73E-12 thioesterase 9 740 2b zgc:114066 Zgc:114066 Dr.84802 566506 0.542 -1.846 2.64E-03 0.959 -1.043 6.86E-01 1.528 1.528 1.40E-03 1.559 1.559 6.70E-04 2.286 2.286 5.61E-15 2.452 2.452 2.13E-13 741 2b wu:fe47a12 Wu:fe47a12 Dr.76804 326892 0.601 -1.665 4.70E-04 0.980 -1.020 8.20E-01 1.473 1.473 2.31E-10 1.410 1.410 9.61E-08 2.049 2.049 3.38E-14 2.093 2.093 0.00E+00 Phosphatidylinositol 4- 742 2b pi4kII alpha Dr.79494 554275 0.254 -3.935 4.08E-03 0.914 -1.095 5.30E-01 2.735 2.735 6.94E-03 2.464 2.464 5.25E-03 6.298 6.298 2.22E-08 6.243 6.243 3.59E-08 kinase II alpha 743 2b wu:fc27b12 Wu:fc27b12 Dr.35817 324380 0.390 -2.562 1.22E-02 0.860 -1.163 2.63E-01 1.966 1.966 1.25E-02 1.883 1.883 1.74E-02 3.876 3.876 1.09E-12 3.797 3.797 4.12E-12 744 2b pgm3 Phosphoglucomutase 3 Dr.37649 474321 0.409 -2.448 1.66E-03 0.895 -1.117 3.32E-01 1.817 1.817 9.22E-03 1.818 1.818 9.48E-03 3.550 3.550 3.42E-12 3.161 3.161 3.61E-10 745 2b wu:fb80f02 Wu:fb80f02 Dr.77380 323066 0.333 -3.005 1.46E-02 0.842 -1.188 9.73E-02 1.994 1.994 2.26E-02 2.151 2.151 9.43E-03 4.777 4.777 9.87E-08 4.151 4.151 7.61E-07 746 2b Dr.81762 Transcribed locus Dr.81762 0.515 -1.941 1.91E-02 0.908 -1.101 2.11E-01 1.799 1.799 1.30E-04 1.654 1.654 8.20E-04 2.889 2.889 7.37E-07 2.652 2.652 2.92E-06 747 2b LOC563512 Hypothetical LOC563512 Dr.115387 563512 0.415 -2.410 5.94E-03 0.990 -1.010 9.17E-01 1.723 1.723 1.59E-02 1.681 1.681 2.19E-02 3.534 3.534 4.02E-12 3.227 3.227 1.22E-10 748 2b wu:fc55g06 Wu:fc55g06 Dr.79035 325115 0.467 -2.143 8.78E-03 1.022 1.022 7.95E-01 1.646 1.646 3.91E-03 1.618 1.618 5.35E-03 2.912 2.912 2.07E-13 2.733 2.733 1.02E-10 749 2b Dr.129189 Transcribed locus Dr.129189 0.318 -3.149 1.62E-02 1.093 1.093 8.50E-01 1.948 1.948 1.19E-01 1.798 1.798 1.65E-01 3.764 3.764 5.00E-05 4.130 4.130 1.97E-07 750 2b wu:fj67d03 Wu:fj67d03 Dr.132704 337431 0.557 -1.797 1.88E-02 1.053 1.053 7.93E-01 1.436 1.436 1.19E-01 1.384 1.384 1.17E-01 2.129 2.129 5.00E-05 2.117 2.117 4.00E-05 751 2b Dr.137711 Transcribed locus Dr.137711 0.573 -1.746 7.13E-02 1.016 1.016 9.61E-01 1.422 1.422 1.58E-01 1.297 1.297 1.95E-01 2.001 2.001 4.00E-05 1.927 1.927 1.98E-08 752 2b zgc:77287 Zgc:77287 Dr.84139 404617 0.579 -1.727 2.65E-02 0.989 -1.011 9.57E-01 1.359 1.359 1.87E-01 1.351 1.351 1.52E-01 1.821 1.821 1.00E-05 1.807 1.807 5.62E-06 753 2b zgc:91915 Zgc:91915 Dr.84836 436595 0.344 -2.909 5.00E-05 0.911 -1.097 5.25E-01 1.930 1.930 3.78E-02 1.690 1.690 9.52E-02 3.044 3.044 4.00E-05 3.444 3.444 3.85E-08 754 2b LOC567256 Hypothetical LOC567256 Dr.117921 567256 0.348 -2.872 1.27E-03 0.822 -1.217 3.20E-01 2.162 2.162 1.29E-02 1.607 1.607 1.25E-01 4.520 4.520 7.42E-10 3.703 3.703 1.11E-07 755 2b wu:fb58f04 Wu:fb58f04 Dr.132301 322344 0.328 -3.053 8.80E-04 0.782 -1.278 1.78E-01 2.140 2.140 9.33E-03 1.622 1.622 1.01E-01 4.793 4.793 1.32E-12 4.021 4.021 1.09E-09 756 2b zgc:123339 Zgc:123339 Dr.15815 567972 0.743 -1.346 8.00E-05 0.930 -1.075 2.50E-01 1.264 1.264 4.00E-05 1.137 1.137 3.70E-02 1.594 1.594 4.18E-28 1.483 1.483 4.12E-06 757 2b Dr.121552 Transcribed locus Dr.121552 0.362 -2.763 1.50E-02 0.891 -1.122 2.67E-01 1.828 1.828 1.86E-02 1.770 1.770 2.43E-02 4.104 4.104 1.44E-08 3.352 3.352 1.70E-06 758 2b wu:fm82b06 Wu:fm82b06 Dr.122949 337686 0.289 -3.460 6.41E-03 0.881 -1.135 1.93E-01 2.196 2.196 9.45E-03 1.877 1.877 2.77E-02 5.500 5.500 1.06E-07 4.770 4.770 1.69E-06 759 2b Dr.90533 Transcribed locus Dr.90533 0.474 -2.111 1.29E-01 0.946 -1.057 9.08E-01 1.625 1.625 1.62E-01 1.439 1.439 2.18E-01 2.919 2.919 5.08E-09 2.613 2.613 1.00E-05 760 2b zgc:77242 Zgc:77242 Dr.89035 402969 0.275 -3.633 4.86E-03 0.857 -1.167 1.02E-01 2.117 2.117 5.41E-02 1.734 1.734 1.58E-01 5.822 5.822 4.61E-20 5.078 5.078 1.65E-18 761 2b wu:fa04g06 Wu:fa04g06 Dr.75459 334833 0.396 -2.525 4.07E-03 0.821 -1.217 8.77E-03 1.784 1.784 1.71E-03 1.623 1.623 9.80E-03 3.447 3.447 3.73E-07 3.115 3.115 1.71E-06 762 2b ada Adenosine deaminase Dr.120392 436919 0.490 -2.039 4.64E-02 0.875 -1.142 1.79E-01 2.257 2.257 1.70E-04 1.998 1.998 1.19E-03 3.743 3.743 2.49E-12 3.864 3.864 6.58E-13 763 2b aco1 Aconitase 1, soluble Dr.40063 568448 0.536 -1.866 3.89E-02 0.953 -1.049 7.24E-01 1.962 1.962 7.24E-09 1.902 1.902 2.03E-07 2.826 2.826 4.76E-08 3.323 3.323 1.42E-24 764 2b Dr.79956 Transcribed locus Dr.79956 0.488 -2.048 1.99E-02 0.992 -1.008 9.46E-01 2.005 2.005 7.30E-04 2.079 2.079 7.10E-04 3.168 3.168 4.83E-35 3.366 3.366 3.40E-38 765 2b im:6911368 Im:6911368 Dr.80514 448895 0.476 -2.102 5.78E-03 0.879 -1.138 7.09E-01 2.097 2.097 2.00E-05 2.255 2.255 1.62E-06 3.163 3.163 3.95E-24 3.617 3.617 6.85E-28 Myotubularin related 766 2b mtmr8 Dr.83197 393365 0.693 -1.444 1.09E-01 1.030 1.030 8.49E-01 1.526 1.526 5.35E-03 1.517 1.517 5.06E-03 2.140 2.140 1.95E-02 2.372 2.372 6.00E-05 protein 8 767 2b LOC567669 Hypothetical LOC567669 Dr.121333 567669 0.309 -3.240 7.20E-02 0.935 -1.070 8.34E-01 3.046 3.046 2.36E-03 2.857 2.857 4.46E-03 10.262 10.262 1.29E-06 8.286 8.286 2.00E-05 768 2b si:ch211-191d7.3 Si:ch211-191d7.3 Dr.122452 337530 0.621 -1.610 7.80E-03 1.015 1.015 8.09E-01 1.575 1.575 1.76E-03 1.516 1.516 3.98E-03 2.266 2.266 2.30E-27 2.022 2.022 2.69E-19 769 2b zgc:92866 Zgc:92866 Dr.76532 436755 0.791 -1.264 1.58E-03 1.007 1.007 9.54E-01 1.240 1.240 2.11E-02 1.230 1.230 8.86E-03 1.539 1.539 3.43E-07 1.434 1.434 1.43E-08 Phosphatidylinositol 770 2b pigc Dr.78451 323994 0.443 -2.260 8.30E-04 1.021 1.021 8.25E-01 1.884 1.884 5.39E-03 1.918 1.918 2.18E-03 3.446 3.446 1.56E-18 3.155 3.155 2.98E-14 glycan, class C 771 2b Dr.122988 Transcribed locus Dr.122988 0.614 -1.629 5.99E-02 1.004 1.004 9.74E-01 1.433 1.433 1.43E-01 1.633 1.633 1.45E-03 2.227 2.227 3.64E-22 1.899 1.899 4.02E-02 772 2b Dr.104849 Transcribed locus Dr.104849 0.569 -1.757 5.07E-02 0.845 -1.183 5.70E-01 1.523 1.523 1.55E-01 1.776 1.776 7.60E-04 3.195 3.195 4.84E-21 2.736 2.736 1.46E-24 773 2b LOC565811 Hypothetical LOC565811 Dr.115851 565811 0.608 -1.644 7.36E-03 1.045 1.045 7.73E-01 1.293 1.293 2.41E-01 1.411 1.411 3.48E-02 2.643 2.643 2.72E-13 2.012 2.012 7.47E-08 774 2b zgc:86754 Zgc:86754 Dr.80284 415225 0.553 -1.809 6.70E-04 0.987 -1.014 9.05E-01 1.372 1.372 9.40E-04 1.423 1.423 8.00E-05 2.657 2.657 3.13E-07 2.185 2.185 1.00E-05
Transcribed locus, weakly similar to XP_001098621.1 775 2b Dr.131852 Dr.131852 0.538 -1.860 2.04E-02 1.014 1.014 8.46E-01 1.332 1.332 3.11E-01 1.590 1.590 8.19E-02 3.547 3.547 7.00E-18 3.098 3.098 1.70E-14 myozenin 2 [Macaca mulatta]
Retinitis pigmentosa 2 (X- 776 2b rp2 Dr.80773 406755 0.685 -1.459 2.08E-01 0.966 -1.035 9.24E-01 1.201 1.201 7.30E-04 1.355 1.355 2.19E-01 2.267 2.267 1.75E-21 2.124 2.124 9.05E-21 linked recessive) 777 2b zgc:55794 Zgc:55794 Dr.80343 327593 0.591 -1.691 5.63E-08 1.030 1.030 6.65E-01 1.377 1.377 3.44E-03 1.550 1.550 6.69E-10 2.972 2.972 0.00E+00 2.703 2.703 0.00E+00 778 2b Dr.133202 Transcribed locus Dr.133202 0.302 -3.309 4.17E-02 0.936 -1.068 9.15E-01 1.626 1.626 4.17E-01 2.000 2.000 1.58E-01 7.928 7.928 2.00E-05 6.598 6.598 1.00E-04 779 2b wu:fb26f10 Wu:fb26f10 Dr.76802 321684 0.679 -1.473 1.00E-01 0.966 -1.035 8.23E-01 1.192 1.192 2.90E-01 1.247 1.247 1.24E-01 2.078 2.078 1.54E-18 1.947 1.947 3.12E-15 780 2b Dr.134954 Transcribed locus Dr.134954 0.475 -2.105 2.66E-02 0.943 -1.060 8.54E-01 1.531 1.531 2.55E-01 1.750 1.750 5.31E-02 4.140 4.140 1.00E-05 3.505 3.505 4.00E-05 781 2b Dr.90573 Transcribed locus Dr.90573 0.525 -1.906 1.37E-02 0.953 -1.049 8.53E-01 1.489 1.489 1.83E-01 1.596 1.596 8.01E-03 3.668 3.668 3.21E-07 3.180 3.180 5.71E-06 Hypothetical protein 782 2b LOC791474 Dr.6304 791474 0.529 -1.889 2.20E-02 0.938 -1.066 7.72E-01 1.431 1.431 2.47E-01 1.479 1.479 1.76E-01 3.350 3.350 5.37E-06 2.850 2.850 4.55E-06 LOC791474 Propionyl-Coenzyme A 783 2b pcca carboxylase, alpha Dr.105309 437019 0.628 -1.592 1.14E-02 1.003 1.003 9.85E-01 1.242 1.242 2.24E-01 1.361 1.361 6.13E-02 1.902 1.902 3.00E-05 1.877 1.877 1.09E-06 polypeptide 784 2b eng1a Engrailed 1a Dr.75072 30244 0.593 -1.685 9.70E-04 1.028 1.028 5.65E-01 1.277 1.277 8.63E-03 1.472 1.472 4.36E-03 2.176 2.176 1.14E-19 2.038 2.038 1.83E-08 785 2b si:busm1-241h12.4 Si:busm1-241h12.4 Dr.81772 368857 0.462 -2.164 2.05E-02 0.991 -1.009 9.78E-01 1.570 1.570 1.05E-01 1.828 1.828 1.70E-03 3.262 3.262 3.29E-07 3.138 3.138 1.81E-06 786 2b Dr.133437 Transcribed locus Dr.133437 0.355 -2.820 1.20E-02 1.130 1.130 7.64E-01 1.628 1.628 2.06E-01 1.932 1.932 2.52E-02 4.736 4.736 6.67E-07 3.931 3.931 1.00E-05
Transcribed locus, strongly similar to XP_706358.1 787 2b Dr.123073 Dr.123073 0.423 -2.362 1.02E-02 1.086 1.086 8.02E-01 1.412 1.412 3.47E-01 1.716 1.716 7.30E-02 2.875 2.875 2.10E-04 2.781 2.781 8.00E-05 hypothetical protein XP_701266 [Danio rerio]
Transcribed locus, weakly similar to XP_001339325.1 788 2b Dr.133293 Dr.133293 0.594 -1.684 1.64E-03 1.047 1.047 7.62E-01 1.283 1.283 2.33E-01 1.422 1.422 6.16E-02 2.002 2.002 1.10E-04 2.134 2.134 2.68E-08 hypothetical protein [Danio rerio]
789 2b zgc:86927 Zgc:86927 Dr.36067 415178 0.419 -2.387 1.20E-02 1.027 1.027 9.37E-01 1.420 1.420 3.21E-01 1.704 1.704 3.08E-02 2.917 2.917 1.30E-04 3.113 3.113 1.22E-07 Similar to LOC495955 790 2b LOC796750 Dr.40212 796750 0.530 -1.889 1.60E-02 1.112 1.112 6.09E-01 1.341 1.341 2.91E-01 1.434 1.434 1.16E-01 2.569 2.569 7.00E-05 2.590 2.590 1.98E-06 protein SEC13 homolog (S. 791 2b sec13 Dr.5496 406644 0.645 -1.550 7.68E-03 1.064 1.064 6.30E-01 1.250 1.250 2.28E-01 1.348 1.348 6.95E-02 2.039 2.039 4.00E-05 1.975 1.975 5.45E-07 cerevisiae) 792 2b wu:fj48a06 Wu:fj48a06 Dr.76584 336088 0.684 -1.463 3.29E-02 1.047 1.047 7.10E-01 1.183 1.183 2.55E-01 1.218 1.218 1.31E-01 1.829 1.829 1.00E-05 1.846 1.846 7.50E-07 793 2b wu:fc70h07 Wu:fc70h07 Dr.76504 619262 0.593 -1.686 1.11E-02 1.127 1.127 5.03E-01 1.204 1.204 2.97E-01 1.438 1.438 2.78E-03 2.220 2.220 1.24E-10 1.957 1.957 3.69E-07 Secreted modular calcium 794 2b smoc2 Dr.108698 550416 0.680 -1.470 3.98E-02 0.969 -1.032 8.56E-01 1.124 1.124 5.20E-01 1.228 1.228 1.79E-01 1.811 1.811 5.00E-05 1.903 1.903 1.16E-09 binding protein 2 795 2b zgc:86892 Zgc:86892 Dr.86400 436952 0.330 -3.026 2.86E-03 0.878 -1.139 5.39E-01 1.479 1.479 4.64E-01 2.143 2.143 1.10E-01 4.479 4.479 5.70E-04 5.852 5.852 9.87E-07 796 2b zgc:92083 Zgc:92083 Dr.117302 447860 0.550 -1.819 1.34E-02 0.946 -1.057 7.96E-01 1.246 1.246 2.52E-01 1.315 1.315 2.12E-02 2.401 2.401 3.00E-05 2.222 2.222 1.14E-10 797 2b Dr.83104 Transcribed locus Dr.83104 0.282 -3.548 2.18E-03 0.970 -1.031 8.45E-01 1.735 1.735 1.33E-02 1.761 1.761 3.03E-02 6.391 6.391 6.27E-22 5.700 5.700 4.11E-27 798 2b Dr.79238 Transcribed locus Dr.79238 0.288 -3.473 1.00E-05 0.926 -1.080 3.26E-01 1.761 1.761 1.64E-01 1.662 1.662 1.77E-01 5.138 5.138 1.39E-06 4.932 4.932 2.33E-06 799 2b Dr.125277 Transcribed locus Dr.125277 0.329 -3.040 2.68E-02 1.033 1.033 9.51E-01 1.565 1.565 2.90E-01 1.858 1.858 3.32E-02 4.969 4.969 8.48E-09 4.431 4.431 5.61E-08 800 2b Dr.131054 Transcribed locus Dr.131054 0.452 -2.214 1.05E-02 0.956 -1.046 6.00E-01 1.415 1.415 1.80E-01 1.604 1.604 1.35E-02 3.121 3.121 6.81E-16 3.075 3.075 1.50E-15 X-ray repair complementing defective 801 2b xrcc4 Dr.83748 393759 0.375 -2.664 1.39E-02 0.957 -1.045 8.93E-01 1.429 1.429 4.35E-01 1.630 1.630 2.38E-01 3.750 3.750 1.90E-04 3.931 3.931 3.26E-06 repair in Chinese hamster cells 4 802 2b Dr.133403 Transcribed locus Dr.133403 0.335 -2.983 2.50E-04 0.874 -1.144 6.74E-02 1.475 1.475 2.08E-01 1.838 1.838 1.29E-02 3.939 3.939 5.32E-10 4.094 4.094 9.43E-10 803 2b zgc:77041 Zgc:77041 Dr.16044 404632 0.322 -3.106 5.40E-04 0.893 -1.119 2.49E-01 1.419 1.419 2.96E-01 1.627 1.627 8.61E-02 4.290 4.290 1.46E-10 3.773 3.773 5.87E-10 Reticulon 4 interacting 804 2b rtn4ip1 Dr.16642 393323 0.435 -2.298 5.63E-03 0.919 -1.088 7.20E-01 1.291 1.291 4.19E-01 1.408 1.408 2.31E-01 2.675 2.675 9.00E-05 2.976 2.976 4.07E-08 protein 1 805 2b Dr.28790 Transcribed locus Dr.28790 0.363 -2.759 1.42E-02 1.032 1.032 9.41E-01 1.330 1.330 5.45E-01 1.477 1.477 3.42E-01 3.435 3.435 1.43E-03 3.817 3.817 7.55E-06 Similar to mFLJ00150 806 2b LOC100000455 Dr.115115 100000455 0.462 -2.166 4.00E-04 0.889 -1.125 1.45E-01 1.304 1.304 1.78E-01 1.555 1.555 1.67E-02 3.080 3.080 2.37E-12 2.661 2.661 1.94E-09 protein 807 2b zgc:158387 Zgc:158387 Dr.75902 567275 0.510 -1.962 1.25E-03 0.835 -1.198 1.78E-01 1.313 1.313 1.01E-02 1.519 1.519 6.50E-07 2.726 2.726 7.46E-17 2.514 2.514 1.52E-11 808 2b wu:fp56f09 Wu:fp56f09 Dr.122259 337698 0.364 -2.750 2.24E-03 0.806 -1.241 1.51E-01 1.377 1.377 2.95E-01 1.811 1.811 3.47E-02 4.897 4.897 1.52E-09 4.527 4.527 2.60E-08 809 2b zgc:66353 Zgc:66353 Dr.4114 321378 0.428 -2.338 9.75E-03 0.793 -1.261 1.63E-02 1.246 1.246 3.79E-01 1.513 1.513 5.63E-02 3.247 3.247 1.41E-15 2.996 2.996 1.16E-14 810 2b zgc:66026 Zgc:66026 Dr.18349 393549 0.338 -2.956 1.39E-02 0.835 -1.198 6.84E-02 1.715 1.715 1.54E-01 1.894 1.894 3.10E-02 4.955 4.955 2.00E-05 3.967 3.967 2.80E-04 811 2b zgc:64031 Zgc:64031 Dr.82104 393338 0.282 -3.546 2.43E-02 0.708 -1.413 4.48E-01 1.913 1.913 2.09E-01 2.603 2.603 4.18E-02 8.453 8.453 4.93E-24 5.530 5.530 2.91E-16 812 2b ctsk Cathepsin K Dr.76224 791982 0.406 -2.465 6.10E-04 0.783 -1.277 6.54E-02 1.446 1.446 1.80E-01 1.588 1.588 3.88E-02 3.598 3.598 6.16E-09 2.750 2.750 7.32E-06 813 2b Dr.83137 Transcribed locus Dr.83137 0.452 -2.213 1.09E-02 0.874 -1.144 1.28E-01 1.286 1.286 2.74E-01 1.544 1.544 4.43E-02 2.884 2.884 1.06E-11 2.260 2.260 1.43E-06 Polymerase (DNA 814 2b polb Dr.116029 445402 0.675 -1.482 2.33E-02 0.920 -1.086 6.09E-01 1.230 1.230 3.07E-01 1.191 1.191 3.24E-01 2.157 2.157 7.95E-11 1.784 1.784 3.37E-07 directed), beta
Transcribed locus, weakly 815 2b Dr.126078 similar to NP_065602.1 Dr.126078 1.938 1.938 4.00E-05 1.694 1.694 7.30E-04 Cyt19 [Mus musculus]
816 2b zgc:113232 Zgc:113232 Dr.43135 541546 0.305 -3.275 3.77E-02 0.747 -1.338 2.17E-02 1.932 1.932 8.49E-02 1.628 1.628 1.86E-01 7.160 7.160 3.21E-06 4.802 4.802 5.00E-04 817 2b Dr.122946 Transcribed locus Dr.122946 0.322 -3.109 8.79E-03 0.777 -1.286 2.41E-02 1.506 1.506 1.92E-01 1.559 1.559 1.11E-01 5.738 5.738 1.12E-13 3.621 3.621 5.00E-05 818 2b zgc:86889 Zgc:86889 Dr.133321 415192 0.146 -6.837 2.28E-03 0.812 -1.232 1.49E-01 2.394 2.394 1.09E-01 1.936 1.936 2.18E-01 13.284 13.284 3.66E-08 8.691 8.691 5.56E-06 819 2b Dr.78420 Transcribed locus Dr.78420 0.653 -1.530 1.51E-08 0.917 -1.091 5.45E-01 1.216 1.216 9.62E-03 1.111 1.111 1.08E-01 1.756 1.756 2.98E-03 1.592 1.592 1.76E-02 820 2b pls1 Plastin 1 (I isoform) Dr.113808 334273 0.425 -2.354 6.33E-03 1.046 1.046 4.63E-01 1.202 1.202 4.40E-01 1.678 1.678 1.32E-02 3.125 3.125 4.73E-14 2.563 2.563 3.17E-10 821 2b LOC557591 Similar to Muc5b protein Dr.120883 557591 0.391 -2.557 6.00E-05 0.924 -1.082 2.64E-01 1.163 1.163 5.42E-01 1.713 1.713 5.66E-03 3.162 3.162 1.78E-12 2.929 2.929 8.56E-11 Hypothetical protein 822 2b LOC792511 Dr.120411 792511 0.532 -1.879 1.10E-02 0.926 -1.080 3.43E-01 1.335 1.335 1.17E-01 1.457 1.457 7.04E-03 2.128 2.128 1.41E-10 2.046 2.046 7.75E-08 LOC792511 823 2b Dr.121884 Transcribed locus Dr.121884 0.426 -2.345 5.71E-03 0.991 -1.010 9.76E-01 1.478 1.478 2.20E-01 1.817 1.817 5.50E-03 3.404 3.404 1.46E-11 2.831 2.831 3.97E-09 824 2b Dr.130502 Transcribed locus Dr.130502 0.585 -1.709 8.30E-04 0.951 -1.052 5.53E-01 1.249 1.249 2.05E-01 1.532 1.532 2.31E-03 2.205 2.205 1.32E-34 1.895 1.895 1.79E-14 825 2b sb:cb657 Sb:cb657 Dr.76278 368358 0.555 -1.802 4.42E-02 1.079 1.079 8.01E-01 1.358 1.358 2.25E-01 1.511 1.511 7.45E-02 2.224 2.224 1.40E-04 1.930 1.930 6.00E-05 Cytochrome P450, family 826 2b cyp17a1 17, subfamily A, Dr.79318 399692 0.532 -1.880 3.88E-09 1.001 1.001 9.83E-01 1.274 1.274 7.30E-04 1.533 1.533 1.59E-03 2.025 2.025 6.63E-15 1.779 1.779 1.46E-13 polypeptide 1 827 2b zgc:92267 Zgc:92267 Dr.102467 494035 0.689 -1.451 3.10E-02 1.106 1.106 5.36E-01 1.325 1.325 6.31E-02 1.381 1.381 4.16E-02 2.005 2.005 2.44E-20 2.360 2.360 4.07E-31 828 2b wu:fj84g06 Wu:fj84g06 Dr.81536 337579 0.697 -1.434 6.84E-02 1.049 1.049 8.09E-01 1.238 1.238 1.73E-01 1.299 1.299 6.59E-02 1.809 1.809 2.80E-04 2.075 2.075 3.93E-16 829 2b Dr.128938 Transcribed locus Dr.128938 0.363 -2.756 2.62E-02 1.199 1.199 1.56E-01 2.191 2.191 7.20E-04 2.436 2.436 1.40E-04 6.072 6.072 3.13E-12 6.643 6.643 1.77E-13 830 2b Dr.83144 Transcribed locus Dr.83144 0.613 -1.632 4.20E-02 1.083 1.083 7.28E-01 1.527 1.527 4.16E-02 1.763 1.763 2.50E-03 3.003 3.003 5.48E-13 3.378 3.378 2.81E-15 Transcribed locus, strongly similar to NP_001007066.1 831 2b Dr.91146 receptor potential cation Dr.91146 0.801 -1.249 1.65E-01 1.056 1.056 6.08E-01 1.173 1.173 1.99E-01 1.251 1.251 8.22E-02 1.563 1.563 2.37E-06 1.631 1.631 2.49E-11 channel, subfamily A, member 1a [Danio rerio]
Similar to novel potassium 832 2b LOC100003336 channel tetramerisation Dr.134946 100003336 0.696 -1.437 9.82E-02 1.053 1.053 8.05E-01 1.281 1.281 2.46E-01 1.630 1.630 6.70E-03 2.185 2.185 1.02E-18 2.339 2.339 2.28E-10 domain protein
Intraflagellar transport 81 833 2b ift81 Dr.18625 432390 0.584 -1.711 2.38E-01 1.046 1.046 7.03E-01 1.459 1.459 9.88E-02 1.855 1.855 3.71E-03 2.679 2.679 1.00E-05 3.292 3.292 6.80E-08 homolog ORM1-like 1 (S. 834 2b ormdl1 Dr.27136 368632 0.781 -1.280 1.87E-01 1.038 1.038 8.31E-01 1.192 1.192 2.75E-01 1.394 1.394 6.37E-03 1.745 1.745 3.00E-05 2.038 2.038 6.34E-25 cerevisiae) UDP-GlcNAc:betaGal beta- 1,3-N- 835 2b b3gnt5 Dr.76667 336526 0.731 -1.367 1.53E-01 0.971 -1.030 8.32E-01 1.317 1.317 1.35E-01 1.561 1.561 3.00E-05 2.213 2.213 6.18E-03 2.378 2.378 5.20E-04 acetylglucosaminyltransfer ase 5 Hypothetical protein 836 2b LOC407694 Dr.77359 407694 0.662 -1.511 2.48E-01 0.929 -1.076 3.96E-01 1.280 1.280 1.84E-01 1.575 1.575 5.89E-03 2.366 2.366 5.00E-05 2.821 2.821 7.32E-07 LOC407694 837 2b flot1 Flotillin 1 Dr.140639 30069 0.625 -1.600 5.41E-02 1.031 1.031 6.25E-01 1.316 1.316 1.23E-01 1.826 1.826 2.18E-07 2.672 2.672 1.17E-16 2.563 2.563 4.99E-16 838 2b wu:fb61e06 Wu:fb61e06 Dr.77125 322446 0.719 -1.390 1.22E-01 1.041 1.041 7.01E-01 1.231 1.231 3.57E-01 1.539 1.539 2.92E-02 2.322 2.322 2.69E-18 2.248 2.248 3.32E-19 839 2b wu:fb74g08 Wu:fb74g08 Dr.105194 322844 0.711 -1.406 9.12E-02 0.954 -1.048 5.92E-01 1.305 1.305 1.32E-01 1.578 1.578 3.00E-05 1.863 1.863 1.99E-11 2.113 2.113 1.84E-07 840 2b Dr.83251 Transcribed locus Dr.83251 0.630 -1.587 2.55E-02 0.909 -1.100 1.31E-01 1.550 1.550 4.43E-03 1.727 1.727 5.72E-21 2.069 2.069 1.00E-05 2.575 2.575 1.06E-08 841 2b zgc:92162 Zgc:92162 Dr.87011 436622 0.471 -2.125 1.33E-01 0.985 -1.015 9.77E-01 1.509 1.509 3.77E-01 2.250 2.250 2.83E-02 3.136 3.136 1.82E-03 4.003 4.003 1.00E-05 Nucleotide binding protein 842 2b nubp1 Dr.88416 503919 0.628 -1.592 1.60E-02 1.000 1.000 1.00E+00 1.289 1.289 2.08E-01 1.515 1.515 4.20E-04 2.048 2.048 4.00E-05 2.160 2.160 1.44E-07 1 (MinD homolog, E. coli)
843 2b wu:fa97h07 Wu:fa97h07 Dr.104634 337111 0.464 -2.155 1.00E-05 0.937 -1.067 5.29E-01 2.178 2.178 7.77E-03 1.998 1.998 1.86E-02 6.642 6.642 9.53E-07 8.304 8.304 7.71E-08
Transcribed locus, weakly similar to XP_001103359.1 ectonucleotide 844 2b Dr.10826 Dr.10826 0.811 -1.233 6.62E-02 0.910 -1.099 5.39E-01 1.453 1.453 1.88E-02 1.409 1.409 1.10E-02 2.140 2.140 6.80E-08 2.283 2.283 1.45E-11 pyrophosphatase/phospho diesterase 1 [Macaca mulatta]
845 2b wu:fb13d05 Wu:fb13d05 Dr.104799 336548 0.635 -1.576 7.82E-03 1.017 1.017 9.24E-01 1.293 1.293 1.80E-01 1.223 1.223 2.04E-01 1.571 1.571 6.14E-03 1.835 1.835 3.00E-05 846 2b Dr.122800 Transcribed locus Dr.122800 0.494 -2.022 2.05E-02 1.022 1.022 8.10E-01 1.561 1.561 5.68E-02 1.319 1.319 2.81E-01 2.227 2.227 1.10E-04 2.842 2.842 5.22E-08 847 2b wu:fb82h02 Wu:fb82h02 Dr.21169 323139 0.517 -1.932 5.42E-02 1.090 1.090 7.87E-01 1.319 1.319 3.56E-01 1.310 1.310 3.29E-01 1.868 1.868 4.32E-03 2.367 2.367 2.91E-09 Hypothetical protein 848 2b LOC100003732 Dr.120214 100003732 0.292 -3.420 8.37E-03 1.048 1.048 9.19E-01 1.745 1.745 1.90E-01 2.177 2.177 3.42E-03 3.728 3.728 5.90E-04 4.898 4.898 1.00E-05 LOC100003732 849 2b Dr.131226 Transcribed locus Dr.131226 0.443 -2.256 3.30E-04 1.038 1.038 8.68E-01 1.462 1.462 1.91E-01 1.631 1.631 6.03E-02 2.452 2.452 2.75E-03 3.483 3.483 2.00E-05 850 2b wu:fd47h11 Wu:fd47h11 Dr.79961 325937 0.727 -1.375 5.89E-02 0.978 -1.022 8.96E-01 1.187 1.187 2.62E-01 1.221 1.221 6.66E-02 1.351 1.351 1.29E-02 1.504 1.504 1.19E-07 Hypothetical protein 851 2b LOC100002471 Dr.114497 100002471 0.660 -1.515 3.88E-02 0.935 -1.069 7.06E-01 1.255 1.255 1.52E-01 1.151 1.151 3.76E-01 1.836 1.836 7.61E-06 2.059 2.059 4.28E-16 LOC100002471 852 2b Dr.132683 Transcribed locus Dr.132683 0.436 -2.293 2.83E-02 0.953 -1.049 8.67E-01 1.630 1.630 1.88E-01 1.423 1.423 2.34E-01 3.479 3.479 8.26E-07 4.037 4.037 4.91E-08 853 2b stx3a Syntaxin 3A Dr.82925 393515 0.691 -1.446 5.00E-05 0.966 -1.035 4.92E-01 1.188 1.188 1.01E-02 1.160 1.160 2.52E-02 1.573 1.573 1.53E-07 1.728 1.728 6.83E-08 Cell division cycle 123 854 2b cdc123 Dr.134594 393694 0.740 -1.352 1.58E-01 0.994 -1.006 9.77E-01 1.248 1.248 2.73E-01 1.171 1.171 3.81E-01 1.553 1.553 1.21E-03 1.710 1.710 3.94E-11 homolog (S. cerevisiae) Wingless-type MMTV 855 2b wnt16 integration site family, Dr.87285 404628 0.711 -1.407 1.75E-08 1.038 1.038 2.75E-01 1.259 1.259 1.40E-04 1.200 1.200 4.79E-02 1.717 1.717 3.00E-05 1.884 1.884 1.84E-06 member 16 856 2b LOC798848 Similar to Igfbp5 protein Dr.116546 798848 0.439 -2.280 7.10E-03 1.102 1.102 7.21E-01 1.438 1.438 2.89E-01 1.274 1.274 4.86E-01 2.919 2.919 2.90E-04 3.423 3.423 2.00E-05 857 2b Dr.133731 Transcribed locus Dr.133731 0.474 -2.110 2.69E-02 1.114 1.114 7.49E-01 1.446 1.446 2.00E-01 1.279 1.279 3.57E-01 2.529 2.529 6.00E-05 2.977 2.977 7.72E-08 858 2b Dr.72235 Transcribed locus Dr.72235 0.295 -3.390 4.93E-02 1.208 1.208 7.62E-01 1.728 1.728 3.19E-01 1.532 1.532 3.98E-01 4.790 4.790 3.40E-04 5.185 5.185 8.32E-06 859 2b zgc:92420 Zgc:92420 Dr.28514 445069 0.585 -1.710 6.77E-06 1.113 1.113 6.76E-02 1.246 1.246 3.25E-01 1.267 1.267 2.82E-01 2.087 2.087 1.08E-22 2.291 2.291 1.60E-32 860 2b Dr.134771 Transcribed locus Dr.134771 0.470 -2.126 1.59E-02 1.155 1.155 6.24E-01 1.484 1.484 1.94E-01 1.375 1.375 2.31E-01 2.443 2.443 9.00E-05 2.821 2.821 7.12E-06 861 2b wu:fj33b10 Wu:fj33b10 Dr.6315 335802 0.713 -1.402 6.30E-02 1.066 1.066 7.13E-01 1.216 1.216 9.44E-02 1.211 1.211 7.53E-02 1.577 1.577 8.40E-04 1.762 1.762 1.43E-06 862 2b Dr.131919 Transcribed locus Dr.131919 0.599 -1.671 1.01E-02 1.022 1.022 9.13E-01 1.224 1.224 3.30E-01 1.138 1.138 5.12E-01 1.807 1.807 3.51E-06 2.095 2.095 3.80E-12 863 2b zgc:92086 Zgc:92086 Dr.18499 436643 0.595 -1.681 2.43E-02 1.030 1.030 8.97E-01 1.263 1.263 3.93E-01 1.197 1.197 4.78E-01 1.852 1.852 4.20E-04 2.278 2.278 2.73E-21 864 2b zgc:63666 Zgc:63666 Dr.86390 393414 0.696 -1.436 7.98E-02 1.063 1.063 7.18E-01 1.173 1.173 3.20E-01 1.096 1.096 5.74E-01 1.489 1.489 6.83E-03 1.769 1.769 3.87E-10 865 2b bin1 Bridging integrator 1 Dr.132574 447863 0.684 -1.462 9.96E-03 1.065 1.065 5.03E-01 1.356 1.356 4.19E-03 1.190 1.190 7.89E-02 1.713 1.713 5.00E-05 1.813 1.813 1.84E-03 866 2b wu:fb92f04 Wu:fb92f04 Dr.21193 323215 0.501 -1.997 1.52E-02 1.169 1.169 4.28E-01 1.572 1.572 1.35E-02 1.225 1.225 3.49E-01 2.202 2.202 5.00E-05 2.624 2.624 2.44E-07 867 2b im:6910535 Im:6910535 Dr.108863 448892 0.301 -3.325 6.20E-04 0.810 -1.234 4.24E-03 2.061 2.061 2.63E-02 1.326 1.326 4.42E-01 4.291 4.291 1.86E-13 4.260 4.260 5.32E-09 868 2b LOC796163 Similar to Chx10 protein Dr.118938 796163 0.610 -1.639 1.08E-01 1.009 1.009 9.79E-01 1.325 1.325 1.82E-01 1.152 1.152 3.88E-01 1.954 1.954 2.00E-05 1.765 1.765 5.54E-06 Deoxyhypusine 869 2b dohh hydroxylase/monooxygena Dr.2393 321732 0.648 -1.543 1.01E-02 0.987 -1.013 9.39E-01 1.304 1.304 1.41E-01 1.105 1.105 5.74E-01 1.919 1.919 2.00E-05 1.815 1.815 1.00E-05 se Metal-regulatory 870 2b mtf1 Dr.118403 195821 0.680 -1.471 6.75E-02 1.090 1.090 6.85E-01 1.232 1.232 1.80E-01 1.095 1.095 5.23E-01 1.657 1.657 7.00E-05 1.474 1.474 7.86E-03 transcription factor 1 871 2b zgc:92225 Zgc:92225 Dr.132558 436906 0.406 -2.465 2.59E-03 1.061 1.061 8.17E-01 1.388 1.388 2.78E-01 1.224 1.224 4.89E-01 3.170 3.170 1.63E-08 2.575 2.575 7.13E-06 872 2b zgc:103473 Zgc:103473 Dr.84834 492477 0.507 -1.971 2.81E-12 1.073 1.073 4.53E-01 1.227 1.227 4.71E-02 1.256 1.256 1.95E-02 2.215 2.215 4.32E-03 2.020 2.020 9.41E-07 873 2b LOC558658 Hypothetical LOC558658 Dr.116697 558658 0.417 -2.399 5.37E-03 0.979 -1.021 9.37E-01 1.370 1.370 2.80E-01 1.119 1.119 6.78E-01 2.663 2.663 1.50E-04 2.596 2.596 1.00E-05 Methylmalonyl CoA 874 2b mcee Dr.82958 553804 0.545 -1.837 1.22E-02 1.008 1.008 9.75E-01 1.229 1.229 4.31E-01 1.104 1.104 6.74E-01 1.959 1.959 7.90E-04 1.944 1.944 3.12E-06 epimerase 875 2b Dr.91932 Transcribed locus Dr.91932 0.342 -2.923 4.94E-02 0.979 -1.021 9.70E-01 1.316 1.316 4.87E-01 1.189 1.189 6.25E-01 3.016 3.016 2.50E-04 2.972 2.972 7.73E-06 876 2b Dr.123345 Transcribed locus Dr.123345 0.491 -2.036 1.75E-02 0.999 -1.001 9.98E-01 1.412 1.412 1.80E-01 1.155 1.155 5.57E-01 2.232 2.232 8.10E-04 2.434 2.434 2.00E-05 Amiloride-sensitive cation 877 2b accn2b Dr.98481 407671 0.417 -2.396 2.19E-02 1.005 1.005 9.90E-01 1.414 1.414 3.11E-01 1.182 1.182 6.23E-01 2.479 2.479 7.20E-04 2.813 2.813 6.56E-07 channel 2 b 878 2b Dr.82714 Transcribed locus Dr.82714 0.477 -2.096 5.98E-03 0.939 -1.065 8.15E-01 1.311 1.311 2.97E-01 1.164 1.164 4.82E-01 2.068 2.068 1.70E-04 2.343 2.343 6.40E-06 879 2b wu:fb97g01 Wu:fb97g01 Dr.77734 323413 0.507 -1.972 4.90E-04 1.019 1.019 9.16E-01 1.259 1.259 3.64E-01 1.150 1.150 5.31E-01 1.905 1.905 9.50E-04 2.106 2.106 4.00E-05 880 2b Dr.92239 Transcribed locus Dr.92239 0.394 -2.536 2.58E-02 1.101 1.101 8.25E-01 1.458 1.458 3.12E-01 1.251 1.251 5.15E-01 2.516 2.516 7.50E-04 2.742 2.742 1.00E-05 Procollagen-lysine, 2- 881 2b plod2 oxoglutarate 5- Dr.77688 100036767 0.426 -2.346 3.28E-03 0.965 -1.037 8.91E-01 1.308 1.308 4.29E-01 1.157 1.157 6.38E-01 2.140 2.140 6.80E-04 2.293 2.293 2.51E-07 dioxygenase 2 Novel protein similar to vertebrate S100 calcium 882 2b DKEY-105N5.1 Dr.92711 100005433 0.620 -1.613 4.55E-03 1.006 1.006 9.67E-01 1.108 1.108 3.26E-01 1.118 1.118 4.45E-01 1.490 1.490 1.27E-03 1.593 1.593 6.00E-05 binding protein A11 (S100A11) 883 2b wu:fc51b07 Wu:fc51b07 Dr.78979 325002 0.643 -1.556 3.00E-05 0.936 -1.068 5.39E-01 1.127 1.127 2.35E-01 1.131 1.131 2.07E-01 1.583 1.583 1.57E-07 1.525 1.525 1.06E-03 884 2b zgc:103433 Zgc:103433 Dr.91379 450017 0.449 -2.226 8.42E-03 0.892 -1.122 6.99E-01 1.336 1.336 2.72E-01 1.146 1.146 5.85E-01 2.280 2.280 3.00E-05 2.201 2.201 3.39E-07 885 2b Dr.84837 Transcribed locus Dr.84837 0.239 -4.186 8.89E-03 1.030 1.030 9.57E-01 1.799 1.799 2.31E-01 1.675 1.675 2.59E-01 4.274 4.274 1.00E-05 3.883 3.883 8.00E-05 Hypothetical protein 886 2b LOC100007768 Dr.86350 100007768 0.520 -1.922 8.30E-04 0.951 -1.052 7.65E-01 1.387 1.387 4.52E-02 1.244 1.244 1.23E-01 1.984 1.984 7.00E-05 1.925 1.925 5.55E-06 LOC100007768 ADP-ribosylation factor-like 887 2b arl2bp Dr.110760 393976 0.671 -1.490 1.00E-05 1.019 1.019 8.35E-01 1.199 1.199 2.45E-02 1.007 1.007 9.47E-01 1.696 1.696 9.50E-07 1.522 1.522 5.00E-05 2 binding protein 888 2b Dr.123072 Transcribed locus Dr.123072 0.586 -1.707 7.91E-03 1.072 1.072 7.28E-01 1.146 1.146 6.10E-01 1.000 -1.000 1.00E+00 1.734 1.734 2.00E-05 1.696 1.696 1.20E-03 889 2b zgc:85616 Zgc:85616 Dr.113645 406356 0.686 -1.458 2.58E-02 1.080 1.080 3.62E-01 1.153 1.153 1.08E-02 1.084 1.084 6.14E-01 1.600 1.600 2.63E-12 1.576 1.576 1.00E-14 890 2b Dr.123742 Transcribed locus Dr.123742 0.503 -1.988 8.39E-03 1.084 1.084 7.56E-01 1.235 1.235 3.83E-01 1.148 1.148 5.72E-01 2.370 2.370 3.00E-05 2.413 2.413 4.56E-06 891 2b Dr.133072 Transcribed locus Dr.133072 0.558 -1.791 1.69E-03 1.100 1.100 5.45E-01 1.181 1.181 4.02E-01 1.064 1.064 7.05E-01 2.020 2.020 1.00E-04 2.253 2.253 1.00E-05 892 2b Dr.124987 Transcribed locus Dr.124987 0.514 -1.947 1.92E-03 1.181 1.181 3.43E-01 1.256 1.256 3.80E-01 1.121 1.121 6.41E-01 2.082 2.082 3.90E-04 2.302 2.302 1.85E-06 893 2b Dr.9851 Transcribed locus Dr.9851 0.578 -1.731 5.14E-02 1.200 1.200 5.33E-01 1.279 1.279 3.03E-01 1.153 1.153 5.12E-01 1.820 1.820 2.70E-04 2.092 2.092 1.35E-07 894 2b Dr.133399 Transcribed locus Dr.133399 0.581 -1.721 2.88E-01 1.079 1.079 8.87E-01 1.283 1.283 4.71E-01 1.049 1.049 8.71E-01 1.788 1.788 3.66E-02 1.891 1.891 5.14E-06 Sodium channel, voltage 895 2b scn12ab Dr.110026 566868 0.625 -1.601 6.79E-02 1.036 1.036 7.03E-01 1.159 1.159 3.19E-01 1.166 1.166 3.79E-01 2.374 2.374 2.51E-15 2.130 2.130 1.65E-12 gated, type VIII, alpha b Ubiquitin specific 896 2b usp39 Dr.77033 790924 0.760 -1.316 1.08E-01 1.011 1.011 9.03E-01 1.144 1.144 2.37E-01 1.068 1.068 5.53E-01 1.696 1.696 3.00E-05 1.580 1.580 2.00E-05 peptidase 39 897 2b zgc:101741 Zgc:101741 Dr.84246 492766 0.581 -1.720 2.34E-02 1.022 1.022 8.89E-01 1.290 1.290 2.11E-01 1.111 1.111 6.12E-01 2.970 2.970 1.05E-10 2.533 2.533 4.16E-08 898 2b Dr.122521 Transcribed locus Dr.122521 0.443 -2.256 3.09E-02 1.165 1.165 6.53E-01 1.517 1.517 2.12E-01 1.289 1.289 4.11E-01 3.994 3.994 2.22E-06 3.546 3.546 2.00E-05 899 2b Dr.123540 Transcribed locus Dr.123540 0.605 -1.652 2.21E-02 1.023 1.023 8.99E-01 1.242 1.242 2.16E-01 1.136 1.136 4.11E-01 2.265 2.265 5.35E-18 1.885 1.885 6.41E-11
Transcribed locus, weakly similar to NP_065703.1 900 2b Dr.124888 Dr.124888 0.500 -2.000 3.73E-02 1.010 1.010 9.77E-01 1.396 1.396 2.42E-01 1.220 1.220 4.35E-01 3.184 3.184 9.96E-12 2.732 2.732 4.68E-09 finger protein 286 [Homo sapiens]
901 2b zgc:77068 Zgc:77068 Dr.113519 405824 0.490 -2.042 2.38E-02 0.950 -1.053 8.40E-01 1.315 1.315 3.89E-01 1.201 1.201 5.55E-01 2.693 2.693 6.00E-05 2.612 2.612 2.00E-05 902 2b Dr.13801 Transcribed locus Dr.13801 0.372 -2.685 1.08E-03 1.017 1.017 9.57E-01 1.386 1.386 3.35E-01 1.210 1.210 4.88E-01 3.665 3.665 1.02E-09 3.551 3.551 5.27E-11 903 2b wu:fa97d10 Wu:fa97d10 Dr.76347 337101 0.467 -2.141 1.40E-02 0.998 -1.002 9.93E-01 1.363 1.363 3.42E-01 1.152 1.152 6.42E-01 2.640 2.640 2.50E-04 2.656 2.656 3.64E-06
Transcribed locus, weakly similar to XP_001098232.1 904 2b Dr.13241 similar to ring finger protein Dr.13241 0.721 -1.387 7.25E-03 0.993 -1.007 9.44E-01 1.109 1.109 1.24E-01 1.084 1.084 3.25E-01 1.569 1.569 1.04E-06 1.641 1.641 3.00E-05 111 isoform 5 [Macaca mulatta]
905 2b Dr.15365 Transcribed locus Dr.15365 0.501 -1.994 1.21E-02 1.024 1.024 9.22E-01 1.277 1.277 3.87E-01 1.282 1.282 3.79E-01 2.606 2.606 3.00E-05 2.938 2.938 5.24E-07 906 2b Dr.123372 Transcribed locus Dr.123372 0.434 -2.306 9.80E-03 0.922 -1.085 8.02E-01 1.442 1.442 2.96E-01 1.198 1.198 5.39E-01 3.808 3.808 5.54E-10 3.753 3.753 1.65E-11 907 2b wu:fc79b02 Wu:fc79b02 Dr.3325 325456 0.508 -1.969 1.32E-02 0.937 -1.067 5.11E-01 1.240 1.240 3.57E-01 1.215 1.215 3.83E-01 2.981 2.981 1.03E-17 2.814 2.814 2.54E-16 908 2b LOC558513 Hypothetical LOC558513 Dr.4251 558513 0.342 -2.921 2.00E-05 0.829 -1.206 2.13E-01 1.430 1.430 2.72E-01 1.426 1.426 2.16E-01 4.748 4.748 2.64E-11 4.265 4.265 2.15E-09 909 2b Dr.114009 Transcribed locus Dr.114009 0.484 -2.064 1.85E-03 0.854 -1.171 7.22E-02 1.257 1.257 3.93E-01 1.110 1.110 7.02E-01 2.541 2.541 9.00E-05 2.660 2.660 8.69E-06 910 2b wu:fb15h11 Wu:fb15h11 Dr.5716 336638 0.459 -2.177 4.97E-02 0.943 -1.060 5.99E-01 1.121 1.121 6.47E-01 1.129 1.129 4.69E-01 2.825 2.825 1.31E-07 2.743 2.743 2.86E-07 911 2b im:7145328 Im:7145328 Dr.104946 497482 0.640 -1.563 1.16E-06 1.117 1.117 1.84E-01 1.071 1.071 6.60E-01 1.378 1.378 4.00E-05 1.930 1.930 3.77E-17 2.009 2.009 1.68E-26 912 2b Dr.105847 Transcribed locus Dr.105847 0.588 -1.699 8.49E-02 1.137 1.137 6.86E-01 1.131 1.131 5.37E-01 1.360 1.360 4.50E-04 2.071 2.071 4.76E-07 2.231 2.231 5.93E-08 Scavenger receptor class 913 2b scarf1 Dr.74559 336834 0.636 -1.572 1.20E-02 1.150 1.150 4.38E-01 1.049 1.049 7.32E-01 1.237 1.237 5.05E-03 1.773 1.773 3.00E-05 1.802 1.802 1.31E-07 F, member 1 914 2b zgc:66443 Zgc:66443 Dr.114215 406856 0.639 -1.565 1.32E-02 1.207 1.207 2.33E-01 1.324 1.324 1.43E-01 1.515 1.515 7.93E-03 2.695 2.695 2.29E-11 2.538 2.538 3.30E-10 915 2b wu:fc20g06 Wu:fc20g06 Dr.2805 324163 0.575 -1.739 3.81E-03 1.208 1.208 1.69E-02 1.302 1.302 2.96E-01 1.616 1.616 1.35E-02 2.755 2.755 3.26E-21 2.883 2.883 1.44E-26 916 2b wu:fj29h10 Wu:fj29h10 Dr.79667 335617 0.674 -1.484 1.23E-01 1.166 1.166 4.39E-01 1.291 1.291 2.34E-01 1.606 1.606 4.64E-03 2.501 2.501 2.49E-14 2.638 2.638 4.38E-15 917 2b wu:fe16c11 Wu:fe16c11 Dr.122189 326772 0.704 -1.420 1.80E-02 1.161 1.161 2.94E-01 1.132 1.132 4.13E-01 1.260 1.260 1.40E-01 1.956 1.956 9.42E-23 1.833 1.833 1.38E-18 918 2b Dr.76018 Transcribed locus Dr.76018 0.549 -1.821 1.94E-02 1.182 1.182 4.64E-01 1.225 1.225 4.32E-01 1.543 1.543 4.34E-02 3.234 3.234 1.06E-19 2.843 2.843 2.45E-15 919 2b ipo9 Importin 9 Dr.33564 406860 0.606 -1.649 3.11E-02 1.228 1.228 2.55E-01 1.144 1.144 4.94E-01 1.490 1.490 2.49E-02 2.522 2.522 2.70E-20 2.401 2.401 8.43E-19 920 2b wu:fc76c11 Wu:fc76c11 Dr.27582 325434 0.658 -1.519 7.75E-03 1.177 1.177 2.59E-01 1.204 1.204 1.39E-01 1.285 1.285 8.33E-02 2.018 2.018 7.46E-19 1.988 1.988 4.08E-23 921 2b LOC572466 Hypothetical LOC572466 Dr.45180 572466 0.623 -1.604 1.68E-02 1.179 1.179 3.62E-01 1.225 1.225 3.68E-01 1.331 1.331 1.91E-01 1.767 1.767 2.20E-04 2.073 2.073 2.17E-12 922 2b Dr.92084 Transcribed locus Dr.92084 0.734 -1.362 3.06E-02 1.122 1.122 3.94E-01 1.265 1.265 2.31E-01 1.264 1.264 1.67E-01 1.574 1.574 2.00E-05 1.762 1.762 1.66E-08 923 2b wu:fe11g10 Wu:fe11g10 Dr.79993 777631 0.538 -1.858 6.74E-03 1.180 1.180 3.88E-01 1.355 1.355 1.46E-01 1.639 1.639 1.87E-03 2.482 2.482 6.68E-20 2.458 2.458 2.65E-19 Proteasome (prosome, macropain) 26S subunit, 924 2b psmd7 Dr.80368 327330 0.631 -1.586 9.41E-03 1.161 1.161 2.47E-01 1.318 1.318 8.98E-02 1.436 1.436 1.32E-02 2.091 2.091 1.20E-04 2.243 2.243 3.25E-06 non-ATPase, 7 (Mov34 homolog) 925 2b LOC569084 Similar to claudin i Dr.1081 569084 0.827 -1.209 7.67E-02 1.116 1.116 2.33E-01 1.198 1.198 2.67E-01 1.208 1.208 1.90E-01 1.597 1.597 1.50E-04 1.815 1.815 4.35E-19 926 2b zgc:153020 Zgc:153020 Dr.134726 560761 0.800 -1.250 1.71E-01 1.138 1.138 3.84E-01 1.228 1.228 8.41E-02 1.185 1.185 1.78E-01 1.635 1.635 7.71E-06 1.839 1.839 1.05E-10 Phospholipase A2, group 927 2b pla2g12b Dr.76783 406739 0.762 -1.312 8.86E-02 1.135 1.135 2.74E-01 1.245 1.245 1.76E-01 1.204 1.204 1.86E-01 1.686 1.686 1.40E-04 1.905 1.905 2.60E-09 XIIB 928 2b ipo9 Importin 9 Dr.132506 406860 0.754 -1.327 1.30E-01 1.220 1.220 1.83E-01 1.187 1.187 1.70E-01 1.284 1.284 1.20E-01 2.114 2.114 9.04E-08 2.365 2.365 1.71E-14 929 2b zgc:100897 Zgc:100897 Dr.23554 445297 0.676 -1.480 1.20E-02 1.303 1.303 1.00E-05 1.382 1.382 1.60E-01 1.494 1.494 6.19E-02 2.761 2.761 1.69E-31 3.099 3.099 4.07E-34 Arachidonate 12- 930 2b alox12 Dr.132326 322732 0.757 -1.322 1.24E-01 1.187 1.187 3.26E-01 1.144 1.144 3.59E-01 1.228 1.228 1.83E-01 1.591 1.591 3.65E-03 1.702 1.702 1.46E-14 lipoxygenase 931 2b Dr.48126 Transcribed locus Dr.48126 0.703 -1.422 4.12E-02 1.185 1.185 3.24E-01 1.160 1.160 2.74E-01 1.227 1.227 1.50E-01 1.650 1.650 6.00E-05 2.013 2.013 4.31E-09 932 2b Dr.86052 Transcribed locus Dr.86052 0.799 -1.252 1.56E-01 1.142 1.142 3.05E-01 1.139 1.139 2.65E-01 1.202 1.202 1.01E-01 1.511 1.511 6.61E-07 1.680 1.680 1.94E-11 933 2b zgc:66125 Zgc:66125 Dr.96456 393796 0.760 -1.316 5.77E-02 1.117 1.117 3.85E-01 1.138 1.138 2.56E-01 1.222 1.222 9.87E-02 1.579 1.579 1.77E-06 1.841 1.841 1.99E-14 Hypothetical protein 934 2b LOC798067 Dr.117730 798067 0.648 -1.543 1.02E-02 1.095 1.095 5.66E-01 1.245 1.245 2.93E-01 1.219 1.219 2.62E-01 1.925 1.925 4.60E-04 2.273 2.273 4.25E-10 LOC798067 935 2b zgc:91940 Zgc:91940 Dr.81687 436942 0.586 -1.707 3.01E-03 1.168 1.168 2.81E-01 1.273 1.273 3.23E-01 1.183 1.183 4.75E-01 2.052 2.052 1.00E-04 2.601 2.601 3.60E-13 936 2b Dr.124767 Transcribed locus Dr.124767 0.738 -1.355 1.47E-01 1.141 1.141 3.03E-01 1.162 1.162 2.26E-01 1.129 1.129 3.48E-01 1.650 1.650 4.50E-04 1.883 1.883 1.82E-07 937 2b Dr.83175 Transcribed locus Dr.83175 0.682 -1.466 3.54E-02 1.145 1.145 4.38E-01 1.258 1.258 3.68E-01 1.222 1.222 4.04E-01 2.067 2.067 6.20E-04 2.718 2.718 1.77E-06 938 2b zgc:64042 Zgc:64042 Dr.84488 393609 0.742 -1.348 2.00E-05 1.113 1.113 5.77E-02 1.204 1.204 1.43E-02 1.190 1.190 3.33E-02 1.658 1.658 6.53E-14 2.087 2.087 0.00E+00
Transcribed locus, weakly similar to NP_065704.1 939 2b Dr.130105 Dr.130105 0.654 -1.529 1.92E-02 1.044 1.044 7.78E-01 1.210 1.210 3.00E-01 1.263 1.263 1.28E-01 2.104 2.104 8.42E-15 2.315 2.315 5.62E-20 finger protein 287 [Homo sapiens]
940 2b Dr.21599 Transcribed locus Dr.21599 0.717 -1.396 2.97E-02 1.044 1.044 7.34E-01 1.144 1.144 1.48E-01 1.232 1.232 5.47E-02 1.732 1.732 1.57E-06 1.911 1.911 4.42E-11 941 2b zgc:76875 Zgc:76875 Dr.82970 405849 0.762 -1.313 4.40E-02 1.061 1.061 5.76E-01 1.123 1.123 2.81E-01 1.175 1.175 1.80E-01 1.520 1.520 1.31E-06 1.628 1.628 2.45E-02 942 2b Dr.133397 Transcribed locus Dr.133397 0.794 -1.260 2.68E-01 1.073 1.073 7.34E-01 1.128 1.128 3.62E-01 1.143 1.143 2.66E-01 1.530 1.530 4.00E-05 1.632 1.632 7.78E-09 943 2b LOC562071 Hypothetical LOC562071 Dr.82437 562071 0.780 -1.281 1.23E-01 1.085 1.085 4.49E-01 1.106 1.106 4.74E-01 1.169 1.169 2.45E-01 1.665 1.665 1.00E-05 1.788 1.788 9.23E-09 944 2b wu:fd10a10 Wu:fd10a10 Dr.4005 325758 0.563 -1.777 1.79E-02 1.060 1.060 2.93E-01 1.262 1.262 2.70E-01 1.128 1.128 5.54E-01 2.562 2.562 5.22E-12 2.870 2.870 6.76E-14 Zinc finger, DHHC-type 945 2b zdhhc23 Dr.83252 445301 0.577 -1.733 1.57E-02 1.028 1.028 8.88E-01 1.306 1.306 2.55E-01 1.193 1.193 4.27E-01 2.196 2.196 8.00E-05 2.712 2.712 1.64E-11 containing 23 Lipoma HMGIC fusion 946 2b lhfp Dr.76496 494110 0.775 -1.291 2.03E-02 1.100 1.100 3.28E-01 1.126 1.126 2.87E-01 1.075 1.075 5.61E-01 1.564 1.564 1.80E-04 1.619 1.619 2.89E-08 partner Paired-like homeodomain 947 2b pitx3 Dr.89375 402974 0.671 -1.490 2.19E-02 1.122 1.122 4.08E-01 1.155 1.155 4.91E-01 1.108 1.108 6.20E-01 1.923 1.923 1.50E-04 2.110 2.110 7.09E-09 transcription factor 3 948 2b Dr.90818 Transcribed locus Dr.90818 0.642 -1.557 3.87E-03 1.113 1.113 3.93E-01 1.171 1.171 2.84E-01 1.197 1.197 2.33E-01 2.150 2.150 3.89E-18 2.176 2.176 3.16E-16 949 2b LOC798216 Similar to ubiquitin Dr.121223 798216 0.809 -1.237 1.12E-01 1.088 1.088 4.71E-01 1.175 1.175 2.43E-01 1.062 1.062 6.44E-01 1.659 1.659 4.40E-04 1.848 1.848 8.18E-07 950 2b zgc:162316 Zgc:162316 Dr.92977 100037372 0.721 -1.386 2.14E-01 1.185 1.185 1.13E-01 1.214 1.214 1.50E-01 1.159 1.159 2.79E-01 2.030 2.030 9.00E-05 2.171 2.171 3.00E-05 Glioma tumor suppressor 951 2b gltscr1 Dr.75629 386775 0.738 -1.355 1.79E-01 1.109 1.109 4.30E-01 1.150 1.150 2.86E-01 1.134 1.134 3.53E-01 1.907 1.907 2.00E-05 2.353 2.353 9.84E-11 candidate region gene 1
952 2b Dr.89189 Transcribed locus Dr.89189 0.612 -1.633 6.73E-02 1.158 1.158 2.88E-01 1.122 1.122 5.65E-01 1.231 1.231 2.75E-01 2.544 2.544 2.54E-09 3.149 3.149 4.20E-13 953 2b Dr.92138 Transcribed locus Dr.92138 0.631 -1.586 9.57E-03 1.146 1.146 3.58E-01 1.114 1.114 5.25E-01 1.123 1.123 4.94E-01 1.798 1.798 1.00E-05 2.254 2.254 8.65E-15 954 2b Dr.97432 Transcribed locus Dr.97432 0.648 -1.544 1.53E-02 1.211 1.211 1.17E-01 1.159 1.159 3.63E-01 1.109 1.109 5.16E-01 1.800 1.800 1.10E-04 2.069 2.069 1.01E-07 Eukaryotic translation 955 2b eif3s8 Dr.117110 334234 0.782 -1.278 3.98E-07 1.095 1.095 1.57E-01 1.188 1.188 7.14E-02 1.121 1.121 3.07E-02 1.807 1.807 9.18E-13 1.545 1.545 4.78E-16 initiation factor 3, subunit 8
1-acylglycerol-3-phosphate 956 2b agpat3 Dr.75961 406734 0.828 -1.208 2.25E-01 1.086 1.086 4.36E-01 1.124 1.124 2.80E-01 1.056 1.056 6.23E-01 1.615 1.615 4.00E-05 1.508 1.508 6.67E-07 O-acyltransferase 3
957 2b wu:fc54g06 Wu:fc54g06 Dr.78101 325086 0.781 -1.280 7.74E-02 1.208 1.208 7.25E-02 1.116 1.116 2.77E-01 1.022 1.022 9.24E-01 2.032 2.032 3.34E-07 1.798 1.798 3.29E-06 958 2b zgc:86870 Zgc:86870 Dr.84307 436953 0.820 -1.220 1.58E-01 1.123 1.123 3.19E-01 1.124 1.124 3.77E-01 1.017 1.017 8.98E-01 1.611 1.611 2.27E-06 1.405 1.405 1.03E-02 959 2b wu:fb97g08 Wu:fb97g08 Dr.121803 323416 0.858 -1.166 4.26E-01 1.134 1.134 3.29E-01 1.151 1.151 3.09E-01 1.140 1.140 3.25E-01 1.738 1.738 1.50E-04 1.788 1.788 1.55E-12 960 2b Dr.128681 Transcribed locus Dr.128681 0.782 -1.279 3.09E-01 1.203 1.203 2.17E-01 1.257 1.257 1.79E-01 1.172 1.172 3.82E-01 2.142 2.142 7.00E-05 1.977 1.977 7.00E-05 Transcribed locus, moderately similar to 961 2b Dr.121924 XP_001107554.1 similar Dr.121924 0.835 -1.198 2.87E-01 1.083 1.083 5.18E-01 1.087 1.087 5.14E-01 1.277 1.277 9.00E-02 1.911 1.911 1.13E-25 1.842 1.842 1.18E-12 to 40S ribosomal protein S29 [Macaca mulatta] 962 2b Dr.130898 Transcribed locus Dr.130898 0.699 -1.430 4.79E-01 1.089 1.089 8.14E-01 1.241 1.241 3.88E-01 1.490 1.490 4.56E-02 3.569 3.569 1.07E-10 3.235 3.235 8.09E-09 963 2b zgc:162198 Zgc:162198 Dr.66850 325787 0.730 -1.370 3.50E-01 1.069 1.069 8.80E-01 1.251 1.251 2.47E-01 1.280 1.280 1.79E-01 2.496 2.496 7.65E-07 2.717 2.717 2.06E-18 964 2b zgc:77358 Zgc:77358 Dr.82216 402928 0.768 -1.301 2.00E-01 1.069 1.069 7.33E-01 1.186 1.186 4.66E-01 1.244 1.244 3.35E-01 1.964 1.964 9.34E-07 2.016 2.016 6.24E-09 965 2b Dr.129661 Transcribed locus Dr.129661 0.729 -1.371 1.00E-01 1.116 1.116 4.99E-01 1.124 1.124 5.11E-01 1.132 1.132 5.06E-01 2.453 2.453 4.01E-23 2.334 2.334 2.48E-25 966 2b wu:fc01f10 Wu:fc01f10 Dr.135376 323526 0.548 -1.824 1.70E-01 1.224 1.224 4.50E-01 1.254 1.254 3.13E-01 1.301 1.301 1.76E-01 6.738 6.738 9.70E-07 5.313 5.313 1.00E-05 967 2b Dr.1034 Transcribed locus Dr.1034 0.493 -2.027 7.85E-03 0.890 -1.123 1.64E-01 1.301 1.301 3.36E-01 1.843 1.843 2.70E-02 1.981 1.981 1.08E-03 2.580 2.580 3.60E-27 968 2b Dr.123589 Transcribed locus Dr.123589 0.505 -1.982 1.94E-02 0.902 -1.108 8.66E-02 1.333 1.333 9.59E-02 1.695 1.695 1.70E-04 1.847 1.847 2.24E-03 2.394 2.394 3.00E-05 969 2b pou47 POU domain gene 47 Dr.221 30397 0.468 -2.137 5.90E-03 0.919 -1.088 2.00E-01 1.432 1.432 9.00E-02 1.795 1.795 1.00E-05 2.305 2.305 3.11E-03 2.826 2.826 7.24E-09 970 2b Dr.40010 Transcribed locus Dr.40010 0.745 -1.342 2.34E-02 0.908 -1.102 2.80E-01 1.156 1.156 2.35E-01 1.346 1.346 9.80E-04 1.397 1.397 1.88E-03 1.542 1.542 1.48E-07
Transcribed locus, strongly similar to XP_001117773.1 971 2b Dr.122614 similar to NMDA receptor 1 Dr.122614 0.710 -1.409 1.01E-01 0.992 -1.008 9.48E-01 1.310 1.310 5.00E-05 1.391 1.391 1.60E-04 1.339 1.339 1.57E-02 1.672 1.672 2.91E-08 isoform NR1-1 precursor [Macaca mulatta]
972 2b Dr.13875 Transcribed locus Dr.13875 0.552 -1.812 4.31E-06 0.996 -1.004 9.56E-01 1.403 1.403 2.33E-02 1.731 1.731 1.03E-06 1.801 1.801 1.66E-09 2.795 2.795 2.07E-08 973 2b Dr.133541 Transcribed locus Dr.133541 0.489 -2.046 1.51E-01 1.083 1.083 8.68E-01 1.497 1.497 2.44E-01 1.680 1.680 1.54E-01 1.978 1.978 2.97E-03 2.757 2.757 3.77E-06 974 2b Dr.23571 Transcribed locus Dr.23571 0.453 -2.206 3.38E-17 1.080 1.080 4.10E-01 1.778 1.778 5.10E-04 1.660 1.660 6.70E-04 2.189 2.189 4.24E-06 3.235 3.235 2.36E-11 975 2b zgc:91964 Zgc:91964 Dr.81856 431715 0.420 -2.383 2.74E-03 1.110 1.110 4.09E-01 2.073 2.073 1.83E-02 1.958 1.958 2.66E-02 2.273 2.273 1.31E-03 3.316 3.316 8.05E-14 976 2b Dr.106912 Transcribed locus Dr.106912 0.715 -1.399 1.51E-01 0.966 -1.036 6.93E-01 1.315 1.315 5.98E-07 1.138 1.138 3.76E-01 1.423 1.423 6.57E-03 1.686 1.686 6.73E-06 Hypothetical protein 977 2b LOC799253 Dr.119564 799253 0.611 -1.635 2.58E-01 0.919 -1.089 8.49E-01 1.761 1.761 1.59E-01 1.577 1.577 2.13E-01 2.011 2.011 6.74E-03 3.685 3.685 4.40E-09 LOC799253 978 2b zgc:64085 Zgc:64085 Dr.12508 393380 0.673 -1.486 1.00E-05 0.866 -1.155 9.30E-04 1.404 1.404 1.27E-03 1.388 1.388 2.00E-05 1.632 1.632 6.00E-05 2.400 2.400 3.47E-17 CDNA clone 979 2b Dr.135386 Dr.135386 0.430 -2.326 2.44E-03 0.817 -1.224 4.29E-02 1.985 1.985 8.80E-04 2.119 2.119 2.36E-06 3.625 3.625 5.93E-06 5.861 5.861 4.89E-09 IMAGE:7148352 980 2b wu:fa01c11 Wu:fa01c11 Dr.75374 334720 0.358 -2.793 3.70E-03 0.884 -1.132 3.70E-01 2.151 2.151 3.41E-03 1.936 1.936 8.76E-03 3.791 3.791 3.17E-15 6.150 6.150 1.13E-32 981 2b Dr.123535 Transcribed locus Dr.123535 0.724 -1.382 2.23E-01 0.867 -1.154 6.01E-01 1.261 1.261 1.81E-01 1.235 1.235 2.82E-02 1.303 1.303 5.18E-02 1.756 1.756 2.32E-14 982 2b Dr.76591 Transcribed locus Dr.76591 0.538 -1.857 1.04E-01 0.912 -1.097 8.12E-01 1.423 1.423 1.88E-01 1.405 1.405 2.94E-01 1.610 1.610 4.00E-05 2.348 2.348 1.94E-09 Oligodendrocyte 983 2b olig3 Dr.117660 324857 0.361 -2.770 6.50E-06 0.850 -1.177 3.12E-01 1.381 1.381 3.60E-01 1.252 1.252 4.88E-01 2.772 2.772 3.80E-04 3.935 3.935 3.34E-11 transcription factor 3 984 2b wu:fa94h07 Wu:fa94h07 Dr.23516 336758 0.498 -2.009 5.60E-04 0.895 -1.117 2.51E-01 1.301 1.301 1.35E-01 1.286 1.286 9.44E-02 2.040 2.040 4.83E-08 2.664 2.664 4.03E-17 985 2b LOC559332 Hypothetical LOC559332 Dr.83827 559332 0.475 -2.104 6.20E-04 0.958 -1.043 8.61E-01 1.323 1.323 4.04E-01 1.311 1.311 2.10E-01 1.981 1.981 3.34E-02 2.805 2.805 1.00E-05 986 2b zgc:77165 Zgc:77165 Dr.19061 404608 0.621 -1.611 9.49E-03 0.921 -1.086 6.49E-01 1.144 1.144 5.24E-01 1.180 1.180 3.72E-01 1.621 1.621 6.05E-03 2.187 2.187 9.39E-07 987 2b zgc:92926 Zgc:92926 Dr.80970 436797 0.465 -2.151 1.30E-04 0.856 -1.169 4.10E-02 1.347 1.347 2.63E-01 1.308 1.308 2.10E-01 2.149 2.149 1.00E-05 3.442 3.442 1.41E-19 Hypothetical protein 988 2b LOC799605 Dr.120565 799605 0.310 -3.226 3.30E-04 0.779 -1.284 6.40E-02 1.519 1.519 2.43E-01 1.869 1.869 2.93E-02 3.583 3.583 5.44E-06 4.655 4.655 1.01E-09 LOC799605 989 2b wu:fb03e09 Wu:fb03e09 Dr.20328 337254 0.366 -2.731 1.20E-04 0.899 -1.113 1.44E-01 1.255 1.255 4.20E-01 1.678 1.678 1.41E-02 2.547 2.547 1.30E-04 3.147 3.147 2.80E-09 990 2b si:dkey-72l14.4 Si:dkey-72l14.4 Dr.7451 562545 0.614 -1.628 2.83E-03 0.949 -1.053 4.23E-01 1.143 1.143 2.39E-01 1.305 1.305 2.18E-03 1.518 1.518 8.00E-05 1.880 1.880 1.73E-07 991 2b Dr.133385 Transcribed locus Dr.133385 0.510 -1.960 3.42E-03 0.921 -1.086 2.95E-01 1.132 1.132 4.11E-01 1.252 1.252 2.02E-01 1.896 1.896 4.40E-04 2.317 2.317 1.19E-17 992 2b Dr.133752 Transcribed locus Dr.133752 0.665 -1.504 4.22E-06 0.943 -1.061 2.63E-01 1.072 1.072 4.96E-01 1.146 1.146 2.25E-01 1.422 1.422 3.75E-03 1.525 1.525 1.16E-02 993 2b wu:fj84f01 Wu:fj84f01 Dr.81535 337578 0.384 -2.607 1.70E-04 0.777 -1.286 8.60E-04 1.293 1.293 2.37E-01 1.587 1.587 1.27E-02 2.136 2.136 4.00E-05 2.625 2.625 1.22E-10 Myocyte enhancer factor 994 2b mef2d Dr.132977 30580 0.758 -1.319 1.04E-01 0.899 -1.112 6.09E-01 1.101 1.101 5.19E-01 1.124 1.124 3.27E-01 1.309 1.309 9.87E-03 1.745 1.745 4.68E-09 2d Hypothetical protein 995 2b LOC795597 Dr.89872 795597 0.369 -2.713 4.51E-02 0.684 -1.463 3.28E-01 1.424 1.424 4.57E-01 1.908 1.908 1.18E-01 2.754 2.754 1.57E-06 5.448 5.448 1.60E-04 LOC795597 Fibroblast growth factor 8 996 2b fgf8b Dr.20979 65089 0.636 -1.572 1.06E-02 1.012 1.012 9.45E-01 1.151 1.151 4.10E-01 1.198 1.198 2.37E-01 1.502 1.502 9.80E-04 1.987 1.987 2.04E-12 b 997 2b LOC556236 Hypothetical LOC556236 Dr.82536 556236 0.643 -1.556 5.46E-03 1.042 1.042 8.23E-01 1.121 1.121 4.97E-01 1.230 1.230 2.58E-01 1.410 1.410 5.41E-02 2.166 2.166 2.07E-16 998 2b LOC100001301 Similar to Prickle2 Dr.78165 100001301 0.627 -1.595 1.20E-01 1.121 1.121 6.22E-01 1.089 1.089 5.94E-01 1.152 1.152 5.18E-01 1.356 1.356 2.12E-01 1.805 1.805 2.30E-06 Hypothetical protein 999 2b LOC792428 Dr.118886 792428 0.603 -1.657 6.86E-03 1.244 1.244 1.82E-01 1.160 1.160 2.82E-01 1.445 1.445 8.00E-04 1.682 1.682 2.13E-06 2.086 2.086 7.25E-11 LOC792428 1000 2b Dr.85690 Transcribed locus Dr.85690 0.657 -1.522 5.58E-02 1.151 1.151 1.60E-01 1.083 1.083 3.54E-01 1.321 1.321 2.38E-02 1.431 1.431 3.13E-06 1.766 1.766 1.24E-14 1001 2b id:ibd5104 Id:ibd5104 Dr.83324 338195 0.715 -1.399 1.42E-01 1.199 1.199 3.09E-01 1.063 1.063 6.76E-01 1.328 1.328 3.27E-02 1.498 1.498 1.81E-02 1.562 1.562 2.93E-08 Autophagy-related 4C 1002 2b atg4c Dr.121931 415193 0.558 -1.793 2.99E-03 1.023 1.023 8.59E-01 1.198 1.198 2.17E-01 1.523 1.523 6.60E-04 1.803 1.803 2.00E-05 2.261 2.261 4.92E-10 (yeast) 1003 2b Dr.80215 Transcribed locus Dr.80215 0.572 -1.747 2.18E-02 1.078 1.078 6.43E-01 1.165 1.165 4.75E-01 1.602 1.602 8.70E-03 1.844 1.844 2.00E-05 2.618 2.618 5.73E-15 1004 2b wu:fa06h01 Wu:fa06h01 Dr.13577 334875 0.607 -1.648 4.20E-04 1.020 1.020 7.90E-01 1.104 1.104 4.32E-01 1.362 1.362 2.00E-04 1.787 1.787 1.39E-15 2.155 2.155 4.74E-26 1005 2b Dr.131984 Transcribed locus Dr.131984 0.766 -1.305 1.05E-01 1.063 1.063 6.40E-01 1.066 1.066 7.13E-01 1.268 1.268 7.27E-02 1.436 1.436 3.92E-02 1.866 1.866 7.28E-16 1006 2b wu:fj86g03 Wu:fj86g03 Dr.132921 337607 0.682 -1.467 1.67E-02 1.114 1.114 4.99E-01 1.183 1.183 2.32E-01 1.443 1.443 2.36E-03 1.678 1.678 4.00E-05 2.285 2.285 2.57E-30 1007 2b myo9b Myosin IXb Dr.4876 322219 0.737 -1.356 4.84E-02 1.187 1.187 2.65E-01 1.095 1.095 5.43E-01 1.407 1.407 5.52E-03 1.516 1.516 8.90E-04 1.896 1.896 1.18E-19 1008 2b wu:fc14f09 Wu:fc14f09 Dr.105655 767701 0.690 -1.450 4.97E-02 1.098 1.098 3.93E-01 1.071 1.071 6.09E-01 0.978 -1.023 8.64E-01 1.594 1.594 7.20E-04 1.836 1.836 2.00E-06 1009 2b Dr.132335 Transcribed locus Dr.132335 0.770 -1.299 7.41E-02 1.002 1.002 9.87E-01 1.075 1.075 5.88E-01 1.049 1.049 6.07E-01 1.466 1.466 2.80E-04 1.658 1.658 1.40E-15 1010 2b wu:fc04b03 Wu:fc04b03 Dr.78003 323592 0.525 -1.904 2.10E-04 1.051 1.051 7.57E-01 1.214 1.214 3.84E-01 1.021 1.021 9.28E-01 2.360 2.360 3.00E-05 2.985 2.985 2.52E-09 1011 2b LOC100001785 Similar to cathepsin L Dr.132540 100001785 0.497 -2.013 2.90E-02 0.979 -1.021 9.33E-01 1.055 1.055 7.73E-01 1.076 1.076 7.42E-01 3.005 3.005 1.13E-15 3.791 3.791 5.66E-11 1012 2b Dr.133710 Transcribed locus Dr.133710 0.400 -2.500 2.26E-02 1.114 1.114 4.83E-01 1.077 1.077 5.81E-01 1.064 1.064 5.84E-01 2.179 2.179 2.87E-03 3.648 3.648 6.09E-10 1013 2b zgc:101803 Zgc:101803 Dr.88420 450030 0.862 -1.160 9.76E-02 1.007 1.007 9.80E-01 1.074 1.074 7.20E-01 0.968 -1.033 8.73E-01 1.473 1.473 1.66E-02 1.695 1.695 6.42E-08 1014 2b zgc:92306 Zgc:92306 Dr.113700 791456 0.676 -1.480 1.21E-01 1.072 1.072 7.86E-01 1.130 1.130 6.06E-01 1.126 1.126 5.74E-01 1.482 1.482 1.87E-02 2.070 2.070 7.57E-15
Amyloid beta (A4) precursor protein-binding, 1015 2b apbb1ip Dr.88358 393607 0.723 -1.383 7.16E-02 1.054 1.054 5.93E-01 1.136 1.136 1.54E-01 1.138 1.138 1.86E-01 1.495 1.495 5.15E-06 1.995 1.995 1.56E-17 family B, member 1 interacting protein
1016 2b LOC573492 Hypothetical LOC573492 Dr.118655 573492 0.713 -1.403 2.99E-02 1.123 1.123 4.66E-01 1.147 1.147 2.90E-01 1.115 1.115 3.42E-01 1.512 1.512 1.54E-03 1.934 1.934 1.55E-21 1017 2b Dr.90742 Transcribed locus Dr.90742 0.614 -1.628 3.29E-03 1.255 1.255 1.64E-01 1.196 1.196 3.77E-01 1.229 1.229 2.73E-01 1.772 1.772 3.50E-04 2.841 2.841 1.28E-12 1018 2b wu:fb99g06 Transcribed locus Dr.121806 386979 0.785 -1.274 8.55E-03 1.108 1.108 2.74E-01 1.100 1.100 4.01E-01 1.030 1.030 7.77E-01 1.332 1.332 1.29E-02 1.731 1.731 8.71E-07 Stromal cell-derived factor 1019 2b sdf2 Dr.79812 336879 0.780 -1.282 2.20E-04 1.073 1.073 3.98E-01 1.172 1.172 4.81E-02 1.050 1.050 7.88E-01 1.391 1.391 1.12E-01 1.983 1.983 9.73E-10 2 1020 2b Dr.131316 Transcribed locus Dr.131316 0.744 -1.344 8.54E-03 1.047 1.047 6.78E-01 1.286 1.286 5.83E-02 1.103 1.103 5.00E-01 1.684 1.684 6.38E-06 2.055 2.055 1.63E-13 1021 2b zgc:73112 Zgc:73112 Dr.6047 393799 0.699 -1.431 1.42E-02 1.015 1.015 8.29E-01 1.264 1.264 9.39E-02 1.327 1.327 5.59E-03 1.888 1.888 2.80E-04 2.732 2.732 5.32E-06 1022 2b zgc:77855 Zgc:77855 Dr.88688 393836 0.695 -1.438 2.35E-02 1.003 1.003 9.85E-01 1.291 1.291 3.44E-01 1.230 1.230 3.59E-01 1.967 1.967 7.00E-05 2.468 2.468 4.21E-10 1023 2b LOC100004607 Similar to Apoa4 protein Dr.132329 100004607 0.699 -1.430 8.12E-06 0.987 -1.013 9.40E-01 1.274 1.274 2.60E-01 1.176 1.176 3.28E-01 1.560 1.560 2.72E-02 2.090 2.090 7.36E-20 1024 2b Dr.9594 Transcribed locus Dr.9594 0.688 -1.453 3.30E-01 0.966 -1.035 9.29E-01 1.488 1.488 5.48E-02 1.305 1.305 1.14E-01 1.792 1.792 8.00E-05 3.128 3.128 5.41E-13 Similar to UDP-glucuronic acid/UDP-N- 1025 2b LOC100005351 Dr.115527 100005351 0.526 -1.901 1.83E-01 0.745 -1.342 5.45E-01 1.601 1.601 2.60E-01 1.406 1.406 3.94E-01 2.817 2.817 4.10E-04 3.457 3.457 1.17E-12 acetylgalactosamine dual transporter 1026 2b Dr.78953 Transcribed locus Dr.78953 0.804 -1.244 9.46E-02 0.868 -1.152 4.28E-01 1.107 1.107 4.70E-01 1.141 1.141 3.41E-01 1.444 1.444 1.46E-03 1.655 1.655 3.39E-15 1027 2b Dr.90284 Transcribed locus Dr.90284 0.704 -1.421 1.03E-01 0.805 -1.242 3.59E-01 1.183 1.183 9.67E-02 1.161 1.161 4.84E-02 1.627 1.627 2.00E-05 1.865 1.865 5.90E-23 Similar to MGC80281 1028 2b LOC557898 Dr.78069 557898 0.797 -1.255 1.58E-01 0.893 -1.120 5.16E-01 1.101 1.101 3.89E-01 1.208 1.208 7.66E-02 1.534 1.534 1.70E-04 1.573 1.573 3.38E-10 protein Hypothetical protein 1029 2b LOC796798 Dr.90648 796798 0.800 -1.249 3.49E-02 0.833 -1.201 7.91E-02 1.093 1.093 3.86E-01 1.176 1.176 7.76E-02 1.490 1.490 2.90E-04 1.578 1.578 7.00E-05 LOC796798 Similar to CCDC74B 1030 2b LOC557479 Dr.119781 557479 0.642 -1.558 2.39E-02 0.844 -1.185 4.09E-01 1.153 1.153 5.20E-01 1.121 1.121 5.56E-01 2.311 2.311 1.45E-03 2.538 2.538 3.41E-08 protein 1031 2b zgc:73201 Zgc:73201 Dr.26944 324079 0.773 -1.294 1.09E-01 0.958 -1.043 7.97E-01 1.145 1.145 4.44E-01 1.065 1.065 6.85E-01 1.623 1.623 2.70E-04 1.791 1.791 1.06E-07 1032 2b Dr.85572 Transcribed locus Dr.85572 0.715 -1.398 1.70E-01 0.915 -1.093 6.92E-01 1.222 1.222 7.71E-02 1.199 1.199 1.77E-01 2.121 2.121 1.90E-04 2.400 2.400 1.04E-16 Pleckstrin homology-like 1033 2b phlda3 domain, family A, member Dr.120320 368779 0.731 -1.368 2.98E-02 0.925 -1.081 6.03E-01 1.167 1.167 2.53E-01 1.178 1.178 1.17E-01 1.725 1.725 1.00E-04 1.964 1.964 6.00E-05 3 Signal peptide, CUB 1034 2b scube2 Dr.3848 503728 0.784 -1.276 1.55E-01 0.939 -1.065 7.47E-01 1.095 1.095 2.98E-01 1.154 1.154 2.37E-01 1.467 1.467 1.10E-04 1.715 1.715 1.15E-09 domain, EGF-like 2 1035 2b chac Chorea acanthocytosis Dr.19565 378837 0.736 -1.359 3.98E-02 0.935 -1.070 5.16E-01 1.083 1.083 4.65E-01 1.075 1.075 4.53E-01 1.497 1.497 3.02E-02 1.919 1.919 4.05E-06 1036 2b LOC100005077 Similar to alpha-tectorin Dr.65913 100005077 0.470 -2.128 6.75E-02 0.704 -1.419 2.80E-01 1.038 1.038 9.20E-01 1.213 1.213 6.04E-01 3.408 3.408 3.65E-07 6.749 6.749 9.25E-09 1037 2b zgc:103438 Zgc:103438 Dr.86834 450015 0.587 -1.704 1.51E-01 0.785 -1.274 5.06E-01 1.072 1.072 7.09E-01 1.472 1.472 6.42E-03 3.990 3.990 1.21E-33 7.541 7.541 0.00E+00 Tissue inhibitor of 1038 2b timp2l Dr.102602 406650 0.923 -1.083 7.68E-01 1.324 1.324 1.22E-02 1.917 1.917 2.97E-23 2.996 2.996 2.67E-16 4.255 4.255 3.05E-19 10.144 10.144 3.78E-08 metalloproteinase 2, like Proteasome (prosome, 1039 2b psmb11 macropain) subunit, beta Dr.8210 64279 0.950 -1.052 6.00E-01 1.174 1.174 2.64E-01 1.280 1.280 9.44E-03 1.369 1.369 7.60E-04 1.517 1.517 2.39E-03 2.078 2.078 5.27E-12 type, 11 B-cell CLL/lymphoma 6 1040 2b bcl6 Dr.115290 393707 0.873 -1.145 3.65E-01 1.024 1.024 8.49E-01 1.182 1.182 1.12E-01 1.289 1.289 2.84E-03 1.457 1.457 5.00E-05 1.735 1.735 5.01E-09 (zinc finger protein 51) 1041 2b wu:fp52e02 Transcribed locus Dr.85903 386835 0.652 -1.533 2.25E-01 1.257 1.257 4.26E-01 1.747 1.747 2.21E-02 2.652 2.652 2.42E-06 5.443 5.443 1.67E-12 9.719 9.719 2.19E-21 Rho guanine nucleotide 1042 2b arhgef1 Dr.133654 368266 0.925 -1.081 4.32E-01 1.027 1.027 7.95E-01 1.086 1.086 3.70E-01 1.258 1.258 1.00E-05 1.196 1.196 7.48E-03 1.591 1.591 3.00E-05 exchange factor (GEF) 1
1043 2b zgc:91984 Zgc:91984 Dr.32169 431775 0.891 -1.122 3.41E-01 0.997 -1.003 9.75E-01 1.123 1.123 1.50E-01 1.338 1.338 7.00E-04 1.335 1.335 3.07E-03 1.685 1.685 2.29E-07 Solute carrier family 1 (glutamate/neutral amino 1044 2b slc1a4 Dr.77685 368885 0.916 -1.092 3.10E-01 1.027 1.027 6.97E-01 1.160 1.160 2.51E-02 1.599 1.599 4.90E-13 1.608 1.608 1.10E-04 2.517 2.517 9.14E-14 acid transporter), member 4 Folylpolyglutamate 1045 2b fpgs Dr.81920 406746 0.948 -1.055 6.00E-01 0.968 -1.033 6.72E-01 1.110 1.110 2.69E-02 1.369 1.369 2.73E-06 1.302 1.302 4.00E-05 1.686 1.686 4.33E-12 synthase 1046 2b zgc:110459 Zgc:110459 Dr.78179 553622 0.971 -1.030 8.04E-01 1.020 1.020 8.66E-01 1.234 1.234 8.53E-02 1.471 1.471 5.40E-04 1.382 1.382 9.00E-05 2.059 2.059 9.74E-08 1047 2b wu:fe16c03 Wu:fe16c03 Dr.106191 326770 0.809 -1.236 1.21E-01 1.039 1.039 8.15E-01 1.178 1.178 8.00E-05 1.420 1.420 6.93E-03 1.508 1.508 4.73E-08 1.650 1.650 5.00E-05 1048 2b wu:fc41f10 Wu:fc41f10 Dr.75531 324768 0.788 -1.269 2.82E-02 1.060 1.060 5.28E-01 1.217 1.217 1.12E-01 1.431 1.431 8.00E-05 1.472 1.472 4.80E-04 1.634 1.634 6.64E-07 1049 2b zgc:92236 Zgc:92236 Dr.88917 436901 0.775 -1.290 1.02E-01 1.044 1.044 7.57E-01 1.281 1.281 1.23E-01 1.445 1.445 4.09E-03 1.602 1.602 2.70E-04 1.928 1.928 4.51E-12 1050 2b Dr.134725 Transcribed locus Dr.134725 0.743 -1.346 2.71E-01 1.043 1.043 7.47E-01 1.330 1.330 1.72E-01 1.995 1.995 5.40E-04 1.955 1.955 1.59E-03 2.621 2.621 9.19E-08
Transcribed locus, strongly similar to XP_690753.2 1051 2b Dr.122769 Dr.122769 0.802 -1.246 2.15E-01 1.144 1.144 4.41E-01 1.305 1.305 8.10E-02 1.788 1.788 6.22E-09 2.069 2.069 1.81E-11 2.034 2.034 7.37E-08 hypothetical protein, partial [Danio rerio]
1052 2b Dr.76346 Transcribed locus Dr.76346 0.769 -1.300 2.31E-01 1.115 1.115 7.08E-02 1.352 1.352 1.34E-01 1.815 1.815 2.31E-02 2.346 2.346 1.00E-05 2.335 2.335 5.00E-05 Prostaglandin- 1053 2b ptgs1 Dr.115126 246226 0.798 -1.254 1.51E-01 1.073 1.073 5.49E-01 1.552 1.552 1.96E-02 1.751 1.751 2.30E-04 1.910 1.910 3.60E-08 2.136 2.136 1.00E-05 endoperoxide synthase 1
1054 2b Dr.45458 Transcribed locus Dr.45458 0.703 -1.423 1.19E-01 1.171 1.171 7.57E-02 1.954 1.954 1.40E-04 2.377 2.377 7.48E-13 2.929 2.929 2.76E-12 3.437 3.437 9.00E-05 1055 2b Dr.122907 Transcribed locus Dr.122907 0.890 -1.124 5.16E-01 1.111 1.111 5.58E-01 1.268 1.268 4.37E-02 1.496 1.496 2.00E-05 1.435 1.435 2.15E-13 1.695 1.695 1.62E-06 Similar to B-box and SPRY 1056 2b LOC559377 Dr.23682 559377 0.753 -1.328 8.27E-02 1.112 1.112 4.85E-01 1.368 1.368 9.02E-02 1.649 1.649 9.11E-07 1.568 1.568 5.93E-02 2.120 2.120 9.09E-24 domain containing 1057 2b wu:fj67h12 Wu:fj67h12 Dr.7234 337451 0.867 -1.154 3.52E-01 1.101 1.101 3.98E-01 1.229 1.229 1.74E-01 1.317 1.317 3.07E-02 1.284 1.284 2.15E-02 1.704 1.704 4.00E-05 Similar to DEAD Box 1058 2b LOC563448 Dr.83188 563448 0.769 -1.300 2.58E-01 1.191 1.191 1.50E-01 1.262 1.262 6.89E-02 1.507 1.507 1.01E-02 1.521 1.521 1.01E-02 2.124 2.124 1.54E-13 Protein 5 1059 2b Dr.85215 Transcribed locus Dr.85215 0.620 -1.612 3.20E-01 1.140 1.140 7.72E-01 1.613 1.613 4.60E-02 1.938 1.938 2.92E-03 2.220 2.220 2.38E-06 4.275 4.275 1.17E-23 1060 2b wu:fj05f05 Wu:fj05f05 Dr.80731 335362 0.532 -1.881 1.97E-01 1.300 1.300 4.12E-01 3.106 3.106 5.60E-04 2.969 2.969 1.90E-04 3.524 3.524 8.84E-08 10.043 10.043 4.90E-06 1061 2b wu:fc14a10 Wu:fc14a10 Dr.118157 323917 0.790 -1.266 8.97E-02 1.163 1.163 1.50E-01 1.269 1.269 1.27E-02 1.891 1.891 6.00E-05 1.381 1.381 2.96E-02 2.301 2.301 1.70E-04 1062 2b zgc:66419 Zgc:66419 Dr.85930 394086 0.800 -1.250 5.72E-01 1.521 1.521 1.55E-01 1.426 1.426 1.20E-01 2.501 2.501 2.55E-07 2.192 2.192 3.87E-03 3.580 3.580 2.27E-14 1063 2b exosc4 Exosome component 4 Dr.107456 393712 0.693 -1.443 5.00E-05 1.206 1.206 1.15E-03 1.301 1.301 1.22E-03 1.515 1.515 2.63E-07 2.384 2.384 1.86E-07 1.883 1.883 8.27E-06 1064 2b wu:fc44e02 Wu:fc44e02 Dr.79112 324828 0.620 -1.613 5.80E-08 1.262 1.262 3.99E-02 1.415 1.415 2.71E-03 1.630 1.630 1.30E-03 2.826 2.826 4.41E-18 2.379 2.379 2.65E-10 YTH domain family, 1065 2b ythdf1 Dr.3039 327606 0.723 -1.384 1.44E-02 1.130 1.130 2.59E-01 1.218 1.218 1.30E-01 1.352 1.352 3.56E-03 1.937 1.937 4.98E-07 1.561 1.561 6.80E-03 member 1 1066 2b wu:fc93b03 Wu:fc93b03 Dr.15376 402912 0.821 -1.218 1.47E-01 1.116 1.116 3.37E-01 1.118 1.118 3.29E-01 1.254 1.254 5.28E-02 1.680 1.680 5.77E-07 1.376 1.376 1.66E-03 Similar to Heat shock 1067 2b LOC573376 Dr.116704 573376 0.689 -1.451 1.10E-01 1.127 1.127 4.88E-01 1.288 1.288 2.31E-01 1.660 1.660 1.69E-02 3.421 3.421 7.65E-20 2.448 2.448 1.12E-10 protein 8 1068 2b fkrp Fukutin related protein Dr.11951 571426 0.693 -1.443 1.06E-01 1.200 1.200 4.20E-01 1.306 1.306 1.20E-01 1.703 1.703 1.00E-04 2.360 2.360 1.38E-19 2.363 2.363 1.50E-12
Transcribed locus, weakly similar to XP_001113053.1 1069 2b Dr.121349 A kinase (PRKA) anchor Dr.121349 0.739 -1.354 5.30E-02 1.288 1.288 1.04E-01 1.340 1.340 1.10E-01 1.689 1.689 7.00E-05 2.335 2.335 8.04E-23 2.540 2.540 5.79E-21 protein 8-like [Macaca mulatta]
1070 2b matn4 Matrilin 4 Dr.78017 497348 0.823 -1.216 1.57E-01 1.151 1.151 2.73E-01 1.157 1.157 1.23E-02 1.340 1.340 7.20E-03 1.546 1.546 5.15E-03 1.612 1.612 3.00E-05 Hypothetical protein 1071 2b LOC793872 Dr.78023 793872 0.758 -1.320 1.30E-01 1.286 1.286 4.12E-02 1.286 1.286 1.27E-01 1.561 1.561 4.70E-04 2.445 2.445 4.20E-08 2.459 2.459 2.43E-09 LOC793872 Calcium channel, voltage- 1072 2b cacng1 dependent, gamma Dr.132288 322013 0.867 -1.153 2.06E-02 1.181 1.181 6.45E-06 1.096 1.096 1.17E-01 1.333 1.333 6.31E-07 1.489 1.489 3.97E-14 1.536 1.536 3.82E-18 subunit 1 Translocase of outer 1073 2b tomm40l mitochondrial membrane Dr.84273 405895 0.857 -1.167 1.82E-01 1.280 1.280 9.13E-03 1.131 1.131 3.74E-01 1.382 1.382 2.43E-03 1.769 1.769 1.14E-18 1.783 1.783 2.92E-21 40 homolog, like 1074 2b Dr.132748 Transcribed locus Dr.132748 0.749 -1.336 9.15E-02 1.244 1.244 7.01E-02 1.091 1.091 4.93E-01 1.416 1.416 1.60E-02 1.793 1.793 2.36E-09 1.726 1.726 3.00E-05 Regulator of G-protein 1075 2b rgs12 Dr.84135 378970 0.739 -1.353 1.29E-01 1.295 1.295 9.78E-02 1.190 1.190 4.07E-02 1.391 1.391 3.73E-03 1.624 1.624 1.32E-08 1.582 1.582 1.30E-04 signalling 12 Hypothetical protein 1076 2b LOC796878 Dr.113515 796878 0.743 -1.347 3.11E-01 1.338 1.338 1.30E-01 1.662 1.662 9.49E-03 1.331 1.331 1.38E-01 2.312 2.312 2.00E-05 2.550 2.550 8.05E-14 LOC796878 1077 2b wu:fa91f10 Wu:fa91f10 Dr.76195 336665 0.759 -1.317 2.71E-01 1.242 1.242 2.35E-01 1.585 1.585 1.60E-04 1.329 1.329 4.67E-02 2.026 2.026 5.21E-19 2.227 2.227 1.43E-25 Hypothetical protein 1078 2b LOC798960 Dr.114401 798960 0.798 -1.254 3.96E-01 1.335 1.335 1.06E-01 1.593 1.593 1.66E-02 1.417 1.417 6.64E-02 2.339 2.339 1.00E-05 2.886 2.886 4.07E-20 LOC798960 1079 2b LOC557160 Hypothetical LOC557160 Dr.81603 767707 0.801 -1.249 6.84E-02 1.227 1.227 4.90E-01 1.663 1.663 6.64E-10 1.440 1.440 1.03E-03 2.021 2.021 4.40E-04 2.147 2.147 1.68E-06 1080 2b wu:fb57b08 Wu:fb57b08 Dr.23720 322301 0.847 -1.181 3.37E-01 1.042 1.042 8.12E-01 1.266 1.266 2.64E-01 1.198 1.198 3.42E-01 1.418 1.418 2.49E-02 1.695 1.695 4.73E-07 1081 2b Dr.77607 Transcribed locus Dr.77607 0.805 -1.242 1.78E-01 1.090 1.090 5.88E-01 1.335 1.335 1.12E-01 1.219 1.219 2.14E-01 1.570 1.570 6.33E-03 1.728 1.728 5.93E-08 Novel protein similar to vertebrate ras homolog 1082 2b DKEYP-97G3.6 Dr.115457 561933 0.823 -1.215 3.17E-01 1.196 1.196 2.17E-01 1.512 1.512 1.90E-03 1.514 1.514 7.80E-04 2.405 2.405 5.58E-07 2.295 2.295 2.48E-06 gene family, member T1 (RHOT1) 1083 2b plrg1 Pleiotropic regulator 1 Dr.79159 406749 0.772 -1.295 9.82E-02 1.154 1.154 2.75E-01 1.486 1.486 6.60E-04 1.458 1.458 1.39E-03 2.358 2.358 1.82E-28 2.146 2.146 6.33E-15 1084 2b Dr.126564 Transcribed locus Dr.126564 0.470 -2.129 1.85E-01 1.177 1.177 5.32E-01 3.552 3.552 6.95E-07 3.002 3.002 2.45E-06 11.315 11.315 2.11E-19 9.914 9.914 2.19E-16 Secretory carrier 1085 2b scamp2 Dr.121550 406687 0.773 -1.294 8.63E-02 1.154 1.154 2.08E-01 1.371 1.371 1.26E-02 1.390 1.390 9.83E-03 2.036 2.036 2.44E-19 2.039 2.039 1.42E-26 membrane protein 2 Chromosome 6 open 1086 2b c6orf83 reading frame 83 (H. Dr.134087 393343 0.769 -1.300 2.58E-02 1.163 1.163 1.75E-02 1.283 1.283 7.10E-04 1.322 1.322 3.18E-03 1.931 1.931 9.75E-08 1.955 1.955 8.59E-16 sapiens) 1087 2b zgc:113102 Zgc:113102 Dr.134817 503754 0.653 -1.531 1.43E-01 1.290 1.290 1.59E-01 1.646 1.646 3.38E-03 1.429 1.429 3.41E-02 2.907 2.907 1.18E-10 2.773 2.773 8.21E-10 1088 2b Dr.15519 Transcribed locus Dr.15519 0.524 -1.908 3.16E-01 1.281 1.281 3.73E-01 2.514 2.514 1.03E-09 2.498 2.498 1.27E-15 4.647 4.647 1.20E-14 5.134 5.134 2.02E-16 1089 2b Dr.51495 Transcribed locus Dr.51495 0.826 -1.211 1.67E-01 1.108 1.108 3.93E-01 1.341 1.341 3.10E-02 1.383 1.383 1.09E-02 1.593 1.593 1.99E-06 1.760 1.760 5.34E-12 1090 2b c6 Complement component 6 Dr.16392 393611 0.761 -1.314 1.16E-01 1.125 1.125 2.59E-03 1.495 1.495 3.00E-04 1.598 1.598 4.33E-08 2.330 2.330 1.00E-11 2.469 2.469 1.24E-08
Serine protease inhibitor, 1091 2b spint1l Dr.75391 406426 0.712 -1.405 1.85E-01 1.210 1.210 3.21E-01 1.597 1.597 1.54E-06 1.732 1.732 2.44E-08 2.834 2.834 1.53E-03 2.920 2.920 7.32E-08 Kunitz type 1-like
1092 2b si:ch211-272f3.3 Si:ch211-272f3.3 Dr.76284 336776 0.783 -1.277 1.44E-01 1.083 1.083 6.28E-01 1.459 1.459 2.12E-02 1.706 1.706 2.16E-08 2.289 2.289 4.93E-15 2.426 2.426 5.70E-15 1093 2b prss35 Protease, serine, 35 Dr.118662 431759 0.780 -1.282 2.22E-01 1.212 1.212 2.70E-01 1.442 1.442 2.16E-03 1.369 1.369 4.34E-03 2.053 2.053 5.03E-32 1.785 1.785 2.96E-16 1094 2b zgc:86926 Zgc:86926 Dr.69080 415179 0.717 -1.394 1.81E-01 1.303 1.303 2.39E-02 1.456 1.456 8.52E-03 1.598 1.598 1.19E-03 2.609 2.609 4.88E-08 2.333 2.333 9.11E-07 1095 2b Dr.84756 Transcribed locus Dr.84756 0.773 -1.293 2.75E-01 1.249 1.249 6.45E-02 1.269 1.269 5.82E-02 1.375 1.375 1.33E-03 1.870 1.870 2.00E-05 1.701 1.701 2.74E-03
Transcribed locus, strongly similar to XP_708887.2 1096 2b Dr.122280 Dr.122280 0.836 -1.196 2.39E-01 1.309 1.309 3.60E-04 1.421 1.421 9.90E-04 1.583 1.583 2.55E-09 1.918 1.918 5.09E-33 1.966 1.966 5.17E-11 hypothetical protein isoform 5 [Danio rerio]
1097 2b wu:fb72c11 Wu:fb72c11 Dr.129593 322739 0.712 -1.404 1.60E-01 1.404 1.404 4.04E-02 1.636 1.636 1.33E-03 1.664 1.664 1.10E-03 2.526 2.526 1.33E-11 2.584 2.584 3.82E-12 1098 2b wu:fb17f01 Wu:fb17f01 Dr.76619 321500 0.716 -1.396 1.79E-01 1.322 1.322 2.79E-01 1.574 1.574 6.04E-03 1.695 1.695 1.42E-03 2.572 2.572 4.96E-19 2.641 2.641 1.49E-15 1099 2b Dr.79468 Transcribed locus Dr.79468 0.742 -1.349 4.22E-01 1.312 1.312 2.78E-01 1.736 1.736 9.00E-05 1.791 1.791 1.80E-04 2.644 2.644 5.00E-05 2.389 2.389 8.40E-04 Hypothetical protein 1100 2b LOC553231 Dr.11563 553231 0.699 -1.430 1.11E-01 1.262 1.262 1.70E-01 1.436 1.436 2.93E-03 1.294 1.294 1.10E-01 1.711 1.711 2.23E-03 1.946 1.946 4.92E-21 LOC553231 Zinc finger and BTB 1101 2b zbtb48 Dr.72135 325725 0.738 -1.355 7.39E-02 1.241 1.241 1.57E-01 1.353 1.353 4.61E-02 1.344 1.344 4.57E-02 1.740 1.740 1.00E-05 1.824 1.824 1.86E-06 domain containing 48 Solute carrier family 25, 1102 2b slc25a16 Dr.78884 324578 0.724 -1.382 8.60E-04 1.286 1.286 1.15E-02 1.487 1.487 2.12E-07 1.419 1.419 4.42E-09 1.887 1.887 1.74E-11 2.184 2.184 2.88E-15 member 16 1103 2b Dr.125670 Transcribed locus Dr.125670 0.654 -1.530 5.19E-02 1.240 1.240 1.52E-01 1.470 1.470 2.65E-02 1.454 1.454 3.24E-02 2.010 2.010 3.00E-05 2.003 2.003 5.54E-06 1104 2b zgc:77906 Zgc:77906 Dr.134550 402945 0.733 -1.365 2.67E-01 1.145 1.145 3.96E-01 1.346 1.346 4.47E-02 1.416 1.416 6.79E-03 1.756 1.756 2.09E-06 1.825 1.825 6.77E-03 1105 2b wu:fb08g12 Wu:fb08g12 Dr.51536 336378 0.637 -1.570 2.70E-04 1.334 1.334 4.00E-05 1.596 1.596 5.98E-10 1.722 1.722 9.56E-12 2.504 2.504 5.25E-23 2.571 2.571 7.56E-25 1106 2b wu:fc23f06 Wu:fc23f06 Dr.15418 324283 0.768 -1.303 1.12E-03 1.172 1.172 7.28E-03 1.249 1.249 6.70E-04 1.416 1.416 2.69E-06 1.576 1.576 3.19E-08 1.772 1.772 7.51E-13 1107 2b Dr.83356 Transcribed locus Dr.83356 0.318 -3.149 3.75E-03 1.792 1.792 3.17E-02 2.492 2.492 1.17E-02 3.010 3.010 7.00E-05 4.112 4.112 2.70E-04 5.953 5.953 8.01E-07 Fasciculation and 1108 2b fez1 elongation protein zeta 1 Dr.116746 406705 0.721 -1.387 1.99E-01 1.131 1.131 5.36E-01 1.459 1.459 3.90E-04 1.437 1.437 2.36E-03 1.813 1.813 4.64E-09 1.649 1.649 8.62E-06 (zygin I) 1109 2b wu:fc09e12 Wu:fc09e12 Dr.51867 323770 0.750 -1.333 2.56E-01 1.158 1.158 3.83E-01 1.408 1.408 2.14E-03 1.314 1.314 1.34E-02 1.713 1.713 4.00E-05 1.575 1.575 5.98E-03 1110 2b Dr.132831 Transcribed locus Dr.132831 0.683 -1.464 3.76E-02 1.120 1.120 4.60E-01 1.323 1.323 1.18E-01 1.374 1.374 5.66E-02 1.649 1.649 2.00E-05 1.664 1.664 7.05E-06 1111 2b im:7150721 Im:7150721 Dr.78394 550189 0.684 -1.463 1.00E-01 1.073 1.073 3.64E-01 1.425 1.425 3.40E-02 1.376 1.376 5.68E-02 1.711 1.711 1.21E-19 1.784 1.784 2.97E-23 Coatomer protein complex, 1112 2b copb2 Dr.14625 114454 0.685 -1.461 8.21E-02 1.138 1.138 4.12E-01 1.545 1.545 1.60E-03 1.537 1.537 1.57E-03 2.364 2.364 7.06E-28 2.020 2.020 7.14E-19 subunit beta 2 1113 2b si:dkey-222b8.2 Si:dkey-222b8.2 Dr.41221 567959 0.692 -1.446 1.13E-02 1.040 1.040 7.84E-01 1.446 1.446 4.00E-04 1.642 1.642 2.00E-05 2.311 2.311 1.29E-22 2.024 2.024 2.68E-15 Transmembrane protein 1114 2b tmem177 Dr.3515 322274 0.743 -1.346 1.22E-02 1.091 1.091 3.78E-01 1.309 1.309 2.95E-02 1.505 1.505 3.30E-09 1.973 1.973 6.78E-10 1.993 1.993 0.00E+00 177 1115 2b wu:fc46a02 Wu:fc46a02 Dr.79391 324870 0.639 -1.565 9.87E-02 1.149 1.149 6.28E-01 1.549 1.549 1.02E-01 1.964 1.964 1.15E-03 2.611 2.611 8.23E-19 2.827 2.827 4.83E-18 1116 2b Dr.78997 Transcribed locus Dr.78997 0.482 -2.073 4.36E-02 1.192 1.192 1.25E-01 1.951 1.951 3.70E-04 2.285 2.285 1.00E-05 4.027 4.027 1.06E-23 3.868 3.868 7.37E-22 1117 2b zgc:109969 Zgc:109969 Dr.78796 553560 0.589 -1.697 1.31E-02 1.162 1.162 4.79E-01 1.376 1.376 1.03E-01 1.790 1.790 4.40E-04 2.456 2.456 7.22E-25 2.365 2.365 7.12E-27 1118 2b zgc:55863 Zgc:55863 Dr.82569 393937 0.602 -1.662 8.20E-03 1.136 1.136 3.93E-01 1.429 1.429 1.59E-02 1.614 1.614 7.55E-11 2.246 2.246 3.00E-05 2.195 2.195 1.05E-22 Hypothetical protein 1119 2b LOC791919 Dr.81849 791919 0.679 -1.472 1.04E-01 1.178 1.178 2.34E-01 1.386 1.386 8.80E-04 1.553 1.553 9.53E-06 2.038 2.038 1.20E-02 1.821 1.821 1.18E-02 LOC791919 1120 2b Dr.118227 Transcribed locus Dr.118227 0.594 -1.684 1.07E-01 1.293 1.293 4.23E-01 1.764 1.764 1.44E-01 2.851 2.851 1.00E-05 2.553 2.553 2.25E-03 2.363 2.363 5.86E-03 1121 2b wu:fc37g06 Wu:fc37g06 Dr.21483 324668 0.755 -1.324 1.51E-01 1.100 1.100 6.25E-01 1.262 1.262 1.79E-01 1.584 1.584 3.60E-04 1.671 1.671 2.00E-05 1.502 1.502 5.80E-04 1122 2b wu:fc54b08 Wu:fc54b08 Dr.79013 325063 0.715 -1.399 2.82E-01 1.094 1.094 7.83E-01 1.555 1.555 5.03E-02 2.084 2.084 1.98E-06 2.521 2.521 3.50E-16 1.959 1.959 4.63E-09 1123 2b Dr.122743 Transcribed locus Dr.122743 0.687 -1.456 4.17E-02 1.040 1.040 8.32E-01 1.233 1.233 2.57E-01 1.526 1.526 6.08E-03 1.706 1.706 3.44E-10 1.466 1.466 2.00E-05 Zinc finger, CCHC domain 1124 2b zcchc10 Dr.80591 334240 0.671 -1.490 1.37E-03 1.069 1.069 4.23E-01 1.212 1.212 1.93E-01 1.603 1.603 4.00E-05 2.036 2.036 4.56E-36 1.726 1.726 9.28E-15 containing 10 1125 2b wu:fb94e12 Wu:fb94e12 Dr.21224 323301 0.678 -1.474 9.40E-04 1.020 1.020 8.46E-01 1.213 1.213 1.89E-01 1.743 1.743 4.90E-13 1.784 1.784 2.25E-13 1.687 1.687 1.00E-18 Similar to protein tyrosine 1126 2b LOC569164 Dr.82846 569164 0.797 -1.254 8.44E-02 0.986 -1.015 9.12E-01 1.151 1.151 3.04E-01 1.353 1.353 1.04E-02 1.603 1.603 4.52E-06 1.238 1.238 1.60E-01 phosphatase e 1127 2b Dr.104912 Transcribed locus Dr.104912 0.247 -4.052 4.21E-03 1.022 1.022 8.66E-01 2.321 2.321 8.63E-03 2.449 2.449 5.01E-03 3.165 3.165 2.49E-03 4.508 4.508 8.26E-09 1128 2b wu:fe01a07 Wu:fe01a07 Dr.80626 326635 0.320 -3.125 1.34E-02 1.022 1.022 8.56E-01 2.128 2.128 1.85E-02 2.433 2.433 6.42E-03 2.930 2.930 1.21E-13 3.326 3.326 3.48E-13 1129 2b Dr.85911 Transcribed locus Dr.85911 0.469 -2.133 3.49E-03 1.012 1.012 9.11E-01 1.621 1.621 1.60E-02 1.679 1.679 4.00E-05 1.972 1.972 1.60E-02 2.067 2.067 1.40E-03 Potassium voltage-gated 1130 2b kcnh2 channel, subfamily H (eag- Dr.93298 405763 0.510 -1.962 1.29E-02 1.133 1.133 6.21E-01 1.541 1.541 6.74E-02 1.511 1.511 9.11E-02 1.906 1.906 2.62E-03 1.925 1.925 7.00E-05 related), member 2 1131 2b Dr.133874 Transcribed locus Dr.133874 0.473 -2.112 6.30E-02 0.919 -1.088 5.58E-01 1.785 1.785 3.10E-04 1.803 1.803 2.20E-04 2.406 2.406 1.90E-04 2.604 2.604 8.00E-05 1132 2b Dr.133882 Transcribed locus Dr.133882 0.308 -3.245 3.00E-04 0.906 -1.103 7.03E-01 2.545 2.545 1.76E-03 2.390 2.390 3.16E-03 3.603 3.603 3.00E-05 3.613 3.613 2.00E-05 1133 2b zgc:85838 Zgc:85838 Dr.30318 405870 0.357 -2.803 1.71E-03 0.866 -1.155 3.20E-01 2.095 2.095 5.99E-03 1.809 1.809 1.59E-02 2.628 2.628 6.70E-04 2.934 2.934 2.00E-05 1134 2b wu:fd11d10 Wu:fd11d10 Dr.79713 325782 0.346 -2.893 1.35E-02 0.972 -1.029 9.46E-01 2.235 2.235 8.02E-03 1.916 1.916 1.69E-02 3.391 3.391 1.57E-11 2.733 2.733 1.50E-18 1135 2b zgc:112361 Zgc:112361 Dr.134432 554112 0.370 -2.701 6.78E-03 0.891 -1.123 7.50E-01 1.356 1.356 4.13E-01 1.584 1.584 1.07E-01 2.415 2.415 5.10E-04 2.211 2.211 3.32E-06 1136 2b Dr.90455 Transcribed locus Dr.90455 0.412 -2.430 1.78E-03 0.871 -1.148 2.39E-01 1.354 1.354 1.41E-01 1.538 1.538 1.78E-02 2.287 2.287 2.18E-09 2.051 2.051 1.26E-06 1137 2b wu:fc14a04 Wu:fc14a04 Dr.22881 323913 0.594 -1.684 1.60E-04 0.971 -1.030 7.37E-01 1.138 1.138 3.51E-01 1.311 1.311 2.32E-02 1.691 1.691 8.25E-12 1.626 1.626 2.36E-09 PDZK1 interacting protein 1138 2b pdzk1ip1l Dr.41116 368722 0.384 -2.603 1.49E-06 0.993 -1.007 9.76E-01 1.483 1.483 3.30E-04 1.637 1.637 9.00E-05 2.211 2.211 1.36E-02 2.445 2.445 3.00E-05 1, like 1139 2b wu:fb11h05 Wu:fb11h05 Dr.76693 336493 0.299 -3.343 2.00E-05 0.897 -1.115 4.54E-01 1.819 1.819 2.23E-03 1.786 1.786 2.69E-03 2.807 2.807 5.00E-05 3.218 3.218 4.83E-06 1140 2b Dr.84788 Transcribed locus Dr.84788 0.330 -3.031 2.16E-03 0.972 -1.029 9.39E-01 1.536 1.536 2.63E-01 2.095 2.095 5.60E-03 2.722 2.722 6.50E-04 3.054 3.054 1.09E-10 1141 2b Dr.17 Transcribed locus Dr.17 0.624 -1.603 5.62E-06 0.934 -1.070 6.13E-01 1.193 1.193 2.94E-01 1.515 1.515 1.12E-03 1.551 1.551 1.60E-04 1.547 1.547 5.37E-02 1142 2b zgc:63863 Zgc:63863 Dr.82376 393372 0.351 -2.849 1.03E-03 0.891 -1.123 3.63E-01 1.722 1.722 4.80E-02 2.181 2.181 8.36E-16 2.585 2.585 2.09E-02 2.483 2.483 2.50E-02 Similar to Mesoderm 1143 2b LOC566167 Dr.108270 566167 0.437 -2.288 4.42E-03 1.042 1.042 8.54E-01 1.451 1.451 1.29E-01 1.691 1.691 7.31E-03 1.528 1.528 1.26E-02 2.006 2.006 3.38E-06 induction early response 1
Hypothetical protein 1144 2b LOC100008328 Dr.121267 100008328 0.502 -1.991 2.22E-06 0.916 -1.092 5.61E-01 1.325 1.325 2.49E-01 1.584 1.584 4.55E-02 1.476 1.476 2.48E-02 1.674 1.674 8.08E-03 LOC100008328 1145 2b oprl Opiate receptor-like Dr.121451 402851 0.538 -1.860 3.00E-05 0.905 -1.105 4.18E-01 1.559 1.559 4.41E-02 1.410 1.410 9.87E-02 1.577 1.577 6.31E-02 1.553 1.553 6.44E-02 1146 2b wu:fc55a06 Wu:fc55a06 Dr.3915 325091 0.266 -3.766 3.00E-05 0.692 -1.444 2.66E-01 2.402 2.402 6.14E-02 2.251 2.251 7.62E-02 2.486 2.486 4.95E-06 2.498 2.498 2.00E-05 1147 2b wu:fc02d02 Wu:fc02d02 Dr.122760 323547 0.424 -2.357 1.19E-03 0.889 -1.125 2.38E-01 1.605 1.605 1.53E-02 1.613 1.613 1.37E-02 1.728 1.728 6.90E-04 2.061 2.061 1.57E-12 1148 2b Dr.123516 Transcribed locus Dr.123516 0.631 -1.584 9.00E-05 0.907 -1.102 3.14E-01 1.318 1.318 1.11E-01 1.322 1.322 6.96E-02 1.400 1.400 5.26E-03 1.537 1.537 5.45E-08 1149 2b Dr.123651 Transcribed locus Dr.123651 0.344 -2.910 3.00E-05 0.770 -1.298 1.97E-01 1.745 1.745 1.73E-03 1.848 1.848 5.30E-04 1.936 1.936 1.00E-02 2.559 2.559 4.34E-11 1150 2b Dr.18641 Transcribed locus Dr.18641 0.222 -4.512 3.70E-04 0.715 -1.399 7.75E-02 2.303 2.303 8.65E-02 2.629 2.629 1.73E-02 2.407 2.407 1.85E-02 3.945 3.945 1.03E-07 1151 2b zgc:92791 Zgc:92791 Dr.85452 436816 0.603 -1.658 1.45E-02 0.808 -1.238 3.03E-01 1.499 1.499 1.90E-02 1.425 1.425 5.11E-03 1.643 1.643 1.10E-04 1.679 1.679 1.00E-05 1152 2b zgc:63667 Zgc:63667 Dr.17457 393451 0.381 -2.623 2.55E-02 0.731 -1.368 7.46E-02 1.519 1.519 9.76E-02 1.706 1.706 1.45E-02 1.674 1.674 8.07E-02 2.287 2.287 8.95E-10 1153 2b Dr.80902 Transcribed locus Dr.80902 0.466 -2.147 3.06E-09 0.789 -1.267 2.87E-02 1.245 1.245 2.22E-01 1.353 1.353 4.09E-02 1.483 1.483 1.11E-03 1.824 1.824 8.98E-11 1154 2b Dr.86460 Transcribed locus Dr.86460 0.324 -3.086 3.07E-02 0.559 -1.789 2.46E-01 2.038 2.038 1.15E-01 2.046 2.046 5.53E-02 2.179 2.179 3.44E-02 2.623 2.623 9.25E-09 1155 2b Dr.92037 Transcribed locus Dr.92037 0.330 -3.035 5.10E-04 0.647 -1.546 8.11E-02 1.615 1.615 5.11E-02 2.011 2.011 3.00E-05 2.020 2.020 3.69E-06 2.114 2.114 5.01E-07 Pyruvate dehydrogenase 1156 2b pdk2 Dr.9528 393971 0.419 -2.385 3.00E-05 0.623 -1.605 9.99E-02 1.400 1.400 8.54E-02 1.580 1.580 1.28E-02 1.643 1.643 1.50E-04 2.038 2.038 3.65E-03 kinase, isoenzyme 2
1157 2b Dr.132954 Transcribed locus Dr.132954 0.438 -2.282 1.01E-01 0.699 -1.430 4.73E-01 1.948 1.948 1.50E-01 2.041 2.041 5.61E-02 1.591 1.591 1.97E-01 3.120 3.120 1.59E-06 1158 2b Dr.90564 Transcribed locus Dr.90564 0.482 -2.073 1.32E-03 0.813 -1.230 3.68E-01 2.003 2.003 5.77E-03 2.080 2.080 2.70E-04 1.922 1.922 9.00E-05 2.771 2.771 3.88E-06 1159 2b tp73 Tumor protein p73 Dr.24319 368221 0.406 -2.465 9.40E-07 0.824 -1.213 5.02E-01 1.736 1.736 2.33E-02 2.240 2.240 1.18E-03 1.459 1.459 7.14E-02 2.248 2.248 2.10E-04 1160 2b si:dkeyp-90a8.2 Si:dkeyp-90a8.2 Dr.77261 562273 0.337 -2.966 9.35E-03 0.777 -1.287 4.48E-02 2.201 2.201 7.66E-06 2.419 2.419 2.76E-07 1.802 1.802 5.15E-02 2.922 2.922 2.00E-05 1161 2b si:dkey-37m8.10 Si:dkey-37m8.10 Dr.106102 325257 0.474 -2.110 7.70E-04 1.050 1.050 8.29E-01 1.461 1.461 1.87E-02 1.212 1.212 2.03E-01 1.602 1.602 4.41E-02 2.074 2.074 4.00E-05 1162 2b Dr.132810 Transcribed locus Dr.132810 0.448 -2.231 2.23E-03 1.106 1.106 7.04E-01 1.563 1.563 9.98E-03 1.318 1.318 1.14E-01 1.523 1.523 8.00E-04 1.990 1.990 6.69E-06 1163 2b Dr.40661 Transcribed locus Dr.40661 0.585 -1.711 2.66E-03 0.989 -1.011 8.85E-01 1.291 1.291 8.70E-02 1.262 1.262 1.19E-01 1.359 1.359 2.97E-02 1.791 1.791 2.00E-05 Transcribed locus, moderately similar to 1164 2b Dr.82697 XP_001345745.1 Dr.82697 0.643 -1.555 1.27E-03 1.020 1.020 7.90E-01 1.200 1.200 1.68E-02 1.205 1.205 1.75E-02 1.365 1.365 1.88E-03 1.539 1.539 6.96E-12 hypothetical protein [Danio rerio] 1165 2b Dr.111687 Transcribed locus Dr.111687 0.362 -2.763 9.56E-03 1.080 1.080 8.53E-01 1.457 1.457 3.30E-01 1.201 1.201 6.00E-01 2.336 2.336 4.10E-03 2.277 2.277 6.00E-05 1166 2b zgc:92446 Zgc:92446 Dr.115939 445112 0.578 -1.732 3.00E-05 1.023 1.023 8.24E-01 1.188 1.188 3.80E-01 1.109 1.109 2.35E-01 1.485 1.485 2.61E-02 1.498 1.498 1.74E-02 1167 2b Dr.83855 Transcribed locus Dr.83855 0.348 -2.878 1.66E-02 1.145 1.145 7.67E-01 1.468 1.468 3.62E-01 1.217 1.217 5.74E-01 2.208 2.208 7.78E-03 2.761 2.761 8.25E-10 1168 2b Dr.128077 Transcribed locus Dr.128077 0.477 -2.097 2.31E-02 0.927 -1.079 8.28E-01 1.283 1.283 4.36E-01 1.113 1.113 6.85E-01 1.655 1.655 4.27E-02 1.899 1.899 1.64E-08 1169 2b Dr.84370 Transcribed locus Dr.84370 0.449 -2.228 1.18E-03 0.996 -1.004 9.86E-01 1.243 1.243 3.12E-01 1.081 1.081 7.34E-01 1.530 1.530 1.49E-02 1.845 1.845 1.02E-08 1170 2b nrp1a Neuropilin 1a Dr.133652 353246 0.450 -2.222 1.74E-08 0.894 -1.119 3.21E-01 1.360 1.360 5.91E-06 1.228 1.228 6.46E-03 1.895 1.895 4.75E-31 2.562 2.562 0.00E+00 1171 2b Dr.133861 Transcribed locus Dr.133861 0.485 -2.060 2.46E-02 0.922 -1.085 8.04E-01 1.321 1.321 2.55E-01 1.229 1.229 4.21E-01 1.726 1.726 9.86E-03 2.234 2.234 1.44E-10 1172 2b zgc:63972 Zgc:63972 Dr.82419 393325 0.332 -3.013 5.60E-04 0.915 -1.093 7.75E-01 1.463 1.463 3.20E-01 1.380 1.380 4.06E-01 2.414 2.414 4.10E-04 2.965 2.965 2.07E-10 Zinc finger, DHHC domain 1173 2b zdhhc16 Dr.26719 394017 0.572 -1.748 1.04E-03 0.901 -1.110 2.80E-01 1.325 1.325 1.56E-01 1.141 1.141 4.25E-01 1.463 1.463 1.94E-02 1.741 1.741 2.39E-18 containing 16 Hypothetical protein 1174 2b LOC100005753 Dr.79723 100005753 0.565 -1.769 2.78E-09 0.902 -1.108 5.06E-01 1.289 1.289 1.74E-01 1.130 1.130 5.56E-01 1.403 1.403 1.51E-02 1.611 1.611 8.33E-07 LOC100005753 1175 2b pth1 Parathyroid hormone 1 Dr.86325 405886 0.426 -2.348 2.49E-16 0.812 -1.231 1.08E-01 1.469 1.469 2.85E-02 1.148 1.148 5.40E-01 1.493 1.493 4.60E-02 3.223 3.223 1.40E-03 Hypothetical protein 1176 2b LOC797946 Dr.107953 797946 0.280 -3.565 4.80E-04 0.639 -1.565 1.90E-03 1.490 1.490 2.27E-01 1.660 1.660 7.40E-02 4.078 4.078 1.32E-08 2.913 2.913 1.00E-05 LOC797946 1177 2b zgc:85944 Zgc:85944 Dr.84638 571696 0.440 -2.272 1.83E-02 0.725 -1.379 3.03E-02 1.291 1.291 2.88E-01 1.481 1.481 1.86E-02 2.701 2.701 3.08E-06 2.149 2.149 3.50E-04 1178 2b wu:fj62g02 Wu:fj62g02 Dr.81251 336305 0.406 -2.460 1.24E-03 0.735 -1.361 4.29E-02 1.347 1.347 2.76E-01 1.380 1.380 1.31E-01 2.668 2.668 1.37E-09 2.350 2.350 1.16E-07 1179 2b zgc:77424 Zgc:77424 Dr.88467 404622 0.238 -4.203 2.20E-04 0.587 -1.705 3.28E-03 1.519 1.519 3.27E-01 1.740 1.740 1.41E-01 5.072 5.072 9.44E-09 4.133 4.133 1.54E-07 1180 2b zgc:162651 Zgc:162651 Dr.115655 323364 0.444 -2.254 1.54E-02 0.824 -1.213 2.45E-02 1.297 1.297 2.24E-01 1.421 1.421 6.05E-02 2.479 2.479 9.40E-11 2.140 2.140 1.72E-07 1181 2b Dr.123681 Transcribed locus Dr.123681 0.381 -2.625 1.62E-02 0.766 -1.305 5.46E-02 1.829 1.829 1.76E-02 1.558 1.558 8.09E-02 3.374 3.374 4.00E-05 2.742 2.742 3.60E-04 1182 2b zgc:92890 Zgc:92890 Dr.88790 436742 0.389 -2.568 2.57E-02 0.704 -1.420 8.26E-03 1.784 1.784 2.17E-02 1.520 1.520 1.11E-01 3.716 3.716 1.55E-06 2.801 2.801 8.00E-05 1183 2b Dr.124535 Transcribed locus Dr.124535 0.369 -2.707 3.27E-03 0.731 -1.368 3.86E-03 1.699 1.699 5.08E-02 1.406 1.406 2.04E-01 3.456 3.456 4.68E-08 2.964 2.964 1.52E-06 1184 2b wu:fb76g02 Transcribed locus Dr.77277 322911 0.435 -2.298 1.08E-03 0.735 -1.360 8.06E-03 1.680 1.680 2.24E-02 1.394 1.394 1.31E-01 2.942 2.942 3.38E-08 2.600 2.600 4.94E-07 1185 2b Dr.88798 Transcribed locus Dr.88798 0.194 -5.158 1.93E-03 0.624 -1.603 3.19E-03 2.117 2.117 1.45E-01 1.634 1.634 3.23E-01 6.438 6.438 7.87E-06 6.004 6.004 1.00E-05 1186 2b lypla3 Lysophospholipase 3 Dr.360 335008 0.702 -1.424 8.96E-02 0.865 -1.156 4.38E-01 1.231 1.231 1.65E-01 1.175 1.175 2.19E-01 1.563 1.563 3.00E-05 1.363 1.363 1.48E-02 1187 2b Dr.29633 Transcribed locus Dr.29633 0.449 -2.227 3.02E-02 0.830 -1.205 5.24E-02 1.485 1.485 1.80E-01 1.330 1.330 2.79E-01 2.218 2.218 4.20E-10 2.043 2.043 2.00E-05 1188 2b LOC561361 Hypothetical LOC561361 Dr.80493 561361 0.376 -2.657 3.64E-02 0.730 -1.370 5.13E-01 1.558 1.558 2.93E-01 1.341 1.341 4.19E-01 2.598 2.598 2.33E-03 2.357 2.357 2.39E-08 Transcribed locus, moderately similar to 1189 2b Dr.78238 XP_001062593.1 Dr.78238 0.370 -2.700 5.98E-03 0.858 -1.166 6.32E-01 1.518 1.518 2.99E-01 1.287 1.287 4.76E-01 2.490 2.490 1.32E-03 2.517 2.517 2.53E-06 hypothetical protein [Rattus norvegicus] Electron-transfer- 1190 2b etfa flavoprotein, alpha Dr.86220 325724 0.410 -2.441 5.06E-03 0.776 -1.289 2.99E-03 1.363 1.363 2.86E-01 1.222 1.222 4.41E-01 2.181 2.181 3.50E-04 2.338 2.338 1.16E-10 polypeptide Hypothetical protein 1191 2b LOC798122 Dr.114702 798122 0.419 -2.385 3.28E-06 0.737 -1.357 1.81E-02 1.428 1.428 1.05E-01 1.691 1.691 1.70E-04 2.587 2.587 7.49E-10 2.332 2.332 3.30E-08 LOC798122 1192 2b Dr.89651 Transcribed locus Dr.89651 0.477 -2.098 8.80E-04 0.815 -1.227 8.76E-02 1.408 1.408 1.48E-01 1.698 1.698 1.22E-02 2.583 2.583 1.31E-14 2.285 2.285 5.01E-11 ATPase, H+ transporting, 1193 2b atp6v1b2 lysosomal 56/58kDa, V1 Dr.132618 359840 0.470 -2.125 4.00E-05 0.875 -1.143 2.34E-02 1.604 1.604 2.00E-05 1.597 1.597 2.29E-06 2.359 2.359 3.16E-10 2.432 2.432 3.25E-11 subunit B2 1194 2b Dr.90629 Transcribed locus Dr.90629 0.543 -1.841 6.71E-03 0.843 -1.187 2.93E-02 1.450 1.450 8.40E-03 1.438 1.438 1.13E-02 1.995 1.995 9.00E-05 2.048 2.048 4.00E-05 1195 2b wu:fb19b08 Wu:fb19b08 Dr.24364 321557 0.316 -3.163 3.81E-03 0.665 -1.504 2.10E-03 1.846 1.846 6.82E-03 1.805 1.805 9.38E-03 3.668 3.668 1.48E-07 3.819 3.819 4.48E-08 1196 2b Dr.27927 Transcribed locus Dr.27927 0.229 -4.359 6.30E-04 0.678 -1.475 4.71E-03 2.125 2.125 4.62E-02 1.872 1.872 9.44E-02 5.075 5.075 3.30E-12 5.163 5.163 1.06E-12 Novel protein similar to vertebrate mitochondrial 1197 2b LOC565937 Dr.85590 565937 0.592 -1.689 8.45E-13 0.900 -1.111 2.88E-01 1.332 1.332 2.10E-04 1.269 1.269 4.90E-04 1.621 1.621 2.29E-17 1.519 1.519 8.90E-30 ribosomal protein S10 (MRSP10) 1198 2b zgc:158861 Zgc:158861 Dr.120725 100005434 0.340 -2.939 2.40E-04 0.775 -1.291 6.80E-02 1.236 1.236 5.14E-01 1.278 1.278 4.31E-01 3.323 3.323 7.69E-13 3.443 3.443 8.25E-14 1199 2b foxc1b Forkhead box C1b Dr.83301 79375 0.441 -2.266 2.89E-03 0.772 -1.295 8.90E-04 1.266 1.266 2.95E-01 1.190 1.190 4.25E-01 2.488 2.488 2.00E-05 2.606 2.606 2.78E-10 1200 2b zgc:91959 Zgc:91959 Dr.32109 436939 0.518 -1.932 1.81E-03 0.804 -1.244 1.48E-02 1.101 1.101 5.71E-01 1.209 1.209 5.30E-02 2.193 2.193 2.00E-05 2.082 2.082 3.00E-05 1201 2b wu:fb81e12 Wu:fb81e12 Dr.77408 323096 0.642 -1.557 2.42E-02 0.856 -1.168 4.48E-02 1.108 1.108 4.88E-01 1.135 1.135 3.53E-01 1.662 1.662 4.32E-02 1.625 1.625 8.59E-06
Transcribed locus, weakly similar to XP_527202.2 1202 2b Dr.132130 Dr.132130 0.534 -1.872 1.60E-04 0.797 -1.255 6.00E-05 1.153 1.153 3.15E-01 1.291 1.291 1.95E-02 1.902 1.902 1.09E-11 1.999 1.999 4.74E-09 CD180 antigen isoform 3 [Pan troglodytes]
1203 2b zgc:77517 Zgc:77517 Dr.76027 393540 0.509 -1.963 1.81E-06 0.827 -1.210 6.68E-06 1.378 1.378 8.20E-04 1.323 1.323 2.66E-02 2.754 2.754 2.39E-19 2.819 2.819 8.94E-20 1204 2b Dr.84839 Transcribed locus Dr.84839 0.466 -2.147 4.00E-03 0.821 -1.219 9.89E-02 1.346 1.346 1.28E-01 1.319 1.319 1.32E-01 2.497 2.497 2.99E-12 2.801 2.801 2.49E-15 1205 2b Dr.85965 Transcribed locus Dr.85965 0.414 -2.418 1.44E-02 0.784 -1.275 5.21E-02 1.367 1.367 1.21E-01 1.475 1.475 2.81E-02 2.894 2.894 3.98E-08 2.880 2.880 2.58E-08 1206 2b zgc:92239 Zgc:92239 Dr.120620 494036 0.608 -1.645 1.30E-02 0.781 -1.281 3.88E-01 1.072 1.072 6.65E-01 1.120 1.120 5.38E-01 1.827 1.827 7.20E-14 1.406 1.406 4.13E-06
Transcribed locus, weakly similar to XP_001081857.1 1207 2b Dr.80786 similar to tubulin-specific Dr.80786 0.412 -2.429 5.05E-07 0.753 -1.328 2.18E-02 1.145 1.145 6.27E-01 1.145 1.145 6.90E-01 3.049 3.049 1.84E-02 2.291 2.291 3.35E-02 chaperone d [Rattus norvegicus]
1208 2b zgc:77182 Zgc:77182 Dr.88453 402953 0.554 -1.804 2.02E-02 0.852 -1.173 5.08E-01 1.031 1.031 8.93E-01 1.133 1.133 3.50E-01 1.970 1.970 1.16E-07 1.605 1.605 4.20E-04 1209 2b Dr.121974 Transcribed locus Dr.121974 0.485 -2.061 6.07E-03 0.726 -1.377 1.80E-04 1.361 1.361 9.24E-02 1.106 1.106 5.17E-01 2.049 2.049 3.84E-08 1.754 1.754 3.36E-03 1210 2b Dr.123950 Transcribed locus Dr.123950 0.505 -1.979 8.00E-04 0.767 -1.303 1.07E-01 1.161 1.161 5.36E-01 1.023 1.023 9.04E-01 1.878 1.878 2.00E-05 1.851 1.851 1.48E-06 1211 2b zgc:86895 Zgc:86895 Dr.31063 415191 0.477 -2.097 2.12E-03 0.766 -1.306 3.26E-03 1.252 1.252 2.05E-01 1.069 1.069 6.89E-01 1.877 1.877 1.30E-04 1.856 1.856 3.00E-05 1212 2b zgc:77380 Zgc:77380 Dr.134001 406554 0.639 -1.565 6.67E-03 0.825 -1.211 2.44E-01 1.206 1.206 1.95E-01 1.071 1.071 6.14E-01 1.611 1.611 1.20E-04 1.598 1.598 1.62E-14 1213 2b dctd DCMP deaminase Dr.39980 550332 0.646 -1.547 1.42E-06 0.918 -1.090 4.01E-01 1.167 1.167 4.09E-01 1.020 1.020 9.10E-01 1.637 1.637 3.00E-04 1.442 1.442 3.59E-02 1214 2b amt Aminomethyltransferase Dr.121883 450000 0.467 -2.140 8.95E-03 0.972 -1.029 9.23E-01 1.294 1.294 3.16E-01 1.168 1.168 5.69E-01 1.854 1.854 2.75E-10 1.558 1.558 1.05E-03 1215 2b si:dkey-266j7.1 Si:dkey-266j7.1 Dr.22774 336156 0.556 -1.798 1.09E-02 1.005 1.005 9.84E-01 1.274 1.274 2.96E-01 1.109 1.109 5.00E-01 1.779 1.779 7.00E-05 1.411 1.411 9.59E-02 1216 2b Dr.123575 Transcribed locus Dr.123575 0.626 -1.598 8.70E-04 0.923 -1.083 2.61E-01 1.201 1.201 2.74E-01 1.144 1.144 3.89E-01 1.571 1.571 3.58E-06 1.429 1.429 4.83E-03 1217 2b Dr.133747 Transcribed locus Dr.133747 0.407 -2.458 6.03E-03 0.876 -1.142 6.84E-01 1.349 1.349 2.41E-01 1.248 1.248 3.07E-01 2.439 2.439 6.16E-08 1.950 1.950 1.20E-04 Histone 2A family member 1218 2b h2afza Dr.29040 403077 0.587 -1.704 4.23E-03 0.979 -1.022 9.06E-01 1.126 1.126 5.10E-01 1.190 1.190 3.03E-01 1.724 1.724 3.00E-05 1.476 1.476 9.82E-03 ZA 1219 2b crygn2 Crystallin, gamma N2 Dr.87252 445034 0.153 -6.554 1.13E-14 0.710 -1.409 6.95E-03 1.238 1.238 4.78E-01 1.228 1.228 3.33E-01 3.960 3.960 2.39E-07 2.791 2.791 1.90E-04 1220 2b wu:fq77h11 Wu:fq77h11 Dr.108155 503777 0.307 -3.259 4.00E-05 0.608 -1.646 1.80E-04 1.449 1.449 2.21E-01 1.286 1.286 3.73E-01 2.571 2.571 2.00E-05 2.398 2.398 2.00E-05 1221 2b Dr.123509 Transcribed locus Dr.123509 0.351 -2.852 7.40E-04 0.646 -1.547 1.43E-01 1.521 1.521 3.15E-01 1.384 1.384 3.74E-01 2.563 2.563 3.52E-06 2.266 2.266 1.12E-08 1222 2b zgc:63934 Zgc:63934 Dr.26462 393316 0.617 -1.620 8.00E-05 0.831 -1.203 1.32E-01 1.228 1.228 5.34E-02 1.138 1.138 1.93E-01 1.396 1.396 2.80E-04 1.403 1.403 1.12E-07 1223 2b wu:fj49c01 Wu:fj49c01 Dr.76105 336116 0.521 -1.920 1.49E-03 0.778 -1.285 1.40E-02 1.305 1.305 1.91E-01 1.284 1.284 1.71E-01 1.656 1.656 1.96E-06 1.667 1.667 3.08E-06 Dehydrogenase/reductase 1224 2b dhrs1 Dr.32174 368670 0.414 -2.418 2.90E-06 0.749 -1.336 1.35E-02 1.381 1.381 1.88E-01 1.198 1.198 3.85E-01 2.098 2.098 4.10E-04 1.690 1.690 1.01E-02 (SDR family) member 1
1225 2b Dr.92105 Transcribed locus Dr.92105 0.320 -3.124 6.13E-06 0.736 -1.358 7.26E-02 1.576 1.576 8.49E-02 1.335 1.335 2.10E-01 2.311 2.311 8.90E-06 1.956 1.956 1.01E-03 1226 2b Dr.92368 Transcribed locus Dr.92368 0.288 -3.476 2.00E-05 0.551 -1.814 1.63E-02 1.569 1.569 8.76E-02 1.226 1.226 3.96E-01 2.444 2.444 2.50E-04 2.060 2.060 3.67E-03 1227 2b Dr.129101 Transcribed locus Dr.129101 0.392 -2.553 1.91E-03 0.619 -1.615 9.60E-04 1.662 1.662 5.43E-03 1.474 1.474 3.47E-02 1.829 1.829 2.02E-03 1.761 1.761 5.00E-05 1228 2b Dr.133363 Transcribed locus Dr.133363 0.307 -3.255 7.04E-03 0.566 -1.766 2.04E-02 1.975 1.975 5.22E-02 1.793 1.793 9.32E-02 3.137 3.137 7.17E-07 2.424 2.424 1.10E-04 Transient receptor 1229 2b trpv6 potential cation channel, Dr.118447 415109 0.409 -2.444 1.78E-09 0.750 -1.334 2.31E-07 1.469 1.469 6.00E-05 1.064 1.064 7.80E-01 1.596 1.596 6.10E-04 1.804 1.804 2.13E-11 subfamily V, member 6 1230 2b Dr.124651 Transcribed locus Dr.124651 0.293 -3.419 4.29E-07 0.777 -1.288 5.38E-01 1.465 1.465 1.02E-01 1.048 1.048 9.03E-01 1.906 1.906 1.66E-21 2.237 2.237 3.03E-03 Similar to beta-1,4-N-acetyl- 1231 2b LOC561505 galactosaminyl transferase Dr.114703 561505 0.738 -1.356 6.23E-02 0.795 -1.257 1.25E-01 1.304 1.304 1.16E-02 1.311 1.311 5.95E-02 1.557 1.557 4.18E-02 1.846 1.846 7.00E-05 3 1232 2b Dr.125080 Transcribed locus Dr.125080 0.693 -1.443 9.43E-02 0.733 -1.364 1.95E-02 1.337 1.337 3.91E-02 1.597 1.597 1.47E-03 1.932 1.932 1.18E-06 2.032 2.032 6.36E-03 1233 2b Dr.90650 Transcribed locus Dr.90650 0.570 -1.753 2.25E-01 0.706 -1.416 4.52E-01 1.630 1.630 3.38E-01 1.636 1.636 1.64E-01 2.611 2.611 9.40E-04 2.585 2.585 9.12E-08 1234 2b zgc:77727 Zgc:77727 Dr.89530 393830 0.512 -1.952 2.69E-02 0.577 -1.732 1.08E-01 2.133 2.133 3.98E-02 1.743 1.743 1.41E-01 2.667 2.667 6.00E-05 2.885 2.885 5.22E-06 Hypothetical protein 1235 2b LOC796302 Dr.16549 796302 0.659 -1.517 4.74E-03 0.717 -1.394 2.28E-02 1.306 1.306 1.73E-01 1.395 1.395 1.92E-03 1.452 1.452 5.00E-05 1.710 1.710 9.56E-14 LOC796302 1236 2b Dr.22715 Transcribed locus Dr.22715 0.552 -1.813 9.85E-02 0.689 -1.452 2.88E-02 1.540 1.540 3.10E-04 1.508 1.508 1.58E-02 1.552 1.552 1.10E-02 2.023 2.023 2.49E-06 1237 2b zgc:92317 Zgc:92317 Dr.76480 449545 0.664 -1.506 1.32E-02 0.793 -1.261 2.98E-02 1.250 1.250 1.37E-01 1.422 1.422 7.10E-04 1.412 1.412 7.18E-03 1.614 1.614 1.19E-14 1238 2b foxc1a Forkhead box C1a Dr.82483 79374 0.666 -1.502 1.75E-02 0.791 -1.265 1.76E-02 1.195 1.195 1.91E-01 1.307 1.307 3.78E-02 1.558 1.558 5.10E-04 1.697 1.697 3.45E-13 1239 2b LOC100005925 Similar to endophilin III Dr.23431 100005925 0.608 -1.646 6.59E-03 0.753 -1.327 2.02E-02 1.502 1.502 1.82E-01 1.210 1.210 4.97E-01 1.679 1.679 1.25E-03 2.094 2.094 8.57E-06 1240 2b Dr.90120 Transcribed locus Dr.90120 0.431 -2.320 2.44E-03 0.571 -1.752 3.87E-02 2.347 2.347 9.63E-03 1.696 1.696 3.65E-02 2.120 2.120 2.60E-04 4.111 4.111 4.18E-15 1241 2b Dr.122295 Transcribed locus Dr.122295 0.831 -1.204 3.41E-01 0.794 -1.259 2.71E-01 1.186 1.186 2.33E-01 1.367 1.367 3.09E-03 1.399 1.399 2.90E-04 1.856 1.856 2.97E-35 1242 2b Dr.133641 Transcribed locus Dr.133641 0.759 -1.317 3.64E-02 0.765 -1.306 6.79E-02 1.205 1.205 7.07E-02 1.435 1.435 8.30E-04 1.556 1.556 3.24E-12 2.005 2.005 1.10E-04 1243 2b wu:fa98d10 Wu:fa98d10 Dr.27231 337125 0.609 -1.643 1.39E-01 0.407 -2.460 3.71E-02 1.417 1.417 2.13E-01 1.894 1.894 3.36E-02 3.470 3.470 5.89E-06 4.758 4.758 3.73E-07 1244 2b Dr.112862 Transcribed locus Dr.112862 0.596 -1.679 2.56E-02 0.747 -1.338 1.11E-03 1.169 1.169 3.18E-01 1.318 1.318 3.74E-02 2.268 2.268 5.00E-05 1.660 1.660 2.69E-02 1245 2b Dr.90757 Transcribed locus Dr.90757 0.711 -1.406 2.20E-01 0.757 -1.322 3.27E-01 1.233 1.233 2.19E-01 1.202 1.202 1.77E-01 1.888 1.888 7.00E-05 1.304 1.304 1.52E-01 1246 2b LOC565603 Hypothetical LOC565603 Dr.119617 565603 0.718 -1.392 1.75E-01 0.839 -1.191 4.93E-01 1.409 1.409 1.18E-01 1.448 1.448 4.70E-04 2.156 2.156 1.87E-13 1.476 1.476 3.30E-04 1247 2b zgc:92276 Zgc:92276 Dr.83119 445024 0.763 -1.311 1.37E-02 0.900 -1.112 2.11E-01 1.182 1.182 1.73E-01 1.259 1.259 5.86E-02 1.566 1.566 1.50E-08 1.290 1.290 1.89E-02 1248 2b Dr.121757 Transcribed locus Dr.121757 0.715 -1.399 7.72E-03 0.814 -1.228 9.31E-02 1.264 1.264 4.20E-04 1.371 1.371 4.58E-11 2.255 2.255 0.00E+00 1.719 1.719 2.00E-06 Translocase of outer 1249 2b tomm22 mitochondrial membrane Dr.117210 321232 0.801 -1.249 1.66E-01 1.057 1.057 7.15E-01 1.156 1.156 2.87E-01 1.170 1.170 2.23E-01 1.627 1.627 7.61E-09 1.257 1.257 2.60E-04 22 homolog (yeast) RAD17 homolog (S. 1250 2b rad17 Dr.31220 436934 0.712 -1.404 8.48E-02 1.035 1.035 8.41E-01 1.309 1.309 1.05E-01 1.249 1.249 1.92E-01 2.199 2.199 1.21E-18 1.539 1.539 1.17E-06 pombe) 1251 2b LOC558391 Similar to sidekick-1 Dr.90300 558391 0.837 -1.195 1.14E-01 1.026 1.026 7.57E-01 1.202 1.202 1.22E-01 1.140 1.140 2.59E-01 1.561 1.561 4.14E-06 1.273 1.273 9.04E-03 Hypothetical protein 1252 2b LOC100001612 Dr.90930 100001612 0.661 -1.513 4.20E-02 1.016 1.016 9.20E-01 1.712 1.712 3.88E-02 1.450 1.450 1.68E-01 3.769 3.769 4.84E-10 1.895 1.895 3.04E-03 LOC100001612
Aldehyde dehydrogenase 1253 2b aldh2 Dr.28434 393462 0.572 -1.747 8.19E-02 0.952 -1.050 7.66E-01 1.301 1.301 2.31E-01 1.368 1.368 1.14E-01 3.575 3.575 3.69E-24 2.359 2.359 1.82E-08 2 family (mitochondrial)
Solute carrier family 2 1254 2b slc2a12 (facilitated glucose Dr.28449 393510 0.735 -1.361 4.67E-02 1.040 1.040 8.02E-01 1.137 1.137 4.21E-01 1.207 1.207 1.88E-01 2.090 2.090 2.32E-08 1.552 1.552 1.48E-03 transporter), member 12 Glutamic-oxaloacetic transaminase 2, 1255 2b got2 Dr.17618 406688 0.707 -1.414 2.39E-02 0.961 -1.040 7.22E-01 1.144 1.144 2.26E-01 1.197 1.197 2.24E-01 1.646 1.646 5.90E-10 1.255 1.255 9.65E-02 mitochondrial (aspartate aminotransferase 2) COP9 constitutive photomorphogenic 1256 2b cops8 Dr.78319 393198 0.681 -1.468 4.17E-03 0.945 -1.059 6.70E-01 1.204 1.204 2.85E-01 1.244 1.244 2.09E-01 2.170 2.170 2.72E-12 1.386 1.386 2.39E-02 homolog subunit 8 (Arabidopsis) Poly (ADP-ribose) 1257 2b parp3 polymerase family, Dr.78126 335495 0.680 -1.470 1.38E-03 0.980 -1.020 8.42E-01 1.204 1.204 2.54E-02 1.354 1.354 8.15E-06 1.889 1.889 7.10E-06 1.459 1.459 1.29E-02 member 3 1258 2b zgc:77486 Zgc:77486 Dr.85913 405808 0.443 -2.259 2.43E-02 1.157 1.157 6.85E-01 1.459 1.459 2.57E-01 1.438 1.438 1.92E-01 3.206 3.206 1.58E-43 1.977 1.977 1.66E-02 1259 2b zgc:86905 Zgc:86905 Dr.31087 415185 0.757 -1.320 3.30E-02 1.117 1.117 3.02E-01 1.062 1.062 6.66E-01 1.234 1.234 6.27E-02 1.660 1.660 2.13E-16 1.299 1.299 4.28E-02 1260 2b wu:fc22a11 Wu:fc22a11 Dr.78496 324223 0.556 -1.798 8.96E-03 1.150 1.150 4.18E-01 1.323 1.323 2.95E-01 1.529 1.529 9.26E-02 3.222 3.222 2.65E-07 1.451 1.451 1.63E-01 Hypothetical protein 1261 2b LOC100002439 Dr.120617 100002439 0.725 -1.380 7.94E-03 0.928 -1.077 1.49E-01 1.235 1.235 3.31E-02 1.077 1.077 4.37E-01 1.633 1.633 9.44E-06 1.384 1.384 4.17E-03 LOC100002439 1262 2b wu:fa92h10 Wu:fa92h10 Dr.76239 336699 0.438 -2.282 1.01E-01 0.787 -1.270 1.65E-01 1.962 1.962 9.50E-03 1.424 1.424 1.88E-01 4.256 4.256 1.02E-08 2.738 2.738 7.00E-05 1263 2b chad Chondroadherin Dr.80402 394038 0.658 -1.521 3.03E-02 0.976 -1.025 7.66E-01 1.271 1.271 9.60E-04 1.182 1.182 9.00E-05 1.932 1.932 9.44E-07 1.541 1.541 9.03E-10 1264 2b wu:fc14h11 Wu:fc14h11 Dr.75449 323945 0.893 -1.120 2.25E-01 0.952 -1.050 5.77E-01 1.239 1.239 4.44E-03 1.132 1.132 7.81E-02 1.532 1.532 5.43E-07 1.281 1.281 2.83E-06 1265 2b zgc:64106 Zgc:64106 Dr.78121 393348 0.732 -1.366 1.68E-02 0.872 -1.146 2.73E-01 1.445 1.445 7.76E-03 1.192 1.192 2.06E-01 1.988 1.988 3.64E-08 1.520 1.520 9.00E-04 1266 2b Dr.123312 Transcribed locus Dr.123312 0.621 -1.611 6.10E-03 1.130 1.130 1.30E-01 1.541 1.541 8.40E-04 1.624 1.624 1.50E-04 2.095 2.095 9.36E-10 1.642 1.642 6.98E-02 Myosin, heavy polypeptide 1267 2b myhz2 Dr.132261 246275 0.735 -1.360 1.80E-04 1.040 1.040 6.44E-01 1.371 1.371 3.28E-17 1.263 1.263 6.40E-04 1.676 1.676 1.62E-24 1.399 1.399 2.62E-13 2, fast muscle specific
Transcribed locus, moderately similar to 1268 2b Dr.141327 XP_509446.2 hypothetical Dr.141327 0.641 -1.560 1.84E-03 0.945 -1.058 4.34E-01 1.476 1.476 1.40E-03 1.399 1.399 5.24E-03 1.958 1.958 3.10E-09 1.427 1.427 2.03E-02 protein isoform 12 [Pan troglodytes]
AU RNA binding 1269 2b auh protein/enoyl-Coenzyme A Dr.2043 445182 0.660 -1.515 1.41E-02 0.933 -1.071 3.81E-01 1.504 1.504 1.64E-02 1.456 1.456 3.16E-02 1.862 1.862 5.00E-05 1.599 1.599 2.40E-04 hydratase 1270 2b Dr.83658 Transcribed locus Dr.83658 0.612 -1.635 3.01E-02 0.913 -1.095 2.26E-01 1.540 1.540 4.13E-03 1.346 1.346 4.72E-02 2.215 2.215 2.96E-08 1.738 1.738 1.20E-04 1271 2b Dr.84597 Transcribed locus Dr.84597 0.352 -2.837 3.57E-02 0.830 -1.205 2.66E-01 2.346 2.346 1.23E-02 1.807 1.807 7.65E-02 4.646 4.646 2.00E-05 3.064 3.064 1.30E-03 1272 2b zgc:85965 Zgc:85965 Dr.81190 405857 0.562 -1.781 6.26E-02 0.983 -1.017 9.17E-01 2.405 2.405 1.80E-04 1.891 1.891 9.38E-03 2.672 2.672 8.45E-06 2.670 2.670 3.86E-10 1273 2b Dr.133426 Transcribed locus Dr.133426 0.617 -1.622 3.73E-02 0.982 -1.018 9.39E-01 1.266 1.266 1.58E-01 1.438 1.438 9.60E-04 1.722 1.722 2.00E-05 1.314 1.314 1.51E-01 1274 2b Dr.134747 Transcribed locus Dr.134747 0.635 -1.575 2.05E-01 0.865 -1.156 6.98E-01 1.271 1.271 3.41E-01 1.363 1.363 1.38E-01 1.585 1.585 2.94E-11 1.265 1.265 1.99E-01 Sarcolemma associated 1275 2b slmap Dr.81986 393146 0.571 -1.750 1.66E-08 0.914 -1.094 1.60E-01 1.333 1.333 2.00E-05 1.432 1.432 6.98E-07 1.879 1.879 4.29E-06 1.390 1.390 1.00E-04 protein Similar to family with 1276 2b LOC556392 sequence similarity 40, Dr.82835 556392 0.705 -1.419 3.17E-02 0.906 -1.104 1.82E-01 1.186 1.186 9.10E-02 1.232 1.232 8.45E-03 1.544 1.544 1.00E-05 1.251 1.251 6.18E-02 member A Iroquois homeobox protein 1277 2b irx2a Dr.88466 394032 0.645 -1.551 1.95E-02 0.864 -1.157 2.31E-01 1.188 1.188 2.77E-01 1.282 1.282 1.09E-01 1.599 1.599 1.17E-12 1.198 1.198 1.29E-01 2, a 1278 2b zgc:112232 Zgc:112232 Dr.90608 565258 0.649 -1.540 1.63E-02 0.875 -1.143 1.58E-01 1.198 1.198 2.78E-01 1.173 1.173 2.77E-01 1.573 1.573 1.02E-08 1.175 1.175 1.23E-01 1279 2b Dr.82821 Transcribed locus Dr.82821 0.632 -1.581 5.94E-02 0.905 -1.105 7.17E-01 1.393 1.393 5.31E-02 1.295 1.295 5.81E-02 1.562 1.562 2.00E-05 1.222 1.222 8.26E-02 1280 2b wu:fc06e12 Wu:fc06e12 Dr.27420 323668 0.647 -1.545 2.15E-02 1.078 1.078 6.97E-01 1.278 1.278 9.29E-02 1.030 1.030 8.18E-01 1.739 1.739 1.31E-11 1.380 1.380 1.10E-02 1281 2b si:dkey-91f15.6 Si:dkey-91f15.6 Dr.34109 564304 0.635 -1.576 4.76E-02 1.113 1.113 5.51E-01 1.385 1.385 5.65E-02 1.033 1.033 7.72E-01 2.115 2.115 1.88E-06 1.323 1.323 1.07E-01 1282 2b zgc:136632 Zgc:136632 Dr.80625 326634 0.717 -1.394 8.00E-02 1.010 1.010 9.59E-01 1.176 1.176 3.34E-01 1.088 1.088 5.67E-01 1.728 1.728 2.00E-05 1.182 1.182 2.05E-01 5-methyltetrahydrofolate- 1283 2b mtr homocysteine Dr.75737 378847 0.709 -1.411 2.00E-05 1.101 1.101 4.88E-01 1.049 1.049 7.37E-01 1.060 1.060 5.48E-01 1.746 1.746 2.79E-07 1.365 1.365 7.20E-02 methyltransferase 1284 2b si:busm1-180o5.3 Si:busm1-180o5.3 Dr.45761 368518 0.668 -1.496 2.78E-01 0.915 -1.093 3.10E-01 1.535 1.535 2.46E-03 0.993 -1.007 9.36E-01 1.898 1.898 1.94E-07 1.368 1.368 1.36E-01 1285 2b Dr.106669 Transcribed locus Dr.106669 0.877 -1.140 4.59E-01 0.884 -1.131 5.34E-01 1.057 1.057 6.29E-01 1.120 1.120 2.94E-01 1.656 1.656 8.03E-12 1.406 1.406 1.10E-02 1286 2b zgc:56567 Zgc:56567 Dr.117075 406725 0.852 -1.173 2.51E-01 0.881 -1.135 3.56E-02 1.217 1.217 1.96E-01 1.192 1.192 1.74E-01 1.932 1.932 3.12E-17 1.607 1.607 9.90E-04 1287 2b zgc:92866 Zgc:92866 Dr.121908 436755 0.868 -1.152 3.51E-01 0.805 -1.243 3.15E-02 1.250 1.250 1.96E-01 1.124 1.124 3.80E-01 1.922 1.922 3.00E-05 1.601 1.601 1.30E-04 Apoptosis, caspase 1288 2b aven Dr.21346 692323 0.850 -1.176 1.92E-01 0.882 -1.133 3.12E-01 1.204 1.204 2.73E-01 1.044 1.044 7.77E-01 1.733 1.733 2.90E-04 1.521 1.521 3.80E-09 activation inhibitor 1289 2b Dr.85557 Transcribed locus Dr.85557 0.678 -1.476 4.26E-02 0.740 -1.352 6.66E-02 1.383 1.383 3.63E-03 1.208 1.208 1.12E-01 3.121 3.121 3.35E-15 1.940 1.940 3.29E-03 Splicing factor 3a, subunit 1290 2b sf3a1 Dr.116253 368732 0.690 -1.449 1.30E-04 0.808 -1.238 2.64E-01 1.143 1.143 1.01E-01 1.091 1.091 6.15E-01 2.209 2.209 1.30E-04 2.002 2.002 7.48E-06 1 1291 2b Dr.131036 Transcribed locus Dr.131036 0.674 -1.484 1.33E-03 0.731 -1.369 1.31E-02 1.286 1.286 3.18E-01 1.166 1.166 5.13E-01 2.122 2.122 3.00E-04 2.074 2.074 3.91E-06 1292 2b zgc:92250 Zgc:92250 Dr.81554 447821 0.712 -1.405 2.75E-01 0.855 -1.170 1.78E-02 1.291 1.291 1.08E-01 1.089 1.089 3.91E-01 1.970 1.970 4.00E-05 1.773 1.773 1.22E-02 Eukaryotic translation 1293 2b eif4e1a Dr.5294 79380 0.807 -1.240 8.93E-02 0.946 -1.057 6.37E-01 1.225 1.225 8.26E-03 1.045 1.045 6.11E-01 1.737 1.737 1.31E-07 1.613 1.613 3.00E-03 initiation factor 4e 1a STIP1 homology and U- 1294 2b stub1 Dr.78513 324243 0.740 -1.352 1.95E-01 0.963 -1.038 7.89E-01 1.248 1.248 1.88E-01 1.028 1.028 8.58E-01 1.935 1.935 2.47E-06 1.964 1.964 7.66E-09 Box containing protein 1 Regulator of G-protein 1295 2b rgs14 Dr.80473 327368 0.894 -1.119 3.10E-01 0.803 -1.246 2.53E-02 1.232 1.232 1.20E-01 0.950 -1.053 7.57E-01 1.650 1.650 1.44E-09 1.479 1.479 1.70E-04 signalling 14 Hypothetical protein 1296 2b LOC100008526 Dr.121323 100008526 0.694 -1.441 2.12E-01 0.349 -2.867 4.40E-04 1.835 1.835 1.64E-02 2.021 2.021 6.23E-03 6.402 6.402 4.14E-18 4.653 4.653 1.63E-13 LOC100008526
Dolichyl- 1297 2b ddost diphosphooligosaccharide- Dr.1142 406408 0.939 -1.065 1.69E-01 0.994 -1.006 9.08E-01 1.175 1.175 3.18E-02 1.097 1.097 2.64E-02 1.501 1.501 1.23E-08 1.278 1.278 1.54E-09 protein glycosyltransferase
1298 2b Dr.81575 Transcribed locus Dr.81575 0.925 -1.081 3.90E-01 0.960 -1.041 7.43E-01 1.242 1.242 1.00E-05 1.037 1.037 4.02E-01 1.672 1.672 1.28E-06 1.394 1.394 6.29E-03 1299 2b zgc:100849 Zgc:100849 Dr.77914 445144 0.864 -1.157 3.46E-01 0.999 -1.001 9.97E-01 1.278 1.278 4.67E-02 1.245 1.245 1.47E-01 2.272 2.272 2.78E-10 1.439 1.439 7.70E-04 1300 2b wu:fb25h12 Wu:fb25h12 Dr.76766 321668 0.938 -1.066 8.81E-01 0.901 -1.110 7.92E-01 1.315 1.315 4.28E-01 0.865 -1.156 6.64E-01 2.589 2.589 1.30E-06 2.481 2.481 8.00E-05 1301 2b LOC100001243 Similar to Septin 6 Dr.117997 100001243 0.896 -1.116 5.81E-02 0.942 -1.062 5.65E-01 1.066 1.066 2.57E-01 1.272 1.272 2.54E-02 1.676 1.676 5.16E-13 1.685 1.685 8.79E-07 1302 2b Dr.85649 Transcribed locus Dr.85649 0.907 -1.102 5.37E-01 0.909 -1.100 5.90E-01 1.094 1.094 4.06E-01 1.326 1.326 8.68E-03 1.632 1.632 5.00E-05 1.762 1.762 1.00E-04 1303 2b egr1 Early growth response 1 Dr.10183 30498 0.860 -1.162 4.08E-01 0.878 -1.139 5.28E-01 1.050 1.050 7.56E-01 1.224 1.224 5.61E-02 1.316 1.316 3.11E-03 2.517 2.517 2.58E-12 1304 2b wu:fc11d12 Wu:fc11d12 Dr.132393 323842 0.874 -1.144 1.96E-01 0.975 -1.025 6.75E-01 1.021 1.021 7.87E-01 1.117 1.117 1.94E-01 1.144 1.144 1.83E-01 1.525 1.525 9.72E-08 1305 2b wu:fi06d09 Wu:fi06d09 Dr.132729 327409 0.870 -1.150 1.84E-01 0.977 -1.023 8.56E-01 1.031 1.031 6.60E-01 1.146 1.146 6.42E-02 1.202 1.202 6.00E-05 1.566 1.566 2.42E-12 1306 2b LOC799834 Similar to serine protease Dr.119715 799834 0.807 -1.239 1.64E-01 0.924 -1.082 1.77E-01 1.150 1.150 9.47E-02 1.172 1.172 5.92E-03 1.369 1.369 1.16E-02 2.086 2.086 4.04E-11 1307 2b wu:fb99g10 Wu:fb99g10 Dr.77790 323495 0.867 -1.153 3.38E-02 0.957 -1.045 5.54E-01 1.102 1.102 2.40E-01 1.082 1.082 3.87E-01 1.245 1.245 1.44E-01 1.608 1.608 7.00E-05 Similar to cocaine and 1308 2b LOC557301 amphetamine regulated Dr.86980 557301 0.714 -1.401 3.15E-02 0.800 -1.249 5.00E-05 1.184 1.184 1.36E-01 1.255 1.255 2.19E-02 1.978 1.978 5.58E-07 3.680 3.680 2.12E-27 transcript protein type I 1309 2b Dr.74678 Transcribed locus Dr.74678 0.808 -1.237 1.13E-01 0.879 -1.137 4.62E-01 1.121 1.121 4.26E-01 1.286 1.286 7.34E-02 1.553 1.553 1.66E-10 1.994 1.994 1.48E-16 1310 2b wu:fb77f12 Wu:fb77f12 Dr.77289 322955 0.843 -1.186 1.44E-01 0.930 -1.075 6.11E-01 1.118 1.118 1.08E-01 1.161 1.161 8.97E-02 1.343 1.343 8.29E-03 1.626 1.626 1.71E-09 1311 2b zgc:91963 Zgc:91963 Dr.85722 445108 0.577 -1.733 8.74E-06 0.958 -1.043 8.03E-01 1.327 1.327 5.34E-02 2.198 2.198 1.79E-06 3.033 3.033 5.58E-14 6.911 6.911 2.96E-23 SRY-box containing gene 1312 2b sox21b Dr.116538 406246 0.815 -1.227 6.37E-01 0.695 -1.439 3.29E-01 2.072 2.072 1.57E-03 1.501 1.501 4.44E-02 2.868 2.868 3.00E-05 5.184 5.184 2.80E-04 21 b Death-associated protein 1313 2b dapk3 Dr.3200 324306 0.916 -1.092 4.61E-01 0.934 -1.071 5.68E-01 1.200 1.200 8.50E-02 1.217 1.217 7.73E-02 1.381 1.381 6.79E-06 1.836 1.836 1.69E-12 kinase 3 1314 2b Dr.122381 Transcribed locus Dr.122381 0.711 -1.406 1.38E-03 0.836 -1.197 5.92E-01 1.251 1.251 2.45E-01 1.364 1.364 3.64E-01 1.177 1.177 1.19E-01 2.708 2.708 2.00E-05 Similar to Profilin family, 1315 2b LOC556873 Dr.92876 556873 0.755 -1.325 4.47E-01 0.933 -1.072 8.53E-01 1.273 1.273 5.06E-01 1.125 1.125 7.10E-01 1.152 1.152 2.47E-01 2.433 2.433 2.43E-13 member 4 1316 2b zgc:100959 Zgc:100959 Dr.106411 445225 0.927 -1.079 3.70E-01 0.777 -1.288 1.89E-03 1.024 1.024 6.47E-01 1.163 1.163 1.15E-02 1.217 1.217 3.01E-02 1.600 1.600 2.01E-10 1317 2b wu:fk81c02 Wu:fk81c02 Dr.82060 335157 0.447 -2.238 1.50E-02 0.459 -2.180 1.81E-02 1.493 1.493 3.29E-01 1.719 1.719 1.22E-01 2.557 2.557 4.60E-09 8.388 8.388 6.98E-25
Solute carrier family 5 1318 2b slc5a1 (sodium/glucose Dr.87868 393654 0.467 -2.141 5.01E-03 0.532 -1.881 1.00E-05 1.239 1.239 3.93E-01 1.555 1.555 6.15E-02 1.734 1.734 1.91E-03 4.459 4.459 0.00E+00 cotransporter), member 1
1319 2b Dr.86575 Transcribed locus Dr.86575 0.540 -1.852 1.16E-01 0.449 -2.225 5.44E-02 1.077 1.077 8.31E-01 1.464 1.464 2.76E-01 1.987 1.987 2.57E-03 4.978 4.978 8.00E-05 POU domain, class 5, 1320 2b pou5f1 Dr.258 30333 0.818 -1.222 3.00E-04 0.795 -1.259 2.00E-05 0.901 -1.110 5.26E-03 1.120 1.120 2.10E-04 1.238 1.238 5.86E-03 1.577 1.577 1.04E-11 transcription factor 1 1321 2b zgc:91890 Zgc:91890 Dr.83427 431729 0.700 -1.429 9.00E-05 0.763 -1.311 4.59E-02 0.961 -1.040 7.47E-01 1.145 1.145 4.05E-02 1.723 1.723 1.27E-26 2.219 2.219 2.40E-04 1322 2b si:ch211-11c20.1 Si:ch211-11c20.1 Dr.83512 568060 0.713 -1.403 8.00E-05 0.737 -1.357 1.66E-06 0.944 -1.059 6.21E-01 1.128 1.128 3.89E-01 1.488 1.488 2.61E-02 2.171 2.171 3.00E-05 1323 2b Dr.103268 Transcribed locus Dr.103268 0.971 -1.029 9.20E-01 1.611 1.611 2.76E-02 1.052 1.052 7.74E-01 1.419 1.419 4.50E-04 1.553 1.553 3.00E-03 1.913 1.913 1.30E-09 1324 2b wu:fb79e06 Wu:fb79e06 Dr.39734 323032 0.938 -1.066 7.62E-01 1.561 1.561 6.13E-03 1.163 1.163 3.68E-01 1.596 1.596 1.69E-03 1.663 1.663 5.00E-05 2.064 2.064 1.67E-26 1325 2b wu:fe26f02 Wu:fe26f02 Dr.5843 767786 1.042 1.042 8.44E-01 1.824 1.824 9.10E-04 0.964 -1.037 8.51E-01 1.351 1.351 3.53E-02 1.360 1.360 2.23E-02 1.944 1.944 1.37E-13 1326 2b Dr.107716 Transcribed locus Dr.107716 0.860 -1.163 4.03E-01 1.341 1.341 8.80E-04 1.044 1.044 7.71E-01 1.134 1.134 3.97E-01 1.577 1.577 5.60E-04 1.942 1.942 4.72E-07 Hedgehog acyltransferase- 1327 2b hhatlb Dr.74495 571120 0.910 -1.099 6.67E-01 1.258 1.258 1.50E-01 1.046 1.046 6.90E-01 1.047 1.047 7.64E-01 1.301 1.301 1.42E-02 1.530 1.530 6.09E-08 like, b Phosphatidylinositol 1328 2b pigq Dr.11595 334764 0.928 -1.077 4.01E-01 1.217 1.217 1.29E-02 1.102 1.102 4.96E-02 1.147 1.147 8.77E-03 1.297 1.297 4.10E-04 1.541 1.541 8.00E-05 glycan, class Q 1329 2b Dr.121913 Transcribed locus Dr.121913 0.896 -1.116 2.75E-01 1.491 1.491 2.67E-09 1.123 1.123 3.43E-01 1.252 1.252 1.09E-01 1.621 1.621 7.00E-05 2.017 2.017 1.47E-18 Similar to Homeodomain 1330 2b LOC572921 Dr.113980 572921 0.839 -1.191 5.97E-01 1.608 1.608 1.38E-02 1.158 1.158 4.88E-01 1.223 1.223 3.60E-01 1.612 1.612 5.50E-04 3.085 3.085 0.00E+00 leucine zipper gene 1331 2b Dr.125458 Transcribed locus Dr.125458 0.950 -1.052 8.97E-01 1.789 1.789 1.02E-01 1.379 1.379 2.87E-01 1.313 1.313 4.30E-01 1.693 1.693 2.85E-02 2.551 2.551 6.03E-06 Similar to Centrosomal 1332 2b LOC567090 protein of 27 kDa (Cep27 Dr.108456 567090 0.928 -1.077 4.33E-01 1.478 1.478 3.84E-06 0.933 -1.072 6.25E-01 1.046 1.046 7.74E-01 1.355 1.355 1.09E-03 1.749 1.749 1.90E-12 protein) Integral membrane protein 1333 2b itm2b Dr.77196 323632 1.026 1.026 9.19E-01 1.408 1.408 1.37E-01 0.969 -1.032 8.57E-01 1.003 1.003 9.84E-01 1.382 1.382 8.05E-03 1.574 1.574 4.00E-05 2B 1334 2b Dr.124020 Transcribed locus Dr.124020 0.966 -1.035 9.28E-01 1.827 1.827 5.73E-02 1.027 1.027 9.14E-01 1.198 1.198 4.25E-01 1.901 1.901 1.00E-05 2.399 2.399 8.75E-33 1335 2b Dr.133621 Transcribed locus Dr.133621 1.031 1.031 9.46E-01 2.167 2.167 1.22E-02 1.190 1.190 3.78E-01 1.324 1.324 1.83E-01 1.914 1.914 2.31E-03 2.703 2.703 6.19E-11 1336 2b Dr.126624 Transcribed locus Dr.126624 0.984 -1.016 9.49E-01 1.546 1.546 3.82E-02 1.070 1.070 7.41E-01 1.149 1.149 4.57E-01 1.482 1.482 2.81E-02 2.204 2.204 1.32E-12 Lysosomal-associated 1337 2b laptm4a protein transmembrane 4 Dr.2933 322305 0.956 -1.047 8.79E-01 1.467 1.467 1.41E-01 1.008 1.008 9.64E-01 1.076 1.076 6.59E-01 1.360 1.360 2.44E-02 1.846 1.846 2.70E-10 alpha Death-associated protein 1338 2b dapk3 Dr.132498 324306 1.069 1.069 8.44E-01 1.667 1.667 9.51E-02 0.984 -1.016 9.34E-01 1.129 1.129 4.99E-01 1.743 1.743 7.18E-03 2.714 2.714 1.45E-09 kinase 3 1339 2b wu:fc22b06 Wu:fc22b06 Dr.104555 324227 0.804 -1.244 5.13E-01 1.074 1.074 8.61E-01 1.019 1.019 9.27E-01 1.137 1.137 6.23E-01 1.789 1.789 5.50E-04 2.176 2.176 4.25E-16 1340 2b Dr.44448 Transcribed locus Dr.44448 0.726 -1.378 3.29E-01 1.101 1.101 7.70E-01 0.991 -1.009 9.70E-01 1.319 1.319 2.01E-01 2.152 2.152 5.15E-19 3.291 3.291 1.14E-27 Hypothetical protein 1341 2b LOC100001075 Dr.117939 100001075 0.655 -1.526 1.97E-01 1.089 1.089 4.84E-01 1.257 1.257 2.54E-01 1.544 1.544 2.76E-02 3.107 3.107 3.69E-18 4.980 4.980 2.37E-30 LOC100001075 1342 2b Dr.86115 Transcribed locus Dr.86115 0.843 -1.186 2.25E-02 1.056 1.056 6.57E-01 1.123 1.123 1.86E-01 1.166 1.166 7.36E-02 1.558 1.558 1.52E-07 1.898 1.898 4.06E-23
Transcribed locus, weakly similar to NP_001036132.1 1343 2b Dr.119809 Dr.119809 0.796 -1.257 2.01E-02 1.097 1.097 1.51E-01 1.120 1.120 1.50E-01 1.224 1.224 4.00E-04 1.570 1.570 5.10E-06 1.952 1.952 3.00E-05 hormone receptor [Macaca mulatta]
1344 2b Dr.129903 Transcribed locus Dr.129903 0.828 -1.207 3.08E-01 1.063 1.063 7.49E-01 1.098 1.098 4.18E-01 1.254 1.254 2.27E-02 1.438 1.438 7.70E-04 1.826 1.826 3.74E-31 1345 2b Dr.123541 Transcribed locus Dr.123541 0.728 -1.374 1.10E-01 1.258 1.258 1.44E-01 1.316 1.316 2.20E-01 1.525 1.525 1.65E-02 2.244 2.244 8.93E-06 5.111 5.111 3.71E-23 1346 2b LOC563193 Hypothetical LOC563193 Dr.117168 563193 0.812 -1.232 8.06E-02 1.315 1.315 1.50E-01 1.068 1.068 5.87E-01 1.224 1.224 2.36E-02 2.239 2.239 1.06E-11 3.565 3.565 3.74E-30 1347 2b zgc:66326 Zgc:66326 Dr.76836 321842 0.904 -1.106 3.98E-01 1.188 1.188 2.00E-05 1.114 1.114 1.61E-01 1.141 1.141 7.55E-02 1.527 1.527 9.23E-06 2.005 2.005 1.16E-06 1348 2b zgc:158807 Zgc:158807 Dr.83792 100009648 0.825 -1.212 4.83E-01 1.639 1.639 2.04E-02 1.282 1.282 8.05E-02 1.473 1.473 2.99E-02 2.526 2.526 6.64E-03 4.701 4.701 2.00E-05
Farnesyl diphosphate synthase (farnesyl 1349 2b fdps pyrophosphate synthetase, Dr.77233 552997 0.981 -1.019 8.61E-01 1.145 1.145 2.41E-01 0.996 -1.004 9.54E-01 1.111 1.111 1.78E-02 1.333 1.333 4.26E-03 1.633 1.633 4.71E-06 dimethylallyltranstransferas e, geranyltranstransferase)
1350 2b zgc:64013 Zgc:64013 Dr.119341 393333 0.917 -1.091 6.08E-01 1.151 1.151 3.80E-01 1.139 1.139 5.52E-01 1.322 1.322 7.01E-02 1.970 1.970 8.00E-05 2.515 2.515 1.13E-13 1351 2b zgc:63695 Zgc:63695 Dr.133823 792112 0.795 -1.258 5.33E-01 1.327 1.327 2.63E-01 1.347 1.347 6.91E-02 1.256 1.256 1.49E-01 1.888 1.888 9.97E-03 2.835 2.835 4.10E-16 Cholinergic receptor, 1352 2b chrm5 Dr.94295 561491 0.899 -1.113 2.78E-01 1.144 1.144 2.00E-01 1.101 1.101 3.26E-01 1.033 1.033 7.65E-01 1.327 1.327 4.46E-03 1.567 1.567 8.36E-17 muscarinic 5 1353 2b Dr.83281 Transcribed locus Dr.83281 0.843 -1.186 2.84E-01 1.135 1.135 3.38E-01 1.067 1.067 5.77E-01 1.085 1.085 5.00E-01 1.414 1.414 8.60E-04 1.846 1.846 6.05E-17 1354 2b im:7149072 Im:7149072 Dr.91280 445153 0.789 -1.267 7.50E-02 1.148 1.148 2.26E-01 1.107 1.107 3.41E-01 1.133 1.133 1.96E-01 1.561 1.561 6.08E-06 2.073 2.073 9.33E-15 1355 2b wu:fc74a06 Wu:fc74a06 Dr.78055 325391 0.965 -1.037 8.43E-01 1.077 1.077 2.90E-01 1.081 1.081 5.62E-01 1.036 1.036 8.55E-01 1.239 1.239 3.49E-01 1.657 1.657 2.90E-09 Similar to LOC495350 1356 2b LOC560274 Dr.119869 560274 0.989 -1.011 9.23E-01 1.181 1.181 1.30E-01 1.133 1.133 1.70E-01 1.203 1.203 3.85E-03 1.396 1.396 3.48E-03 1.508 1.508 8.84E-06 protein 1357 2b Dr.133746 Transcribed locus Dr.133746 0.915 -1.093 3.88E-01 1.418 1.418 2.40E-04 1.168 1.168 2.59E-01 1.324 1.324 1.00E-01 2.109 2.109 3.23E-36 2.569 2.569 0.00E+00 1358 2b stard3nl STARD3 N-terminal like Dr.75372 436592 0.931 -1.075 5.02E-01 1.289 1.289 8.15E-02 1.186 1.186 4.99E-02 1.315 1.315 5.09E-03 1.827 1.827 4.10E-07 2.110 2.110 4.40E-21 1359 2b zgc:56141 Zgc:56141 Dr.42026 406277 0.872 -1.146 4.94E-01 1.434 1.434 1.79E-02 1.408 1.408 5.94E-03 1.293 1.293 1.80E-01 2.236 2.236 0.00E+00 2.426 2.426 1.04E-24 1360 2b Dr.127398 Transcribed locus Dr.127398 0.903 -1.108 4.29E-01 1.130 1.130 5.64E-01 1.104 1.104 4.38E-01 1.254 1.254 3.55E-02 1.637 1.637 6.50E-04 1.702 1.702 6.00E-05 1361 2b wu:fc07b07 Wu:fc07b07 Dr.77935 323690 0.882 -1.134 4.07E-01 1.233 1.233 4.80E-02 1.157 1.157 2.74E-01 1.308 1.308 4.99E-02 1.689 1.689 1.00E-05 1.864 1.864 5.25E-06 1362 2b LOC556505 Hypothetical LOC556505 Dr.133579 556505 0.755 -1.325 4.20E-01 1.343 1.343 1.18E-01 1.109 1.109 6.39E-01 1.455 1.455 7.63E-03 2.198 2.198 3.70E-04 2.710 2.710 4.05E-09 1363 2b agk Acylglycerol kinase Dr.80681 334270 0.910 -1.099 4.71E-01 1.160 1.160 9.40E-03 1.051 1.051 6.11E-01 1.185 1.185 1.68E-01 1.443 1.443 1.20E-02 1.557 1.557 5.00E-05 Hypothetical protein 1364 2b LOC794757 Dr.91628 794757 0.771 -1.297 5.14E-01 1.476 1.476 1.25E-01 1.126 1.126 6.11E-01 1.400 1.400 4.93E-02 2.040 2.040 1.80E-04 2.392 2.392 9.52E-09 LOC794757 1365 2b Dr.131410 Transcribed locus Dr.131410 0.832 -1.202 2.63E-01 1.306 1.306 8.92E-02 1.261 1.261 1.64E-01 1.485 1.485 6.10E-04 1.840 1.840 1.98E-15 2.476 2.476 6.61E-23 1366 2b LOC570757 Hypothetical LOC570757 Dr.121002 570757 0.743 -1.346 4.43E-01 1.867 1.867 3.63E-02 1.207 1.207 3.36E-01 1.793 1.793 3.00E-05 2.410 2.410 1.00E-05 3.042 3.042 1.76E-09
Vesicle-associated 1367 2b vapb membrane protein, Dr.935 323628 0.721 -1.386 1.49E-01 1.960 1.960 4.30E-04 1.505 1.505 2.29E-01 1.764 1.764 1.30E-02 2.728 2.728 7.10E-04 2.871 2.871 2.00E-05 associated protein B and C
Similar to Ribonuclease 1368 2b LOC568902 Dr.120089 568902 0.657 -1.523 2.56E-02 1.355 1.355 5.93E-03 1.337 1.337 1.38E-02 1.509 1.509 4.70E-04 1.857 1.857 3.00E-04 2.679 2.679 5.77E-14 inhibitor 1369 2b Dr.84632 Transcribed locus Dr.84632 0.752 -1.330 1.29E-01 1.168 1.168 8.69E-02 1.233 1.233 6.63E-02 1.335 1.335 5.83E-02 1.531 1.531 2.09E-07 1.934 1.934 1.00E-05 1370 2b zgc:85948 Zgc:85948 Dr.3014 406516 0.771 -1.298 1.08E-02 1.204 1.204 2.69E-02 1.180 1.180 9.14E-02 1.346 1.346 6.00E-05 1.462 1.462 5.84E-03 1.784 1.784 2.45E-09 1371 2b cldnf Claudin f Dr.76180 791933 0.686 -1.458 8.70E-02 1.313 1.313 4.06E-02 1.511 1.511 5.60E-04 1.438 1.438 3.15E-03 1.820 1.820 9.00E-05 2.623 2.623 9.24E-15 1372 2b wu:fc89a04 Wu:fc89a04 Dr.79591 325575 0.743 -1.345 1.50E-04 1.266 1.266 3.50E-04 1.266 1.266 2.92E-02 1.261 1.261 1.59E-02 1.600 1.600 4.56E-11 1.955 1.955 0.00E+00 1373 2b Dr.132023 Transcribed locus Dr.132023 0.685 -1.459 2.71E-01 1.750 1.750 1.15E-02 1.501 1.501 1.03E-01 1.613 1.613 5.45E-02 2.452 2.452 1.70E-04 3.814 3.814 4.80E-18 1374 2b mg:cb01g02 Mg:cb01g02 Dr.55608 326963 0.841 -1.189 1.66E-01 1.168 1.168 1.53E-01 1.112 1.112 2.00E-01 1.170 1.170 1.22E-01 1.269 1.269 7.93E-03 1.537 1.537 1.88E-13 1375 2b wu:fc83a09 Wu:fc83a09 Dr.79472 325480 0.769 -1.301 2.07E-01 1.368 1.368 4.34E-02 1.169 1.169 3.52E-01 1.452 1.452 3.03E-03 1.612 1.612 7.00E-05 2.158 2.158 2.18E-22 Hypothetical protein 1376 2b LOC795393 Dr.89230 795393 0.829 -1.207 1.48E-01 1.280 1.280 2.66E-03 1.160 1.160 1.69E-01 1.266 1.266 5.51E-02 1.408 1.408 7.00E-05 1.696 1.696 1.09E-10 LOC795393 1377 2b wu:fb82f09 Wu:fb82f09 Dr.77559 323130 0.859 -1.164 2.30E-01 1.181 1.181 2.67E-01 1.010 1.010 9.39E-01 1.347 1.347 1.04E-02 1.548 1.548 3.27E-06 1.965 1.965 5.44E-09 Transcription elongation 1378 2b tcea2 Dr.85125 393961 0.840 -1.191 2.93E-01 1.156 1.156 2.93E-01 1.040 1.040 7.23E-01 1.392 1.392 3.80E-04 1.522 1.522 7.00E-05 1.760 1.760 4.53E-07 factor A (SII), 2 1379 2b her11 Hairy-related 11 Dr.84178 445409 0.818 -1.223 3.17E-01 1.074 1.074 7.64E-01 0.978 -1.022 8.75E-01 1.731 1.731 2.16E-03 1.763 1.763 1.21E-02 2.591 2.591 5.00E-05 Hypothetical protein 1380 2b LOC555433 Dr.89273 555433 0.799 -1.252 1.64E-01 1.220 1.220 2.02E-01 0.968 -1.033 7.29E-01 1.173 1.173 3.71E-01 1.579 1.579 4.07E-03 1.653 1.653 9.46E-07 LOC555433 1381 2b si:dkey-30c15.13 Si:dkey-30c15.13 Dr.119059 558731 0.880 -1.137 4.65E-01 1.098 1.098 5.93E-01 1.021 1.021 8.85E-01 1.018 1.018 9.21E-01 1.240 1.240 1.01E-01 1.555 1.555 7.52E-07 1382 2b Dr.131746 Transcribed locus Dr.131746 0.873 -1.145 3.25E-01 1.191 1.191 7.37E-02 0.990 -1.010 9.27E-01 1.037 1.037 7.97E-01 1.304 1.304 1.58E-02 1.739 1.739 2.62E-11 1383 2b zgc:110676 Zgc:110676 Dr.75438 550571 0.821 -1.218 9.31E-02 1.096 1.096 4.37E-01 0.997 -1.003 9.78E-01 1.076 1.076 5.08E-01 1.349 1.349 1.22E-03 1.522 1.522 1.90E-08 1384 2b zgc:64090 Zgc:64090 Dr.97367 393383 0.789 -1.267 7.06E-02 1.158 1.158 1.80E-01 1.020 1.020 8.70E-01 1.048 1.048 7.77E-01 1.372 1.372 1.37E-02 1.751 1.751 5.71E-19 Hypothetical protein 1385 2b LOC799395 Dr.29970 799395 0.841 -1.188 2.21E-01 1.225 1.225 1.24E-01 1.045 1.045 5.53E-01 1.048 1.048 6.81E-01 1.203 1.203 3.82E-02 1.537 1.537 7.70E-10 LOC799395 1386 2b im:7148034 Im:7148034 Dr.41107 553066 0.547 -1.829 3.47E-01 1.434 1.434 3.08E-01 1.024 1.024 9.54E-01 1.213 1.213 6.33E-01 1.513 1.513 2.50E-01 3.721 3.721 8.51E-07 Similar to crystallin gamma 1387 2b LOC797787 Dr.104305 797787 1.065 1.065 8.60E-01 1.470 1.470 4.65E-02 1.026 1.026 8.48E-01 1.035 1.035 8.55E-01 1.902 1.902 2.19E-06 1.537 1.537 1.65E-03 EM2-7 1388 2b wu:fi32b04 Wu:fi32b04 Dr.132168 494042 0.981 -1.019 9.05E-01 1.270 1.270 7.68E-02 1.161 1.161 3.13E-01 1.060 1.060 5.94E-01 1.715 1.715 1.00E-05 1.455 1.455 1.31E-02 1389 2b wu:fb37a10 Wu:fb37a10 Dr.11310 321850 0.831 -1.203 5.01E-01 1.284 1.284 6.38E-02 1.310 1.310 1.76E-01 1.262 1.262 2.51E-01 2.462 2.462 4.44E-30 1.694 1.694 2.58E-03 1390 2b exosc8 Exosome component 8 Dr.116761 323016 0.899 -1.112 2.06E-02 1.158 1.158 2.49E-01 1.268 1.268 2.48E-03 1.161 1.161 6.09E-02 1.576 1.576 1.26E-08 1.456 1.456 2.00E-05 RAB32, member RAS 1391 2b rab32 Dr.119612 378969 0.882 -1.133 3.68E-01 1.267 1.267 2.82E-03 1.157 1.157 1.17E-01 1.194 1.194 1.10E-01 2.072 2.072 2.00E-05 1.851 1.851 1.20E-04 oncogene family Similar to kainate receptor 1392 2b LOC571720 Dr.3211 571720 0.826 -1.211 5.80E-01 1.285 1.285 2.92E-01 1.204 1.204 2.15E-01 1.253 1.253 1.77E-01 2.206 2.206 1.91E-17 1.862 1.862 2.75E-10 alpha subunit Coiled-coil domain 1393 2b ccdc43 Dr.85117 393631 0.885 -1.130 2.84E-01 1.219 1.219 5.92E-02 1.114 1.114 3.35E-01 1.118 1.118 4.31E-01 1.684 1.684 1.30E-14 1.507 1.507 1.18E-11 containing 43 1394 2b Dr.126130 Transcribed locus Dr.126130 0.722 -1.384 1.27E-01 1.346 1.346 1.04E-01 1.140 1.140 5.22E-01 1.284 1.284 2.89E-01 2.376 2.376 1.37E-06 2.077 2.077 7.00E-05 1395 2b wu:fk36h04 Wu:fk36h04 Dr.23134 336972 0.848 -1.180 3.64E-01 1.227 1.227 2.56E-01 1.098 1.098 5.07E-01 1.193 1.193 1.72E-01 1.770 1.770 4.00E-05 1.688 1.688 1.95E-07 1396 2b Dr.13481 Transcribed locus Dr.13481 0.950 -1.053 6.25E-01 1.269 1.269 7.30E-04 1.173 1.173 3.09E-02 1.199 1.199 2.00E-05 1.924 1.924 9.61E-09 1.751 1.751 1.35E-08 1397 2b wu:fa92h11 Wu:fa92h11 Dr.132222 336700 0.875 -1.143 4.15E-01 1.346 1.346 2.15E-02 1.104 1.104 3.00E-01 1.198 1.198 2.05E-01 1.508 1.508 9.57E-08 1.334 1.334 5.07E-02 1398 2b zgc:76951 Zgc:76951 Dr.79424 325410 0.774 -1.291 1.22E-01 1.355 1.355 1.56E-02 1.196 1.196 2.86E-01 1.278 1.278 1.50E-01 1.780 1.780 5.00E-05 1.532 1.532 1.08E-03 1399 2b Dr.122020 Transcribed locus Dr.122020 0.807 -1.240 3.01E-01 1.730 1.730 3.93E-03 1.322 1.322 3.58E-01 1.223 1.223 4.73E-01 2.335 2.335 3.10E-04 2.595 2.595 2.41E-06 1400 2b Dr.132918 Transcribed locus Dr.132918 0.782 -1.279 3.15E-01 2.201 2.201 8.80E-04 1.434 1.434 3.84E-01 1.282 1.282 4.97E-01 3.077 3.077 3.90E-04 3.186 3.186 3.00E-05 1401 2b Dr.134773 Transcribed locus Dr.134773 0.817 -1.223 3.20E-01 2.017 2.017 1.70E-04 1.474 1.474 3.36E-01 1.347 1.347 3.78E-01 2.568 2.568 1.20E-03 2.996 2.996 8.07E-08 1402 2b Dr.83994 Transcribed locus Dr.83994 0.900 -1.111 6.19E-01 1.894 1.894 5.00E-05 1.330 1.330 4.46E-01 1.247 1.247 5.12E-01 2.467 2.467 7.00E-05 2.237 2.237 6.00E-05 1403 2b Dr.124864 Transcribed locus Dr.124864 1.019 1.019 8.99E-01 1.793 1.793 9.34E-06 1.475 1.475 1.57E-01 1.253 1.253 2.68E-01 2.041 2.041 2.50E-04 2.094 2.094 1.40E-07 1404 2b Dr.140087 Transcribed locus Dr.140087 0.919 -1.088 6.28E-01 2.086 2.086 8.00E-05 1.443 1.443 3.22E-01 1.326 1.326 3.90E-01 2.050 2.050 4.33E-03 2.165 2.165 4.00E-05 1405 2b Dr.123324 Transcribed locus Dr.123324 0.789 -1.267 1.63E-01 1.665 1.665 1.36E-03 1.370 1.370 1.23E-01 1.123 1.123 5.40E-01 2.031 2.031 3.00E-05 1.517 1.517 2.28E-02
Transcribed locus, weakly similar to NP_039499.1 c 1406 2b Dr.140627 oxidase 1 Dr.140627 0.899 -1.112 6.79E-01 1.425 1.425 1.28E-01 1.426 1.426 4.44E-02 0.978 -1.022 9.12E-01 2.191 2.191 2.43E-08 1.478 1.478 3.60E-02 [Schizosaccharomyces pombe]
1407 2b Dr.17702 Transcribed locus Dr.17702 0.840 -1.190 1.31E-01 1.236 1.236 5.73E-02 1.228 1.228 8.07E-02 1.047 1.047 7.45E-01 1.818 1.818 1.95E-19 1.303 1.303 2.45E-02 Chemokine (C-X-C motif) 1408 2b cxcr7b Dr.114187 561050 0.733 -1.364 1.07E-01 1.229 1.229 3.09E-02 1.410 1.410 1.38E-02 1.103 1.103 5.54E-01 1.700 1.700 1.40E-04 2.026 2.026 2.42E-09 receptor 7b 1409 2b Dr.131719 Transcribed locus Dr.131719 0.829 -1.206 3.97E-01 1.193 1.193 1.73E-01 1.376 1.376 1.62E-02 1.082 1.082 6.25E-01 1.686 1.686 3.00E-05 1.685 1.685 3.45E-03
Transcribed locus, weakly similar to NP_065708.1 1410 2b Dr.125824 Dr.125824 0.785 -1.274 1.85E-01 1.344 1.344 3.36E-03 1.545 1.545 1.00E-05 1.072 1.072 6.86E-01 1.696 1.696 7.90E-04 1.683 1.683 1.76E-02 finger protein 304 [Homo sapiens]
1411 2b wu:fa20b10 Wu:fa20b10 Dr.135679 327042 0.727 -1.376 4.69E-02 1.125 1.125 2.72E-01 1.462 1.462 6.57E-03 1.049 1.049 7.62E-01 1.375 1.375 1.71E-02 1.538 1.538 6.23E-06 1412 2b zgc:162266 Zgc:162266 Dr.79929 100037322 0.662 -1.510 2.43E-02 1.220 1.220 1.72E-01 1.685 1.685 6.02E-03 1.210 1.210 4.45E-01 1.542 1.542 6.62E-03 1.795 1.795 2.60E-08 1413 2b zgc:100952 Zgc:100952 Dr.114908 445324 0.739 -1.354 2.89E-01 1.340 1.340 1.53E-01 1.446 1.446 2.70E-02 1.480 1.480 1.29E-02 1.566 1.566 3.28E-03 1.975 1.975 2.02E-17 1414 2b LOC566323 Hypothetical LOC566323 Dr.118057 566323 0.684 -1.462 3.15E-01 1.556 1.556 2.71E-02 1.880 1.880 3.41E-03 1.650 1.650 2.31E-02 1.995 1.995 1.05E-03 2.470 2.470 8.61E-09 Similar to N- 1415 2b LOC570932 Dr.115914 570932 0.703 -1.423 1.49E-01 1.493 1.493 8.51E-02 1.409 1.409 6.69E-02 1.513 1.513 2.78E-03 1.573 1.573 7.82E-03 1.936 1.936 7.00E-05 acetylglucosamine kinase
Transcribed locus, strongly similar to XP_699270.2 1416 2b Dr.126272 Dr.126272 0.633 -1.579 1.02E-01 1.265 1.265 3.50E-01 1.811 1.811 2.44E-02 1.445 1.445 1.70E-01 1.792 1.792 4.59E-03 2.410 2.410 5.50E-13 similar to synapsin Ia [Danio rerio] 1417 2b Dr.122277 Transcribed locus Dr.122277 0.873 -1.145 2.83E-01 1.223 1.223 1.05E-01 1.427 1.427 3.28E-02 1.197 1.197 3.05E-01 1.443 1.443 5.51E-03 1.549 1.549 1.00E-05 1418 2b zgc:101621 Zgc:101621 Dr.120445 450073 0.646 -1.547 9.67E-03 1.443 1.443 3.16E-02 1.373 1.373 1.24E-02 1.273 1.273 1.64E-01 1.495 1.495 1.71E-02 2.066 2.066 4.82E-27 1419 2b LOC563976 Hypothetical LOC563976 Dr.88627 563976 0.424 -2.360 7.90E-03 2.800 2.800 4.66E-07 1.916 1.916 3.54E-02 1.832 1.832 6.28E-02 2.788 2.788 4.75E-03 3.279 3.279 7.40E-04 1420 2b Dr.129741 Transcribed locus Dr.129741 0.668 -1.496 8.63E-02 1.760 1.760 3.41E-03 1.772 1.772 8.90E-04 2.301 2.301 1.25E-06 2.064 2.064 3.38E-03 3.090 3.090 3.54E-07 1421 2b wu:fc22a10 Wu:fc22a10 Dr.78495 324222 0.777 -1.287 3.31E-01 1.512 1.512 4.68E-02 1.305 1.305 3.71E-02 1.656 1.656 1.16E-08 1.449 1.449 3.69E-02 2.028 2.028 1.96E-33 1422 2b wu:fb14g06 Wu:fb14g06 Dr.76652 336604 0.827 -1.210 2.20E-01 1.412 1.412 1.70E-03 1.206 1.206 4.05E-01 1.515 1.515 7.09E-02 1.431 1.431 1.43E-03 1.619 1.619 8.00E-05 CAMP responsive element 1423 2b creb3l3 Dr.79921 406853 0.965 -1.037 5.49E-01 1.278 1.278 3.80E-06 1.230 1.230 1.69E-06 1.347 1.347 6.76E-33 1.256 1.256 3.21E-06 1.660 1.660 1.26E-13 binding protein 3-like 3 1424 2b Dr.82632 Transcribed locus Dr.82632 1.052 1.052 6.65E-01 1.397 1.397 2.60E-06 1.258 1.258 5.40E-04 1.415 1.415 5.26E-07 1.491 1.491 1.87E-03 1.957 1.957 1.30E-18
Solute carrier family 2 1425 2b slc2a8l (facilitated glucose Dr.82374 373140 0.915 -1.093 6.46E-01 1.469 1.469 1.39E-02 1.495 1.495 3.35E-03 1.431 1.431 8.79E-03 1.613 1.613 7.30E-03 2.155 2.155 1.49E-32 transporter), member 8-like
1426 2b Dr.89757 Transcribed locus Dr.89757 0.853 -1.173 6.56E-01 2.150 2.150 4.76E-20 2.523 2.523 1.00E-05 2.995 2.995 1.71E-07 4.423 4.423 2.78E-19 7.866 7.866 2.23E-11 1427 2b Dr.86565 Transcribed locus Dr.86565 0.859 -1.164 2.60E-01 1.273 1.273 2.21E-01 1.445 1.445 2.19E-01 1.449 1.449 1.69E-01 1.585 1.585 2.98E-03 2.355 2.355 1.12E-07 1428 2b zgc:77033 Zgc:77033 Dr.23613 406598 1.126 1.126 1.91E-01 1.617 1.617 6.84E-09 1.350 1.350 1.00E-05 1.909 1.909 1.92E-11 1.688 1.688 1.00E-05 1.840 1.840 2.14E-06 1429 2b si:dkeyp-55f12.4 Si:dkeyp-55f12.4 Dr.76408 619265 1.015 1.015 8.92E-01 1.412 1.412 1.19E-03 1.432 1.432 3.64E-03 1.446 1.446 2.81E-03 1.417 1.417 1.89E-03 1.669 1.669 1.43E-14 1430 2b LOC557286 Hypothetical LOC557286 Dr.76446 557286 1.007 1.007 9.69E-01 1.916 1.916 1.69E-07 1.284 1.284 4.35E-02 1.514 1.514 2.35E-12 1.650 1.650 2.10E-03 2.023 2.023 1.00E-05 1431 2b im:7151270 Im:7151270 Dr.91068 492704 0.959 -1.043 8.72E-01 1.613 1.613 1.94E-02 1.368 1.368 2.05E-02 1.353 1.353 2.44E-02 1.485 1.485 6.98E-03 1.677 1.677 1.60E-08 1432 2b LOC797351 Similar to Krt5 protein Dr.120340 797351 0.585 -1.709 1.21E-07 1.190 1.190 5.50E-02 1.013 1.013 9.32E-01 1.400 1.400 2.00E-02 1.915 1.915 2.14E-08 1.326 1.326 2.66E-01 1433 2b Dr.135158 Transcribed locus Dr.135158 0.660 -1.515 2.47E-02 1.029 1.029 8.76E-01 1.297 1.297 1.09E-01 1.627 1.627 1.49E-06 1.543 1.543 8.00E-05 1.238 1.238 1.31E-01 1434 2b wu:fc89f07 Wu:fc89f07 Dr.79597 325583 0.607 -1.647 2.16E-02 1.061 1.061 5.77E-01 1.368 1.368 3.38E-02 1.819 1.819 2.17E-14 1.571 1.571 1.70E-03 1.320 1.320 4.77E-02 1435 2b Dr.122810 Transcribed locus Dr.122810 0.854 -1.172 2.10E-01 1.121 1.121 2.84E-01 1.150 1.150 3.90E-01 1.430 1.430 1.20E-04 1.919 1.919 2.69E-29 1.368 1.368 1.21E-01 Stromal cell-derived factor 1436 2b sdf2l1 Dr.51929 445275 0.837 -1.194 1.28E-02 1.126 1.126 4.55E-02 1.271 1.271 2.00E-05 1.484 1.484 2.52E-24 1.955 1.955 2.59E-14 1.345 1.345 7.08E-09 2-like 1 1437 2b Dr.132610 Transcribed locus Dr.132610 0.951 -1.051 7.54E-01 1.149 1.149 3.68E-01 1.301 1.301 8.60E-02 1.419 1.419 3.11E-03 2.224 2.224 1.12E-13 1.415 1.415 4.00E-02 1438 2b wu:fa04h11 Wu:fa04h11 Dr.34097 325495 0.840 -1.190 1.52E-01 1.173 1.173 1.03E-01 1.211 1.211 1.73E-01 1.217 1.217 1.48E-01 1.638 1.638 4.00E-05 1.187 1.187 1.39E-01 1439 2b si:ch211-244b2.4 Si:ch211-244b2.4 Dr.42682 336755 0.939 -1.065 5.57E-01 1.269 1.269 1.46E-02 1.373 1.373 2.89E-02 1.741 1.741 5.98E-06 1.686 1.686 1.08E-06 1.767 1.767 5.47E-07 1440 2b zgc:101100 Zgc:101100 Dr.90945 445169 0.884 -1.131 7.62E-02 1.175 1.175 1.77E-02 1.188 1.188 5.15E-03 1.447 1.447 4.28E-12 1.501 1.501 4.97E-14 1.394 1.394 1.61E-15 1441 2b Dr.83826 Transcribed locus Dr.83826 0.861 -1.161 5.15E-01 1.070 1.070 7.68E-01 1.262 1.262 8.20E-02 1.891 1.891 7.14E-17 1.623 1.623 1.00E-05 1.368 1.368 8.52E-02 Cellular retinoic acid 1442 2b crabp2a Dr.104443 324997 0.983 -1.017 8.70E-01 1.226 1.226 1.97E-02 1.267 1.267 3.12E-03 1.299 1.299 1.35E-03 1.612 1.612 8.25E-03 1.592 1.592 1.00E-05 binding protein 2, a Zinc finger protein 36, C3H 1443 2b zfp36l1 Dr.105582 554684 1.000 -1.000 9.96E-01 1.351 1.351 2.00E-01 1.414 1.414 3.69E-03 1.524 1.524 2.67E-03 2.069 2.069 1.99E-13 2.043 2.043 4.62E-12 type-like 1 1444 2b Dr.122993 Transcribed locus Dr.122993 0.771 -1.296 6.11E-01 1.828 1.828 2.54E-02 1.849 1.849 1.66E-02 2.043 2.043 5.32E-03 3.853 3.853 7.25E-10 3.965 3.965 8.46E-10 1445 2b zgc:92608 Zgc:92608 Dr.134016 436979 1.196 1.196 4.84E-01 2.079 2.079 5.03E-03 3.096 3.096 1.20E-07 3.514 3.514 7.21E-14 5.239 5.239 5.36E-18 4.627 4.627 8.50E-15 1446 2b LOC100002165 Similar to selenoprotein Pa Dr.9483 100002165 0.989 -1.011 9.32E-01 1.178 1.178 1.51E-01 1.316 1.316 4.42E-03 1.419 1.419 3.80E-04 1.675 1.675 1.55E-07 1.579 1.579 2.00E-05 1447 2b Dr.122410 Transcribed locus Dr.122410 1.198 1.198 3.69E-02 1.360 1.360 1.02E-03 1.306 1.306 5.10E-03 1.331 1.331 1.39E-02 1.776 1.776 9.02E-08 1.561 1.561 4.65E-09 Retinoic acid receptor, 1448 2b raraa Dr.193 30680 1.085 1.085 4.02E-01 1.338 1.338 3.97E-03 1.400 1.400 4.51E-03 1.439 1.439 1.07E-06 1.671 1.671 3.40E-04 1.880 1.880 5.64E-06 alpha a 1449 2b zgc:101645 Zgc:101645 Dr.30620 494099 1.087 1.087 6.14E-01 1.240 1.240 1.63E-01 1.269 1.269 8.24E-02 1.236 1.236 2.77E-02 1.543 1.543 2.60E-04 1.592 1.592 2.00E-05 1450 2b LOC792364 Similar to Cfb protein Dr.95191 792364 1.660 1.660 4.01E-02 2.354 2.354 1.70E-04 3.257 3.257 1.20E-04 2.562 2.562 1.60E-03 6.937 6.937 8.80E-11 5.762 5.762 9.82E-08 1451 2b myod Myogenic differentiation Dr.36017 30513 1.030 1.030 8.45E-01 1.246 1.246 1.18E-01 1.210 1.210 4.62E-02 1.476 1.476 1.68E-02 1.886 1.886 2.00E-05 1.512 1.512 2.00E-04 Similar to chemokine CXC- 1452 2b LOC562246 Dr.117585 562246 1.244 1.244 1.46E-02 1.309 1.309 3.52E-02 1.608 1.608 1.27E-19 1.890 1.890 1.21E-40 4.387 4.387 0.00E+00 5.337 5.337 0.00E+00 like protein 1453 2b fn1b Fibronectin 1b Dr.24233 334613 1.124 1.124 2.53E-01 1.059 1.059 5.10E-01 1.428 1.428 1.00E-05 1.510 1.510 2.26E-06 1.849 1.849 1.84E-06 2.227 2.227 2.67E-15 1454 2b zgc:65788 Zgc:65788 Dr.77223 322420 1.174 1.174 1.68E-01 1.199 1.199 1.13E-02 2.506 2.506 1.09E-35 2.692 2.692 6.74E-12 5.062 5.062 0.00E+00 9.948 9.948 1.97E-31 A disintegrin and 1455 2b adam8 metalloproteinase domain Dr.86401 368917 1.121 1.121 1.12E-01 1.231 1.231 2.42E-03 1.398 1.398 3.68E-25 1.606 1.606 0.00E+00 1.965 1.965 0.00E+00 2.643 2.643 0.00E+00 8 1456 2b Dr.122080 Transcribed locus Dr.122080 1.195 1.195 1.83E-01 1.420 1.420 8.68E-03 2.382 2.382 1.10E-14 2.562 2.562 1.93E-17 4.697 4.697 6.79E-33 4.744 4.744 7.02E-39 1457 2b cfb Complement factor B Dr.75096 30604 1.218 1.218 9.20E-04 1.136 1.136 5.45E-03 1.686 1.686 1.91E-20 1.594 1.594 1.20E-11 2.212 2.212 2.17E-07 2.201 2.201 3.32E-09 1458 2b si:dkey-253d23.1 Si:dkey-253d23.1 Dr.4570 386996 1.003 1.003 9.70E-01 1.082 1.082 4.55E-01 1.232 1.232 1.25E-01 1.209 1.209 1.51E-01 1.559 1.559 7.13E-06 1.575 1.575 9.11E-07 1459 2b Dr.84436 Transcribed locus Dr.84436 0.937 -1.067 8.20E-01 1.088 1.088 7.40E-01 1.361 1.361 1.12E-03 1.334 1.334 5.28E-02 1.847 1.847 2.76E-03 1.894 1.894 3.05E-08 1460 2b Dr.67299 Transcribed locus Dr.67299 0.927 -1.079 7.30E-01 1.091 1.091 6.95E-01 1.280 1.280 1.71E-01 1.414 1.414 6.49E-03 1.903 1.903 1.22E-17 2.071 2.071 2.48E-29 NudE nuclear distribution 1461 2b ndel1b gene E homolog like 1 (A. Dr.7294 333957 0.951 -1.052 6.66E-01 1.074 1.074 5.87E-01 1.136 1.136 3.44E-01 1.272 1.272 1.09E-01 1.629 1.629 1.20E-06 1.621 1.621 2.49E-03 nidulans) B Tumor necrosis factor 1462 2b tnfsf10l2 (ligand) superfamily, Dr.86839 436866 1.161 1.161 2.91E-01 1.023 1.023 8.76E-01 1.284 1.284 1.05E-01 1.685 1.685 7.00E-05 2.106 2.106 1.18E-30 1.876 1.876 6.07E-07 member 10 like 2 1463 2b Dr.108104 Transcribed locus Dr.108104 0.935 -1.069 6.60E-01 0.992 -1.008 9.59E-01 1.683 1.683 1.07E-02 1.550 1.550 3.28E-02 1.889 1.889 9.00E-05 1.960 1.960 1.03E-12 Proteasome (prosome, 1464 2b psma6b macropain) subunit, alpha Dr.82172 83917 0.801 -1.249 3.47E-03 0.897 -1.114 3.31E-01 2.379 2.379 2.37E-22 2.039 2.039 4.87E-21 2.584 2.584 2.19E-14 3.041 3.041 6.19E-31 type, 6b 1465 2b Dr.18912 Transcribed locus Dr.18912 0.802 -1.246 3.43E-01 1.021 1.021 8.97E-01 1.887 1.887 8.79E-07 2.031 2.031 5.02E-09 2.488 2.488 2.27E-08 2.917 2.917 4.21E-09 ATP-binding cassette, sub- 1466 2b abcb3 family B (MDR/TAP), Dr.88570 368771 0.689 -1.451 3.62E-01 0.979 -1.021 9.07E-01 4.488 4.488 3.45E-09 4.110 4.110 1.49E-25 7.622 7.622 2.45E-39 12.152 12.152 2.80E-45 member 3 Similar to complement C4- 1467 2b LOC562579 Dr.12491 562579 1.060 1.060 2.84E-01 1.007 1.007 9.18E-01 1.495 1.495 1.13E-03 1.433 1.433 7.00E-05 2.048 2.048 8.08E-06 2.001 2.001 7.00E-05 2 Proteasome activator 1468 2b psme1 Dr.81309 30648 0.985 -1.015 8.87E-01 0.965 -1.036 7.84E-01 2.913 2.913 0.00E+00 2.945 2.945 0.00E+00 5.553 5.553 3.47E-25 5.551 5.551 0.00E+00 subunit 1 1469 2b zgc:153267 Zgc:153267 Dr.89419 767684 0.935 -1.070 7.74E-01 0.834 -1.200 3.44E-01 1.904 1.904 8.59E-18 1.974 1.974 2.11E-06 2.987 2.987 3.26E-11 2.615 2.615 3.71E-18 1470 2b mvp Major vault protein Dr.114231 373081 0.986 -1.014 8.42E-01 0.951 -1.051 4.15E-01 1.219 1.219 2.92E-02 1.296 1.296 1.91E-03 1.474 1.474 2.30E-04 1.696 1.696 1.00E-05 Protein kinase, cGMP- 1471 2b prkg1 Dr.26605 394005 0.991 -1.009 9.11E-01 0.964 -1.038 7.16E-01 1.363 1.363 4.67E-02 1.477 1.477 2.70E-04 1.782 1.782 6.00E-05 2.042 2.042 4.00E-05 dependent, type I 1472 2b Dr.110766 Transcribed locus Dr.110766 0.837 -1.194 6.95E-01 1.065 1.065 8.87E-01 2.131 2.131 7.76E-02 3.420 3.420 4.53E-28 3.221 3.221 1.46E-07 6.804 6.804 1.46E-20 Similar to Solute carrier 1473 2b LOC100000090 Dr.79853 100000090 0.908 -1.102 4.71E-01 0.974 -1.027 8.45E-01 1.230 1.230 3.79E-02 1.424 1.424 3.20E-04 1.411 1.411 1.00E-05 1.694 1.694 6.53E-11 family 20, member 1a 1474 2b tpsn Tapasin Dr.132863 30163 0.959 -1.043 5.57E-01 0.973 -1.028 5.89E-01 1.366 1.366 9.01E-11 1.539 1.539 4.33E-09 1.460 1.460 1.32E-03 1.790 1.790 4.00E-05 Invariant chain-like protein 1475 2b iclp1 Dr.7740 58113 0.939 -1.065 6.52E-01 0.862 -1.160 1.38E-01 1.679 1.679 5.80E-03 2.233 2.233 1.00E-05 2.091 2.091 6.62E-19 3.133 3.133 7.78E-09 1 Solute carrier family 20, 1476 2b slc20a1a Dr.116243 406458 0.940 -1.064 2.39E-01 1.017 1.017 7.99E-01 1.257 1.257 3.25E-06 1.403 1.403 4.09E-07 1.274 1.274 2.50E-04 1.677 1.677 3.17E-08 member 1a 1477 2b zgc:103580 Zgc:103580 Dr.13131 449557 0.749 -1.335 5.32E-01 0.873 -1.145 7.94E-01 3.624 3.624 6.00E-04 4.431 4.431 1.90E-08 3.562 3.562 7.86E-03 10.341 10.341 3.41E-11 1478 2b LOC563410 Hypothetical LOC563410 Dr.121431 563410 1.053 1.053 5.48E-01 1.024 1.024 7.56E-01 1.240 1.240 7.17E-03 1.325 1.325 3.91E-03 1.302 1.302 2.45E-03 1.533 1.533 1.69E-07 1479 2b Dr.133119 Transcribed locus Dr.133119 1.009 1.009 9.13E-01 1.120 1.120 1.88E-01 1.651 1.651 2.19E-06 1.927 1.927 1.42E-06 1.833 1.833 4.30E-10 2.630 2.630 5.46E-21 1480 2b wu:fb60c02 Wu:fb60c02 Dr.77169 322409 1.000 1.000 9.99E-01 0.997 -1.003 9.88E-01 2.700 2.700 1.88E-11 3.106 3.106 1.34E-20 2.978 2.978 4.00E-05 5.990 5.990 4.79E-10
Similar to Poly [ADP- ribose] polymerase 14 1481 2b LOC799434 Dr.40164 799434 1.016 1.016 9.39E-01 1.004 1.004 9.86E-01 1.372 1.372 2.30E-04 1.596 1.596 1.83E-06 1.623 1.623 4.17E-02 2.250 2.250 2.90E-04 (PARP-14) (B aggressive lymphoma protein 2)
1482 2b jak1 Janus kinase 1 Dr.74470 30280 1.037 1.037 6.69E-01 1.070 1.070 3.75E-01 1.259 1.259 9.71E-08 1.411 1.411 8.80E-04 1.434 1.434 6.00E-05 1.784 1.784 2.55E-14 Similar to CC chemokine 1483 2b CH211-89F7.4 Dr.133987 794891 1.010 1.010 8.95E-01 1.056 1.056 6.28E-01 2.392 2.392 2.14E-16 2.522 2.522 5.40E-20 2.670 2.670 2.94E-09 6.831 6.831 0.00E+00 SCYA106 Similar to VHSV-induced 1484 2b LOC100003425 Dr.116650 100003425 1.282 1.282 1.09E-02 0.897 -1.115 4.39E-01 1.816 1.816 1.49E-03 2.354 2.354 1.38E-06 2.232 2.232 5.69E-08 3.077 3.077 1.90E-10 protein-10 1485 2b si:dkey-177p2.16 Si:dkey-177p2.16 Dr.132056 325997 1.097 1.097 4.42E-01 0.979 -1.021 8.08E-01 1.365 1.365 1.26E-03 1.494 1.494 4.80E-04 1.374 1.374 1.00E-05 1.547 1.547 9.25E-07 Similar to PHD finger 1486 2b LOC569187 Dr.83423 569187 1.092 1.092 7.10E-01 0.983 -1.017 8.83E-01 2.363 2.363 6.24E-12 2.479 2.479 4.78E-07 2.353 2.353 3.70E-04 3.462 3.462 6.00E-05 protein 6 1487 2b LOC560532 Hypothetical LOC560532 Dr.17331 560532 1.046 1.046 7.58E-01 0.988 -1.012 9.43E-01 2.335 2.335 1.01E-07 2.264 2.264 1.25E-13 2.647 2.647 5.61E-18 2.770 2.770 1.94E-18
Serpin peptidase inhibitor, 1488 2b serpinb1l1 clade B (ovalbumin), Dr.82062 494155 1.271 1.271 2.79E-01 0.954 -1.048 8.53E-01 3.017 3.017 5.44E-11 2.426 2.426 7.61E-08 3.282 3.282 1.71E-24 3.348 3.348 1.45E-28 member 1, like 1
Similar to caspase 1489 2b LOC571448 Dr.84556 571448 1.142 1.142 4.93E-01 1.033 1.033 8.72E-01 1.455 1.455 7.70E-04 1.431 1.431 7.00E-04 1.510 1.510 7.00E-05 1.479 1.479 2.84E-06 recruitment domain protein
Proteasome activator 1490 2b psme2 Dr.76266 30647 1.152 1.152 3.57E-01 0.695 -1.438 3.20E-03 2.874 2.874 8.18E-08 2.626 2.626 1.04E-07 3.153 3.153 2.67E-06 3.660 3.660 6.11E-07 subunit 2 N-myc (and STAT) 1491 2b nmi Dr.80228 335331 1.020 1.020 9.08E-01 0.729 -1.371 2.60E-02 2.150 2.150 5.10E-07 2.056 2.056 1.25E-06 2.211 2.211 2.90E-22 2.611 2.611 6.18E-31 interactor Hypothetical protein 1492 2b LOC100000643 Dr.84913 100000643 0.900 -1.111 5.56E-01 0.811 -1.232 2.11E-01 2.058 2.058 4.32E-18 2.154 2.154 4.18E-21 2.119 2.119 3.41E-20 2.560 2.560 0.00E+00 LOC100000643 1493 2b hm:zeh0225r Hm:zeh0225r Dr.107618 503823 1.109 1.109 2.15E-01 1.156 1.156 8.22E-02 1.303 1.303 3.40E-08 1.461 1.461 2.24E-06 1.218 1.218 1.00E-04 1.527 1.527 1.16E-08 Myxovirus (influenza virus) 1494 2b mxc Dr.26920 360145 1.841 1.841 1.79E-01 2.514 2.514 5.41E-06 3.532 3.532 1.74E-02 5.097 5.097 6.92E-03 2.935 2.935 7.20E-04 6.706 6.706 2.00E-05 resistance C Gonadotropin-releasing 1495 2b gnrh2 Dr.84757 353222 1.673 1.673 2.79E-03 2.018 2.018 4.60E-20 2.525 2.525 1.40E-45 3.497 3.497 3.43E-35 1.989 1.989 1.40E-39 6.429 6.429 0.00E+00 hormone 2 1496 2b zgc:85914 Zgc:85914 Dr.27758 406471 1.257 1.257 1.37E-02 1.402 1.402 8.70E-04 1.344 1.344 2.66E-03 1.843 1.843 1.10E-06 1.382 1.382 1.62E-02 1.835 1.835 5.00E-04 1497 2b Dr.133240 Transcribed locus Dr.133240 1.012 1.012 9.17E-01 1.242 1.242 3.53E-02 1.235 1.235 5.71E-03 1.486 1.486 6.31E-07 1.217 1.217 1.45E-01 1.526 1.526 2.00E-05 1498 2b aspn Asporin (LRR class 1) Dr.81771 65228 1.049 1.049 6.19E-01 1.253 1.253 9.32E-02 1.506 1.506 4.33E-09 1.774 1.774 3.42E-13 1.595 1.595 7.15E-08 2.227 2.227 1.65E-11 1499 2b LOC567537 Similar to interleukin-8 Dr.111760 567537 1.269 1.269 2.29E-02 1.421 1.421 5.43E-08 2.292 2.292 0.00E+00 2.217 2.217 3.30E-42 1.846 1.846 2.30E-12 3.049 3.049 0.00E+00 Similar to LOC495244 1500 2b LOC798623 Dr.79926 798623 2.233 2.233 6.83E-03 2.126 2.126 8.60E-03 5.933 5.933 4.39E-08 7.638 7.638 4.95E-13 4.465 4.465 1.74E-10 8.290 8.290 2.99E-19 protein 1501 2b wu:fb10a09 Wu:fb10a09 Dr.51646 336418 1.183 1.183 3.16E-02 1.230 1.230 3.60E-04 2.917 2.917 1.20E-30 3.118 3.118 0.00E+00 2.413 2.413 8.46E-39 3.977 3.977 1.30E-43 BH3 interacting domain 1502 2b bida Dr.84878 559425 1.082 1.082 5.57E-01 1.100 1.100 4.99E-01 1.377 1.377 5.07E-02 1.492 1.492 3.11E-03 1.382 1.382 1.06E-03 1.569 1.569 1.79E-09 death agonist 1503 2b zgc:123218 Zgc:123218 Dr.86778 641321 1.613 1.613 1.35E-06 1.197 1.197 2.86E-02 2.278 2.278 6.88E-11 2.629 2.629 5.13E-24 2.025 2.025 1.65E-16 3.520 3.520 0.00E+00 1504 2b LOC556826 Similar to TAP2 protein Dr.96241 556826 1.238 1.238 3.38E-02 1.144 1.144 1.79E-01 1.523 1.523 2.75E-03 2.074 2.074 3.04E-07 1.648 1.648 1.56E-06 1.956 1.956 6.93E-22 1505 2b wu:fb39d01 Wu:fb39d01 Dr.76365 321959 1.102 1.102 3.48E-01 1.079 1.079 3.88E-01 1.359 1.359 2.67E-02 1.294 1.294 4.35E-02 1.097 1.097 3.87E-01 1.556 1.556 3.00E-05 1506 2b Dr.83420 Transcribed locus Dr.83420 1.364 1.364 2.67E-01 1.241 1.241 6.01E-01 1.536 1.536 8.60E-04 2.433 2.433 7.93E-26 1.244 1.244 2.69E-02 2.593 2.593 4.69E-09 1507 2b si:dkeyp-59a8.2 Si:dkeyp-59a8.2 Dr.84529 563208 1.593 1.593 1.06E-01 1.359 1.359 2.06E-01 2.101 2.101 4.72E-11 2.921 2.921 3.41E-12 1.320 1.320 1.25E-01 2.724 2.724 1.71E-09 Similar to MGC115642 1508 2b LOC565650 Dr.27020 565650 1.253 1.253 5.95E-01 1.167 1.167 7.26E-01 3.297 3.297 4.63E-03 6.565 6.565 5.58E-09 2.506 2.506 1.04E-03 9.761 9.761 1.36E-18 protein 1509 2b Dr.84630 Transcribed locus Dr.84630 0.923 -1.083 5.23E-01 0.970 -1.031 6.46E-01 1.418 1.418 2.00E-05 1.745 1.745 1.22E-11 1.200 1.200 3.81E-01 1.960 1.960 1.48E-03 Similar to complement 1510 2b LOC792472 Dr.119903 792472 1.895 1.895 9.27E-03 1.239 1.239 3.68E-01 2.706 2.706 5.07E-23 2.126 2.126 1.10E-07 2.193 2.193 8.44E-15 2.373 2.373 3.45E-10 factor B/C2-A3 1511 2b sb:cb26 Sb:cb26 Dr.77174 321046 1.340 1.340 4.70E-03 1.106 1.106 2.25E-01 1.803 1.803 4.99E-15 1.487 1.487 5.79E-14 1.735 1.735 4.60E-04 1.673 1.673 1.18E-06 Complement component 1512 2b c3b Dr.21006 30491 1.498 1.498 1.26E-02 1.364 1.364 1.92E-02 2.147 2.147 8.96E-08 1.848 1.848 2.00E-05 2.083 2.083 3.38E-02 2.311 2.311 2.38E-03 c3b Hypothetical protein 1513 2b LOC100004989 Dr.80969 100004989 1.217 1.217 1.88E-01 1.237 1.237 1.63E-01 1.754 1.754 1.31E-15 1.780 1.780 5.94E-08 1.897 1.897 8.53E-09 1.571 1.571 5.68E-12 LOC100004989 1514 2b wu:fb66c11 Wu:fb66c11 Dr.105221 322582 0.491 -2.036 4.70E-02 0.552 -1.810 1.73E-01 11.395 11.395 6.45E-11 11.361 11.361 2.30E-07 6.207 6.207 1.38E-08 9.959 9.959 4.00E-05 1515 2b Dr.107926 Transcribed locus Dr.107926 0.641 -1.560 3.30E-01 0.930 -1.075 8.69E-01 2.672 2.672 6.00E-05 3.794 3.794 2.44E-16 2.877 2.877 5.12E-17 4.116 4.116 1.68E-12 1516 2b env Envelope protein Dr.132764 402813 0.816 -1.226 4.35E-01 0.903 -1.107 7.06E-01 1.452 1.452 6.78E-03 1.648 1.648 8.17E-07 1.515 1.515 4.57E-16 1.630 1.630 5.29E-03 1517 2b zgc:113045 Zgc:113045 Dr.41669 664768 0.647 -1.545 1.11E-01 0.767 -1.303 1.00E-01 1.915 1.915 8.22E-03 2.175 2.175 2.00E-05 1.851 1.851 7.26E-02 2.354 2.354 1.12E-02 Guanylate cyclase 1518 2b guca1c Dr.81617 373099 0.813 -1.230 1.22E-01 0.936 -1.069 6.98E-01 1.455 1.455 1.51E-03 2.005 2.005 5.49E-07 1.513 1.513 3.92E-03 1.514 1.514 1.43E-06 activator 1C 1519 2b th2 Tyrosine hydroxylase 2 Dr.88913 414844 0.817 -1.224 4.74E-01 0.970 -1.031 9.24E-01 1.631 1.631 1.62E-02 1.852 1.852 1.00E-05 1.389 1.389 8.74E-02 1.544 1.544 4.24E-03 Deiodinase, iodothyronine, 1520 2b dio1 Dr.116077 352936 1.048 1.048 7.18E-01 0.914 -1.094 4.72E-01 1.300 1.300 2.00E-03 1.549 1.549 2.64E-08 1.315 1.315 7.37E-02 1.510 1.510 1.82E-02 type I
Transcribed locus, weakly similar to XP_001111465.1 1521 2b Dr.135070 similar to zinc finger CCCH- Dr.135070 0.977 -1.024 8.90E-01 0.955 -1.048 7.85E-01 1.397 1.397 2.24E-02 1.664 1.664 9.96E-08 1.401 1.401 5.20E-04 1.558 1.558 6.49E-07 type containing 12A isoform 1 [Macaca mulatta]
1522 2b Dr.128421 Transcribed locus Dr.128421 0.869 -1.150 6.33E-01 0.824 -1.214 4.96E-01 1.992 1.992 6.83E-06 2.692 2.692 4.67E-36 1.591 1.591 2.00E-05 2.194 2.194 1.71E-07 Similar to interferon- 1523 2b LOC566020 Dr.83480 566020 0.867 -1.153 2.99E-01 0.701 -1.426 6.01E-02 1.541 1.541 6.76E-03 1.982 1.982 2.93E-03 1.407 1.407 1.33E-02 1.844 1.844 3.00E-05 inducible protein Gig2 Hypothetical protein 1524 2b LOC792613 Dr.120624 792613 0.859 -1.164 2.08E-01 0.914 -1.094 4.37E-01 1.510 1.510 1.14E-02 1.483 1.483 1.75E-02 1.714 1.714 1.37E-09 1.562 1.562 4.44E-07 LOC792613 Hypothetical protein 1525 2b LOC402857 Dr.27086 402857 0.607 -1.648 3.51E-01 0.545 -1.835 2.47E-01 13.942 13.942 0.00E+00 12.637 12.637 7.34E-35 21.061 21.061 1.63E-36 10.463 10.463 3.17E-11 LOC402857 1526 2b wu:fb11a04 Wu:fb11a04 Dr.3436 336451 0.750 -1.334 1.10E-02 0.670 -1.493 1.77E-02 1.486 1.486 9.89E-02 2.265 2.265 1.60E-02 2.659 2.659 8.00E-05 2.142 2.142 5.63E-02 1527 2b zgc:123236 Zgc:123236 Dr.110015 557480 0.866 -1.155 3.36E-01 1.209 1.209 1.08E-02 2.261 2.261 4.58E-11 2.650 2.650 1.52E-35 2.455 2.455 1.20E-09 2.739 2.739 2.68E-13 Major histocompatibility 1528 2b mhc1ufa Dr.33261 64886 0.779 -1.284 5.21E-01 1.289 1.289 5.13E-01 2.456 2.456 9.00E-04 2.098 2.098 4.80E-04 1.770 1.770 2.00E-04 2.929 2.929 1.06E-08 complex class I UFA gene
Hypothetical protein 1529 2b LOC100004573 Dr.117748 100004573 0.893 -1.119 7.97E-01 1.303 1.303 4.94E-01 4.588 4.588 3.29E-13 5.132 5.132 2.44E-43 2.273 2.273 4.44E-02 3.558 3.558 6.00E-05 LOC100004573 Similar to B-type natriuretic 1530 2b LOC568005 Dr.91651 568005 0.847 -1.181 5.92E-01 1.085 1.085 6.18E-01 2.746 2.746 1.93E-14 2.748 2.748 6.69E-28 1.747 1.747 1.04E-03 2.259 2.259 1.76E-06 peptide Odorant receptor, family 2, 1531 2b or2.4 Dr.75771 80367 1.159 1.159 6.94E-01 1.152 1.152 6.95E-01 2.789 2.789 1.03E-03 3.287 3.287 2.16E-07 1.753 1.753 1.52E-01 2.611 2.611 1.10E-02 member 4 1532 2b wu:fb63d05 Wu:fb63d05 Dr.132313 322510 0.763 -1.310 6.46E-02 0.782 -1.279 4.41E-01 6.181 6.181 5.06E-16 3.868 3.868 3.03E-10 2.120 2.120 3.77E-07 4.305 4.305 2.62E-13 1533 2b Dr.131275 Transcribed locus Dr.131275 0.879 -1.137 4.10E-01 0.879 -1.137 4.08E-01 1.560 1.560 5.19E-03 1.291 1.291 2.63E-02 1.512 1.512 1.83E-06 1.548 1.548 9.67E-03 1534 2b wu:fi37b05 Wu:fi37b05 Dr.7324 334231 0.771 -1.297 4.15E-01 0.792 -1.262 1.93E-01 2.638 2.638 1.00E-05 1.543 1.543 1.87E-01 1.968 1.968 1.02E-01 2.301 2.301 5.17E-02 1535 2b zgc:63672 Zgc:63672 Dr.86785 393416 0.602 -1.662 2.15E-01 0.615 -1.626 9.66E-02 2.444 2.444 5.96E-02 2.079 2.079 1.23E-01 1.950 1.950 3.86E-02 2.978 2.978 7.00E-05 1536 2b wu:fc08e01 Wu:fc08e01 Dr.105450 323740 0.765 -1.307 3.56E-01 0.896 -1.116 7.02E-01 1.319 1.319 5.47E-02 1.746 1.746 7.00E-05 1.390 1.390 1.99E-01 2.037 2.037 3.50E-04 1537 2b wu:fj30a12 Wu:fj30a12 Dr.80946 335619 0.857 -1.167 3.84E-01 0.935 -1.069 7.02E-01 1.227 1.227 4.69E-02 1.439 1.439 1.00E-05 1.277 1.277 8.90E-04 1.689 1.689 7.00E-05 1538 2b asns Asparagine synthetase Dr.25168 394138 0.942 -1.062 5.69E-01 0.915 -1.093 4.55E-01 1.175 1.175 6.24E-02 1.535 1.535 1.37E-03 1.330 1.330 2.59E-02 1.687 1.687 1.03E-10 1539 2b inhbaa Inhibin, beta Aa Dr.107692 30072 0.688 -1.454 7.16E-02 0.887 -1.128 3.25E-01 1.172 1.172 1.99E-01 1.549 1.549 1.62E-06 1.224 1.224 4.54E-01 2.137 2.137 8.10E-03 1540 2b Dr.83102 Transcribed locus Dr.83102 0.749 -1.335 1.63E-01 0.804 -1.243 3.02E-01 1.402 1.402 1.34E-01 1.564 1.564 6.22E-02 1.324 1.324 4.65E-02 2.328 2.328 3.19E-06 1541 2b si:dkey-80c24.6 Si:dkey-80c24.6 Dr.120873 100038765 0.710 -1.409 2.21E-01 0.972 -1.028 8.94E-01 1.785 1.785 1.55E-02 1.718 1.718 3.51E-03 1.461 1.461 9.85E-07 2.778 2.778 2.33E-28 1542 2b wu:fc91a05 Wu:fc91a05 Dr.106263 325603 0.251 -3.987 3.96E-03 1.151 1.151 6.16E-01 2.174 2.174 1.17E-01 4.498 4.498 1.99E-03 2.431 2.431 6.71E-02 4.728 4.728 9.66E-08 1543 2b im:7140576 Im:7140576 Dr.81377 449945 0.522 -1.917 2.30E-04 1.065 1.065 4.30E-01 1.462 1.462 4.14E-02 1.934 1.934 7.76E-09 1.765 1.765 7.66E-03 2.052 2.052 8.11E-03 Major histocompatibility 1544 2b mhc1uea Dr.11010 64885 0.631 -1.584 4.50E-04 1.082 1.082 5.74E-01 1.574 1.574 3.00E-04 2.055 2.055 2.51E-03 1.470 1.470 4.13E-03 2.284 2.284 2.87E-10 complex class I UEA gene
Similar to huntingtin 1545 2b LOC793823 Dr.118181 793823 0.503 -1.987 1.05E-01 1.231 1.231 2.91E-01 1.916 1.916 7.90E-03 2.781 2.781 1.97E-10 1.966 1.966 1.91E-03 3.428 3.428 1.26E-19 interacting protein 1 1546 2b wu:fb12a05 Wu:fb12a05 Dr.24997 336499 0.452 -2.213 4.74E-02 1.064 1.064 7.15E-01 1.783 1.783 7.36E-02 2.895 2.895 1.40E-04 1.946 1.946 9.42E-02 3.533 3.533 8.54E-19 Similar to B-aggressive 1547 2b LOC100005858 Dr.23573 100005858 0.766 -1.306 2.48E-02 0.997 -1.003 9.58E-01 1.333 1.333 6.50E-03 1.501 1.501 3.00E-05 1.491 1.491 1.00E-04 1.531 1.531 8.29E-03 lymphoma 3 1548 2b zgc:56417 Zgc:56417 Dr.79371 393258 0.497 -2.011 1.86E-03 1.021 1.021 8.71E-01 1.812 1.812 1.24E-02 2.132 2.132 1.35E-03 2.336 2.336 1.00E-05 2.755 2.755 0.00E+00 1549 2b im:7145101 Im:7145101 Dr.79495 553460 0.681 -1.468 3.11E-02 1.070 1.070 6.98E-01 1.381 1.381 6.02E-02 1.601 1.601 3.93E-06 1.639 1.639 9.40E-06 1.697 1.697 5.76E-12 Chromobox homolog 8 (Pc 1550 2b cbx8 Dr.81470 404038 0.716 -1.396 1.05E-02 0.991 -1.010 9.20E-01 1.213 1.213 1.59E-02 1.484 1.484 2.50E-04 1.431 1.431 6.60E-04 1.631 1.631 2.29E-08 class homolog, Drosophila)
1551 2b wu:fc46c11 Wu:fc46c11 Dr.121987 324877 0.774 -1.291 1.02E-01 1.095 1.095 5.60E-01 1.117 1.117 3.69E-01 1.585 1.585 1.89E-07 1.443 1.443 1.56E-03 1.663 1.663 8.45E-17 1552 2b Dr.23568 Transcribed locus Dr.23568 0.642 -1.559 6.88E-03 1.218 1.218 1.85E-01 1.268 1.268 7.72E-02 1.654 1.654 1.10E-06 1.603 1.603 3.00E-05 1.967 1.967 4.86E-14 1553 2b Dr.90833 Transcribed locus Dr.90833 0.663 -1.509 3.19E-02 1.161 1.161 4.40E-01 1.201 1.201 2.09E-01 1.589 1.589 3.80E-04 1.510 1.510 6.10E-04 1.805 1.805 1.35E-08 1554 2b Dr.95177 Transcribed locus Dr.95177 0.582 -1.718 1.17E-02 1.239 1.239 5.45E-02 1.368 1.368 8.93E-02 1.740 1.740 1.13E-03 1.837 1.837 5.50E-04 2.161 2.161 4.38E-07 1555 2b si:dkey-25f3.3 Si:dkey-25f3.3 Dr.83732 558800 0.748 -1.337 5.34E-02 1.166 1.166 2.81E-01 1.165 1.165 6.95E-02 1.368 1.368 2.00E-05 1.340 1.340 1.90E-03 1.682 1.682 3.61E-08 1556 2b Dr.85933 Transcribed locus Dr.85933 0.662 -1.511 1.83E-07 1.028 1.028 8.11E-01 1.057 1.057 7.48E-01 1.761 1.761 2.50E-04 1.397 1.397 5.76E-02 1.715 1.715 6.60E-06 1557 2b zgc:112094 Zgc:112094 Dr.113647 550449 0.378 -2.642 2.03E-02 0.856 -1.169 2.96E-01 2.355 2.355 9.06E-03 3.230 3.230 1.12E-06 1.748 1.748 2.21E-02 3.316 3.316 8.88E-08 Similar to Profilin family, 1558 2b LOC799214 Dr.118945 799214 0.392 -2.549 7.62E-02 0.934 -1.071 6.57E-01 2.950 2.950 3.00E-05 2.996 2.996 1.00E-02 1.726 1.726 2.24E-01 3.409 3.409 1.04E-03 member 4 1559 2b Dr.84327 Transcribed locus Dr.84327 0.559 -1.788 1.65E-01 0.901 -1.110 7.64E-01 1.939 1.939 1.44E-02 2.116 2.116 1.00E-05 1.269 1.269 4.24E-01 2.195 2.195 1.71E-06 1560 2b zgc:162095 Zgc:162095 Dr.132653 553256 0.643 -1.556 1.61E-01 1.130 1.130 6.96E-01 1.701 1.701 2.20E-04 1.767 1.767 1.01E-10 1.437 1.437 2.00E-02 1.868 1.868 3.09E-06
V-rel reticuloendotheliosis 1561 2b rela Dr.84126 415099 0.484 -2.066 1.35E-01 1.170 1.170 5.10E-01 3.631 3.631 1.93E-03 3.497 3.497 2.33E-03 1.634 1.634 2.36E-01 3.952 3.952 5.85E-09 viral oncogene homolog A
1562 2b wu:fb16f08 Wu:fb16f08 Dr.104825 321479 0.401 -2.497 1.51E-02 0.579 -1.726 1.52E-01 1.201 1.201 6.34E-01 1.300 1.300 4.59E-01 1.474 1.474 6.80E-04 2.334 2.334 3.04E-13 1563 2b wu:fb72c11 Wu:fb72c11 Dr.75160 322739 0.214 -4.663 2.09E-08 0.429 -2.333 3.40E-04 1.606 1.606 2.53E-01 1.588 1.588 1.63E-01 2.106 2.106 4.06E-03 3.394 3.394 1.94E-08 1564 2b Dr.25825 Transcribed locus Dr.25825 0.228 -4.389 3.40E-04 0.369 -2.710 1.78E-02 1.448 1.448 5.54E-01 1.426 1.426 4.64E-01 2.211 2.211 5.95E-03 3.540 3.540 3.99E-13 1565 2b Dr.88858 Transcribed locus Dr.88858 0.121 -8.234 4.70E-08 0.185 -5.396 5.07E-08 1.694 1.694 4.07E-01 1.719 1.719 3.26E-01 3.033 3.033 3.87E-06 5.682 5.682 3.64E-11 1566 2b Dr.123093 Transcribed locus Dr.123093 0.287 -3.488 1.70E-04 0.407 -2.459 2.17E-03 1.482 1.482 3.95E-01 1.544 1.544 2.52E-01 2.514 2.514 1.33E-16 3.545 3.545 6.14E-11 1567 2b Dr.124067 Transcribed locus Dr.124067 0.209 -4.785 2.00E-04 0.341 -2.937 9.87E-03 1.852 1.852 2.37E-01 2.211 2.211 8.83E-02 1.777 1.777 3.42E-02 4.672 4.672 1.10E-11 1568 2b zgc:63634 Zgc:63634 Dr.12674 393367 0.296 -3.380 6.16E-03 0.483 -2.070 9.67E-02 1.639 1.639 3.23E-01 1.882 1.882 1.12E-01 1.972 1.972 9.56E-03 3.794 3.794 2.98E-07 1569 2b Dr.123342 Transcribed locus Dr.123342 0.439 -2.278 4.73E-03 0.480 -2.082 1.70E-04 1.219 1.219 5.68E-01 1.281 1.281 4.43E-01 3.033 3.033 6.70E-04 3.346 3.346 9.81E-12
Transcribed locus, weakly similar to XP_001114179.1 1570 2b Dr.132472 similar to oxysterol-binding Dr.132472 0.773 -1.293 9.11E-02 0.778 -1.286 1.34E-01 1.128 1.128 3.81E-01 1.148 1.148 1.11E-01 1.265 1.265 5.23E-03 1.581 1.581 1.44E-14 protein-like protein 11 [Macaca mulatta]
1571 2b Dr.133440 Transcribed locus Dr.133440 0.484 -2.066 2.13E-02 0.498 -2.007 2.39E-02 1.431 1.431 2.88E-01 1.482 1.482 1.88E-01 1.856 1.856 9.33E-03 2.869 2.869 4.45E-06 1572 2b zgc:56407 Zgc:56407 Dr.79344 393257 0.762 -1.312 3.13E-02 0.785 -1.274 1.14E-01 1.138 1.138 2.91E-01 1.087 1.087 4.58E-01 1.349 1.349 3.28E-03 1.503 1.503 4.89E-07 1573 2b LOC561659 Hypothetical LOC561659 Dr.82380 561659 0.380 -2.634 1.59E-02 0.428 -2.337 1.52E-02 1.375 1.375 4.54E-01 1.727 1.727 1.66E-01 3.148 3.148 6.03E-08 5.469 5.469 7.48E-12 1574 2b wu:fj05c06 Wu:fj05c06 Dr.80727 335354 0.537 -1.864 8.39E-02 0.633 -1.579 2.22E-01 1.293 1.293 3.59E-01 1.086 1.086 7.43E-01 1.657 1.657 8.34E-07 2.386 2.386 7.30E-18 1575 2b zgc:91796 Zgc:91796 Dr.88264 431761 0.692 -1.445 2.28E-02 0.775 -1.291 1.69E-01 1.087 1.087 6.32E-01 1.057 1.057 6.92E-01 1.360 1.360 2.93E-02 1.677 1.677 1.13E-08 1576 2b si:dkey-111e8.1 Si:dkey-111e8.1 Dr.15488 323719 0.738 -1.356 3.36E-01 0.655 -1.526 1.52E-01 0.961 -1.041 8.13E-01 1.132 1.132 3.38E-01 1.303 1.303 3.30E-03 1.542 1.542 1.02E-09 Sine oculis homeobox 1577 2b six7 Dr.75839 30625 0.584 -1.712 5.00E-05 0.535 -1.868 4.60E-04 1.019 1.019 8.96E-01 1.096 1.096 1.17E-01 1.445 1.445 9.57E-02 2.355 2.355 3.40E-02 homolog 7 1578 2b wu:fl03e01 Wu:fl03e01 Dr.82179 335270 0.430 -2.323 1.90E-04 0.399 -2.505 3.78E-11 1.192 1.192 7.14E-01 1.266 1.266 4.51E-01 1.779 1.779 1.43E-03 2.443 2.443 7.80E-04 1579 2b Dr.83922 Transcribed locus Dr.83922 0.416 -2.402 7.52E-08 0.287 -3.488 3.51E-06 1.448 1.448 3.03E-01 1.322 1.322 3.45E-01 2.267 2.267 1.23E-06 3.702 3.702 9.03E-21 1580 2b wu:fk35f04 Wu:fk35f04 Dr.76616 386925 0.545 -1.836 6.78E-06 0.660 -1.516 6.91E-03 1.120 1.120 4.70E-01 1.579 1.579 1.75E-03 1.737 1.737 9.01E-06 1.706 1.706 1.57E-03 1581 2b Dr.107715 Transcribed locus Dr.107715 0.402 -2.490 5.67E-03 0.394 -2.537 2.90E-07 1.249 1.249 3.43E-01 0.896 -1.117 6.12E-01 2.461 2.461 2.00E-05 2.865 2.865 2.91E-06 1582 2b wu:fc27f12 Transcribed locus Dr.121895 324399 0.701 -1.426 1.69E-02 0.786 -1.273 3.65E-01 1.116 1.116 4.14E-01 0.977 -1.024 8.71E-01 1.578 1.578 1.04E-10 1.412 1.412 1.24E-02 1583 2b unc119.2 Unc-119 homolog 2 Dr.94317 403018 0.367 -2.727 3.95E-03 0.486 -2.057 2.11E-02 1.584 1.584 2.82E-01 1.028 1.028 9.45E-01 3.191 3.191 4.80E-04 2.373 2.373 9.95E-14 1584 2b Dr.122416 Transcribed locus Dr.122416 0.403 -2.484 1.34E-02 0.526 -1.901 7.68E-02 1.250 1.250 5.45E-01 0.959 -1.043 8.94E-01 2.681 2.681 4.40E-04 1.925 1.925 2.50E-12 1585 2b Dr.124279 Transcribed locus Dr.124279 0.374 -2.674 5.08E-03 0.487 -2.055 3.27E-02 1.251 1.251 5.39E-01 1.009 1.009 9.80E-01 2.550 2.550 2.51E-19 2.010 2.010 8.30E-04 1586 2b im:7149561 Im:7149561 Dr.124869 503989 0.346 -2.890 7.00E-05 0.374 -2.671 7.40E-04 1.441 1.441 3.95E-01 1.408 1.408 3.68E-01 3.149 3.149 3.00E-04 2.713 2.713 1.01E-11 1587 2b wu:fa05b11 Wu:fa05b11 Dr.75266 334850 0.367 -2.721 1.95E-03 0.388 -2.575 2.47E-03 1.374 1.374 4.37E-01 1.330 1.330 4.03E-01 2.731 2.731 2.06E-03 2.627 2.627 1.36E-11 1588 2b zgc:85942 Zgc:85942 Dr.140429 405866 0.632 -1.582 5.00E-05 0.669 -1.495 4.27E-02 1.162 1.162 8.09E-02 1.160 1.160 1.70E-01 1.566 1.566 4.40E-04 1.440 1.440 3.46E-02 1589 2b zgc:112199 Zgc:112199 Dr.76995 550402 0.514 -1.944 6.10E-04 0.558 -1.791 2.00E-05 1.364 1.364 5.48E-02 1.101 1.101 5.83E-01 1.782 1.782 1.20E-04 1.734 1.734 1.04E-03 1590 2b wu:fb18b12 Wu:fb18b12 Dr.23649 321526 0.221 -4.534 3.71E-03 0.370 -2.705 1.60E-04 1.695 1.695 2.83E-01 1.459 1.459 3.74E-01 5.507 5.507 2.00E-05 4.134 4.134 3.13E-12 1591 2b snx1 Sorting nexin 1 Dr.140305 337386 0.214 -4.683 3.62E-08 0.365 -2.737 4.00E-05 1.296 1.296 6.30E-01 1.412 1.412 4.93E-01 2.968 2.968 1.60E-03 2.651 2.651 9.18E-09 1592 2b Dr.133097 Transcribed locus Dr.133097 0.535 -1.871 3.40E-02 0.501 -1.997 2.00E-02 1.151 1.151 3.16E-01 1.283 1.283 4.44E-02 2.739 2.739 4.55E-08 1.637 1.637 1.09E-01 1593 2b wu:fj20h08 Wu:fj20h08 Dr.122319 335545 0.210 -4.761 8.40E-03 0.316 -3.167 4.73E-02 4.398 4.398 1.00E-05 2.818 2.818 1.16E-03 4.229 4.229 4.83E-19 6.303 6.303 5.21E-15 1594 2b Dr.92257 Transcribed locus Dr.92257 0.590 -1.696 4.86E-02 0.657 -1.522 1.50E-01 1.508 1.508 5.96E-02 1.340 1.340 5.42E-02 1.519 1.519 7.91E-06 1.569 1.569 2.25E-03 1595 2b LOC568476 Hypothetical LOC568476 Dr.85087 568476 0.438 -2.285 6.45E-08 0.518 -1.930 1.44E-08 1.619 1.619 8.87E-03 1.295 1.295 2.86E-02 1.832 1.832 1.71E-08 2.168 2.168 9.80E-04 1596 2b tuba7l Tubulin, alpha 7 like Dr.12524 431777 0.567 -1.764 3.40E-04 0.517 -1.933 6.00E-05 1.426 1.426 2.50E-02 1.341 1.341 2.03E-01 1.576 1.576 7.91E-03 1.686 1.686 1.34E-10 1597 2b Dr.86498 Transcribed locus Dr.86498 0.502 -1.993 3.23E-02 0.404 -2.476 4.73E-03 1.651 1.651 3.00E-05 1.701 1.701 6.00E-05 2.095 2.095 2.27E-10 1.876 1.876 4.27E-02 1598 2b Dr.132994 Transcribed locus Dr.132994 0.618 -1.619 6.84E-02 0.443 -2.255 3.30E-04 1.456 1.456 1.52E-02 1.169 1.169 2.66E-01 1.871 1.871 8.21E-06 1.850 1.850 1.53E-02 1599 2b zgc:136362 Zgc:136362 Dr.115122 692259 0.889 -1.125 2.86E-01 0.885 -1.130 3.20E-01 0.954 -1.048 5.03E-01 0.970 -1.031 6.42E-01 1.300 1.300 1.24E-02 1.528 1.528 3.21E-20 Transcribed locus, strongly similar to NP_956086.1 1600 2b Dr.134395 Dr.134395 0.708 -1.412 5.35E-02 0.810 -1.234 2.11E-01 0.830 -1.204 5.34E-01 1.024 1.024 9.37E-01 2.139 2.139 9.65E-18 3.350 3.350 8.93E-20 protein LOC327348 [Danio rerio] 1601 2b Dr.122018 Transcribed locus Dr.122018 0.843 -1.186 9.13E-02 0.864 -1.158 3.33E-01 0.967 -1.034 8.29E-01 0.976 -1.025 8.62E-01 1.473 1.473 8.38E-03 1.501 1.501 5.49E-06 1602 2b zgc:92754 Zgc:92754 Dr.32124 436840 0.795 -1.258 1.21E-02 0.833 -1.201 2.28E-01 1.043 1.043 7.46E-01 0.945 -1.059 6.50E-01 1.649 1.649 4.88E-10 1.583 1.583 4.02E-13 1603 2b LOC561676 Hypothetical LOC561676 Dr.118857 561676 0.497 -2.011 1.00E-05 0.809 -1.236 3.30E-02 1.107 1.107 4.51E-01 1.038 1.038 7.89E-01 2.716 2.716 3.29E-09 3.372 3.372 5.08E-13 1604 2b wu:fb81c07 Wu:fb81c07 Dr.75682 323088 0.698 -1.432 1.70E-02 0.854 -1.171 2.87E-01 0.948 -1.055 6.89E-01 1.018 1.018 8.83E-01 1.548 1.548 3.85E-06 1.842 1.842 2.19E-15 1605 2b rhag Transcribed locus Dr.22827 336285 0.535 -1.868 1.37E-01 0.848 -1.179 5.64E-01 1.053 1.053 4.59E-01 1.003 1.003 9.74E-01 1.969 1.969 1.56E-03 2.147 2.147 7.21E-07 1606 2b zgc:77387 Zgc:77387 Dr.6336 324010 0.420 -2.381 6.00E-05 0.868 -1.153 5.23E-01 1.226 1.226 5.10E-01 1.055 1.055 8.39E-01 2.267 2.267 1.80E-04 2.595 2.595 7.41E-07 1607 2b zgc:85923 Zgc:85923 Dr.30256 406448 0.510 -1.960 9.46E-03 0.736 -1.358 5.10E-02 1.249 1.249 3.50E-01 1.005 1.005 9.84E-01 1.970 1.970 3.50E-04 2.406 2.406 8.62E-06 Similar to alpha globin type- 1608 2b LOC561790 Dr.87994 561790 0.590 -1.696 1.47E-03 0.924 -1.083 6.54E-01 0.956 -1.046 6.53E-01 0.973 -1.028 6.91E-01 2.174 2.174 2.83E-08 1.935 1.935 2.09E-06 2 1609 2b Dr.124014 Transcribed locus Dr.124014 0.240 -4.166 2.51E-03 0.602 -1.661 3.02E-02 1.187 1.187 6.49E-01 1.345 1.345 3.28E-01 2.664 2.664 9.98E-03 4.632 4.632 1.00E-05 1610 2b zgc:109896 Zgc:109896 Dr.26640 553543 0.453 -2.210 4.13E-07 0.815 -1.227 1.50E-01 1.036 1.036 8.80E-01 1.023 1.023 9.20E-01 1.618 1.618 1.19E-03 2.054 2.054 1.32E-10 1611 2b Dr.28338 Transcribed locus Dr.28338 0.620 -1.614 7.00E-05 0.867 -1.154 2.10E-01 1.084 1.084 4.04E-01 0.969 -1.032 7.87E-01 1.220 1.220 9.24E-03 1.498 1.498 5.43E-09 1612 2b Dr.90540 Transcribed locus Dr.90540 0.395 -2.534 4.38E-03 0.697 -1.435 2.76E-01 1.080 1.080 7.42E-01 1.010 1.010 9.63E-01 1.518 1.518 1.10E-02 2.157 2.157 4.00E-05 Similar to chromosome X 1613 2b LOC569232 Dr.87903 569232 0.570 -1.755 3.75E-02 0.961 -1.041 8.12E-01 0.988 -1.012 9.58E-01 1.002 1.002 9.92E-01 1.286 1.286 1.50E-01 1.772 1.772 3.52E-12 open reading frame 36 1614 2b LOC570148 Hypothetical LOC570148 Dr.19520 570148 0.393 -2.544 2.00E-05 0.702 -1.425 1.26E-01 0.776 -1.289 4.75E-02 0.789 -1.267 1.56E-02 2.000 2.000 3.39E-03 2.975 2.975 3.75E-06 Tuberoinfundibular peptide 1615 2b tip39 Dr.83558 402812 0.513 -1.949 3.52E-02 0.947 -1.056 8.13E-01 0.757 -1.321 4.15E-03 1.044 1.044 7.90E-01 1.487 1.487 4.22E-02 2.125 2.125 1.00E-05 of 39 amino acids
1616 2b zgc:123046 Zgc:123046 Dr.114190 568429 0.771 -1.298 1.96E-02 1.096 1.096 4.80E-01 0.950 -1.052 6.74E-01 0.912 -1.096 4.05E-01 1.797 1.797 1.58E-21 1.529 1.529 1.06E-02 1617 2b wu:fa91d01 Wu:fa91d01 Dr.76189 336652 0.733 -1.365 2.50E-04 1.025 1.025 9.32E-01 1.110 1.110 6.42E-01 0.897 -1.115 6.44E-01 2.726 2.726 3.42E-07 1.852 1.852 9.93E-03 1618 2b Dr.84373 Transcribed locus Dr.84373 0.799 -1.251 1.79E-01 0.925 -1.081 6.38E-01 0.946 -1.057 5.26E-01 0.866 -1.155 1.93E-02 1.912 1.912 1.00E-05 1.356 1.356 6.86E-02 Similar to peroxisomal acyl- 1619 2b DKEY-183C16.6 Dr.12004 572757 0.423 -2.364 1.26E-03 0.889 -1.125 6.51E-01 1.147 1.147 6.65E-01 0.795 -1.257 4.38E-01 3.067 3.067 7.18E-06 1.738 1.738 3.81E-02 CoA thioesterase 2b like 1
DNA (cytosine-5-)- 1620 2b dnmt3 Dr.67521 30659 0.675 -1.481 4.18E-02 0.993 -1.007 9.63E-01 1.088 1.088 6.15E-01 0.864 -1.158 4.49E-01 1.888 1.888 1.56E-06 1.578 1.578 7.54E-03 methyltransferase 3 1621 2b Dr.28905 Transcribed locus Dr.28905 0.573 -1.746 9.00E-05 0.913 -1.096 6.68E-01 1.026 1.026 9.20E-01 0.795 -1.259 1.37E-01 1.697 1.697 3.74E-02 1.485 1.485 2.59E-02 Hypothetical protein 1622 2b LOC794313 Dr.86125 794313 0.636 -1.572 5.50E-04 0.865 -1.156 2.16E-01 1.119 1.119 2.79E-01 0.959 -1.043 6.95E-01 1.679 1.679 1.00E-05 1.334 1.334 4.01E-03 LOC794313 Lens intrinsic membrane 1623 2b lim2.4 Dr.88040 436680 0.559 -1.790 7.06E-02 0.745 -1.342 3.22E-02 1.329 1.329 9.58E-03 0.966 -1.036 7.83E-01 2.257 2.257 4.63E-07 1.448 1.448 4.77E-02 protein 2.4 Reticulon 4 receptor-like 2 1624 2b rtn4rl2a Dr.91444 403307 0.464 -2.154 5.10E-02 1.328 1.328 4.71E-01 1.065 1.065 8.11E-01 0.712 -1.405 1.13E-01 2.223 2.223 3.62E-06 1.969 1.969 1.28E-01 a Cytokine induced 1625 2b ciapin1 Dr.120788 445283 0.789 -1.268 1.55E-02 0.903 -1.107 5.05E-01 1.223 1.223 7.91E-02 1.093 1.093 3.42E-01 1.678 1.678 2.83E-07 1.069 1.069 6.77E-01 apoptosis inhibitor 1 1626 2b wu:fi12h09 Wu:fi12h09 Dr.122177 327466 0.914 -1.094 4.26E-01 0.936 -1.068 5.80E-01 1.186 1.186 9.60E-02 1.069 1.069 3.89E-01 1.521 1.521 5.34E-11 1.070 1.070 5.90E-01 1627 2b Dr.123134 Transcribed locus Dr.123134 0.654 -1.529 1.05E-01 0.802 -1.248 3.09E-01 1.011 1.011 9.68E-01 1.456 1.456 3.77E-02 1.918 1.918 6.47E-10 1.111 1.111 1.34E-01 1628 2b wu:fb57b02 Wu:fb57b02 Dr.4216 322299 0.501 -1.998 1.38E-01 1.119 1.119 6.77E-01 1.185 1.185 6.48E-01 1.000 -1.000 9.99E-01 2.323 2.323 2.00E-05 0.995 -1.005 9.86E-01 1629 2b Dr.133400 Transcribed locus Dr.133400 1.020 1.020 8.93E-01 0.885 -1.131 5.31E-01 0.974 -1.027 9.04E-01 0.929 -1.077 7.50E-01 1.955 1.955 1.00E-05 1.223 1.223 4.29E-01 1630 2b wu:fd61c04 Wu:fd61c04 Dr.113440 326081 0.312 -3.205 1.14E-01 0.281 -3.565 7.80E-02 2.525 2.525 1.18E-01 1.867 1.867 2.41E-01 1.184 1.184 7.44E-01 9.793 9.793 3.00E-05 1631 2b wu:fj62d01 Wu:fj62d01 Dr.132859 336300 0.870 -1.150 4.89E-02 0.702 -1.424 5.37E-02 1.165 1.165 7.94E-02 1.194 1.194 3.87E-01 1.036 1.036 7.45E-01 1.582 1.582 6.00E-05 Similar to SNF1/AMP- 1632 2b LOC560275 Dr.71665 560275 0.983 -1.017 9.07E-01 0.700 -1.428 9.68E-02 1.175 1.175 2.83E-01 1.182 1.182 1.31E-01 1.221 1.221 4.48E-02 1.506 1.506 4.55E-06 activated protein kinase 1633 2b zgc:110200 Zgc:110200 Dr.116678 550523 0.999 -1.001 9.97E-01 0.713 -1.404 7.00E-02 1.334 1.334 2.10E-01 1.586 1.586 5.64E-02 0.968 -1.033 8.53E-01 2.083 2.083 2.25E-06 Branched chain 1634 2b bcat1 aminotransferase 1, Dr.80309 337412 0.856 -1.169 2.59E-01 0.729 -1.372 1.01E-03 0.998 -1.002 9.78E-01 1.423 1.423 1.05E-03 0.833 -1.200 7.53E-02 1.858 1.858 3.33E-07 cytosolic 1635 2b Dr.22136 Transcribed locus Dr.22136 1.138 1.138 6.07E-01 0.814 -1.229 3.87E-01 1.200 1.200 2.24E-01 1.335 1.335 1.01E-02 1.339 1.339 7.30E-04 1.648 1.648 2.47E-07 1636 2b Dr.75128 Transcribed locus Dr.75128 1.118 1.118 6.82E-01 0.830 -1.205 2.61E-01 1.117 1.117 5.45E-01 1.381 1.381 1.30E-04 1.120 1.120 4.33E-01 1.607 1.607 3.00E-05 1637 2b zgc:92530 Zgc:92530 Dr.77138 445052 1.810 1.810 2.40E-02 0.638 -1.568 2.58E-02 0.934 -1.070 5.46E-01 1.152 1.152 1.66E-01 1.931 1.931 5.12E-03 3.131 3.131 1.07E-10 Hypothetical protein 1638 2b LOC100001701 Dr.82051 100001701 1.711 1.711 5.00E-05 0.833 -1.200 1.95E-01 1.131 1.131 1.84E-01 1.235 1.235 4.50E-01 1.018 1.018 8.50E-01 1.777 1.777 9.00E-05 LOC100001701 1639 2b zgc:165461 Zgc:165461 Dr.108135 497419 0.644 -1.552 4.02E-03 0.875 -1.143 5.32E-01 0.650 -1.539 4.00E-05 0.890 -1.124 3.95E-01 1.874 1.874 7.87E-02 2.452 2.452 5.49E-11 1640 2b Dr.84659 Transcribed locus Dr.84659 0.762 -1.312 2.41E-01 1.020 1.020 9.03E-01 0.778 -1.285 3.98E-01 0.936 -1.068 8.18E-01 1.422 1.422 4.66E-02 1.750 1.750 4.27E-08 Hypothetical protein 1641 2b LOC407678 Dr.87071 407678 0.769 -1.301 6.59E-02 1.005 1.005 9.60E-01 0.741 -1.350 9.30E-09 0.838 -1.194 1.30E-02 1.472 1.472 1.00E-05 1.506 1.506 1.40E-06 LOC407678 1642 2b zgc:64101 Zgc:64101 Dr.80315 393878 0.995 -1.005 9.85E-01 0.789 -1.267 3.59E-01 0.872 -1.147 5.87E-01 0.830 -1.205 3.88E-01 1.330 1.330 1.22E-02 1.743 1.743 4.35E-09 1643 2b zgc:92192 Zgc:92192 Dr.90111 436612 0.804 -1.243 3.54E-02 0.644 -1.554 2.50E-04 0.799 -1.252 2.04E-01 1.092 1.092 6.13E-01 1.382 1.382 1.00E-05 1.744 1.744 3.00E-05 Similar to matrix 1644 2b LOC557654 Dr.121062 557654 1.597 1.597 2.41E-01 1.421 1.421 3.77E-01 0.347 -2.880 1.71E-06 2.140 2.140 1.49E-01 2.036 2.036 4.20E-04 16.566 16.566 3.14E-22 metalloproteinase 13 Matrix metalloproteinase 1645 2b mmp13 Dr.81475 387293 1.396 1.396 3.47E-20 0.952 -1.051 3.68E-01 0.560 -1.784 1.64E-10 1.469 1.469 5.20E-04 2.139 2.139 1.17E-41 9.502 9.502 0.00E+00 13 1646 2b im:7151068 Im:7151068 Dr.91065 492696 0.872 -1.146 5.81E-01 0.866 -1.155 5.96E-01 0.778 -1.285 1.91E-01 1.199 1.199 3.29E-01 1.280 1.280 2.09E-01 2.015 2.015 5.00E-05 Ladybird homeobox 1647 2b lbx1 Dr.27181 64276 0.917 -1.091 6.81E-01 0.983 -1.017 8.01E-01 0.815 -1.227 2.58E-01 0.947 -1.056 7.78E-01 1.782 1.782 6.60E-04 2.065 2.065 2.26E-06 homolog 1 (Drosophila) 1648 2b zgc:92662 Zgc:92662 Dr.83126 436697 1.010 1.010 9.64E-01 1.192 1.192 4.74E-01 0.740 -1.351 7.38E-02 0.990 -1.010 9.43E-01 1.867 1.867 5.88E-02 3.518 3.518 3.41E-08 1649 2b zgc:91794 Zgc:91794 Dr.132314 431764 1.462 1.462 4.49E-01 0.869 -1.151 7.67E-01 0.505 -1.978 3.73E-03 0.979 -1.021 8.71E-01 1.705 1.705 6.20E-04 2.907 2.907 1.33E-14 1650 2b si:ch211-262h13.3 Si:ch211-262h13.3 Dr.18273 569577 1.097 1.097 7.76E-01 1.068 1.068 8.30E-01 0.579 -1.728 2.95E-01 0.768 -1.301 5.31E-01 0.922 -1.084 8.17E-01 14.156 14.156 2.83E-07 1651 2b sesn2 Sestrin 2 Dr.44360 558966 1.113 1.113 4.05E-01 0.920 -1.087 3.94E-01 0.873 -1.145 3.37E-01 0.836 -1.196 2.62E-01 0.838 -1.193 3.60E-01 2.903 2.903 3.94E-11 Solute carrier family 7 (cationic amino acid 1652 2b slc7a3 Dr.77674 492363 0.958 -1.044 3.24E-01 1.038 1.038 6.01E-01 0.852 -1.173 2.70E-02 0.743 -1.345 4.10E-01 1.117 1.117 6.45E-02 2.399 2.399 5.65E-06 transporter, y+ system), member 3 1653 2b arg2 Arginase, type II Dr.77297 322614 0.958 -1.044 6.08E-01 0.912 -1.097 3.83E-01 0.773 -1.295 3.00E-05 0.999 -1.001 9.93E-01 0.857 -1.167 7.73E-03 1.635 1.635 1.03E-18 1654 2c zgc:91978 Zgc:91978 Dr.106802 436927 0.357 -2.805 6.08E-02 0.773 -1.294 2.36E-01 2.903 2.903 8.00E-05 2.676 2.676 2.90E-04 1.564 1.564 6.90E-04 1.605 1.605 3.60E-04 Prostaglandin E receptor 2 1655 2c ptger2l Dr.87881 393608 0.118 -8.450 3.97E-07 0.658 -1.521 3.24E-01 6.878 6.878 1.09E-06 7.087 7.087 1.01E-09 2.314 2.314 3.99E-02 3.627 3.627 1.38E-06 (subtype EP2)-like
Transcribed locus, weakly similar to NP_001074221.1 1656 2c Dr.131335 Dr.131335 0.459 -2.178 7.94E-02 0.726 -1.378 4.70E-01 3.177 3.177 1.89E-16 2.959 2.959 2.15E-12 1.788 1.788 1.14E-03 1.952 1.952 1.10E-04 protein LOC559830 [Danio rerio]
1657 2c im:7136115 Im:7136115 Dr.83392 497312 0.437 -2.291 2.23E-02 0.681 -1.469 2.15E-01 2.483 2.483 1.58E-06 2.442 2.442 6.00E-05 2.121 2.121 5.39E-03 1.830 1.830 2.26E-02 1658 2c LOC555409 Hypothetical LOC555409 Dr.76106 555409 0.404 -2.473 3.03E-02 0.621 -1.611 2.24E-02 2.977 2.977 8.00E-05 2.304 2.304 3.74E-02 1.552 1.552 8.49E-02 2.073 2.073 6.47E-02 1659 2c wu:fe24a06 Wu:fe24a06 Dr.132679 326807 0.321 -3.118 6.75E-06 0.492 -2.032 1.52E-01 2.491 2.491 2.96E-02 2.772 2.772 1.10E-04 1.405 1.405 4.81E-01 3.195 3.195 7.46E-08 1660 2c wu:fc83f05 Wu:fc83f05 Dr.79478 325498 0.122 -8.169 1.45E-08 0.410 -2.440 8.04E-02 4.264 4.264 5.54E-02 6.625 6.625 8.06E-07 1.519 1.519 9.65E-02 3.880 3.880 2.53E-03 Hypothetical protein 1661 2c LOC100002523 Dr.116473 100002523 0.211 -4.746 1.63E-06 0.805 -1.243 4.85E-01 1.820 1.820 1.74E-01 2.948 2.948 2.64E-03 1.211 1.211 6.86E-01 2.102 2.102 8.00E-02 LOC100002523 1662 2c Dr.91687 Transcribed locus Dr.91687 0.232 -4.313 3.90E-04 1.144 1.144 5.50E-01 1.652 1.652 2.44E-01 2.987 2.987 7.99E-07 0.979 -1.021 9.55E-01 2.171 2.171 6.05E-03 1663 2c Dr.131145 Transcribed locus Dr.131145 0.507 -1.972 3.23E-03 0.947 -1.056 7.99E-01 1.678 1.678 1.90E-04 1.722 1.722 1.64E-09 1.025 1.025 8.77E-01 1.243 1.243 1.71E-01 1664 2c LOC570432 Hypothetical LOC570432 Dr.15633 570432 0.423 -2.362 7.03E-03 0.937 -1.067 7.86E-01 1.908 1.908 1.44E-02 1.937 1.937 3.06E-15 1.153 1.153 7.10E-01 1.725 1.725 3.91E-03 Hypothetical protein 1665 2c LOC553490 Dr.133089 553490 0.330 -3.027 1.35E-03 1.260 1.260 4.74E-01 1.759 1.759 3.20E-02 2.673 2.673 1.00E-05 1.310 1.310 4.01E-01 2.337 2.337 7.20E-04 LOC553490 Hypothetical protein 1666 2c LOC799503 Dr.18788 799503 0.577 -1.733 3.90E-02 1.135 1.135 6.44E-01 1.163 1.163 4.79E-01 1.417 1.417 4.69E-02 1.261 1.261 2.33E-01 1.574 1.574 5.00E-05 LOC799503 1667 2c Dr.85220 Transcribed locus Dr.85220 0.593 -1.686 2.73E-01 1.061 1.061 8.37E-01 1.199 1.199 5.90E-01 2.169 2.169 1.18E-06 0.942 -1.061 8.11E-01 1.831 1.831 1.20E-04 1668 2c Dr.123311 Transcribed locus Dr.123311 0.785 -1.274 4.44E-01 1.128 1.128 7.00E-01 1.540 1.540 4.56E-02 1.672 1.672 1.99E-13 0.769 -1.301 7.38E-02 1.833 1.833 1.00E-04 1669 2c Dr.123677 Transcribed locus Dr.123677 0.618 -1.618 1.24E-01 0.850 -1.177 5.96E-01 1.691 1.691 5.87E-03 1.450 1.450 4.20E-04 0.834 -1.199 1.72E-01 1.905 1.905 6.55E-08 1670 2c Dr.125330 Transcribed locus Dr.125330 0.236 -4.233 1.49E-03 0.476 -2.099 5.15E-02 3.803 3.803 1.28E-02 3.394 3.394 4.00E-05 0.649 -1.541 2.92E-01 3.851 3.851 6.39E-06 1671 2c hm:zehn2160 Hm:zehn2160 Dr.107623 337758 0.455 -2.197 2.71E-06 0.715 -1.399 4.12E-02 1.426 1.426 2.53E-02 1.674 1.674 1.70E-04 0.904 -1.106 7.25E-01 1.069 1.069 8.12E-01 1672 2c Dr.133343 Transcribed locus Dr.133343 0.164 -6.095 2.34E-09 0.660 -1.515 1.29E-01 2.846 2.846 2.10E-02 3.674 3.674 4.30E-03 0.879 -1.137 7.92E-01 1.306 1.306 4.05E-01 1673 2c Dr.83390 Transcribed locus Dr.83390 0.073 -13.707 8.94E-08 0.353 -2.830 4.20E-02 5.722 5.722 1.08E-02 9.028 9.028 4.40E-06 0.655 -1.526 4.17E-01 1.317 1.317 5.21E-01 Solute carrier family 10 (sodium/bile acid 1674 2c slc10a2 Dr.88326 393329 0.249 -4.013 3.11E-06 0.621 -1.610 1.37E-03 2.082 2.082 1.54E-03 2.686 2.686 1.09E-09 1.347 1.347 6.26E-02 1.149 1.149 3.60E-01 cotransporter family), member 2 Similar to beta- 1675 2c LOC793284 Dr.113263 793284 0.604 -1.657 2.35E-02 0.831 -1.203 3.84E-01 1.609 1.609 2.10E-04 1.851 1.851 1.04E-09 0.895 -1.117 5.58E-01 1.242 1.242 3.08E-01 microseminoprotein 1676 2c Dr.90763 Transcribed locus Dr.90763 0.148 -6.772 4.70E-04 0.476 -2.099 1.57E-01 5.462 5.462 1.20E-02 6.916 6.916 3.11E-06 0.779 -1.284 3.32E-01 2.102 2.102 1.65E-01 1677 2c Dr.83434 Transcribed locus Dr.83434 0.257 -3.886 9.00E-05 0.713 -1.402 1.14E-01 4.451 4.451 5.14E-07 5.423 5.423 1.20E-12 1.026 1.026 9.34E-01 1.729 1.729 6.05E-02 1678 2c Dr.90656 Transcribed locus Dr.90656 0.230 -4.351 2.64E-03 0.528 -1.895 1.62E-01 4.480 4.480 1.93E-02 6.604 6.604 8.07E-08 1.288 1.288 5.39E-01 1.858 1.858 2.59E-01 1679 2c Dr.133303 Transcribed locus Dr.133303 0.491 -2.036 1.10E-04 0.733 -1.365 2.08E-01 1.881 1.881 2.05E-03 2.550 2.550 6.44E-11 0.638 -1.568 1.75E-02 0.904 -1.107 6.16E-01 Similar to rhamnose 1680 2c LOC563686 Dr.24876 563686 0.427 -2.343 2.04E-06 0.581 -1.722 6.82E-02 3.055 3.055 8.65E-07 3.300 3.300 3.01E-13 0.745 -1.342 3.58E-01 0.948 -1.055 7.95E-01 binding lectin STL2 1681 2c im:7138823 Im:7138823 Dr.38927 497383 0.183 -5.469 4.87E-03 0.416 -2.405 1.07E-01 3.599 3.599 4.28E-02 5.656 5.656 7.00E-05 0.682 -1.466 4.92E-01 0.822 -1.217 7.08E-01 1682 2c si:ch211-14a17.6 Si:ch211-14a17.6 Dr.113962 368668 0.561 -1.783 3.01E-02 0.800 -1.251 1.79E-01 3.369 3.369 5.30E-04 2.456 2.456 2.00E-05 0.894 -1.119 6.08E-01 1.028 1.028 9.31E-01 1683 2c Dr.53946 Transcribed locus Dr.53946 0.208 -4.804 3.18E-03 0.179 -5.587 1.16E-03 4.289 4.289 1.93E-02 6.706 6.706 5.00E-05 0.796 -1.257 6.54E-01 2.004 2.004 1.24E-01 1684 2c Dr.84365 Transcribed locus Dr.84365 0.181 -5.538 3.18E-03 0.197 -5.070 4.98E-03 3.555 3.555 2.33E-02 7.815 7.815 1.85E-10 1.492 1.492 4.30E-01 2.464 2.464 1.21E-01 1685 2c Dr.84426 Transcribed locus Dr.84426 0.318 -3.148 4.29E-03 0.330 -3.033 9.20E-04 3.696 3.696 1.51E-02 6.541 6.541 1.06E-06 1.151 1.151 7.12E-01 1.163 1.163 6.72E-01 1686 2c Dr.84864 Transcribed locus Dr.84864 0.402 -2.487 6.57E-06 0.319 -3.133 1.94E-06 2.910 2.910 3.11E-06 4.219 4.219 1.17E-10 0.628 -1.592 9.48E-02 1.152 1.152 6.34E-01 1687 2c wu:fa14a01 Wu:fa14a01 Dr.75919 334589 0.855 -1.169 5.05E-01 0.642 -1.558 5.85E-02 1.621 1.621 6.99E-06 1.573 1.573 1.33E-03 1.062 1.062 7.02E-01 0.959 -1.042 8.05E-01 1688 2c Dr.90792 Transcribed locus Dr.90792 0.375 -2.665 4.40E-02 0.327 -3.058 1.08E-02 4.057 4.057 1.78E-07 3.100 3.100 5.00E-05 1.524 1.524 2.03E-01 1.251 1.251 5.02E-01 1689 2c Dr.123253 Transcribed locus Dr.123253 0.602 -1.660 2.90E-04 1.033 1.033 8.09E-01 1.763 1.763 1.24E-03 2.443 2.443 5.44E-07 1.010 1.010 9.46E-01 1.333 1.333 6.90E-02 1690 2c omp Olfactory marker protein Dr.85654 317636 0.589 -1.699 4.79E-02 0.830 -1.205 5.95E-01 1.632 1.632 1.33E-01 3.532 3.532 1.42E-07 0.839 -1.192 6.89E-01 1.398 1.398 3.57E-01 1691 2c zgc:73123 Zgc:73123 Dr.82245 393800 0.573 -1.745 9.84E-03 1.127 1.127 5.60E-01 1.379 1.379 8.47E-02 1.817 1.817 1.45E-17 0.885 -1.130 7.66E-01 1.042 1.042 9.25E-01 1692 2c zgc:110617 Zgc:110617 Dr.45532 553639 0.470 -2.128 3.66E-02 0.962 -1.040 9.04E-01 1.688 1.688 3.21E-10 1.404 1.404 6.60E-04 1.100 1.100 4.82E-01 0.944 -1.060 6.36E-01 1693 2c Dr.85425 Transcribed locus Dr.85425 0.576 -1.737 1.10E-04 1.286 1.286 1.49E-01 1.745 1.745 3.35E-08 1.368 1.368 1.32E-01 1.272 1.272 3.16E-01 1.003 1.003 9.85E-01 1694 2c zgc:63663 Zgc:63663 Dr.118336 393586 0.912 -1.096 4.20E-01 0.733 -1.364 1.84E-03 1.256 1.256 4.76E-02 1.631 1.631 1.00E-05 0.905 -1.105 2.03E-01 1.045 1.045 5.34E-01
Transcribed locus, strongly similar to XP_683147.2 1695 2c Dr.125037 Dr.125037 0.846 -1.183 6.51E-01 0.673 -1.485 3.13E-01 1.422 1.422 2.63E-01 3.898 3.898 9.57E-07 0.490 -2.040 2.27E-02 1.353 1.353 3.08E-01 hypothetical protein [Danio rerio]
1696 2c LOC565793 Similar to stromelysin-3 Dr.108314 565793 1.074 1.074 8.14E-01 0.993 -1.007 9.76E-01 1.747 1.747 1.15E-08 1.370 1.370 9.96E-03 0.895 -1.117 3.63E-01 1.018 1.018 8.84E-01 1697 2c Dr.86973 Transcribed locus Dr.86973 0.940 -1.064 9.10E-01 1.141 1.141 8.08E-01 6.310 6.310 6.40E-04 3.070 3.070 3.00E-05 0.885 -1.130 8.66E-01 1.362 1.362 5.23E-01 1698 2c wu:fa95e03 Wu:fa95e03 Dr.1101 337025 1.013 1.013 9.37E-01 1.005 1.005 9.82E-01 1.620 1.620 6.00E-05 1.107 1.107 6.11E-01 0.964 -1.037 8.22E-01 1.022 1.022 8.88E-01 1699 2c wu:fc38b05 Wu:fc38b05 Dr.78588 324684 1.000 1.000 1.00E+00 1.000 1.000 1.00E+00 5.409 5.409 8.42E-09 1.000 1.000 1.00E+00 1.000 1.000 1.00E+00 1.000 1.000 1.00E+00 1700 2c zgc:101699 Zgc:101699 Dr.115979 492789 1.864 1.864 1.68E-01 1.262 1.262 6.62E-01 2.867 2.867 1.54E-02 3.454 3.454 3.00E-05 0.976 -1.024 9.65E-01 2.662 2.662 4.61E-02 Transcription factor IIIA 1701 2c LOC558030 Dr.75664 558030 1.407 1.407 2.19E-02 1.229 1.229 1.40E-01 1.777 1.777 1.00E-05 1.967 1.967 1.37E-13 1.432 1.432 2.88E-03 1.562 1.562 5.30E-04 like 1702 2c si:ch211-245h14.1 Si:ch211-245h14.1 Dr.85745 563420 1.318 1.318 3.52E-01 1.118 1.118 6.87E-01 1.736 1.736 6.00E-05 1.860 1.860 3.00E-05 1.204 1.204 3.20E-01 1.276 1.276 1.71E-01 1703 2c wu:fi40d02 Wu:fi40d02 Dr.140094 334318 1.063 1.063 7.59E-01 1.037 1.037 8.32E-01 1.941 1.941 4.28E-07 1.501 1.501 7.36E-03 1.353 1.353 2.58E-02 1.345 1.345 7.28E-02 1704 2c zgc:101659 Zgc:101659 Dr.37198 492798 1.194 1.194 6.23E-01 1.359 1.359 5.27E-01 2.510 2.510 4.05E-09 1.505 1.505 1.21E-01 1.432 1.432 1.83E-01 1.226 1.226 4.66E-01 Natriuretic peptide 1705 2c nppa Dr.72101 321442 1.245 1.245 1.11E-02 1.372 1.372 3.00E-05 2.010 2.010 1.29E-16 1.398 1.398 3.00E-05 1.343 1.343 2.11E-02 1.220 1.220 1.52E-01 precursor A 1706 2c prnp Prion protein Dr.116262 494129 0.731 -1.369 1.36E-01 1.509 1.509 9.22E-02 1.707 1.707 2.10E-02 2.193 2.193 3.00E-05 1.109 1.109 6.47E-01 1.267 1.267 4.89E-01 1707 2c wu:fj85h12 Wu:fj85h12 Dr.81581 337599 0.787 -1.270 4.07E-01 1.429 1.429 9.41E-03 1.535 1.535 5.75E-07 1.518 1.518 1.45E-03 1.129 1.129 5.24E-01 1.242 1.242 4.11E-02
Transcribed locus, strongly similar to XP_698629.1 1708 2c Dr.125372 Dr.125372 0.759 -1.318 5.62E-01 1.803 1.803 3.50E-02 2.428 2.428 1.84E-02 3.550 3.550 7.42E-08 1.192 1.192 6.09E-01 2.787 2.787 1.70E-04 similar to MAX dimerization protein 1 [Danio rerio]
1709 2c zgc:66450 Zgc:66450 Dr.80393 393501 0.669 -1.495 4.68E-01 1.678 1.678 4.10E-01 3.278 3.278 8.89E-02 6.520 6.520 1.03E-03 1.537 1.537 5.54E-01 5.137 5.137 5.62E-09 1710 2c Dr.82495 Transcribed locus Dr.82495 0.731 -1.368 4.59E-01 1.350 1.350 3.38E-01 1.425 1.425 9.18E-03 1.709 1.709 6.00E-05 1.196 1.196 5.75E-01 1.541 1.541 1.23E-01 Hypothetical protein 1711 2c LOC100005536 Dr.87663 100005536 0.439 -2.279 1.60E-01 1.784 1.784 2.19E-01 2.889 2.889 3.02E-02 6.074 6.074 5.02E-10 2.266 2.266 9.62E-02 4.208 4.208 8.42E-08 LOC100005536
Transcribed locus, weakly similar to NP_065704.1 1712 2c Dr.133195 Dr.133195 0.958 -1.043 6.62E-01 0.969 -1.032 9.10E-01 1.261 1.261 2.96E-02 1.565 1.565 4.00E-05 1.181 1.181 2.77E-01 1.123 1.123 3.68E-01 finger protein 287 [Homo sapiens]
1713 2c Dr.77749 Transcribed locus Dr.77749 0.884 -1.131 8.61E-01 1.012 1.012 9.86E-01 6.420 6.420 1.16E-02 7.728 7.728 4.00E-05 2.657 2.657 1.31E-01 2.216 2.216 2.41E-01 1714 2c Dr.134510 Transcribed locus Dr.134510 0.682 -1.467 4.47E-01 0.773 -1.294 5.79E-01 5.952 5.952 8.60E-04 5.291 5.291 1.55E-07 0.877 -1.140 7.44E-01 1.956 1.956 9.08E-02 Myosin, heavy polypeptide 1715 2c myh6 Dr.29034 386711 0.864 -1.158 2.19E-01 0.935 -1.070 5.72E-01 1.715 1.715 3.00E-05 1.534 1.534 5.50E-04 1.193 1.193 5.56E-02 1.199 1.199 6.08E-02 6, cardiac muscle, alpha
1716 2c LOC563546 Hypothetical LOC563546 Dr.82629 563546 0.767 -1.304 2.78E-01 0.882 -1.133 6.04E-01 2.035 2.035 1.00E-05 1.873 1.873 3.00E-05 1.339 1.339 4.24E-01 1.192 1.192 5.40E-01 CDNA clone 1717 2c Dr.94477 Dr.94477 0.650 -1.538 4.34E-01 1.074 1.074 8.22E-01 4.852 4.852 5.50E-09 4.482 4.482 4.17E-07 1.415 1.415 1.82E-01 2.027 2.027 1.15E-01 IMAGE:7267816 1718 2d Dr.1026 Transcribed locus Dr.1026 0.116 -8.589 7.68E-06 0.376 -2.662 1.25E-03 2.473 2.473 9.58E-02 4.368 4.368 3.70E-11 1.221 1.221 4.85E-01 3.276 3.276 7.79E-06 1719 2d Dr.122525 Transcribed locus Dr.122525 0.265 -3.767 2.80E-04 0.611 -1.636 2.72E-01 1.496 1.496 1.40E-02 2.145 2.145 1.96E-06 1.009 1.009 9.79E-01 1.770 1.770 3.25E-03 1720 2d wu:fj66h07 Wu:fj66h07 Dr.1574 337418 0.320 -3.123 5.30E-04 0.576 -1.737 1.60E-04 1.616 1.616 3.81E-02 2.149 2.149 6.79E-13 1.268 1.268 2.35E-01 1.522 1.522 4.90E-04 1721 2d wu:fj08d01 Wu:fj08d01 Dr.80874 335387 0.271 -3.684 5.19E-03 0.472 -2.118 1.06E-01 1.918 1.918 9.50E-02 2.842 2.842 6.00E-05 1.143 1.143 4.83E-01 1.478 1.478 2.00E-02 1722 2d Dr.15621 Transcribed locus Dr.15621 0.095 -10.487 1.36E-06 0.500 -1.999 1.56E-01 1.874 1.874 2.43E-01 4.376 4.376 8.29E-03 0.897 -1.115 6.96E-01 1.654 1.654 1.77E-01 1723 2d Dr.78817 Transcribed locus Dr.78817 0.290 -3.446 6.00E-05 0.665 -1.505 1.34E-01 1.293 1.293 4.47E-01 1.815 1.815 6.10E-02 1.120 1.120 7.00E-01 1.453 1.453 1.52E-01 1724 2d Dr.84001 Transcribed locus Dr.84001 0.253 -3.945 6.27E-07 0.783 -1.278 1.79E-01 1.294 1.294 4.61E-01 2.268 2.268 1.33E-02 0.908 -1.101 7.82E-01 1.754 1.754 5.04E-03 1725 2d Dr.135155 Transcribed locus Dr.135155 0.500 -1.999 1.00E-04 0.707 -1.415 2.56E-02 1.090 1.090 5.07E-01 1.518 1.518 9.10E-04 1.163 1.163 2.51E-01 1.225 1.225 3.83E-02 Transcribed locus, strongly similar to XP_697511.1 1726 2d Dr.87006 similar to GTPase, IMAP Dr.87006 0.235 -4.262 1.34E-07 0.457 -2.190 2.63E-03 1.177 1.177 6.18E-01 2.226 2.226 6.00E-04 0.978 -1.022 9.59E-01 1.521 1.521 1.94E-01 family member 7 [Danio rerio] 1727 2d Dr.104095 Transcribed locus Dr.104095 0.436 -2.295 5.00E-05 0.725 -1.380 5.50E-02 1.304 1.304 2.48E-01 1.289 1.289 2.16E-01 1.213 1.213 4.79E-01 1.390 1.390 1.18E-01 1728 2d Dr.132049 Transcribed locus Dr.132049 0.139 -7.200 4.52E-06 0.523 -1.911 1.17E-01 2.036 2.036 1.59E-01 1.485 1.485 1.37E-01 1.603 1.603 3.60E-01 2.513 2.513 1.37E-02 N-acetylglucosamine-1- 1729 2d gnptg phosphate transferase, Dr.3328 415147 0.560 -1.784 1.65E-06 0.799 -1.252 1.49E-02 1.265 1.265 3.76E-03 1.156 1.156 1.30E-01 1.214 1.214 3.49E-02 1.276 1.276 4.15E-02 gamma subunit 1730 2d Dr.134581 Transcribed locus Dr.134581 0.334 -2.992 7.88E-07 0.602 -1.660 1.49E-02 1.472 1.472 1.11E-01 1.429 1.429 5.42E-02 1.616 1.616 2.50E-02 1.700 1.700 8.55E-03 1731 2d Dr.140743 Transcribed locus Dr.140743 0.127 -7.870 1.00E-05 0.515 -1.942 4.94E-02 1.669 1.669 2.90E-01 1.788 1.788 1.66E-01 2.550 2.550 2.07E-02 3.182 3.182 2.26E-03 1732 2d Dr.26104 Transcribed locus Dr.26104 0.169 -5.920 2.29E-08 0.541 -1.847 5.83E-02 1.489 1.489 4.53E-01 1.269 1.269 6.23E-01 1.651 1.651 1.52E-01 1.592 1.592 1.65E-01 Hypothetical protein 1733 2d LOC799067 Dr.81695 799067 0.495 -2.021 1.21E-09 0.754 -1.326 4.77E-02 1.405 1.405 1.78E-03 1.238 1.238 5.31E-02 1.472 1.472 1.80E-04 1.265 1.265 1.86E-02 LOC799067 1734 2d zgc:85611 Zgc:85611 Dr.85105 406368 0.473 -2.114 4.99E-07 0.739 -1.353 1.27E-02 1.459 1.459 2.24E-01 1.381 1.381 2.82E-01 1.429 1.429 2.34E-02 1.293 1.293 3.44E-02 1735 2d Dr.90695 Transcribed locus Dr.90695 0.514 -1.945 6.00E-05 0.739 -1.353 1.22E-02 1.283 1.283 7.83E-02 1.229 1.229 1.56E-01 1.348 1.348 1.21E-02 1.183 1.183 3.86E-01 1736 2d Dr.128926 Transcribed locus Dr.128926 0.531 -1.884 6.02E-11 0.908 -1.101 2.97E-01 1.219 1.219 3.61E-01 1.136 1.136 5.36E-01 1.328 1.328 3.12E-02 1.221 1.221 1.58E-01 1737 2d zgc:110025 Zgc:110025 Dr.135075 553578 0.323 -3.097 2.60E-07 0.484 -2.064 6.16E-03 1.467 1.467 2.35E-01 1.053 1.053 8.29E-01 1.863 1.863 7.49E-02 1.743 1.743 7.39E-02 1738 2d zgc:163057 Zgc:163057 Dr.87319 563335 0.291 -3.442 2.49E-06 0.429 -2.331 5.05E-03 1.768 1.768 3.69E-02 0.984 -1.016 9.36E-01 1.800 1.800 1.87E-02 1.708 1.708 5.38E-02 Hypothetical protein 1739 2d LOC794413 Dr.116674 794413 0.242 -4.133 3.25E-14 0.452 -2.213 6.04E-20 1.647 1.647 1.84E-03 1.636 1.636 7.88E-03 1.261 1.261 8.75E-02 1.463 1.463 1.32E-02 LOC794413 1740 2d wu:fd58b05 Wu:fd58b05 Dr.94688 100007552 0.275 -3.632 5.03E-08 0.604 -1.655 1.22E-02 1.422 1.422 1.91E-01 1.406 1.406 5.39E-03 1.075 1.075 6.60E-01 1.584 1.584 4.68E-07 1741 2d Dr.83483 Transcribed locus Dr.83483 0.152 -6.585 3.60E-15 0.339 -2.952 6.20E-04 2.151 2.151 9.64E-02 1.305 1.305 1.82E-01 0.952 -1.050 8.90E-01 2.219 2.219 4.25E-03 1742 2d Dr.85154 Transcribed locus Dr.85154 0.154 -6.512 5.00E-05 0.405 -2.471 8.62E-03 2.242 2.242 1.83E-01 1.836 1.836 1.29E-01 0.865 -1.156 7.78E-01 1.701 1.701 1.71E-01 1743 2d Dr.133523 Transcribed locus Dr.133523 0.172 -5.799 5.00E-06 0.324 -3.091 2.14E-03 1.439 1.439 5.43E-01 1.052 1.052 9.25E-01 1.231 1.231 6.55E-01 1.924 1.924 1.30E-01 Hypothetical protein 1744 2d LOC100002334 Dr.23240 100002334 0.542 -1.846 6.00E-06 0.713 -1.402 2.34E-02 1.088 1.088 6.65E-01 1.069 1.069 4.77E-01 1.176 1.176 1.53E-01 1.316 1.316 2.07E-02 LOC100002334 1745 2d Dr.84330 Transcribed locus Dr.84330 0.145 -6.883 3.00E-05 0.355 -2.819 2.41E-02 1.036 1.036 9.35E-01 1.502 1.502 3.44E-01 1.107 1.107 8.52E-01 1.576 1.576 2.89E-01 1746 2d crygm6 Crystallin, gamma M6 Dr.15363 553966 0.335 -2.985 6.63E-06 0.449 -2.229 3.49E-02 1.705 1.705 2.62E-02 1.257 1.257 2.10E-01 0.763 -1.311 2.21E-01 1.143 1.143 4.93E-01 1747 2d zgc:92591 Zgc:92591 Dr.18405 436997 0.175 -5.726 1.00E-05 0.200 -5.012 1.70E-04 2.081 2.081 9.68E-02 1.242 1.242 5.91E-01 0.771 -1.297 5.75E-01 1.457 1.457 3.12E-01 1748 2d wu:fc29c12 Wu:fc29c12 Dr.78749 324446 0.284 -3.526 1.36E-08 0.585 -1.709 1.34E-02 2.476 2.476 6.08E-03 1.475 1.475 3.47E-01 0.746 -1.341 3.59E-01 1.652 1.652 3.63E-02 1749 2d wu:fd42f04 Wu:fd42f04 Dr.106615 325883 0.430 -2.324 1.65E-06 1.327 1.327 1.24E-01 1.087 1.087 7.58E-01 1.206 1.206 4.91E-01 1.160 1.160 6.35E-01 1.977 1.977 8.65E-03 1750 2d Dr.122627 Transcribed locus Dr.122627 0.600 -1.666 1.60E-04 0.959 -1.043 7.51E-01 1.018 1.018 8.36E-01 1.238 1.238 1.18E-03 1.176 1.176 1.16E-02 1.601 1.601 1.28E-10 1751 2d Dr.86040 Transcribed locus Dr.86040 0.506 -1.976 9.32E-03 1.055 1.055 8.15E-01 1.043 1.043 8.13E-01 1.359 1.359 2.41E-01 1.126 1.126 4.01E-01 1.876 1.876 5.45E-06 Hypothetical protein 1752 2d LOC797099 Dr.120111 797099 0.142 -7.027 1.56E-06 0.743 -1.346 4.44E-01 1.111 1.111 8.27E-01 1.135 1.135 7.72E-01 2.014 2.014 6.80E-02 2.905 2.905 1.80E-04 LOC797099 1753 2d Dr.22350 Transcribed locus Dr.22350 0.321 -3.111 2.97E-07 0.782 -1.279 4.09E-01 0.906 -1.104 6.88E-01 1.251 1.251 3.44E-01 1.209 1.209 6.26E-01 2.056 2.056 1.61E-02 1754 2d wu:fc15f06 Wu:fc15f06 Dr.78434 474325 0.492 -2.031 3.46E-06 0.915 -1.093 5.33E-01 1.115 1.115 4.47E-01 1755 2d Dr.122414 Transcribed locus Dr.122414 0.528 -1.895 3.96E-12 0.783 -1.277 1.02E-01 1.100 1.100 4.07E-01 1.040 1.040 7.55E-01 1.068 1.068 6.65E-01 1.500 1.500 9.18E-02 1756 2d LOC100001968 Similar to bloodthirsty Dr.23709 100001968 0.562 -1.778 2.00E-05 0.940 -1.064 7.14E-01 1.128 1.128 5.99E-01 1.108 1.108 6.02E-01 1.033 1.033 7.78E-01 1.328 1.328 1.59E-01 1757 2d Dr.123322 Transcribed locus Dr.123322 0.568 -1.762 2.40E-04 0.906 -1.104 4.17E-01 1.024 1.024 8.76E-01 1.509 1.509 2.45E-12 1.457 1.457 5.84E-03 1.875 1.875 1.04E-17 1758 2d Dr.92304 Transcribed locus Dr.92304 0.627 -1.595 1.12E-03 0.915 -1.093 3.32E-01 1.118 1.118 4.10E-01 1.397 1.397 1.41E-02 1.269 1.269 1.64E-01 1.623 1.623 7.70E-09 1759 2d Dr.82883 Transcribed locus Dr.82883 0.304 -3.289 3.00E-05 0.645 -1.549 1.31E-01 1.291 1.291 3.52E-01 2.203 2.203 1.41E-11 1.377 1.377 5.13E-02 2.632 2.632 1.58E-11 1760 2d Dr.85922 Transcribed locus Dr.85922 0.349 -2.869 3.20E-04 0.605 -1.652 5.34E-03 1.485 1.485 2.73E-01 2.128 2.128 1.07E-03 1.672 1.672 3.15E-02 2.847 2.847 1.28E-06 1761 2d Dr.140570 Transcribed locus Dr.140570 0.219 -4.571 2.22E-09 0.763 -1.311 5.85E-01 1.752 1.752 3.40E-01 3.326 3.326 1.45E-02 1.267 1.267 4.37E-01 5.884 5.884 1.02E-14 Similar to dedicator of 1762 2d Dock8 Dr.27090 403040 0.549 -1.823 4.74E-11 0.926 -1.080 3.49E-01 1.032 1.032 7.77E-01 1.426 1.426 6.50E-04 1.326 1.326 1.85E-02 1.313 1.313 3.19E-02 cytokinesis 8 1763 2d Dr.84755 Transcribed locus Dr.84755 0.655 -1.526 1.39E-06 0.946 -1.057 3.92E-01 1.124 1.124 1.88E-01 1.265 1.265 3.60E-04 1.190 1.190 2.02E-02 1.135 1.135 3.82E-01 Coiled-coil domain 1764 2d ccdc52 Dr.85458 494093 0.409 -2.448 1.03E-08 0.873 -1.145 4.07E-01 0.842 -1.188 5.63E-01 1.514 1.514 1.61E-01 1.685 1.685 6.71E-02 1.782 1.782 1.44E-03 containing 52 1765 2d Dr.83201 Transcribed locus Dr.83201 0.428 -2.335 5.00E-05 0.856 -1.169 4.50E-01 1.013 1.013 9.74E-01 1.572 1.572 7.35E-02 0.773 -1.293 5.28E-01 1.657 1.657 1.19E-01 1766 2d zgc:92913 Zgc:92913 Dr.115549 436804 0.521 -1.921 5.34E-06 0.815 -1.227 3.00E-02 1.085 1.085 6.91E-01 0.857 -1.167 3.02E-01 1.311 1.311 1.14E-02 1.149 1.149 4.79E-01 1767 2d zgc:101066 Zgc:101066 Dr.88663 445178 0.664 -1.507 9.55E-08 0.888 -1.126 1.82E-01 1.062 1.062 6.04E-01 0.887 -1.127 4.22E-01 1.308 1.308 6.43E-03 1.072 1.072 6.63E-01 Churchill domain 1768 2d churc1 Dr.79574 492508 0.547 -1.829 4.09E-08 0.795 -1.258 5.93E-02 1.113 1.113 3.71E-01 0.946 -1.057 5.60E-01 1.515 1.515 2.66E-02 1.198 1.198 1.95E-01 containing 1
Transcribed locus, moderately similar to 1769 2d Dr.92303 Dr.92303 0.570 -1.753 1.00E-05 0.852 -1.173 2.11E-01 1.090 1.090 5.96E-01 0.980 -1.021 8.79E-01 1.332 1.332 5.34E-02 1.206 1.206 1.97E-01 NP_000531.1 receptor 1 (skeletal) [Homo sapiens]
Corticotropin releasing 1770 2d crh Dr.96618 492507 0.297 -3.365 3.21E-06 0.628 -1.593 1.21E-02 1.060 1.060 8.23E-01 0.966 -1.036 8.58E-01 2.095 2.095 3.70E-04 1.810 1.810 4.01E-03 hormone 1771 2d Dr.83460 Transcribed locus Dr.83460 0.559 -1.788 1.00E-04 0.840 -1.190 2.42E-01 1.036 1.036 7.90E-01 0.959 -1.043 8.24E-01 1.234 1.234 2.17E-01 1.063 1.063 7.34E-01 1772 2d Dr.90589 Transcribed locus Dr.90589 0.525 -1.904 3.00E-05 0.818 -1.223 5.86E-02 1.034 1.034 7.64E-01 1.016 1.016 8.27E-01 1.169 1.169 1.52E-01 1.133 1.133 1.99E-01 Hypothetical protein 1773 2d LOC797508 Dr.117285 797508 0.551 -1.816 6.76E-03 0.814 -1.228 2.95E-01 1.144 1.144 3.68E-01 1.021 1.021 8.26E-01 1.702 1.702 4.00E-05 1.144 1.144 3.31E-01 LOC797508 1774 2d Dr.132082 Transcribed locus Dr.132082 0.612 -1.634 6.50E-04 0.878 -1.139 1.88E-02 1.083 1.083 6.96E-01 0.945 -1.058 7.74E-01 1.529 1.529 1.08E-08 0.989 -1.011 9.16E-01 1775 2d zgc:63982 Zgc:63982 Dr.48970 337376 0.629 -1.591 7.22E-02 0.608 -1.643 9.13E-09 1.242 1.242 1.94E-02 0.795 -1.257 5.85E-02 1.564 1.564 5.00E-03 1.195 1.195 3.12E-01 RAB11a, member RAS 1776 2d rab11a Dr.80427 492487 0.331 -3.017 9.46E-06 0.479 -2.087 6.00E-05 1.276 1.276 5.75E-01 0.797 -1.255 5.80E-01 2.270 2.270 1.24E-02 1.592 1.592 1.06E-01 oncogene family 1777 2d Dr.124946 Transcribed locus Dr.124946 0.396 -2.526 1.00E-05 0.606 -1.651 1.48E-02 1.423 1.423 1.43E-01 1.267 1.267 1.93E-01 1.462 1.462 9.18E-03 0.881 -1.135 3.71E-01 1778 2d spi1 Spi1 Dr.34508 30117 0.641 -1.559 3.00E-05 0.782 -1.279 1.08E-03 1.333 1.333 1.37E-03 0.910 -1.099 4.96E-01 1.326 1.326 2.00E-05 0.965 -1.036 5.52E-01 1779 2d zgc:113317 Zgc:113317 Dr.105275 619243 0.685 -1.460 8.74E-03 0.460 -2.173 2.90E-07 0.986 -1.014 9.43E-01 0.887 -1.128 4.47E-01 0.960 -1.042 7.72E-01 0.919 -1.088 6.88E-01 1780 2d apoa1 Apolipoprotein A-I Dr.75775 30355 0.755 -1.325 1.39E-01 0.546 -1.831 2.36E-07 0.937 -1.067 3.33E-01 0.997 -1.003 9.78E-01 1.090 1.090 7.16E-01 0.936 -1.068 7.64E-01 1781 2d LOC567756 Similar to fmHP Dr.84991 567756 0.710 -1.408 2.51E-01 0.544 -1.837 1.89E-08 0.936 -1.068 7.15E-01 1.104 1.104 5.07E-01 1.023 1.023 9.04E-01 0.875 -1.143 5.88E-01
Transcription elongation 1782 2d tceb2 factor B (SIII), polypeptide Dr.33340 192341 0.590 -1.696 4.01E-06 0.388 -2.578 3.26E-07 1.049 1.049 8.85E-01 0.876 -1.142 6.71E-01 1.543 1.543 2.92E-02 0.948 -1.055 7.87E-01 2 (18kD, elongin B)
Saccharopine 1783 2d sccpdha Dr.77107 436632 0.587 -1.704 9.36E-07 0.534 -1.872 8.83E-18 0.973 -1.028 5.09E-01 0.841 -1.188 7.03E-02 1.131 1.131 1.42E-01 0.962 -1.039 3.59E-01 dehydrogenase a 1784 2d LOC562165 Similar to Cyclin D1 Dr.115576 562165 0.763 -1.311 7.75E-02 0.581 -1.721 1.83E-06 0.778 -1.285 8.33E-02 0.953 -1.050 5.28E-01 1.140 1.140 5.67E-02 1.081 1.081 1.80E-01 1785 2d mg:db03g07 Mg:db03g07 Dr.76103 326955 0.408 -2.449 3.07E-06 0.187 -5.359 2.95E-21 0.641 -1.560 3.38E-02 0.642 -1.559 4.53E-02 1.274 1.274 1.43E-01 1.310 1.310 9.93E-02 1786 2d zgc:112208 Zgc:112208 Dr.82025 550398 0.606 -1.650 1.04E-08 0.547 -1.827 6.78E-06 0.775 -1.290 4.00E-01 0.893 -1.119 5.71E-01 1.393 1.393 1.64E-01 1.024 1.024 9.17E-01 1787 2d wu:fk59h02 Wu:fk59h02 Dr.81943 335724 0.338 -2.958 4.86E-03 0.305 -3.283 2.00E-05 0.563 -1.775 7.43E-02 1.183 1.183 7.57E-01 1.015 1.015 9.48E-01 0.971 -1.029 8.91E-01 1788 2d Dr.109938 Transcribed locus Dr.109938 0.326 -3.069 7.10E-03 0.375 -2.665 4.10E-04 1.044 1.044 8.75E-01 1.515 1.515 1.27E-01 1.901 1.901 4.85E-07 1.684 1.684 2.83E-02 Transcribed locus, moderately similar to XP_001110216.1 similar 1789 2d Dr.13598 Dr.13598 0.500 -2.002 2.09E-02 0.450 -2.224 9.55E-03 0.961 -1.041 8.41E-01 1.287 1.287 2.11E-01 1.630 1.630 9.37E-07 0.995 -1.005 9.72E-01 to integrator complex subunit 2 isoform 2 [Macaca mulatta] 1790 2d LOC571281 Hypothetical LOC571281 Dr.83442 571281 0.608 -1.644 1.59E-02 0.564 -1.773 6.00E-05 0.963 -1.038 7.91E-01 1.153 1.153 5.73E-01 1.440 1.440 2.61E-02 1.168 1.168 3.10E-01 1791 2d Dr.123661 Transcribed locus Dr.123661 0.579 -1.726 2.91E-09 0.657 -1.522 1.74E-03 1.102 1.102 3.80E-01 1.037 1.037 6.91E-01 1.214 1.214 3.13E-02 1.026 1.026 8.55E-01 1792 2d Dr.81922 Transcribed locus Dr.81922 0.594 -1.685 3.46E-06 0.621 -1.611 9.11E-03 1.135 1.135 3.89E-01 1.058 1.058 7.24E-01 1.294 1.294 7.73E-03 1.095 1.095 3.51E-01 1793 2d Dr.83405 Transcribed locus Dr.83405 0.597 -1.674 2.85E-02 0.569 -1.759 5.88E-10 1.221 1.221 7.66E-02 1.006 1.006 9.47E-01 1.203 1.203 4.00E-01 1.083 1.083 6.70E-01 Hypothetical protein 1794 2d LOC100000608 Dr.85440 100000608 0.497 -2.012 1.26E-08 0.539 -1.855 5.75E-07 1.244 1.244 3.36E-01 1.118 1.118 2.20E-01 1.219 1.219 2.64E-02 1.103 1.103 2.35E-01 LOC100000608 Similar to cytoplasmic 1795 2d LOC798868 dynein 74kDa intermediate Dr.67279 798868 0.545 -1.835 5.02E-06 0.550 -1.818 8.66E-11 1.287 1.287 1.01E-01 1.236 1.236 3.04E-01 1.110 1.110 5.13E-01 1.080 1.080 6.82E-01 chain Similar to nuclear receptor 1796 2d Nr0b2 subfamily 0, group B, Dr.13394 403010 0.589 -1.699 1.11E-10 0.568 -1.761 1.60E-12 1.089 1.089 5.83E-01 1.071 1.071 6.89E-01 1.083 1.083 5.25E-01 0.937 -1.067 4.06E-01 member 2 Hematopoietically 1797 2d hhex Dr.79053 30098 0.729 -1.371 4.02E-02 0.628 -1.591 3.87E-08 1.082 1.082 4.75E-01 1.082 1.082 4.98E-01 1.083 1.083 6.94E-01 0.965 -1.036 8.46E-01 expressed homeobox 1798 2d Dr.17763 Transcribed locus Dr.17763 0.166 -6.030 1.70E-02 0.285 -3.511 9.29E-02 1.081 1.081 9.10E-01 0.458 -2.182 2.78E-03 1.148 1.148 6.67E-01 3.188 3.188 3.36E-06 Similar to Regulator of G- 1799 2d LOC566268 Dr.82117 566268 0.636 -1.571 1.66E-03 0.631 -1.584 8.03E-08 0.834 -1.199 1.13E-01 0.858 -1.166 1.99E-01 1.217 1.217 2.20E-01 1.341 1.341 4.43E-03 protein signalling 4 1800 2d Dr.86461 Transcribed locus Dr.86461 0.544 -1.839 4.76E-03 0.420 -2.379 2.00E-05 0.899 -1.112 6.21E-01 1.045 1.045 7.68E-01 1.095 1.095 6.61E-01 1.472 1.472 7.11E-03 Tumor necrosis factor, 1801 2d tnfaip8l alpha-induced protein 8, Dr.88310 393345 0.596 -1.678 8.88E-12 0.530 -1.885 2.70E-02 0.940 -1.064 6.74E-01 0.938 -1.066 7.29E-01 1.235 1.235 1.12E-01 1.599 1.599 8.00E-04 like 1802 2d LOC565777 Hypothetical LOC565777 Dr.86193 798514 0.378 -2.648 8.40E-06 0.387 -2.582 2.00E-05 0.898 -1.113 6.56E-01 1.326 1.326 2.16E-01 0.928 -1.078 6.70E-01 1.568 1.568 1.00E-01 Prion protein, related 1803 2d prnprs1 Dr.90045 503701 0.476 -2.099 3.70E-04 0.430 -2.324 6.00E-05 1.265 1.265 4.14E-01 1.191 1.191 5.45E-01 1.208 1.208 5.25E-01 1.851 1.851 2.89E-03 sequence 1 1804 2d si:ch211-203h15.3 Si:ch211-203h15.3 Dr.108675 323050 0.531 -1.883 5.00E-05 0.820 -1.219 1.64E-01 0.851 -1.175 2.58E-01 1.132 1.132 3.84E-01 1.137 1.137 3.69E-01 1.132 1.132 4.22E-01 Nudix (nucleoside 1805 2d nudt1 diphosphate linked moiety Dr.76941 406727 0.655 -1.526 3.08E-07 0.783 -1.277 5.40E-04 0.901 -1.110 2.67E-01 0.989 -1.011 7.78E-01 1.147 1.147 1.89E-02 1.098 1.098 1.48E-01 X)-type motif 1 1806 2d zgc:110848 Zgc:110848 Dr.118397 503751 0.567 -1.762 4.35E-12 0.718 -1.393 9.15E-06 1.163 1.163 2.02E-01 1.102 1.102 4.20E-01 1.020 1.020 8.04E-01 0.974 -1.027 7.93E-01 1807 2d wu:fj01a12 Wu:fj01a12 Dr.80190 554089 0.656 -1.525 1.75E-06 0.780 -1.282 2.59E-03 1.077 1.077 3.81E-01 1.046 1.046 4.44E-01 0.977 -1.024 8.50E-01 0.982 -1.019 8.65E-01
Transcribed locus, weakly similar to NP_065708.1 1808 2d Dr.126204 Dr.126204 0.176 -5.676 3.34E-08 0.362 -2.766 7.65E-03 1.167 1.167 6.99E-01 1.286 1.286 5.37E-01 1.079 1.079 8.48E-01 0.749 -1.336 4.62E-01 finger protein 304 [Homo sapiens]
1809 2d zgc:103755 Zgc:103755 Dr.12697 449988 0.265 -3.776 4.59E-06 0.448 -2.231 6.91E-03 1.147 1.147 6.47E-01 1.387 1.387 3.06E-02 0.857 -1.167 3.82E-01 1.068 1.068 7.59E-01 1810 2d Dr.12823 Transcribed locus Dr.12823 0.534 -1.872 4.37E-07 0.819 -1.221 2.18E-01 1.106 1.106 5.72E-01 1.073 1.073 5.82E-01 0.979 -1.022 9.03E-01 0.896 -1.116 5.47E-01 1811 2d Dr.83069 Transcribed locus Dr.83069 0.505 -1.980 1.00E-05 0.816 -1.225 1.65E-01 1.008 1.008 9.74E-01 1.036 1.036 8.62E-01 1.040 1.040 6.41E-01 0.949 -1.053 7.79E-01 1812 2d Dr.86201 Transcribed locus Dr.86201 0.387 -2.587 7.61E-07 0.742 -1.348 6.37E-02 1.115 1.115 2.59E-01 1.086 1.086 4.11E-01 0.997 -1.003 9.89E-01 1.009 1.009 9.68E-01
Transcribed locus, weakly similar to XP_001105179.1 1813 2d Dr.13837 similar to patched domain Dr.13837 0.491 -2.036 9.00E-05 0.886 -1.128 5.68E-01 1.134 1.134 5.43E-01 1.193 1.193 2.16E-01 0.949 -1.054 6.59E-01 1.079 1.079 5.87E-01 containing 3 [Macaca mulatta]
1814 2d Dr.14870 Transcribed locus Dr.14870 0.486 -2.058 2.00E-05 0.765 -1.307 4.81E-02 1.150 1.150 4.05E-01 1.153 1.153 3.94E-01 0.893 -1.119 5.09E-01 1.110 1.110 4.11E-01 1815 2d zgc:65996 Zgc:65996 Dr.18197 336641 0.491 -2.037 9.11E-08 0.652 -1.535 8.00E-05 1.060 1.060 5.83E-01 0.966 -1.035 6.30E-01 1.030 1.030 7.06E-01 0.948 -1.055 2.32E-01 1816 2d zgc:103600 Zgc:103600 Dr.37357 492516 0.306 -3.273 1.59E-03 0.493 -2.028 9.57E-08 1.234 1.234 1.82E-02 0.847 -1.181 4.85E-02 1.335 1.335 1.14E-01 0.867 -1.153 5.09E-01 Neuroblastoma, 1817 2d nbl1 suppression of Dr.82779 404629 0.622 -1.607 5.00E-05 0.740 -1.351 8.90E-04 1.046 1.046 6.80E-01 0.887 -1.127 2.40E-01 1.075 1.075 5.13E-01 0.853 -1.173 1.02E-01 tumorigenicity 1 1818 2d il15l Interleukin 15, like Dr.37800 553172 0.621 -1.611 6.32E-10 0.699 -1.430 2.00E-05 0.967 -1.034 6.37E-01 1.004 1.004 9.58E-01 0.948 -1.055 4.34E-01 0.967 -1.034 6.38E-01 1819 2d zgc:92456 Zgc:92456 Dr.86760 445287 0.553 -1.809 5.68E-08 0.571 -1.752 1.50E-06 0.967 -1.034 8.42E-01 1.027 1.027 7.59E-01 0.859 -1.163 1.37E-01 0.931 -1.075 4.12E-01 1820 2d wu:fj04f08 Wu:fj04f08 Dr.80233 335346 0.665 -1.504 8.05E-07 0.693 -1.442 1.25E-03 0.994 -1.006 9.27E-01 1.031 1.031 6.02E-01 1.006 1.006 9.50E-01 0.890 -1.124 3.92E-02 1821 2d Dr.84409 Transcribed locus Dr.84409 0.173 -5.766 1.49E-12 0.397 -2.519 1.93E-03 0.782 -1.279 3.09E-01 0.996 -1.004 9.80E-01 0.732 -1.366 2.53E-01 0.941 -1.062 8.50E-01 1822 2d Dr.82700 Transcribed locus Dr.82700 0.358 -2.793 5.54E-06 0.494 -2.023 4.65E-03 0.979 -1.022 9.48E-01 1.442 1.442 4.35E-02 0.889 -1.125 5.26E-01 0.698 -1.432 1.59E-01 1823 2d crygm5 Crystallin, gamma M5 Dr.134555 474328 0.386 -2.588 4.68E-17 0.780 -1.282 8.78E-02 1.078 1.078 7.56E-01 1.109 1.109 5.96E-01 1.097 1.097 8.22E-01 0.597 -1.674 2.14E-01 1824 2d wu:fc15g08 Wu:fc15g08 Dr.77881 323970 0.643 -1.556 4.75E-06 0.928 -1.078 3.27E-01 1.249 1.249 7.04E-02 0.875 -1.143 1.68E-02 0.889 -1.124 1.69E-01 0.898 -1.113 7.28E-02 1825 2d Dr.89615 Transcribed locus Dr.89615 0.519 -1.927 2.81E-06 0.965 -1.036 8.20E-01 1.115 1.115 6.49E-01 0.948 -1.055 8.38E-01 0.874 -1.144 3.37E-01 0.882 -1.133 4.53E-01 1826 2d wu:fk85d05 Wu:fk85d05 Dr.107555 335180 0.826 -1.211 1.78E-01 0.494 -2.025 1.93E-12 1.200 1.200 1.13E-03 1.141 1.141 3.85E-01 1.439 1.439 1.58E-02 1.295 1.295 3.29E-01 1827 2d zgc:136311 Zgc:136311 Dr.132858 336252 0.909 -1.100 4.57E-01 0.551 -1.814 3.78E-11 1.108 1.108 4.24E-01 1.123 1.123 3.65E-01 1.432 1.432 2.61E-02 1.246 1.246 3.31E-01 1828 2d Dr.83209 Transcribed locus Dr.83209 0.829 -1.207 4.71E-01 0.406 -2.464 8.22E-06 1.420 1.420 7.45E-02 1.207 1.207 3.57E-01 1.515 1.515 1.70E-02 1.260 1.260 4.57E-01 1829 2d si:ch211-241e1.5 Si:ch211-241e1.5 Dr.80697 334366 0.963 -1.039 8.25E-01 0.646 -1.547 3.24E-07 1.026 1.026 8.71E-01 1.048 1.048 7.32E-01 1.269 1.269 1.68E-02 1.055 1.055 7.62E-01 1830 2d wu:fl03d04 Wu:fl03d04 Dr.107584 335268 0.970 -1.030 8.81E-01 0.632 -1.583 3.69E-10 1.289 1.289 4.76E-01 0.982 -1.018 9.47E-01 1.453 1.453 1.70E-01 0.974 -1.027 8.84E-01 1831 2d wu:fj85a06 Wu:fj85a06 Dr.113601 337584 0.973 -1.027 8.29E-01 0.595 -1.680 1.95E-07 1.234 1.234 4.50E-01 0.980 -1.021 9.40E-01 1.453 1.453 1.77E-02 1.025 1.025 8.77E-01 1832 2d Hrc Hrc protein Dr.79314 553296 1.003 1.003 9.92E-01 0.525 -1.905 4.99E-02 1.115 1.115 6.61E-01 0.887 -1.128 6.17E-01 1.670 1.670 1.28E-09 0.927 -1.078 7.55E-01 1833 2d LOC100002770 Similar to EphA4 protein Dr.47585 100002770 0.923 -1.083 5.88E-01 0.499 -2.003 1.00E-05 1.132 1.132 4.74E-01 0.856 -1.168 3.43E-01 1.174 1.174 2.47E-01 1.017 1.017 8.72E-01 1834 2d Dr.80904 Transcribed locus Dr.80904 0.704 -1.421 1.22E-01 0.398 -2.511 6.00E-05 1.433 1.433 1.87E-02 0.862 -1.160 3.09E-01 1.431 1.431 3.19E-03 0.963 -1.038 7.09E-01 Suppressor of variegation 1835 2d suv420h1 4-20 homolog 1 Dr.77736 572849 0.866 -1.155 3.64E-01 0.465 -2.150 8.00E-05 1.083 1.083 7.30E-01 1.135 1.135 5.73E-01 1.362 1.362 9.44E-02 0.805 -1.242 2.41E-01 (Drosophila) 1836 2d zgc:110525 Zgc:110525 Dr.76821 503767 0.764 -1.309 1.57E-02 0.482 -2.073 9.98E-06 0.846 -1.182 5.62E-01 0.809 -1.236 4.58E-01 1.957 1.957 3.23E-02 0.772 -1.295 1.26E-01 1837 2d wu:fb98c10 Wu:fb98c10 Dr.77747 323431 0.663 -1.509 4.70E-04 0.412 -2.427 2.95E-02 0.967 -1.034 9.24E-01 0.826 -1.210 5.73E-01 2.331 2.331 2.71E-08 1.108 1.108 7.83E-01 1838 2d Dr.83842 Transcribed locus Dr.83842 0.583 -1.714 2.04E-01 0.425 -2.351 4.98E-02 1.171 1.171 5.09E-01 1.034 1.034 9.08E-01 2.113 2.113 1.18E-06 0.985 -1.015 9.21E-01 1839 2d zgc:158494 Zgc:158494 Dr.107928 386720 0.811 -1.232 2.96E-01 0.798 -1.252 3.77E-01 1.414 1.414 5.15E-02 0.771 -1.297 2.25E-01 1.359 1.359 4.30E-04 1.528 1.528 2.56E-13 1840 2d Dr.108238 Transcribed locus Dr.108238 0.896 -1.116 4.82E-01 0.631 -1.585 5.00E-05 1.323 1.323 3.88E-01 0.886 -1.129 6.65E-01 1.353 1.353 6.61E-02 1.461 1.461 5.02E-02 1841 2d caspxa Caspase Xa Dr.86735 794756 0.689 -1.451 1.47E-01 0.343 -2.912 5.73E-03 1.217 1.217 5.49E-01 0.860 -1.163 6.49E-01 2.650 2.650 1.00E-04 3.043 3.043 6.00E-05 1842 2d crygm2b Crystallin, gamma M2b Dr.116427 553954 0.612 -1.633 1.71E-01 0.570 -1.755 3.93E-03 1.459 1.459 1.04E-01 0.954 -1.048 7.69E-01 3.822 3.822 9.17E-07 1.722 1.722 5.06E-02 1843 2d Dr.21609 Transcribed locus Dr.21609 0.802 -1.247 7.04E-02 0.676 -1.479 6.64E-03 1.131 1.131 5.56E-01 0.955 -1.047 8.29E-01 1.563 1.563 1.00E-05 1.255 1.255 1.30E-01 1844 2d wu:fb54d07 Wu:fb54d07 Dr.33295 322245 0.837 -1.194 1.10E-01 0.501 -1.998 2.21E-02 1.581 1.581 2.47E-03 1.152 1.152 3.21E-01 2.116 2.116 6.00E-05 1.372 1.372 3.94E-01 1845 2d Dr.70517 Transcribed locus Dr.70517 0.788 -1.269 1.58E-01 0.538 -1.858 1.06E-06 1.623 1.623 9.62E-03 1.128 1.128 5.11E-01 1.647 1.647 8.90E-04 1.087 1.087 7.40E-01 1846 2d LOC559420 Similar to hCG28723 Dr.84169 559420 0.721 -1.387 2.06E-01 0.663 -1.509 4.83E-02 1.624 1.624 1.02E-02 0.999 -1.001 9.95E-01 1.893 1.893 1.81E-06 1.087 1.087 7.25E-01 1847 2d wu:fc07b09 Wu:fc07b09 Dr.104714 323691 1.005 1.005 9.83E-01 0.747 -1.339 1.23E-01 1.584 1.584 5.00E-05 1.016 1.016 9.58E-01 1.033 1.033 8.77E-01 0.802 -1.246 2.40E-01 Fibroblast growth factor 1848 2d fgfrl1b Dr.37960 497135 1.017 1.017 9.53E-01 0.789 -1.268 4.33E-01 1.879 1.879 1.03E-08 1.256 1.256 3.36E-01 1.025 1.025 8.37E-01 0.746 -1.341 4.82E-02 receptor-like 1b Hypothetical protein 1849 2d LOC100001935 Dr.44195 100001935 0.793 -1.261 6.05E-01 0.808 -1.237 7.02E-01 1.806 1.806 1.10E-09 0.903 -1.108 7.75E-01 1.199 1.199 4.77E-01 0.971 -1.030 9.11E-01 LOC100001935 Retinol binding protein 2b, 1850 2d rbp2b Dr.89689 432384 0.554 -1.804 4.00E-05 0.627 -1.595 3.94E-02 2.114 2.114 1.02E-02 1.132 1.132 5.40E-01 1.205 1.205 2.15E-01 0.773 -1.293 2.31E-01 cellular 1851 2d Dr.124799 Transcribed locus Dr.124799 1.266 1.266 4.74E-01 0.969 -1.032 9.24E-01 1.842 1.842 5.00E-05 1.148 1.148 4.44E-01 1.336 1.336 1.34E-02 0.879 -1.137 4.09E-01 1852 2d zgc:113947 Zgc:113947 Dr.140628 403081 1.141 1.141 3.54E-01 0.920 -1.087 6.40E-01 1.674 1.674 2.50E-04 0.934 -1.071 6.41E-01 1.728 1.728 4.42E-14 0.991 -1.009 9.75E-01 1853 2d wu:fc35a10 Wu:fc35a10 Dr.5234 324618 1.177 1.177 2.92E-01 0.806 -1.241 2.13E-01 1.662 1.662 1.14E-02 1.007 1.007 9.73E-01 1.938 1.938 3.16E-06 0.781 -1.281 3.87E-01 1854 2d si:dkeyp-113f10.1 Si:dkeyp-113f10.1 Dr.81070 336053 1.148 1.148 4.59E-01 1.246 1.246 3.08E-01 1.699 1.699 3.60E-07 0.919 -1.088 6.64E-01 1.026 1.026 8.88E-01 0.791 -1.265 5.60E-04
Similar to retinitis 1855 3 LOC557752 pigmentosa GTPase Dr.100975 557752 2.433 2.433 5.00E-05 1.871 1.871 3.54E-03 0.964 -1.037 7.57E-01 1.239 1.239 4.95E-02 0.943 -1.060 7.72E-01 0.701 -1.426 1.03E-01 regulator
Transcribed locus, weakly similar to XP_001096124.1 similar to catechol-O- 1856 3 Dr.131225 Dr.131225 1.741 1.741 1.83E-08 1.433 1.433 6.16E-03 0.856 -1.169 4.23E-01 1.026 1.026 9.11E-01 0.857 -1.167 6.72E-02 0.713 -1.402 5.19E-02 methyltransferase domain containing 1 [Macaca mulatta]
Hypothetical protein 1857 3 LOC100006949 Dr.113861 100006949 2.527 2.527 2.00E-05 1.584 1.584 1.23E-01 1.146 1.146 5.36E-01 0.894 -1.119 7.54E-01 1.309 1.309 4.21E-01 0.604 -1.655 1.16E-01 LOC100006949 1858 3 Dr.12002 Transcribed locus Dr.12002 1.667 1.667 4.61E-06 1.483 1.483 3.94E-02 1.286 1.286 3.35E-02 1.089 1.089 5.54E-01 0.985 -1.015 8.63E-01 0.719 -1.390 4.60E-04 Hypothetical protein 1859 3 LOC798123 Dr.107566 798123 1.587 1.587 7.51E-06 1.102 1.102 3.49E-01 0.901 -1.109 1.74E-01 0.963 -1.039 6.84E-01 0.831 -1.203 2.10E-04 0.939 -1.065 4.34E-01 LOC798123 1860 3 LOC568537 Hypothetical LOC568537 Dr.78812 568537 1.719 1.719 3.00E-05 1.084 1.084 4.34E-01 0.867 -1.153 2.80E-01 0.864 -1.158 2.97E-02 0.855 -1.169 2.16E-01 0.883 -1.132 3.14E-01 Nuclear receptor subfamily 1861 3 nr0b1 Dr.74816 100008590 1.823 1.823 9.51E-08 1.263 1.263 1.08E-01 0.840 -1.190 1.05E-01 0.904 -1.107 2.22E-01 0.887 -1.128 6.94E-02 0.888 -1.126 2.54E-01 0, group B, member 1
Transcribed locus, weakly similar to NP_031886.3 1862 3 Dr.76544 Dr.76544 1.736 1.736 3.85E-08 1.276 1.276 1.86E-01 0.905 -1.105 5.67E-01 0.833 -1.201 1.45E-01 0.849 -1.178 4.67E-01 0.935 -1.069 6.09E-01 iodothyronine, type I [Mus musculus]
Similar to Dystrobrevin 1863 3 LOC100007489 Dr.118558 100007489 1.934 1.934 8.00E-05 1.143 1.143 5.44E-01 0.973 -1.028 8.59E-01 0.780 -1.282 1.94E-01 0.895 -1.117 5.78E-01 1.051 1.051 7.72E-01 binding protein 1 1864 3 zgc:123291 Zgc:123291 Dr.39466 555725 1.621 1.621 4.70E-06 1.415 1.415 2.00E-04 1.118 1.118 1.53E-01 0.899 -1.112 4.96E-01 0.962 -1.040 7.46E-01 0.916 -1.092 5.29E-01
Transcribed locus, strongly similar to XP_001346068.1 1865 3 Dr.75718 similar to putative G Dr.75718 1.925 1.925 3.00E-05 1.490 1.490 8.26E-02 0.971 -1.030 8.75E-01 0.786 -1.272 2.08E-01 0.946 -1.057 6.91E-01 0.994 -1.006 9.57E-01 protein-coupled Receptor [Danio rerio]
Wingless-type MMTV 1866 3 wnt1 integration site family, Dr.85371 30128 1.527 1.527 3.49E-06 1.744 1.744 1.22E-03 1.038 1.038 7.63E-01 0.768 -1.302 1.12E-01 0.868 -1.152 1.45E-01 0.908 -1.101 1.68E-01 member 1 1867 3 zgc:110361 Zgc:110361 Dr.40351 550478 1.726 1.726 1.59E-12 1.477 1.477 3.80E-04 0.898 -1.114 2.45E-01 0.924 -1.082 3.68E-01 0.733 -1.364 8.33E-06 0.814 -1.229 3.70E-04 1868 3 wu:fi15d04 Wu:fi15d04 Dr.79942 327519 1.823 1.823 8.00E-05 1.537 1.537 2.87E-03 0.886 -1.129 5.38E-01 0.785 -1.274 3.00E-02 0.721 -1.386 1.01E-01 0.913 -1.096 6.72E-01 1869 3 wu:fb48a08 Wu:fb48a08 Dr.77186 322050 2.927 2.927 5.54E-16 1.931 1.931 2.04E-02 1.308 1.308 1.68E-01 0.785 -1.273 3.58E-01 0.628 -1.593 1.90E-04 0.565 -1.770 5.50E-04 1870 3 LOC100000144 Similar to KIAA1797 Dr.85734 100000144 4.245 4.245 2.00E-05 1.374 1.374 3.70E-01 1.190 1.190 6.46E-01 0.728 -1.374 3.44E-01 1.384 1.384 1.99E-01 0.919 -1.088 8.03E-01 1871 3 zgc:91880 Zgc:91880 Dr.105402 431733 1.289 1.289 1.01E-01 1.583 1.583 3.00E-05 0.919 -1.088 5.54E-01 1.080 1.080 4.08E-01 1.147 1.147 3.93E-01 1.142 1.142 5.07E-02 Coiled-coil domain 1872 3 ccdc24 Dr.105612 541495 1.925 1.925 9.10E-04 2.279 2.279 5.53E-09 0.932 -1.073 5.36E-01 1.318 1.318 1.51E-02 1.164 1.164 3.69E-01 1.288 1.288 1.19E-01 containing 24 Transcribed locus, moderately similar to XP_001110578.1 similar 1873 3 Dr.123832 to solute carrier family 37 Dr.123832 1.394 1.394 8.69E-03 1.728 1.728 1.68E-06 0.930 -1.075 6.73E-01 1.189 1.189 2.85E-01 0.962 -1.040 6.29E-01 1.320 1.320 7.80E-04 (glycerol-3-phosphate transporter), member 2 [Macaca mulatta]
Transcribed locus, weakly similar to XP_001096584.1 heterogeneous nuclear 1874 3 Dr.122348 Dr.122348 1.544 1.544 3.72E-02 1.897 1.897 8.85E-07 0.996 -1.004 9.78E-01 1.113 1.113 5.32E-01 1.027 1.027 8.72E-01 1.037 1.037 8.21E-01 ribonucleoprotein C (C1/C2) isoform 7 [Macaca mulatta]
1875 3 wu:fc17h04 Wu:fc17h04 Dr.122420 324068 1.369 1.369 3.69E-02 1.624 1.624 3.00E-05 1.010 1.010 9.45E-01 1.017 1.017 9.21E-01 1.025 1.025 8.50E-01 1.022 1.022 9.04E-01 1876 3 stc1 Stanniocalcin 1 Dr.88421 393511 1.934 1.934 3.85E-16 2.326 2.326 2.27E-25 0.933 -1.072 5.04E-01 1.083 1.083 4.31E-01 0.896 -1.116 3.50E-01 1.055 1.055 6.49E-01 1877 3 efnb2b Ephrin B2b Dr.12618 114402 1.674 1.674 2.44E-03 1.862 1.862 4.00E-05 1.023 1.023 7.84E-01 1.045 1.045 2.71E-01 1.055 1.055 3.70E-01 1.193 1.193 2.76E-02 1878 3 LOC563864 Hypothetical LOC563864 Dr.81746 563864 2.601 2.601 9.00E-05 2.688 2.688 7.00E-05 1.042 1.042 9.14E-01 0.918 -1.090 7.54E-01 1.100 1.100 7.18E-01 0.939 -1.065 7.54E-01 Hypothetical protein 1879 3 LOC100006440 Dr.67374 100006440 1.331 1.331 6.79E-03 1.501 1.501 8.00E-05 0.905 -1.106 1.82E-01 0.949 -1.053 4.96E-01 0.927 -1.079 7.29E-01 1.002 1.002 9.91E-01 LOC100006440 Murine double minute 2 1880 3 mdm2 Dr.75764 30637 1.460 1.460 5.11E-09 1.533 1.533 4.49E-10 0.889 -1.125 1.25E-02 0.958 -1.044 4.93E-01 1.002 1.002 9.87E-01 1.193 1.193 1.93E-01 homolog 1881 3 pim1 Pim-1 oncogene Dr.78102 58054 1.751 1.751 1.13E-17 1.773 1.773 0.00E+00 0.738 -1.355 2.86E-09 1.153 1.153 3.96E-02 1.002 1.002 9.85E-01 1.065 1.065 3.20E-01 Cytochrome P450, 1882 3 cyp11a1 subfamily XIA, polypeptide Dr.80336 80374 1.657 1.657 5.00E-05 1.485 1.485 9.80E-04 0.896 -1.116 3.83E-01 1.084 1.084 7.01E-01 1.142 1.142 9.71E-02 1.124 1.124 5.08E-01 1 1883 3 zgc:92167 Zgc:92167 Dr.111731 436621 2.062 2.062 1.00E-05 3.092 3.092 8.33E-14 1.004 1.004 9.79E-01 0.809 -1.236 1.11E-02 1.441 1.441 7.20E-04 1.268 1.268 1.64E-03 1884 3 zgc:101886 Zgc:101886 Dr.86897 492502 1.844 1.844 6.10E-04 2.163 2.163 3.81E-09 1.170 1.170 2.91E-01 0.877 -1.140 4.88E-01 1.288 1.288 1.60E-01 1.243 1.243 2.14E-01 Tumor necrosis factor, 1885 3 tnfaip8 Dr.105711 393303 1.577 1.577 9.24E-10 1.480 1.480 1.36E-06 1.024 1.024 6.63E-01 1.215 1.215 4.50E-04 0.931 -1.074 4.59E-01 1.190 1.190 3.82E-02 alpha-induced protein 8 1886 3 LOC561108 Hypothetical LOC561108 Dr.86831 561108 1.932 1.932 9.67E-09 1.796 1.796 4.88E-09 1.071 1.071 4.42E-01 1.396 1.396 1.50E-04 0.964 -1.037 7.29E-01 1.263 1.263 4.38E-03 1887 3 wu:fc51f03 Wu:fc51f03 Dr.78985 325018 1.771 1.771 1.87E-20 1.823 1.823 1.89E-19 1.017 1.017 8.12E-01 1.387 1.387 2.50E-04 0.870 -1.149 1.63E-01 1.219 1.219 1.62E-01 Bone morphogenetic 1888 3 bmp2b Dr.568 30632 1.582 1.582 2.70E-02 1.560 1.560 5.78E-12 0.990 -1.010 9.40E-01 1.284 1.284 2.49E-01 0.849 -1.178 2.97E-01 1.302 1.302 3.54E-01 protein 2b 1889 3 LOC799377 Similar to dickkopf1 Dr.117628 799377 1.730 1.730 6.00E-05 1.274 1.274 1.51E-01 1.083 1.083 4.75E-01 1.159 1.159 3.01E-01 0.872 -1.147 3.99E-01 1.119 1.119 5.25E-01 Hypothetical protein 1890 3 LOC792525 Dr.139178 792525 4.545 4.545 2.30E-07 2.279 2.279 1.84E-02 0.983 -1.018 9.28E-01 1.149 1.149 3.66E-01 0.637 -1.569 5.40E-02 1.037 1.037 8.58E-01 LOC792525 Hypothetical protein 1891 3 LOC100006524 Dr.13947 100006524 1.556 1.556 4.00E-05 1.443 1.443 1.52E-02 0.957 -1.045 6.00E-01 1.019 1.019 8.24E-01 0.776 -1.288 7.86E-03 1.217 1.217 1.66E-02 LOC100006524 1892 3 hp Haptoglobin Dr.115936 322539 3.074 3.074 2.60E-04 1.759 1.759 1.00E-05 1.190 1.190 2.03E-01 1.214 1.214 3.03E-01 1.382 1.382 2.19E-01 1.523 1.523 3.46E-02 1893 3 Dr.85684 Transcribed locus Dr.85684 3.658 3.658 5.27E-07 2.202 2.202 9.28E-02 1.207 1.207 6.25E-01 1.049 1.049 8.86E-01 1.209 1.209 3.91E-01 1.188 1.188 4.91E-01 1894 3 zgc:112143 Zgc:112143 Dr.76505 550429 8.051 8.051 0.00E+00 9.257 9.257 0.00E+00 1.707 1.707 5.49E-13 1.579 1.579 1.61E-03 1.961 1.961 2.02E-06 2.866 2.866 1.67E-09 Nuclear factor of kappa light polypeptide gene 1895 3 nfkb2 Dr.117553 415100 2.281 2.281 1.07E-06 2.091 2.091 2.71E-08 0.962 -1.040 4.24E-01 1.266 1.266 1.30E-04 1.051 1.051 3.60E-01 1.902 1.902 2.06E-11 enhancer in B-cells 2, p49/p100 1896 3 zgc:92367 Zgc:92367 Dr.81587 445119 1.991 1.991 1.79E-15 1.613 1.613 3.73E-06 1.017 1.017 6.91E-01 1.208 1.208 3.94E-02 1.043 1.043 5.10E-01 1.491 1.491 4.29E-03 1897 3 cldnc Claudin c Dr.12596 81582 1.530 1.530 9.99E-12 1.376 1.376 4.23E-10 1.077 1.077 2.85E-01 1.199 1.199 1.27E-01 1.062 1.062 4.00E-01 1.236 1.236 1.07E-02 Nuclear factor of kappa light polypeptide gene 1898 3 nfkbiab Dr.77409 323099 2.116 2.116 7.96E-27 1.623 1.623 1.37E-11 1.121 1.121 6.17E-07 1.134 1.134 1.18E-03 1.262 1.262 6.00E-05 2.007 2.007 7.34E-21 enhancer in B-cells inhibitor, alpha b
V-rel reticuloendotheliosis 1899 3 rel Dr.86023 415101 2.507 2.507 4.40E-23 1.885 1.885 0.00E+00 1.073 1.073 9.18E-02 1.393 1.393 1.47E-13 1.170 1.170 1.36E-01 2.251 2.251 4.82E-09 viral oncogene homolog
1900 3 LOC560193 Hypothetical LOC560193 Dr.119093 560193 2.732 2.732 6.73E-06 1.882 1.882 5.00E-05 0.992 -1.008 9.11E-01 1.005 1.005 9.46E-01 1.000 -1.000 1.00E+00 1.853 1.853 8.88E-08
Transcribed locus, strongly similar to XP_001331660.1 1901 3 Dr.123559 Dr.123559 4.652 4.652 9.78E-28 3.646 3.646 4.19E-20 0.940 -1.064 4.87E-01 1.060 1.060 5.14E-01 1.124 1.124 2.88E-01 2.638 2.638 2.63E-18 hypothetical protein [Danio rerio]
Hypothetical protein 1902 3 LOC795529 Dr.80961 795529 2.417 2.417 4.73E-40 2.092 2.092 1.98E-12 1.041 1.041 7.63E-01 0.946 -1.057 7.50E-01 0.946 -1.057 3.55E-01 1.594 1.594 2.78E-09 LOC795529 1903 3 LOC561001 Hypothetical LOC561001 Dr.74671 561001 4.629 4.629 0.00E+00 3.604 3.604 3.42E-35 1.000 1.000 9.99E-01 1.070 1.070 6.13E-01 1.308 1.308 1.00E-04 3.642 3.642 2.37E-29 1904 3 wu:fj85b02 Wu:fj85b02 Dr.81541 337585 2.660 2.660 3.49E-07 1.635 1.635 1.80E-04 0.838 -1.193 5.94E-02 0.924 -1.083 6.04E-01 1.111 1.111 3.75E-01 1.477 1.477 9.70E-04 1905 3 zgc:101794 Zgc:101794 Dr.114873 447881 1.086 1.086 2.76E-01 1.516 1.516 2.09E-08 0.764 -1.309 4.86E-02 0.749 -1.334 4.04E-02 1.243 1.243 7.88E-03 1.149 1.149 1.30E-01 1906 3 wu:fi38b05 Wu:fi38b05 Dr.75367 406447 1.204 1.204 1.64E-01 1.677 1.677 9.73E-06 0.833 -1.200 2.93E-01 0.800 -1.250 1.85E-01 0.996 -1.004 9.86E-01 1.319 1.319 3.13E-01 FAT tumor suppressor 1907 3 fat Dr.87471 406172 1.284 1.284 6.90E-04 1.677 1.677 1.39E-13 0.901 -1.110 2.12E-01 0.840 -1.190 1.53E-01 1.225 1.225 1.02E-02 1.250 1.250 5.04E-06 homolog 1 1908 3 riok3 RIO kinase 3 (yeast) Dr.34142 445220 1.192 1.192 5.56E-01 1.491 1.491 1.98E-01 0.914 -1.094 6.43E-01 0.963 -1.038 7.99E-01 1.696 1.696 1.81E-31 1.651 1.651 2.07E-02 Hypothetical protein 1909 3 LOC793576 Dr.86450 793576 1.107 1.107 6.63E-01 1.567 1.567 9.99E-02 0.870 -1.149 5.40E-01 0.556 -1.800 2.02E-02 1.922 1.922 4.38E-03 2.804 2.804 1.00E-05 LOC793576 Transcribed locus, moderately similar to 1910 3 Dr.123298 XP_001111763.1 similar Dr.123298 0.799 -1.252 6.43E-01 2.258 2.258 5.00E-05 1.432 1.432 2.73E-01 0.859 -1.164 7.24E-01 0.959 -1.042 8.98E-01 0.852 -1.174 5.93E-01 to Protein MICAL-3 [Macaca mulatta] 1911 3 ttna Titin a Dr.140815 317731 0.830 -1.205 3.84E-01 2.391 2.391 1.05E-15 0.939 -1.065 6.96E-01 1.047 1.047 8.15E-01 1.154 1.154 4.44E-01 1.051 1.051 8.07E-01 ST6 beta-galactosamide 1912 3 st6gal2 Dr.82299 403116 0.846 -1.182 2.47E-01 1.862 1.862 4.96E-06 0.945 -1.058 5.41E-01 1.035 1.035 7.96E-01 0.942 -1.062 4.33E-01 1.483 1.483 6.50E-04 alpha-2,6-sialyltranferase 2
Ventral expressed 1913 3 vent Dr.106743 64810 1.094 1.094 7.37E-01 1.522 1.522 3.58E-02 1.298 1.298 1.75E-01 1.755 1.755 1.93E-10 0.836 -1.196 2.93E-01 0.961 -1.040 9.24E-01 homeobox V-mos Moloney murine 1914 3 mos sarcoma viral oncogene Dr.118177 402817 1.215 1.215 1.92E-01 1.258 1.258 2.98E-02 1.277 1.277 2.37E-02 1.607 1.607 4.38E-08 0.919 -1.088 4.94E-02 1.076 1.076 2.84E-01 homolog 1915 3 Dr.122260 Transcribed locus Dr.122260 0.694 -1.441 4.86E-01 2.234 2.234 5.89E-02 1.217 1.217 6.74E-01 3.313 3.313 7.43E-07 0.586 -1.706 5.28E-02 0.998 -1.002 9.95E-01 Supplementary Table VI. Master-target test of GO analysis of up-regulated genes for Molecular Function*
S. typhimurium Ra mutant S. typhimurium wild type GO-term Name target lists target lists master 2h 5h 8h 24h 2h 5h 8h 24h zebrafish UniGene identifiers GO:0003674 molecular_function 6518 41 32 163 56 44 64 260 878 GO:0016209 antioxidant activity 15 0 0 0 0 0 0 0 4 GO:0015457 auxiliary transport protein activity 162 1 0 2 1 3 2 5 19 GO:0005488 binding 3192 23 13 74 28 27 31 131 448 GO:0003824 catalytic activity 1875 11 11 49 16 11 21 77 279 GO:0030234 enzyme regulator activity 187 1 6 8 6 2 8 12 38 GO:0060089 molecular transducer activity 473 4 6 10 2 4 6 18 46 GO:0003774 motor activity 27 0 1 1 0 0 0 1 2 GO:0005198 structural molecule activity 185 2 0 6 0 0 0 11 18 GO:0030528 transcription regulator activity 517 5 1 14 6 6 4 26 71 GO:0045182 translation regulator activity 35 0 0 2 0 0 0 1 4 GO:0005215 transporter activity 461 2 3 16 6 4 7 25 65 UniGene identifiers of human homologs GO:0003674 molecular_function 6479 52 41 252 53 47 76 364 1414 GO:0016209 antioxidant activity 21 0 0 1 0 1 0 2 6 GO:0015457 auxiliary transport protein activity 9 0 0 0 0 0 0 0 2 GO:0005488 binding 5218 43 36 211 45 44 62 301 1173 GO:0003824 catalytic activity 2575 18 18 91 21 18 32 135 586 GO:0030188 chaperone regulator activity 5 0 0 1 0 0 0 1 1 GO:0042056 chemoattractant activity 2 0 0 0 0 0 0 0 0 GO:0045499 chemorepellant activity 1 0 0 0 0 0 0 0 0 GO:0030234 enzyme regulator activity 315 4 7 13 12 4 11 19 84 GO:0060089 molecular transducer activity 679 13 7 21 7 10 11 34 135 GO:0003774 motor activity 66 1 1 2 0 0 0 4 8 GO:0005198 structural molecule activity 327 4 1 19 1 2 2 22 56 GO:0030528 transcription regulator activity 688 7 2 31 6 9 6 50 143 GO:0045182 translation regulator activity 70 0 0 4 0 0 0 4 25 GO:0005215 transporter activity 505 1 8 23 11 2 15 43 120
* A master-target statistical test using eGOn software was performed with input gene lists of zebrafish UniGene identifiers or the UniGene identifiers of their human homologs. The master input lists contained all UniGene identifiers present on the microarray (19122 zebrafish UniGenes, for 10620 of which the human homologs could be identified). The target lists contained the UniGene identifiers that were > 1.5-fold up-regulated (p < 0.0001) at different time points of S. typhimurium wild type or Ra mutant infection. The table indicates the number of genes in each list that are associated with the indicated GO-terms. Highlighted numbers are significantly enriched in the target list compared to the master (p < 0.01). It should be noted that genes can be associated with more than one GO-term. Supplementary Table VII. Master-target test of GO analysis of up-regulated genes for Cellular Component*
S. typhimurium Ra mutant target S. typhimurium wild type target GO-term Name lists lists master 2h 5h 8h 24h 2h 5h 8h 24h zebrafish UniGene identifiers GO:0005575 cellular_component 5663 38 29 149 50 39 57 234 742 GO:0005623 cell 2889 22 16 83 24 25 28 131 356 GO:0044464 cell part 2889 22 16 83 24 25 28 131 356 GO:0031975 envelope 82 0 0 5 0 0 0 5 7 GO:0031012 extracellular matrix 31 1 1 3 3 1 2 4 4 GO:0044420 extracellular matrix part 12 0 0 0 0 0 0 0 0 GO:0005576 extracellular region 169 10 10 15 19 9 17 25 40 GO:0044421 extracellular region part 48 2 2 4 5 2 4 7 6 GO:0032991 macromolecular complex 1040 6 9 27 8 6 11 44 121 GO:0031974 membrane-enclosed lumen 72 0 0 2 0 0 0 2 15 GO:0043226 organelle 1262 7 2 39 7 9 5 50 124 GO:0044422 organelle part 347 1 1 14 0 2 0 12 35 GO:0045202 synapse 13 0 0 0 0 0 0 0 0 GO:0044456 synapse part 11 0 0 0 0 0 0 0 0 UniGene identifiers of human homologs GO:0005575 cellular_component 6001 49 37 249 53 46 76 362 1309 GO:0005623 cell 5672 41 26 226 40 37 62 333 1230 GO:0044464 cell part 5672 41 26 226 40 37 62 333 1230 GO:0031975 envelope 223 1 0 7 1 0 1 11 46 GO:0031012 extracellular matrix 134 5 4 12 4 3 5 13 23 GO:0044420 extracellular matrix part 48 2 1 3 1 1 1 3 3 GO:0005576 extracellular region 368 12 13 28 18 11 20 36 89 GO:0044421 extracellular region part 260 10 10 24 11 10 14 28 61 GO:0032991 macromolecular complex 1114 7 7 52 6 4 14 60 181 GO:0031974 membrane-enclosed lumen 400 1 1 10 1 2 2 14 75 GO:0043226 organelle 3227 21 8 133 25 19 24 189 678 GO:0044422 organelle part 1286 6 3 41 4 4 6 51 215 GO:0045202 synapse 90 1 0 2 1 0 2 4 13 GO:0044456 synapse part 19 1 0 0 1 0 1 1 1
* A master-target statistical test using eGOn software was performed with input gene lists of zebrafish UniGene identifiers or the UniGene identifiers of their human homologs. The master input lists contained all UniGene identifiers present on the microarray (19122 zebrafish UniGenes, for 10620 of which the human homologs could be identified). The target lists contained the UniGene identifiers that were > 1.5-fold up-regulated (p < 0.0001) at different time points of S. typhimurium wild type or Ra mutant infection. The table indicates the number of genes in each list that are associated with the indicated GO-terms. Highlighted numbers are significantly enriched in the target list compared to the master (p < 0.01). It should be noted that genes can be associated with more than one GO-term.
Supplementary Table VIII. Identification of novel immune genes
A. S. typhimurium wt vs. control*
Gene Symbol UniGene Code Entrez GeneID Category 1 Category 2 Category 3 Category 4 (build # 105) abcb3 Dr.88570 368771 abcb3 accn2b Dr.98481 407671 accn2b aco1 Dr.40063 568448 aco1 acta1 Dr.75552 58114 acta1 ada Dr.120392 436919 ada adam8 Dr.86401 368917 adam8 admp Dr.80639 140619 admp agk Dr.80681 334270 agk agpat3 Dr.75961 406734 agpat3 agps Dr.101140 386801 agps ak5 Dr.81461 336312 ak5 aldh2 Dr.28434 393462 aldh2 alox12 Dr.132326 322732 alox12 apbb1ip Dr.88358 393607 apbb1ip apoa1 Dr.75775 30355 apoa1 arg2 Dr.77297 322614 arg2 arhgef1 Dr.133654 368266 arhgef1 arih1 Dr.75869 327005 arih1 arl2bp Dr.110760 393976 arl2bp asb13 Dr.31363 436801 asb13 asns Dr.25168 394138 asns aspn Dr.81771 65228 aspn atf3 Dr.77523 393939 atf3 atg4c Dr.121931 415193 atg4c atp11c Dr.132351 368385 atp11c atp1a1a.3 Dr.10713 245703 atp1a1a.3 atp6v1b2 Dr.132618 359840 atp6v1b2 aven Dr.21346 692323 aven b3gnt5 Dr.76667 336526 b3gnt5 bactin2 Dr.75125 57935 bactin2 baz1a Dr.36447 334173 baz1a bcat1 Dr.80309 337412 bcat1 bcl6 Dr.115290 393707 bcl6 bida Dr.84878 559425 bida bmp2b Dr.568 30632 bmp2b brd1 Dr.91233 449908 brd1 brf1 Dr.20342 334402 brf1 btbd2 Dr.107582 373096 btbd2 c3b Dr.21006 30491 c3b c3c Dr.88584 30492 c3c c6 Dr.16392 393611 c6 c6orf83 Dr.134087 393343 c6orf83 cacna1c Dr.83683 170581 cacna1c cacng1 Dr.132288 322013 cacng1 caspxa Dr.86735 794756 caspxa cbx8 Dr.81470 404038 cbx8 ccdc24 Dr.105612 541495 ccdc24 ccdc43 Dr.85117 393631 ccdc43 cdc123 Dr.134594 393694 cdc123 cebp1 Dr.41318 114453 cebp1 cebpb Dr.79988 140814 cebpb cebpd Dr.1280 140817 cebpd cebpg Dr.15663 140816 cebpg cfb Dr.75096 30604 cfb CH211- CH211- Dr.112790 564179 119C20.3 119C20.3
CH211-133N4.6 Dr.132691 797776 CH211-133N4.6
CH211- CH211- Dr.119543 563855 244P18.4 244P18.4
CH211-45M15.1 Dr.82864 556137 CH211-45M15.1
CH211-89F7.4 Dr.133987 794891 CH211-89F7.4 chac Dr.19565 378837 chac chac1 Dr.76600 323237 chac1 chad Dr.80402 394038 chad chrm5 Dr.94295 561491 chrm5 chrngl Dr.21772 325080 chrngl cldnf Dr.76180 791933 cldnf clock3 Dr.86747 352927 clock3 clstn1 Dr.53665 777737 clstn1 copb2 Dr.14625 114454 copb2 coro1a Dr.114363 337566 coro1a cpa5 Dr.77201 246092 cpa5 crabp2a Dr.104443 324997 crabp2a creb3l3 Dr.79921 406853 creb3l3 cry2a Dr.116325 83779 cry2a crygs3 Dr.92878 550617 crygs3 ctnna2 Dr.86260 553258 ctnna2 ctsk Dr.76224 791982 ctsk ctssa Dr.81560 393398 ctssa cxcr3.2 Dr.82754 492348 cxcr3.2 cxcr7b Dr.114187 561050 cxcr7b cyp17a1 Dr.79318 399692 cyp17a1 dao.1 Dr.47162 619259 dao.1 dapk3 Dr.132498 324306 dapk3 dapk3 Dr.3200 324306 dapk3 dio1 Dr.116077 352936 dio1
DKEY-105N5.1 Dr.92711 100005433 DKEY-105N5.1
DKEYP-97G3.6 Dr.115457 561933 DKEYP-97G3.6 dohh Dr.2393 321732 dohh Dr.100635 Dr.100635 Dr.100635 Dr.1026 Dr.1026 Dr.1026 Dr.102711 Dr.102711 Dr.102711 Dr.103268 Dr.103268 Dr.103268 Dr.1034 Dr.1034 Dr.1034 Dr.104563 Dr.104563 Dr.104563 Dr.104849 Dr.104849 Dr.104849 Dr.104912 Dr.104912 Dr.104912 Dr.105847 Dr.105847 Dr.105847 Dr.106912 Dr.106912 Dr.106912 Dr.107516 Dr.107516 Dr.107516 Dr.107715 Dr.107715 Dr.107715 Dr.107716 Dr.107716 Dr.107716 Dr.107926 Dr.107926 Dr.107926 Dr.108104 Dr.108104 Dr.108104 Dr.108238 Dr.108238 Dr.108238 Dr.10826 Dr.10826 Dr.10826 Dr.110766 Dr.110766 Dr.110766 Dr.111687 Dr.111687 Dr.111687 Dr.114009 Dr.114009 Dr.114009 Dr.118227 Dr.118227 Dr.118227 Dr.119089 Dr.119089 Dr.119089 Dr.119809 Dr.119809 Dr.119809 Dr.121349 Dr.121349 Dr.121349 Dr.121552 Dr.121552 Dr.121552 Dr.121574 Dr.121574 Dr.121574 Dr.121588 Dr.121588 Dr.121588 Dr.121757 Dr.121757 Dr.121757 Dr.121765 Dr.121765 Dr.121765 Dr.121884 Dr.121884 Dr.121884 Dr.121890 Dr.121890 Dr.121890 Dr.121913 Dr.121913 Dr.121913 Dr.121924 Dr.121924 Dr.121924 Dr.122018 Dr.122018 Dr.122018 Dr.122020 Dr.122020 Dr.122020 Dr.122052 Dr.122052 Dr.122052 Dr.122080 Dr.122080 Dr.122080 Dr.122215 Dr.122215 Dr.122215 Dr.122260 Dr.122260 Dr.122260 Dr.122277 Dr.122277 Dr.122277 Dr.122280 Dr.122280 Dr.122280 Dr.122295 Dr.122295 Dr.122295 Dr.122313 Dr.122313 Dr.122313 Dr.122348 Dr.122348 Dr.122348 Dr.122381 Dr.122381 Dr.122381 Dr.122410 Dr.122410 Dr.122410 Dr.122416 Dr.122416 Dr.122416 Dr.122492 Dr.122492 Dr.122492 Dr.122495 Dr.122495 Dr.122495 Dr.122521 Dr.122521 Dr.122521 Dr.122525 Dr.122525 Dr.122525 Dr.122581 Dr.122581 Dr.122581 Dr.122614 Dr.122614 Dr.122614 Dr.122627 Dr.122627 Dr.122627 Dr.122669 Dr.122669 Dr.122669 Dr.122673 Dr.122673 Dr.122673 Dr.122738 Dr.122738 Dr.122738 Dr.122741 Dr.122741 Dr.122741 Dr.122769 Dr.122769 Dr.122769 Dr.122772 Dr.122772 Dr.122772 Dr.122786 Dr.122786 Dr.122786 Dr.122800 Dr.122800 Dr.122800 Dr.122894 Dr.122894 Dr.122894 Dr.122907 Dr.122907 Dr.122907 Dr.122944 Dr.122944 Dr.122944 Dr.122946 Dr.122946 Dr.122946 Dr.122993 Dr.122993 Dr.122993 Dr.123073 Dr.123073 Dr.123073 Dr.123093 Dr.123093 Dr.123093 Dr.123122 Dr.123122 Dr.123122 Dr.123153 Dr.123153 Dr.123153 Dr.123175 Dr.123175 Dr.123175 Dr.123239 Dr.123239 Dr.123239 Dr.123253 Dr.123253 Dr.123253 Dr.123298 Dr.123298 Dr.123298 Dr.123311 Dr.123311 Dr.123311 Dr.123322 Dr.123322 Dr.123322 Dr.123342 Dr.123342 Dr.123342 Dr.123345 Dr.123345 Dr.123345 Dr.123372 Dr.123372 Dr.123372 Dr.123433 Dr.123433 Dr.123433 Dr.123509 Dr.123509 Dr.123509 Dr.123516 Dr.123516 Dr.123516 Dr.123535 Dr.123535 Dr.123535 Dr.123540 Dr.123540 Dr.123540 Dr.123541 Dr.123541 Dr.123541 Dr.123559 Dr.123559 Dr.123559 Dr.123589 Dr.123589 Dr.123589 Dr.123651 Dr.123651 Dr.123651 Dr.123677 Dr.123677 Dr.123677 Dr.123742 Dr.123742 Dr.123742 Dr.123832 Dr.123832 Dr.123832 Dr.123864 Dr.123864 Dr.123864 Dr.123950 Dr.123950 Dr.123950 Dr.124014 Dr.124014 Dr.124014 Dr.124020 Dr.124020 Dr.124020 Dr.124063 Dr.124063 Dr.124063 Dr.124067 Dr.124067 Dr.124067 Dr.124535 Dr.124535 Dr.124535 Dr.124767 Dr.124767 Dr.124767 Dr.124864 Dr.124864 Dr.124864 Dr.124888 Dr.124888 Dr.124888 Dr.124987 Dr.124987 Dr.124987 Dr.125037 Dr.125037 Dr.125037 Dr.125277 Dr.125277 Dr.125277 Dr.125330 Dr.125330 Dr.125330 Dr.125372 Dr.125372 Dr.125372 Dr.125458 Dr.125458 Dr.125458 Dr.125570 Dr.125570 Dr.125570 Dr.125670 Dr.125670 Dr.125670 Dr.125752 Dr.125752 Dr.125752 Dr.125894 Dr.125894 Dr.125894 Dr.126130 Dr.126130 Dr.126130 Dr.126272 Dr.126272 Dr.126272 Dr.126413 Dr.126413 Dr.126413 Dr.126564 Dr.126564 Dr.126564 Dr.126624 Dr.126624 Dr.126624 Dr.127398 Dr.127398 Dr.127398 Dr.128077 Dr.128077 Dr.128077 Dr.128421 Dr.128421 Dr.128421 Dr.128681 Dr.128681 Dr.128681 Dr.128938 Dr.128938 Dr.128938 Dr.129101 Dr.129101 Dr.129101 Dr.129189 Dr.129189 Dr.129189 Dr.129433 Dr.129433 Dr.129433 Dr.129661 Dr.129661 Dr.129661 Dr.129741 Dr.129741 Dr.129741 Dr.129805 Dr.129805 Dr.129805 Dr.129903 Dr.129903 Dr.129903 Dr.130105 Dr.130105 Dr.130105 Dr.130502 Dr.130502 Dr.130502 Dr.130898 Dr.130898 Dr.130898 Dr.131036 Dr.131036 Dr.131036 Dr.131054 Dr.131054 Dr.131054 Dr.131145 Dr.131145 Dr.131145 Dr.131226 Dr.131226 Dr.131226 Dr.131316 Dr.131316 Dr.131316 Dr.131335 Dr.131335 Dr.131335 Dr.131410 Dr.131410 Dr.131410 Dr.131746 Dr.131746 Dr.131746 Dr.131852 Dr.131852 Dr.131852 Dr.131919 Dr.131919 Dr.131919 Dr.131984 Dr.131984 Dr.131984 Dr.132023 Dr.132023 Dr.132023 Dr.132086 Dr.132086 Dr.132086 Dr.132109 Dr.132109 Dr.132109 Dr.132130 Dr.132130 Dr.132130 Dr.132335 Dr.132335 Dr.132335 Dr.13241 Dr.13241 Dr.13241 Dr.132472 Dr.132472 Dr.132472 Dr.132683 Dr.132683 Dr.132683 Dr.132748 Dr.132748 Dr.132748 Dr.132810 Dr.132810 Dr.132810 Dr.132831 Dr.132831 Dr.132831 Dr.132918 Dr.132918 Dr.132918 Dr.132954 Dr.132954 Dr.132954 Dr.133001 Dr.133001 Dr.133001 Dr.133072 Dr.133072 Dr.133072 Dr.133119 Dr.133119 Dr.133119 Dr.133159 Dr.133159 Dr.133159 Dr.133195 Dr.133195 Dr.133195 Dr.133240 Dr.133240 Dr.133240 Dr.133255 Dr.133255 Dr.133255 Dr.133293 Dr.133293 Dr.133293 Dr.133303 Dr.133303 Dr.133303 Dr.133385 Dr.133385 Dr.133385 Dr.133397 Dr.133397 Dr.133397 Dr.133399 Dr.133399 Dr.133399 Dr.133403 Dr.133403 Dr.133403 Dr.133437 Dr.133437 Dr.133437 Dr.133440 Dr.133440 Dr.133440 Dr.133494 Dr.133494 Dr.133494 Dr.133501 Dr.133501 Dr.133501 Dr.133541 Dr.133541 Dr.133541 Dr.133621 Dr.133621 Dr.133621 Dr.133710 Dr.133710 Dr.133710 Dr.133731 Dr.133731 Dr.133731 Dr.133746 Dr.133746 Dr.133746 Dr.133861 Dr.133861 Dr.133861 Dr.133874 Dr.133874 Dr.133874 Dr.133882 Dr.133882 Dr.133882 Dr.134395 Dr.134395 Dr.134395 Dr.134510 Dr.134510 Dr.134510 Dr.134582 Dr.134582 Dr.134582 Dr.134588 Dr.134588 Dr.134588 Dr.134725 Dr.134725 Dr.134725 Dr.134771 Dr.134771 Dr.134771 Dr.134773 Dr.134773 Dr.134773 Dr.13481 Dr.13481 Dr.13481 Dr.134954 Dr.134954 Dr.134954 Dr.135070 Dr.135070 Dr.135070 Dr.135072 Dr.135072 Dr.135072 Dr.135158 Dr.135158 Dr.135158 Dr.135177 Dr.135177 Dr.135177 Dr.135386 Dr.135386 Dr.135386 Dr.137711 Dr.137711 Dr.137711 Dr.13801 Dr.13801 Dr.13801 Dr.13875 Dr.13875 Dr.13875 Dr.140087 Dr.140087 Dr.140087 Dr.140306 Dr.140306 Dr.140306 Dr.140503 Dr.140503 Dr.140503 Dr.140570 Dr.140570 Dr.140570 Dr.140672 Dr.140672 Dr.140672 Dr.140791 Dr.140791 Dr.140791 Dr.14578 Dr.14578 Dr.14578 Dr.15365 Dr.15365 Dr.15365 Dr.15519 Dr.15519 Dr.15519 Dr.16097 Dr.16097 Dr.16097 Dr.17763 Dr.17763 Dr.17763 Dr.18641 Dr.18641 Dr.18641 Dr.18912 Dr.18912 Dr.18912 Dr.19055 Dr.19055 Dr.19055 Dr.19769 Dr.19769 Dr.19769 Dr.21599 Dr.21599 Dr.21599 Dr.22136 Dr.22136 Dr.22136 Dr.22715 Dr.22715 Dr.22715 Dr.23568 Dr.23568 Dr.23568 Dr.23571 Dr.23571 Dr.23571 Dr.25825 Dr.25825 Dr.25825 Dr.27927 Dr.27927 Dr.27927 Dr.28032 Dr.28032 Dr.28032 Dr.28585 Dr.28585 Dr.28585 Dr.28790 Dr.28790 Dr.28790 Dr.29633 Dr.29633 Dr.29633 Dr.31311 Dr.31311 Dr.31311 Dr.40010 Dr.40010 Dr.40010 Dr.40661 Dr.40661 Dr.40661 Dr.42665 Dr.42665 Dr.42665 Dr.44448 Dr.44448 Dr.44448 Dr.45458 Dr.45458 Dr.45458 Dr.48126 Dr.48126 Dr.48126 Dr.51495 Dr.51495 Dr.51495 Dr.53946 Dr.53946 Dr.53946 Dr.67299 Dr.67299 Dr.67299 Dr.68835 Dr.68835 Dr.68835 Dr.70517 Dr.70517 Dr.70517 Dr.72235 Dr.72235 Dr.72235 Dr.74678 Dr.74678 Dr.74678 Dr.75128 Dr.75128 Dr.75128 Dr.75197 Dr.75197 Dr.75197 Dr.76018 Dr.76018 Dr.76018 Dr.76143 Dr.76143 Dr.76143 Dr.76346 Dr.76346 Dr.76346 Dr.76591 Dr.76591 Dr.76591 Dr.77607 Dr.77607 Dr.77607 Dr.77749 Dr.77749 Dr.77749 Dr.78238 Dr.78238 Dr.78238 Dr.78245 Dr.78245 Dr.78245 Dr.78788 Dr.78788 Dr.78788 Dr.78953 Dr.78953 Dr.78953 Dr.78997 Dr.78997 Dr.78997 Dr.79067 Dr.79067 Dr.79067 Dr.79238 Dr.79238 Dr.79238 Dr.79956 Dr.79956 Dr.79956 Dr.79979 Dr.79979 Dr.79979 Dr.80051 Dr.80051 Dr.80051 Dr.80215 Dr.80215 Dr.80215 Dr.80441 Dr.80441 Dr.80441 Dr.80672 Dr.80672 Dr.80672 Dr.80902 Dr.80902 Dr.80902 Dr.80904 Dr.80904 Dr.80904 Dr.81063 Dr.81063 Dr.81063 Dr.81762 Dr.81762 Dr.81762 Dr.82495 Dr.82495 Dr.82495 Dr.82632 Dr.82632 Dr.82632 Dr.82697 Dr.82697 Dr.82697 Dr.82714 Dr.82714 Dr.82714 Dr.82883 Dr.82883 Dr.82883 Dr.82902 Dr.82902 Dr.82902 Dr.83102 Dr.83102 Dr.83102 Dr.83104 Dr.83104 Dr.83104 Dr.83137 Dr.83137 Dr.83137 Dr.83144 Dr.83144 Dr.83144 Dr.83157 Dr.83157 Dr.83157 Dr.83175 Dr.83175 Dr.83175 Dr.83202 Dr.83202 Dr.83202 Dr.83204 Dr.83204 Dr.83204 Dr.83209 Dr.83209 Dr.83209 Dr.83244 Dr.83244 Dr.83244 Dr.83251 Dr.83251 Dr.83251 Dr.83281 Dr.83281 Dr.83281 Dr.83356 Dr.83356 Dr.83356 Dr.83390 Dr.83390 Dr.83390 Dr.83405 Dr.83405 Dr.83405 Dr.83420 Dr.83420 Dr.83420 Dr.83434 Dr.83434 Dr.83434 Dr.83826 Dr.83826 Dr.83826 Dr.83855 Dr.83855 Dr.83855 Dr.83922 Dr.83922 Dr.83922 Dr.83994 Dr.83994 Dr.83994 Dr.84041 Dr.84041 Dr.84041 Dr.84084 Dr.84084 Dr.84084 Dr.84292 Dr.84292 Dr.84292 Dr.84327 Dr.84327 Dr.84327 Dr.84365 Dr.84365 Dr.84365 Dr.84370 Dr.84370 Dr.84370 Dr.84371 Dr.84371 Dr.84371 Dr.84380 Dr.84380 Dr.84380 Dr.84423 Dr.84423 Dr.84423 Dr.84426 Dr.84426 Dr.84426 Dr.84436 Dr.84436 Dr.84436 Dr.84613 Dr.84613 Dr.84613 Dr.84615 Dr.84615 Dr.84615 Dr.84630 Dr.84630 Dr.84630 Dr.84632 Dr.84632 Dr.84632 Dr.84659 Dr.84659 Dr.84659 Dr.84783 Dr.84783 Dr.84783 Dr.84788 Dr.84788 Dr.84788 Dr.84832 Dr.84832 Dr.84832 Dr.84837 Dr.84837 Dr.84837 Dr.84839 Dr.84839 Dr.84839 Dr.84861 Dr.84861 Dr.84861 Dr.84864 Dr.84864 Dr.84864 Dr.84926 Dr.84926 Dr.84926 Dr.85215 Dr.85215 Dr.85215 Dr.85220 Dr.85220 Dr.85220 Dr.85572 Dr.85572 Dr.85572 Dr.85649 Dr.85649 Dr.85649 Dr.85690 Dr.85690 Dr.85690 Dr.85911 Dr.85911 Dr.85911 Dr.85922 Dr.85922 Dr.85922 Dr.85933 Dr.85933 Dr.85933 Dr.85965 Dr.85965 Dr.85965 Dr.86040 Dr.86040 Dr.86040 Dr.86052 Dr.86052 Dr.86052 Dr.86075 Dr.86075 Dr.86075 Dr.86115 Dr.86115 Dr.86115 Dr.86131 Dr.86131 Dr.86131 Dr.86162 Dr.86162 Dr.86162 Dr.86460 Dr.86460 Dr.86460 Dr.86461 Dr.86461 Dr.86461 Dr.86498 Dr.86498 Dr.86498 Dr.86565 Dr.86565 Dr.86565 Dr.86575 Dr.86575 Dr.86575 Dr.86973 Dr.86973 Dr.86973 Dr.88294 Dr.88294 Dr.88294 Dr.88798 Dr.88798 Dr.88798 Dr.88858 Dr.88858 Dr.88858 Dr.89189 Dr.89189 Dr.89189 Dr.89651 Dr.89651 Dr.89651 Dr.89757 Dr.89757 Dr.89757 Dr.90120 Dr.90120 Dr.90120 Dr.90284 Dr.90284 Dr.90284 Dr.90383 Dr.90383 Dr.90383 Dr.90455 Dr.90455 Dr.90455 Dr.90533 Dr.90533 Dr.90533 Dr.90540 Dr.90540 Dr.90540 Dr.90564 Dr.90564 Dr.90564 Dr.90573 Dr.90573 Dr.90573 Dr.90629 Dr.90629 Dr.90629 Dr.90650 Dr.90650 Dr.90650 Dr.90656 Dr.90656 Dr.90656 Dr.90742 Dr.90742 Dr.90742 Dr.90763 Dr.90763 Dr.90763 Dr.90773 Dr.90773 Dr.90773 Dr.90792 Dr.90792 Dr.90792 Dr.90818 Dr.90818 Dr.90818 Dr.90833 Dr.90833 Dr.90833 Dr.90912 Dr.90912 Dr.90912 Dr.91146 Dr.91146 Dr.91146 Dr.91687 Dr.91687 Dr.91687 Dr.91932 Dr.91932 Dr.91932 Dr.92037 Dr.92037 Dr.92037 Dr.92084 Dr.92084 Dr.92084 Dr.92138 Dr.92138 Dr.92138 Dr.92239 Dr.92239 Dr.92239 Dr.92304 Dr.92304 Dr.92304 Dr.94477 Dr.94477 Dr.94477 Dr.95177 Dr.95177 Dr.95177 Dr.9594 Dr.9594 Dr.9594 Dr.97432 Dr.97432 Dr.97432 Dr.9851 Dr.9851 Dr.9851 Dr.99729 Dr.99729 Dr.99729 efnb2b Dr.12618 114402 efnb2b egr1 Dr.10183 30498 egr1 eif3s8 Dr.117110 334234 eif3s8 ek3 Dr.28327 30313 ek3 ela2 Dr.82353 403061 ela2 elf3 Dr.76707 336816 elf3 eng1a Dr.75072 30244 eng1a env Dr.132764 402813 env esrrgl Dr.84786 407691 esrrgl etfa Dr.86220 325724 etfa exosc4 Dr.107456 393712 exosc4 fas Dr.82180 768248 fas fat Dr.87471 406172 fat fbxl5 Dr.76970 322181 fbxl5 fdps Dr.77233 552997 fdps fez1 Dr.116746 406705 fez1 fgf8b Dr.20979 65089 fgf8b fgl2 Dr.81522 565637 fgl2 fkbp5 Dr.78793 368924 fkbp5 fkrp Dr.11951 571426 fkrp flot1 Dr.140639 30069 flot1 fn1b Dr.24233 334613 fn1b fos Dr.12986 394198 fos foxc1a Dr.82483 79374 foxc1a foxc1b Dr.83301 79375 foxc1b fpgs Dr.81920 406746 fpgs frzb Dr.81280 30119 frzb ft1 Dr.85396 30683 ft1 gadd45a Dr.83410 431763 gadd45a gcat Dr.79486 402822 gcat gdf7 Dr.88610 30642 gdf7 gfra1b Dr.117284 79377 gfra1b gltscr1 Dr.75629 386775 gltscr1 gnb3l Dr.32120 436710 gnb3l gngt2 Dr.19203 335655 gngt2 gnrh2 Dr.84757 353222 gnrh2 gpr34a Dr.82252 335288 gpr34a Gpsm1 Dr.115158 493623 Gpsm1 grb10 Dr.105808 446167 grb10 grem1 Dr.119605 405778 grem1 gria2a Dr.107958 170450 gria2a guca1c Dr.81617 373099 guca1c hamp1 Dr.89447 402837 hamp1 has1 Dr.88031 403130 has1 hbbe3 Dr.29153 30596 hbbe3 her11 Dr.84178 445409 her11 hhatlb Dr.74495 571120 hhatlb hhex Dr.79053 30098 hhex hig1 Dr.76367 373084 hig1 hm:zeh0225r Dr.107618 503823 hm:zeh0225r hoxc12a Dr.140970 562600 hoxc12a hp Dr.115936 322539 hp hpx Dr.80362 327588 hpx iclp1 Dr.7740 58113 iclp1 id:ibd1152 Dr.104509 338300 id:ibd1152 id:ibd2861 Dr.107890 57978 id:ibd2861 id:ibd5104 Dr.83324 338195 id:ibd5104 ifn Dr.85981 360134 ifn ift81 Dr.18625 432390 ift81 igfbp1 Dr.76315 317638 igfbp1 il10 Dr.135567 553957 il10 il17-3 Dr.135566 553960 il17-3 il1b Dr.30443 405770 il1b im:6899804 Dr.88215 552956 im:6899804 im:6901964 Dr.40830 552973 im:6901964 im:6910535 Dr.108863 448892 im:6910535 im:6911368 Dr.80514 448895 im:6911368 im:7136115 Dr.83392 497312 im:7136115 im:7138823 Dr.38927 497383 im:7138823 im:7140048 Dr.108540 503899 im:7140048 im:7140162 Dr.109254 492532 im:7140162 im:7140576 Dr.81377 449945 im:7140576 im:7141573 Dr.90963 492566 im:7141573 im:7145101 Dr.79495 553460 im:7145101 im:7145273 Dr.133223 492655 im:7145273 im:7145328 Dr.104946 497482 im:7145328 im:7148034 Dr.41107 553066 im:7148034 im:7149072 Dr.91280 445153 im:7149072 im:7149561 Dr.124869 503989 im:7149561 im:7150721 Dr.78394 550189 im:7150721 im:7151068 Dr.91065 492696 im:7151068 im:7151086 Dr.66408 492698 im:7151086 im:7151270 Dr.91068 492704 im:7151270 im:7153552 Dr.75319 606595 im:7153552 inhbaa Dr.107692 30072 inhbaa ins Dr.75811 30262 ins ipo9 Dr.132506 406860 ipo9 ipo9 Dr.33564 406860 ipo9 itm2b Dr.77196 323632 itm2b jak1 Dr.74470 30280 jak1 junb Dr.10326 407086 junb junbl Dr.737 336038 junbl kcnh2 Dr.93298 405763 kcnh2 laptm4a Dr.2933 322305 laptm4a lbx1 Dr.27181 64276 lbx1 lcp1 Dr.25823 30583 lcp1 lhfp Dr.76496 494110 lhfp
LOC100000090 Dr.79853 100000090 LOC100000090
LOC100000095 Dr.83652 100000095 LOC100000095
LOC100000306 Dr.116123 100000306 LOC100000306
LOC100000415 Dr.117055 100000415 LOC100000415
LOC100000455 Dr.115115 100000455 LOC100000455
LOC100000608 Dr.85440 100000608 LOC100000608
LOC100000643 Dr.84913 100000643 LOC100000643
LOC100000934 Dr.48801 100000934 LOC100000934
LOC100001075 Dr.117939 100001075 LOC100001075
LOC100001192 Dr.114413 100001192 LOC100001192
LOC100001243 Dr.117997 100001243 LOC100001243
LOC100001301 Dr.78165 100001301 LOC100001301
LOC100001701 Dr.82051 100001701 LOC100001701
LOC100001785 Dr.132540 100001785 LOC100001785
LOC100002165 Dr.9483 100002165 LOC100002165
LOC100002364 Dr.120837 100002364 LOC100002364
LOC100002383 Dr.19812 100002383 LOC100002383
LOC100002471 Dr.114497 100002471 LOC100002471
LOC100002610 Dr.86013 100002610 LOC100002610
LOC100002770 Dr.47585 100002770 LOC100002770
LOC100003336 Dr.134946 100003336 LOC100003336
LOC100003370 Dr.132943 100003370 LOC100003370
LOC100003425 Dr.116650 100003425 LOC100003425
LOC100003446 Dr.94265 100003446 LOC100003446
LOC100003605 Dr.87657 100003605 LOC100003605
LOC100003661 Dr.115571 100003661 LOC100003661
LOC100003732 Dr.120214 100003732 LOC100003732
LOC100003762 Dr.84872 100003762 LOC100003762
LOC100003911 Dr.92011 100003911 LOC100003911
LOC100004329 Dr.89636 100004329 LOC100004329
LOC100004438 Dr.116159 100004438 LOC100004438
LOC100004573 Dr.117748 100004573 LOC100004573
LOC100004607 Dr.132329 100004607 LOC100004607
LOC100004989 Dr.80969 100004989 LOC100004989
LOC100005077 Dr.65913 100005077 LOC100005077
LOC100005141 Dr.119870 100005141 LOC100005141
LOC100005351 Dr.115527 100005351 LOC100005351
LOC100005536 Dr.87663 100005536 LOC100005536
LOC100005753 Dr.79723 100005753 LOC100005753
LOC100005858 Dr.23573 100005858 LOC100005858
LOC100005925 Dr.23431 100005925 LOC100005925
LOC100006321 Dr.87054 100006321 LOC100006321
LOC100006440 Dr.67374 100006440 LOC100006440
LOC100006560 Dr.84920 100006560 LOC100006560
LOC100007087 Dr.81777 100007087 LOC100007087
LOC100007403 Dr.119610 100007403 LOC100007403
LOC100007768 Dr.86350 100007768 LOC100007768
LOC100007887 Dr.113957 100007887 LOC100007887
LOC100008526 Dr.121323 100008526 LOC100008526
LOC402857 Dr.27086 402857 LOC402857 LOC407664 Dr.83237 407664 LOC407664 LOC407678 Dr.87071 407678 LOC407678 LOC407694 Dr.77359 407694 LOC407694 LOC553231 Dr.11563 553231 LOC553231 LOC553285 Dr.115906 553285 LOC553285 LOC553343 Dr.78682 553343 LOC553343 LOC553490 Dr.133089 553490 LOC553490 LOC555433 Dr.89273 555433 LOC555433 LOC555974 Dr.99488 555974 LOC555974 LOC556029 Dr.87568 556029 LOC556029 LOC556236 Dr.82536 556236 LOC556236 LOC556362 Dr.17847 556362 LOC556362 LOC556437 Dr.89132 556437 LOC556437 LOC556467 Dr.77730 556467 LOC556467 LOC556505 Dr.133579 556505 LOC556505 LOC556826 Dr.96241 556826 LOC556826 LOC556873 Dr.92876 556873 LOC556873 LOC557160 Dr.81603 767707 LOC557160 LOC557257 Dr.76578 557257 LOC557257 LOC557286 Dr.76446 557286 LOC557286 LOC557301 Dr.86980 557301 LOC557301 LOC557408 Dr.91613 557408 LOC557408 LOC557479 Dr.119781 557479 LOC557479 LOC557591 Dr.120883 557591 LOC557591 LOC557654 Dr.121062 557654 LOC557654 LOC557898 Dr.78069 557898 LOC557898 LOC558030 Dr.75664 558030 LOC558030 LOC558513 Dr.4251 558513 LOC558513 LOC558658 Dr.116697 558658 LOC558658 LOC559097 Dr.85695 559097 LOC559097 LOC559127 Dr.86192 559127 LOC559127 LOC559247 Dr.116367 559247 LOC559247 LOC559332 Dr.83827 559332 LOC559332 LOC559377 Dr.23682 559377 LOC559377 LOC559603 Dr.77445 559603 LOC559603 LOC559790 Dr.82435 559790 LOC559790 LOC560138 Dr.84738 560138 LOC560138 LOC560193 Dr.119093 560193 LOC560193 LOC560274 Dr.119869 560274 LOC560274 LOC560275 Dr.71665 560275 LOC560275 LOC560532 Dr.17331 560532 LOC560532 LOC560548 Dr.115738 560548 LOC560548 LOC560916 Dr.19538 560916 LOC560916 LOC561001 Dr.74671 561001 LOC561001 LOC561108 Dr.86831 561108 LOC561108 LOC561119 Dr.94004 561119 LOC561119 LOC561361 Dr.80493 561361 LOC561361 LOC561505 Dr.114703 561505 LOC561505 LOC561659 Dr.82380 561659 LOC561659 LOC561676 Dr.118857 561676 LOC561676 LOC561790 Dr.87994 561790 LOC561790 LOC561985 Dr.83151 561985 LOC561985 LOC562071 Dr.82437 562071 LOC562071 LOC562146 Dr.83930 562146 LOC562146 LOC562165 Dr.115576 562165 LOC562165 LOC562205 Dr.84374 562205 LOC562205 LOC562207 Dr.133880 562207 LOC562207 LOC562246 Dr.117585 562246 LOC562246 LOC562251 Dr.83183 562251 LOC562251 LOC562320 Dr.115891 562320 LOC562320 LOC562338 Dr.133176 562338 LOC562338 LOC562343 Dr.83172 562343 LOC562343 LOC562579 Dr.12491 562579 LOC562579 LOC562744 Dr.120600 562744 LOC562744 LOC562763 Dr.87477 562763 LOC562763 LOC563053 Dr.78391 563053 LOC563053 LOC563152 Dr.133624 563152 LOC563152 LOC563180 Dr.105165 563180 LOC563180 LOC563193 Dr.117168 563193 LOC563193 LOC563289 Dr.7346 563289 LOC563289 LOC563410 Dr.121431 563410 LOC563410 LOC563448 Dr.83188 563448 LOC563448 LOC563512 Dr.115387 563512 LOC563512 LOC563546 Dr.82629 563546 LOC563546 LOC563686 Dr.24876 563686 LOC563686 LOC563864 Dr.81746 563864 LOC563864 LOC563874 Dr.84665 563874 LOC563874 LOC563952 Dr.29197 563952 LOC563952 LOC563976 Dr.88627 563976 LOC563976 LOC564019 Dr.120150 564019 LOC564019 LOC564674 Dr.79321 564674 LOC564674 LOC565650 Dr.27020 565650 LOC565650 LOC565777 Dr.86193 798514 LOC565777 LOC565811 Dr.115851 565811 LOC565811 LOC565839 Dr.80657 565839 LOC565839 LOC565937 Dr.85590 565937 LOC565937 LOC566020 Dr.83480 566020 LOC566020 LOC566092 Dr.133269 566092 LOC566092 LOC566122 Dr.79668 566122 LOC566122 LOC566167 Dr.108270 566167 LOC566167 LOC566268 Dr.82117 566268 LOC566268 LOC566323 Dr.118057 566323 LOC566323 LOC567090 Dr.108456 567090 LOC567090 LOC567217 Dr.113963 567217 LOC567217 LOC567256 Dr.117921 567256 LOC567256 LOC567444 Dr.90054 567444 irak3 LOC567537 Dr.111760 567537 LOC567537 LOC567669 Dr.121333 567669 LOC567669 LOC567756 Dr.84991 567756 LOC567756 LOC568005 Dr.91651 568005 LOC568005 LOC568476 Dr.85087 568476 LOC568476 LOC568720 Dr.107484 568720 LOC568720 LOC568734 Dr.116437 568734 LOC568734 LOC568795 Dr.81104 568795 LOC568795 LOC568832 Dr.83524 568832 LOC568832 LOC568839 Dr.117709 568839 LOC568839 LOC568902 Dr.120089 568902 LOC568902 LOC568926 Dr.113491 568926 LOC568926 LOC569006 Dr.115342 569006 LOC569006 LOC569014 Dr.89018 569014 LOC569014 LOC569084 Dr.1081 569084 LOC569084 LOC569187 Dr.83423 569187 LOC569187 LOC569232 Dr.87903 569232 LOC569232 LOC569234 Dr.11568 569234 LOC569234 LOC569249 Dr.87470 569249 LOC569249 LOC569516 Dr.114366 569516 LOC569516 LOC569735 Dr.82736 569735 LOC569735 LOC569954 Dr.114835 569954 LOC569954 LOC569969 Dr.41215 569969 LOC569969 LOC570023 Dr.132685 30363 LOC570023 LOC570148 Dr.19520 570148 LOC570148 LOC570432 Dr.15633 570432 LOC570432 LOC570757 Dr.121002 570757 LOC570757 LOC570832 Dr.107751 570832 LOC570832 LOC570932 Dr.115914 570932 LOC570932 LOC571281 Dr.83442 571281 LOC571281 LOC571720 Dr.3211 571720 LOC571720 LOC571747 Dr.84005 571747 LOC571747 LOC571939 Dr.116371 571939 LOC571939 LOC572121 Dr.104887 572121 LOC572121 LOC572173 Dr.69573 572173 LOC572173 LOC572466 Dr.45180 572466 LOC572466 LOC572907 Dr.11081 572907 LOC572907 LOC572921 Dr.113980 572921 LOC572921 LOC573376 Dr.116704 573376 LOC573376 LOC573492 Dr.118655 573492 LOC573492 LOC791474 Dr.6304 791474 LOC791474 LOC791919 Dr.81849 791919 LOC791919 LOC791930 Dr.79753 791930 LOC791930 LOC791963 Dr.118394 791963 LOC791963 LOC792364 Dr.95191 792364 LOC792364 LOC792428 Dr.118886 792428 LOC792428 LOC792472 Dr.119903 792472 LOC792472 LOC792511 Dr.120411 792511 LOC792511 LOC792591 Dr.80155 792591 LOC792591 LOC792601 Dr.17591 792601 LOC792601 LOC792613 Dr.120624 792613 LOC792613 LOC793284 Dr.113263 793284 LOC793284 LOC793374 Dr.86757 793374 LOC793374 LOC793509 Dr.73230 793509 LOC793509 LOC793536 Dr.119248 793536 LOC793536 LOC793576 Dr.86450 793576 LOC793576 LOC793666 Dr.116424 793666 LOC793666 LOC793823 Dr.118181 793823 LOC793823 LOC793872 Dr.78023 793872 LOC793872 LOC793907 Dr.16095 793907 LOC793907 LOC794083 Dr.81713 794083 LOC794083 LOC794136 Dr.11446 794136 LOC794136 LOC794413 Dr.116674 794413 LOC794413 LOC794621 Dr.116461 794621 LOC794621 LOC794757 Dr.91628 794757 LOC794757 LOC795015 Dr.114986 795015 LOC795015 LOC795305 Dr.116421 795305 LOC795305 LOC795393 Dr.89230 795393 LOC795393 LOC795529 Dr.80961 795529 LOC795529 LOC795752 Dr.118941 795752 LOC795752 LOC795755 Dr.85828 795755 LOC795755 LOC795785 Dr.113696 795785 LOC795785 LOC796163 Dr.118938 796163 LOC796163 LOC796233 Dr.120930 796233 LOC796233 LOC796302 Dr.16549 796302 LOC796302 LOC796750 Dr.40212 796750 LOC796750 LOC796798 Dr.90648 796798 LOC796798 LOC796842 Dr.120514 796842 LOC796842 LOC796865 Dr.116887 796865 LOC796865 LOC796878 Dr.113515 796878 LOC796878 LOC797020 Dr.118318 797020 LOC797020 LOC797263 Dr.115884 797263 LOC797263 LOC797698 Dr.10637 797698 LOC797698 LOC797836 Dr.6283 797836 LOC797836 LOC797946 Dr.107953 797946 LOC797946 LOC797973 Dr.114131 797973 LOC797973 LOC797976 Dr.87039 797976 LOC797976 LOC798012 Dr.121079 798012 LOC798012 LOC798067 Dr.117730 798067 LOC798067 LOC798073 Dr.120561 798073 LOC798073 LOC798122 Dr.114702 798122 LOC798122 LOC798216 Dr.121223 798216 LOC798216 LOC798492 Dr.84868 798492 LOC798492 LOC798623 Dr.79926 798623 LOC798623 LOC798772 Dr.115286 798772 LOC798772 LOC798774 Dr.115985 798774 LOC798774 LOC798848 Dr.116546 798848 LOC798848 LOC798868 Dr.67279 798868 LOC798868 LOC798960 Dr.114401 798960 LOC798960 LOC799085 Dr.133048 799085 LOC799085 LOC799253 Dr.119564 799253 LOC799253 LOC799395 Dr.29970 799395 LOC799395 LOC799434 Dr.40164 799434 LOC799434 LOC799503 Dr.18788 799503 LOC799503 LOC799605 Dr.120565 799605 LOC799605 LOC799812 Dr.26143 799812 LOC799812 LOC799834 Dr.119715 799834 LOC799834 lrrc17 Dr.25268 321202 lrrc17 lyz Dr.83681 246089 lyz matn1 Dr.82373 403023 matn1 matn4 Dr.78017 497348 matn4 mcee Dr.82958 553804 mcee mdm2 Dr.75764 30637 mdm2 mecp2 Dr.82151 335250 mecp2 mef2d Dr.132977 30580 mef2d mg:ab01b07 Dr.41813 326968 mg:ab01b07 mg:cb01g02 Dr.55608 326963 mg:cb01g02 mg:db03g07 Dr.76103 326955 mg:db03g07 mhc1uea Dr.11010 64885 mhc1uea mhc1ufa Dr.33261 64886 mhc1ufa mlc1 Dr.119073 559990 mlc1 mmp13 Dr.81475 387293 mmp13 mmp9 Dr.76275 406397 mmp9 mos Dr.118177 402817 mos ms4a4a Dr.40434 550363 ms4a4a mt Dr.20068 30282 mt mthfd2 Dr.105864 431728 mthfd2 mtmr8 Dr.83197 393365 mtmr8 mtnr1c Dr.88563 30661 mtnr1c mvp Dr.114231 373081 mvp mxa Dr.80859 360142 mxa mxc Dr.26703 282672 mxc mxc Dr.26920 360145 mxc myb Dr.80654 30484 myb myo9b Dr.4876 322219 myo9b myoc Dr.77862 548602 myoc nadl1.1 Dr.120298 30656 nadl1.1 ncam1 Dr.75350 30447 ncam1 ncf1 Dr.2973 378966 ncf1 nfe2l1 Dr.79857 405781 nfe2l1 nfkb2 Dr.117553 415100 nfkb2 nfkbiaa Dr.79912 406463 nfkbiaa nfkbiab Dr.77409 323099 nfkbiab nitr2b Dr.83336 60647 nitr2b nmi Dr.80228 335331 nmi nos1 Dr.88599 60658 nos1 nova1a Dr.77006 553201 nova1a noxo1 Dr.42641 572245 noxo1 nphs2l Dr.12280 557914 nphs2l Nr0b2 Dr.13394 403010 Nr0b2 nrp1a Dr.133652 353246 nrp1a nubp1 Dr.88416 503919 nubp1 olig3 Dr.117660 324857 olig3 omp Dr.85654 317636 omp or13.1 Dr.75767 58111 or13.1 or2.4 Dr.75771 80367 or2.4 ormdl1 Dr.27136 368632 ormdl1 p2rx8 Dr.89526 387299 p2rx8 pabpc1a Dr.24504 606498 pabpc1a pcca Dr.105309 437019 pcca pcdh1a3 Dr.47088 497127 pcdh1a3 pdcd7 Dr.82365 445020 pdcd7 pdzk1ip1l Dr.41116 368722 pdzk1ip1l pgm3 Dr.37649 474321 pgm3 phlda3 Dr.120320 368779 phlda3 pi4kII alpha Dr.79494 554275 pi4kII alpha pigc Dr.78451 323994 pigc pigq Dr.11595 334764 pigq pim1 Dr.78102 58054 pim1 pitx3 Dr.89375 402974 pitx3 pkd2 Dr.92211 432387 pkd2 pklr Dr.132396 114551 pklr pknox1.2 Dr.87714 170445 pknox1.2 pla2g12b Dr.76783 406739 pla2g12b plek Dr.29086 393814 plek plekhf1 Dr.80998 393311 plekhf1 plod2 Dr.77688 100036767 plod2 plrg1 Dr.79159 406749 plrg1 pls1 Dr.113808 334273 pls1 polb Dr.116029 445402 polb polr1a Dr.101226 327078 polr1a pou47 Dr.221 30397 pou47 pou5f1 Dr.258 30333 pou5f1 prkg1 Dr.26605 394005 prkg1 prnp Dr.116262 494129 prnp prnprs1 Dr.90045 503701 prnprs1 prss35 Dr.118662 431759 prss35 psma6b Dr.82172 83917 psma6b psmb11 Dr.8210 64279 psmb11 psmd7 Dr.80368 327330 psmd7 psme1 Dr.81309 30648 psme1 psme2 Dr.76266 30647 psme2 ptc2 Dr.81263 30189 ptc2 ptger2l Dr.87881 393608 ptger2l ptgs1 Dr.115126 246226 ptgs1 ptgs2a Dr.113864 246227 ptgs2a ptpru Dr.118674 335096 ptpru pura Dr.85924 415106 pura pvalb2 Dr.460 58028 pvalb2 rab11a Dr.80427 492487 rab11a rad17 Dr.31220 436934 rad17 ralgps2 Dr.17213 393446 ralgps2 raraa Dr.193 30680 raraa rel Dr.86023 415101 rel rela Dr.84126 415099 rela rgs4 Dr.75538 321256 rgs4 rhag Dr.22827 336285 rhag rhbg Dr.118521 337596 rhbg rhobtb2a Dr.115039 553415 rhobtb2a rhoua Dr.84141 492802 rhoua ripk2 Dr.28180 373874 ripk2 rnmtl1 Dr.84838 550390 rnmtl1 rp2 Dr.80773 406755 rp2 rpl10 Dr.75581 336712 rpl10 rtk8 Dr.75829 30691 rtk8 rtn4ip1 Dr.16642 393323 rtn4ip1 ruvbl2 Dr.35479 333992 ruvbl2 sb:cb26 Dr.77174 321046 sb:cb26 sb:cb339 Dr.100378 321210 sb:cb339 sb:cb474 Dr.77270 321271 sb:cb474 sb:cb55 Dr.117532 321067 sb:cb55 sb:cb606 Dr.114993 321320 sb:cb606 sb:cb657 Dr.76278 368358 sb:cb657 scamp2 Dr.121550 406687 scamp2 scarf1 Dr.74559 336834 scarf1 sccpdha Dr.77107 436632 sccpdha scn12ab Dr.110026 566868 scn12ab scube2 Dr.3848 503728 scube2 sdf2 Dr.79812 336879 sdf2 sec13 Dr.5496 406644 sec13 serpina7 Dr.46572 449799 serpina7 serpinb1l1 Dr.82062 494155 serpinb1l1 sesn2 Dr.44360 558966 sesn2 sf3a1 Dr.116253 368732 sf3a1 sfrp1b Dr.134623 798564 sfrp1b sfxn1 Dr.33964 445143 sfxn1 si:busm1- si:busm1- Dr.87489 566732 189a20.4 189a20.4 si:busm1- si:busm1- Dr.81772 368857 241h12.4 241h12.4 si:busm1- Dr.81717 368621 si:busm1-57f23.1 57f23.1 si:busm1-6a2.1 Dr.123332 368398 si:busm1-6a2.1 si:ch211- si:ch211- Dr.78329 541445 103f16.4 103f16.4 si:ch211- Dr.83512 568060 si:ch211-11c20.1 11c20.1 si:ch211- si:ch211- Dr.78433 566537 132p20.4 132p20.4 si:ch211- Dr.113962 368668 si:ch211-14a17.6 14a17.6 si:ch211- Dr.75717 368669 si:ch211-14a17.7 14a17.7 si:ch211- si:ch211- Dr.12904 562258 168n16.2 168n16.2 si:ch211- Dr.122452 337530 si:ch211-191d7.3 191d7.3 si:ch211- Dr.91260 445293 si:ch211-192k9.1 192k9.1 si:ch211- si:ch211- Dr.78777 324497 199g17.7 199g17.7 si:ch211- si:ch211- Dr.35714 565458 201b11.2 201b11.2 si:ch211- si:ch211- Dr.87374 553387 202c21.3 202c21.3 si:ch211- si:ch211- Dr.88124 368902 214p16.2 214p16.2 si:ch211- Dr.78676 327152 si:ch211-225p5.3 225p5.3 si:ch211-237l4.2 Dr.48022 561047 si:ch211-237l4.2 si:ch211- si:ch211- Dr.87397 560115 238c15.1 238c15.1 si:ch211- Dr.80697 334366 si:ch211-241e1.5 241e1.5 si:ch211- Dr.42682 336755 si:ch211-244b2.4 244b2.4 si:ch211- si:ch211- Dr.85745 563420 245h14.1 245h14.1 si:ch211- si:ch211- Dr.18273 569577 262h13.3 262h13.3 si:ch211-272f3.3 Dr.76284 336776 si:ch211-272f3.3
si:ch211-31p3.2 Dr.79497 325530 si:ch211-31p3.2 si:ch211-51l3.4 Dr.82671 567716 si:ch211-51l3.4
si:dkey-111e8.1 Dr.15488 323719 si:dkey-111e8.1
si:dkey-114f6.1 Dr.56035 327573 si:dkey-114f6.1 si:dkey- Dr.78607 557526 si:dkey-170o10.1 170o10.1 si:dkey- Dr.132056 325997 si:dkey-177p2.16 177p2.16 si:dkey- Dr.80560 333977 si:dkey-202g15.7 202g15.7 si:dkey-222b8.2 Dr.41221 567959 si:dkey-222b8.2 si:dkey- Dr.36001 322415 si:dkey-236e20.5 236e20.5 si:dkey- Dr.4570 386996 si:dkey-253d23.1 253d23.1 si:dkey-25e12.3 Dr.78146 569300 si:dkey-25e12.3
si:dkey-25f3.3 Dr.83732 558800 si:dkey-25f3.3 si:dkey- Dr.74466 557132 si:dkey-264g21.1 264g21.1 si:dkey- Dr.119059 558731 si:dkey-30c15.13 30c15.13 si:dkey-37m8.10 Dr.106102 325257 si:dkey-37m8.10
si:dkey-37m8.9 Dr.107057 336081 si:dkey-37m8.9
si:dkey-72l14.4 Dr.7451 562545 si:dkey-72l14.4
si:dkey-7l12.1 Dr.79856 553232 si:dkey-7l12.1
si:dkey-80c24.6 Dr.120873 100038765 si:dkey-80c24.6
si:dkey-9a20.6 Dr.82226 335251 si:dkey-9a20.6 si:dkeyp- Dr.25788 368326 si:dkeyp-110c7.6 110c7.6 si:dkeyp-20g2.4 Dr.82396 334561 si:dkeyp-20g2.4
si:dkeyp-38g8.3 Dr.140675 567017 si:dkeyp-38g8.3
si:dkeyp-55f12.4 Dr.76408 619265 si:dkeyp-55f12.4
si:dkeyp-59a8.2 Dr.84529 563208 si:dkeyp-59a8.2 si:dkeyp- Dr.114710 402867 si:dkeyp-89c11.1 89c11.1 si:dkeyp-90a8.2 Dr.77261 562273 si:dkeyp-90a8.2
si:rp71-36d5.1 Dr.108558 368423 si:rp71-36d5.1 slc10a2 Dr.88326 393329 slc10a2 slc16a9a Dr.7340 393382 slc16a9a slc1a4 Dr.77685 368885 slc1a4 slc20a1a Dr.116243 406458 slc20a1a slc25a12 Dr.76801 337675 slc25a12 slc25a16 Dr.78884 324578 slc25a16 slc2a8l Dr.82374 373140 slc2a8l slc39a13 Dr.75981 368686 slc39a13 slc5a1 Dr.87868 393654 slc5a1 slc7a3 Dr.77674 492363 slc7a3 slco1c1 Dr.83831 562772 slco1c1 smad2 Dr.79140 30639 smad2 smc4 Dr.77769 192332 smc4 smek2 Dr.121387 336198 smek2 smoc2 Dr.108698 550416 smoc2 snx1 Dr.140305 337386 snx1 socs3 Dr.6431 335409 socs3a sparcl Dr.92040 567331 sparcl spint1l Dr.75391 406426 spint1l st6gal2 Dr.82299 403116 st6gal2 stard3nl Dr.75372 436592 stard3nl stat4 Dr.34491 368519 stat4 stc1 Dr.88421 393511 stc1 stub1 Dr.78513 324243 stub1 stx3a Dr.82925 393515 stx3a suv420h1 Dr.77736 572849 suv420h1 tagln2 Dr.104755 259183 tagln2 tbl2 Dr.116733 337068 tbl2 tcea2 Dr.85125 393961 tcea2 tceb2 Dr.33340 192341 tceb2 tdh Dr.10250 406528 tdh tgfb1 Dr.76626 359834 tgfb1 th2 Dr.88913 414844 th2 thbs1 Dr.78947 561901 thbs1 timp2l Dr.102602 406650 timp2l tip39 Dr.83558 402812 tip39 titf1a Dr.82318 58112 titf1a tlr18 Dr.89702 403133 tlr18 tlr5a Dr.89423 403138 tlr5a tlr5b Dr.89707 751829 tlr5b tlr8b Dr.89704 403136 tlr8b tmem161a Dr.86254 492692 tmem161a tmem177 Dr.3515 322274 tmem177 tnfa Dr.89727 405785 tnfa tnfb Dr.94015 554167 tnfb tnfsf10l2 Dr.86839 436866 tnfsf10l2 tnnt1 Dr.13906 353248 tnnt1 tomm40l Dr.84273 405895 tomm40l tpsn Dr.132863 30163 tpsn trpv6 Dr.118447 415109 trpv6 ttna Dr.140815 317731 ttna tuba7l Dr.12524 431777 tuba7l uba52 Dr.35198 641289 uba52 unc119.2 Dr.94317 403018 unc119.2 ush1c Dr.80034 564412 ush1c usp39 Dr.77033 790924 usp39 vapb Dr.935 323628 vapb vat1 Dr.63036 368752 vat1 vcanb Dr.77767 323465 vcanb vent Dr.106743 64810 vent vezf1 Dr.103946 556915 vezf1 wnt16 Dr.87285 404628 wnt16 wu:fa01c11 Dr.75374 334720 wu:fa01c11 wu:fa04g06 Dr.75459 334833 wu:fa04g06 wu:fa05b11 Dr.75266 334850 wu:fa05b11 wu:fa06h01 Dr.13577 334875 wu:fa06h01 wu:fa06h02 Dr.41005 334876 wu:fa06h02 wu:fa07c11 Dr.104432 334890 wu:fa07c11 wu:fa20b10 Dr.135679 327042 wu:fa20b10 wu:fa91f10 Dr.76195 336665 wu:fa91f10 wu:fa92h10 Dr.76239 336699 wu:fa92h10 wu:fa94h07 Dr.23516 336758 wu:fa94h07 wu:fa95b08 Dr.104580 337012 wu:fa95b08 wu:fa97d10 Dr.76347 337101 wu:fa97d10 wu:fa97h07 Dr.104634 337111 wu:fa97h07 wu:fa98d10 Dr.27231 337125 wu:fa98d10 wu:fa98e11 Dr.76350 337130 wu:fa98e11 wu:fb01b03 Dr.70656 337182 wu:fb01b03 wu:fb02f05 Dr.32313 337231 wu:fb02f05 wu:fb03e09 Dr.20328 337254 wu:fb03e09 wu:fb07d03 Dr.141511 336838 wu:fb07d03 wu:fb08g12 Dr.51536 336378 wu:fb08g12 wu:fb09g03 Dr.76687 336411 wu:fb09g03 wu:fb10a09 Dr.51646 336418 wu:fb10a09 wu:fb10g03 Dr.27253 336442 wu:fb10g03 wu:fb11h05 Dr.76693 336493 wu:fb11h05 wu:fb12a05 Dr.24997 336499 wu:fb12a05 wu:fb13b07 Dr.23569 336539 wu:fb13b07 wu:fb13d05 Dr.104799 336548 wu:fb13d05 wu:fb13g09 Dr.76665 336563 wu:fb13g09 wu:fb14c11 Dr.32415 336586 wu:fb14c11 wu:fb14g06 Dr.76652 336604 wu:fb14g06 wu:fb15e04 Dr.32406 336624 wu:fb15e04 wu:fb15h11 Dr.5716 336638 wu:fb15h11 wu:fb16f08 Dr.104825 321479 wu:fb16f08 wu:fb17f01 Dr.76619 321500 wu:fb17f01 wu:fb18b12 Dr.23649 321526 wu:fb18b12 wu:fb19b08 Dr.24364 321557 wu:fb19b08 wu:fb25h12 Dr.76766 321668 wu:fb25h12 wu:fb26f10 Dr.76802 321684 wu:fb26f10 wu:fb39d01 Dr.76365 321959 wu:fb39d01 wu:fb40f06 Dr.27293 322002 wu:fb40f06 wu:fb57b08 Dr.23720 322301 wu:fb57b08 wu:fb57f08 Dr.23725 322318 wu:fb57f08 wu:fb58f04 Dr.132301 322344 wu:fb58f04 wu:fb58g10 Dr.77046 322355 wu:fb58g10 wu:fb59d03 Dr.77126 322381 wu:fb59d03 wu:fb60c02 Dr.77169 322409 wu:fb60c02 wu:fb61e06 Dr.77125 322446 wu:fb61e06 wu:fb63d05 Dr.132313 322510 wu:fb63d05 wu:fb64e03 Dr.76413 322540 wu:fb64e03 wu:fb66c11 Dr.105221 322582 wu:fb66c11 wu:fb66f11 Dr.77427 406400 wu:fb66f11 wu:fb69c03 Dr.4246 322653 wu:fb69c03 wu:fb72c11 Dr.129593 322739 wu:fb72c11 wu:fb72c11 Dr.75160 322739 wu:fb72c11 wu:fb74g08 Dr.105194 322844 wu:fb74g08 wu:fb76g02 Dr.77277 322911 wu:fb76g02 wu:fb77c07 Dr.132327 322936 wu:fb77c07 wu:fb77f12 Dr.77289 322955 wu:fb77f12 wu:fb79e06 Dr.39734 323032 wu:fb79e06 wu:fb80f02 Dr.77380 323066 wu:fb80f02 wu:fb81c07 Dr.75682 323088 wu:fb81c07 wu:fb81e12 Dr.77408 323096 wu:fb81e12 wu:fb82f09 Dr.77559 323130 wu:fb82f09 wu:fb82h02 Dr.21169 323139 wu:fb82h02 wu:fb92f04 Dr.21193 323215 wu:fb92f04 wu:fb93c02 Dr.121775 323247 wu:fb93c02 wu:fb93g03 Dr.132381 323265 wu:fb93g03 wu:fb94e12 Dr.21224 323301 wu:fb94e12 wu:fb97g01 Dr.77734 323413 wu:fb97g01 wu:fb97g08 Dr.121803 323416 wu:fb97g08 wu:fb99e06 Dr.77781 323481 wu:fb99e06 wu:fb99g06 Dr.121806 386979 wu:fb99g06 wu:fb99g10 Dr.77790 323495 wu:fb99g10 wu:fc01f10 Dr.135376 323526 wu:fc01f10 wu:fc02d02 Dr.122760 323547 wu:fc02d02 wu:fc04b03 Dr.78003 323592 wu:fc04b03 wu:fc07b07 Dr.77935 323690 wu:fc07b07 wu:fc08e01 Dr.105450 323740 wu:fc08e01 wu:fc11d12 Dr.132393 323842 wu:fc11d12 wu:fc14a04 Dr.22881 323913 wu:fc14a04 wu:fc14a10 Dr.118157 323917 wu:fc14a10 wu:fc14f09 Dr.105655 767701 wu:fc14f09 wu:fc17h04 Dr.122420 324068 wu:fc17h04 wu:fc19f02 Dr.22472 324127 wu:fc19f02 wu:fc20g06 Dr.2805 324163 wu:fc20g06 wu:fc21a03 Dr.106313 324170 wu:fc21a03 wu:fc22a10 Dr.78495 324222 wu:fc22a10 wu:fc22b06 Dr.104555 324227 wu:fc22b06 wu:fc22c09 Dr.74490 324234 wu:fc22c09 wu:fc23d01 Dr.22938 793794 wu:fc23d01 wu:fc23f06 Dr.15418 324283 wu:fc23f06 wu:fc25e04 Dr.21605 324319 wu:fc25e04 wu:fc27b12 Dr.35817 324380 wu:fc27b12 wu:fc30g11 Dr.105823 324493 wu:fc30g11 wu:fc37c02 Dr.105731 324650 wu:fc37c02 wu:fc38d09 Dr.21497 324693 wu:fc38d09 wu:fc41f10 Dr.75531 324768 wu:fc41f10 wu:fc44e02 Dr.79112 324828 wu:fc44e02 wu:fc46a02 Dr.79391 324870 wu:fc46a02 wu:fc46c11 Dr.121987 324877 wu:fc46c11 wu:fc49d01 Dr.10914 562007 wu:fc49d01 wu:fc51f03 Dr.78985 325018 wu:fc51f03 wu:fc54b08 Dr.79013 325063 wu:fc54b08 wu:fc54g06 Dr.78101 325086 wu:fc54g06 wu:fc55a06 Dr.3915 325091 wu:fc55a06 wu:fc55g06 Dr.79035 325115 wu:fc55g06 wu:fc58a04 Dr.121953 325179 wu:fc58a04 wu:fc70h07 Dr.76504 619262 wu:fc70h07 wu:fc74a06 Dr.78055 325391 wu:fc74a06 wu:fc74e04 Dr.77547 445132 wu:fc74e04 wu:fc76c11 Dr.27582 325434 wu:fc76c11 wu:fc79b02 Dr.3325 325456 wu:fc79b02 wu:fc83a09 Dr.79472 325480 wu:fc83a09 wu:fc83f05 Dr.79478 325498 wu:fc83f05 wu:fc84c07 Dr.108582 325519 wu:fc84c07 wu:fc89a04 Dr.79591 325575 wu:fc89a04 wu:fc89f07 Dr.79597 325583 wu:fc89f07 wu:fc91a05 Dr.106263 325603 wu:fc91a05 wu:fc93f07 Dr.28720 325624 wu:fc93f07 wu:fd10a10 Dr.4005 325758 wu:fd10a10 wu:fd11d10 Dr.79713 325782 wu:fd11d10 wu:fd36h06 Dr.79872 325877 wu:fd36h06 wu:fd47h11 Dr.79961 325937 wu:fd47h11 wu:fd58b05 Dr.94688 100007552 wu:fd58b05 wu:fd59c01 Dr.52856 735312 wu:fd59c01 wu:fd61c04 Dr.113440 326081 wu:fd61c04 wu:fe01a07 Dr.80626 326635 wu:fe01a07 wu:fe11g10 Dr.79993 777631 wu:fe11g10 wu:fe16c03 Dr.106191 326770 wu:fe16c03 wu:fe16c11 Dr.122189 326772 wu:fe16c11 wu:fe24a06 Dr.132679 326807 wu:fe24a06 wu:fe24e09 Dr.106515 795458 wu:fe24e09 wu:fe26f02 Dr.5843 767786 wu:fe26f02 wu:fe47a12 Dr.76804 326892 wu:fe47a12 wu:fi06d09 Dr.132729 327409 wu:fi06d09 wu:fi31e12 Dr.75996 334103 wu:fi31e12 wu:fi36g12 Dr.80708 334220 wu:fi36g12 wu:fi38a11 Dr.20697 334257 wu:fi38a11 wu:fi38b05 Dr.75367 406447 wu:fi38b05 wu:fi40b08 Dr.24020 334311 wu:fi40b08 wu:fi48f03 Dr.119413 334410 wu:fi48f03 wu:fj05c06 Dr.80727 335354 wu:fj05c06 wu:fj05f05 Dr.80731 335362 wu:fj05f05 wu:fj08d01 Dr.80874 335387 wu:fj08d01 wu:fj14f03 Dr.132807 335460 wu:fj14f03 wu:fj17a09 Dr.77645 563496 wu:fj17a09 wu:fj20h08 Dr.122319 335545 wu:fj20h08 wu:fj22f09 Dr.80938 335576 wu:fj22f09 wu:fj23a05 Dr.80855 335583 wu:fj23a05 wu:fj23b11 Dr.21044 335525 wu:fj23b11 wu:fj29h10 Dr.79667 335617 wu:fj29h10 wu:fj30a12 Dr.80946 335619 wu:fj30a12 wu:fj33b10 Dr.6315 335802 wu:fj33b10 wu:fj38c09 Dr.81028 335932 wu:fj38c09 wu:fj48a06 Dr.76584 336088 wu:fj48a06 wu:fj49c01 Dr.76105 336116 wu:fj49c01 wu:fj49c06 Dr.22759 336119 wu:fj49c06 wu:fj53e10 Dr.80301 336172 wu:fj53e10 wu:fj59h10 Dr.22812 336261 wu:fj59h10 wu:fj60h04 Dr.107128 336273 wu:fj60h04 wu:fj62d01 Dr.132859 336300 wu:fj62d01 wu:fj62g02 Dr.81251 336305 wu:fj62g02 wu:fj66h07 Dr.1574 337418 wu:fj66h07 wu:fj67d03 Dr.132704 337431 wu:fj67d03 wu:fj67f05 Dr.77690 337439 wu:fj67f05 wu:fj67h12 Dr.7234 337451 wu:fj67h12 wu:fj84f01 Dr.81535 337578 wu:fj84f01 wu:fj84g06 Dr.81536 337579 wu:fj84g06 wu:fj85a06 Dr.113601 337584 wu:fj85a06 wu:fj86d02 Dr.79919 337602 wu:fj86d02 wu:fj86g03 Dr.132921 337607 wu:fj86g03 wu:fj87c06 Dr.9554 337619 wu:fj87c06 wu:fk14g08 Dr.81512 337300 wu:fk14g08 wu:fk25e12 Dr.81805 336896 wu:fk25e12 wu:fk31a07 Dr.23104 336938 wu:fk31a07 wu:fk36h04 Dr.23134 336972 wu:fk36h04 wu:fk56e01 Dr.81970 335690 wu:fk56e01 wu:fk59g12 Dr.81942 335723 wu:fk59g12 wu:fk59h02 Dr.81943 335724 wu:fk59h02 wu:fk81c02 Dr.82060 335157 wu:fk81c02 wu:fk85d05 Dr.107555 335180 wu:fk85d05 wu:fk86g11 Dr.10031 335194 wu:fk86g11 wu:fl02d04 Dr.122566 335264 wu:fl02d04 wu:fl03b09 Dr.10410 337704 wu:fl03b09 wu:fl03d04 Dr.107584 335268 wu:fl03d04 wu:fl03e01 Dr.82179 335270 wu:fl03e01 wu:fl04a11 Dr.122575 335272 wu:fl04a11 wu:fm82b06 Dr.122949 337686 wu:fm82b06 wu:fp52e02 Dr.85903 386835 wu:fp52e02 wu:fp56f09 Dr.122259 337698 wu:fp56f09 wu:fq77h11 Dr.108155 503777 wu:fq77h11 xrcc4 Dr.83748 393759 xrcc4 zbtb22 Dr.79311 64809 zbtb22 zbtb48 Dr.72135 325725 zbtb48 zcchc10 Dr.80591 334240 zcchc10 zdhhc16 Dr.26719 394017 zdhhc16 zdhhc23 Dr.83252 445301 zdhhc23 zfp36l1 Dr.31482 338213 zfp36l1 zfp36l1 Dr.105582 554684 zfp36l1 zgc:100897 Dr.23554 445297 zgc:100897 zgc:100950 Dr.91020 445325 zgc:100950 zgc:100952 Dr.114908 445324 zgc:100952 zgc:100959 Dr.106411 445225 zgc:100959 zgc:100960 Dr.111296 792270 zgc:100960 zgc:101621 Dr.120445 450073 zgc:101621 zgc:101645 Dr.30620 494099 zgc:101645 zgc:101687 Dr.82189 450053 zgc:101687 zgc:101688 Dr.82220 494109 zgc:101688 zgc:101699 Dr.115979 492789 zgc:101699 zgc:101739 Dr.80825 447890 zgc:101739 zgc:101741 Dr.84246 492766 zgc:101741 zgc:101786 Dr.80728 492757 zgc:101786 zgc:101794 Dr.114873 447881 zgc:101794 zgc:101803 Dr.88420 450030 zgc:101803 zgc:101811 Dr.77501 450028 zgc:101811 zgc:101818 Dr.117252 494076 zgc:101818 zgc:101886 Dr.86897 492502 zgc:101886 zgc:101893 Dr.37833 494045 zgc:101893 zgc:103433 Dr.91379 450017 zgc:103433 zgc:103438 Dr.86834 450015 zgc:103438 zgc:103473 Dr.84834 492477 zgc:103473 zgc:103566 Dr.119956 403071 zgc:103566 zgc:103575 Dr.85993 449806 zgc:103575 zgc:103580 Dr.13131 449557 zgc:103580 zgc:103594 Dr.76097 447942 zgc:103594 zgc:103600 Dr.37357 492516 zgc:103600 zgc:103635 Dr.133079 449554 zgc:103635 zgc:103639 Dr.78106 447930 zgc:103639 zgc:103717 Dr.76782 492483 zgc:103717 zgc:103747 Dr.36931 334744 zgc:103747 zgc:109896 Dr.26640 553543 zgc:109896 zgc:109969 Dr.78796 553560 zgc:109969 zgc:110112 Dr.76556 550237 zgc:110112 zgc:110133 Dr.37702 550229 zgc:110133 zgc:110152 Dr.27897 550551 zgc:110152 zgc:110191 Dr.114250 553593 zgc:110191 zgc:110200 Dr.116678 550523 zgc:110200 zgc:110354 Dr.88891 553612 zgc:110354 zgc:110411 Dr.90104 571309 zgc:110411 zgc:110441 Dr.45818 449947 zgc:110441 zgc:110459 Dr.78179 553622 zgc:110459 zgc:110525 Dr.76821 503767 zgc:110525 zgc:110599 Dr.118208 550600 zgc:110599 zgc:110639 Dr.134084 553642 zgc:110639 zgc:110676 Dr.75438 550571 zgc:110676 zgc:110684 Dr.120368 553650 zgc:110684 zgc:110712 Dr.33453 550250 zgc:110712 zgc:110773 Dr.109713 613246 zgc:110773 zgc:110829 Dr.121466 541427 zgc:110829 zgc:112094 Dr.113647 550449 zgc:112094 zgc:112143 Dr.76505 550429 zgc:112143 zgc:112199 Dr.76995 550402 zgc:112199 zgc:112208 Dr.82025 550398 zgc:112208 zgc:112226 Dr.75553 554157 zgc:112226 zgc:112242 Dr.44274 553694 zgc:112242 zgc:112304 Dr.41753 554050 zgc:112304 zgc:112361 Dr.134432 554112 zgc:112361 zgc:112433 Dr.89507 550469 zgc:112433 zgc:113011 Dr.42603 553737 zgc:113011 zgc:113045 Dr.41669 664768 zgc:113045 zgc:113102 Dr.134817 503754 zgc:113102 zgc:113317 Dr.105275 619243 zgc:113317 zgc:113516 Dr.79930 541449 zgc:113516 zgc:113527 Dr.88899 613245 zgc:113527 zgc:114066 Dr.84802 566506 zgc:114066 zgc:114101 Dr.81643 559198 zgc:114101 zgc:114170 Dr.91502 557352 zgc:114170 zgc:123047 Dr.20771 553283 zgc:123047 zgc:123203 Dr.92219 641583 zgc:123203 zgc:123218 Dr.86778 641321 zgc:123218 zgc:123236 Dr.110015 557480 zgc:123236 zgc:123251 Dr.75167 641503 zgc:123251 zgc:123304 Dr.79607 556136 zgc:123304 zgc:123334 Dr.78614 677660 zgc:123334 zgc:136228 Dr.76679 570276 zgc:136228 zgc:136311 Dr.132858 336252 zgc:136311 zgc:136362 Dr.115122 692259 zgc:136362 zgc:136545 Dr.48052 692317 zgc:136545 zgc:136620 Dr.108105 678626 zgc:136620 zgc:136734 Dr.103079 677744 zgc:136734 zgc:136816 Dr.825 723996 zgc:136816 zgc:136858 Dr.77512 678543 zgc:136858 zgc:136908 Dr.47664 563679 zgc:136908 zgc:152922 Dr.39279 751734 zgc:152922 zgc:152924 Dr.75034 777606 zgc:152924 zgc:152945 Dr.77704 767787 zgc:152945 zgc:153020 Dr.134726 560761 zgc:153020 zgc:153057 Dr.13838 767798 zgc:153057 zgc:153186 Dr.82256 751758 zgc:153186 zgc:153267 Dr.89419 767684 zgc:153267 zgc:153333 Dr.87215 555376 zgc:153333 zgc:153349 Dr.37104 555269 zgc:153349 zgc:153351 Dr.81133 768153 zgc:153351 zgc:153638 Dr.89616 777740 zgc:153638 zgc:153723 Dr.88985 767718 zgc:153723 zgc:153863 Dr.37700 566132 zgc:153863 zgc:153888 Dr.83167 768164 zgc:153888 zgc:154064 Dr.108555 791699 zgc:154064 zgc:154077 Dr.52561 777745 zgc:154077 zgc:154079 Dr.82865 777750 zgc:154079 zgc:158387 Dr.75902 567275 zgc:158387 zgc:158404 Dr.89148 557029 zgc:158404 zgc:158463 Dr.27261 100037361 zgc:158463 zgc:158494 Dr.107928 386720 zgc:158494 zgc:158695 Dr.40378 791134 zgc:158695 zgc:158782 Dr.117229 100009640 zgc:158782 zgc:158807 Dr.83792 100009648 zgc:158807 zgc:158861 Dr.120725 100005434 zgc:158861 zgc:162095 Dr.132653 553256 zgc:162095 zgc:162166 Dr.80678 100005551 zgc:162166 zgc:162191 Dr.77158 322373 zgc:162191 zgc:162198 Dr.66850 325787 zgc:162198 zgc:162235 Dr.86308 563648 zgc:162235 zgc:162266 Dr.79929 100037322 zgc:162266 zgc:162301 Dr.84698 797343 zgc:162301 zgc:162316 Dr.92977 100037372 zgc:162316 zgc:162651 Dr.115655 323364 zgc:162651 zgc:162897 Dr.132990 100049157 zgc:162897 zgc:163098 Dr.2575 100037380 zgc:163098 zgc:165461 Dr.108135 497419 zgc:165461 zgc:55292 Dr.1786 321491 zgc:55292 zgc:55398 Dr.80443 394023 zgc:55398 zgc:55418 Dr.14064 334109 zgc:55418 zgc:55523 Dr.10172 327196 zgc:55523 zgc:55587 Dr.6680 334167 zgc:55587 zgc:55764 Dr.116955 324211 zgc:55764 zgc:55794 Dr.80343 327593 zgc:55794 zgc:55813 Dr.80110 399488 zgc:55813 zgc:55863 Dr.82569 393937 zgc:55863 zgc:56141 Dr.42026 406277 zgc:56141 zgc:56407 Dr.79344 393257 zgc:56407 zgc:56417 Dr.79371 393258 zgc:56417 zgc:63546 Dr.82416 790959 zgc:63546 zgc:63633 Dr.26592 393366 zgc:63633 zgc:63634 Dr.12674 393367 zgc:63634 zgc:63663 Dr.118336 393586 zgc:63663 zgc:63666 Dr.86390 393414 zgc:63666 zgc:63667 Dr.17457 393451 zgc:63667 zgc:63672 Dr.86785 393416 zgc:63672 zgc:63695 Dr.133823 792112 zgc:63695 zgc:63792 Dr.75976 337333 zgc:63792 zgc:63863 Dr.82376 393372 zgc:63863 zgc:63972 Dr.82419 393325 zgc:63972 zgc:63982 Dr.48970 337376 zgc:63982 zgc:64013 Dr.119341 393333 zgc:64013 zgc:64031 Dr.82104 393338 zgc:64031 zgc:64042 Dr.84488 393609 zgc:64042 zgc:64085 Dr.12508 393380 zgc:64085 zgc:64090 Dr.97367 393383 zgc:64090 zgc:64101 Dr.80315 393878 zgc:64101 zgc:64114 Dr.82488 378866 zgc:64114 zgc:64141 Dr.78662 393353 zgc:64141 zgc:65788 Dr.77223 322420 zgc:65788 zgc:65831 Dr.12437 393541 zgc:65831 zgc:65909 Dr.75861 393504 zgc:65909 zgc:65996 Dr.18197 336641 zgc:65996 zgc:66125 Dr.96456 393796 zgc:66125 zgc:66326 Dr.76836 321842 zgc:66326 zgc:66353 Dr.4114 321378 zgc:66353 zgc:66409 Dr.23608 335407 zgc:66409 zgc:66419 Dr.85930 394086 zgc:66419 zgc:66443 Dr.114215 406856 zgc:66443 zgc:66450 Dr.80393 393501 zgc:66450 zgc:73112 Dr.6047 393799 zgc:73112 zgc:73123 Dr.82245 393800 zgc:73123 zgc:73201 Dr.26944 324079 zgc:73201 zgc:73310 Dr.115522 393758 zgc:73310 zgc:76966 Dr.30396 405805 zgc:76966 zgc:77002 Dr.83170 405846 zgc:77002 zgc:77033 Dr.23613 406598 zgc:77033 zgc:77038 Dr.81607 406596 socs3b zgc:77041 Dr.16044 404632 zgc:77041 zgc:77068 Dr.113519 405824 zgc:77068 zgc:77076 Dr.86370 405825 zgc:77076 zgc:77165 Dr.19061 404608 zgc:77165 zgc:77242 Dr.89035 402969 zgc:77242 zgc:77287 Dr.84139 404617 zgc:77287 zgc:77306 Dr.80127 406509 zgc:77306 zgc:77358 Dr.82216 402928 zgc:77358 zgc:77380 Dr.134001 406554 zgc:77380 zgc:77387 Dr.6336 324010 zgc:77387 zgc:77424 Dr.88467 404622 zgc:77424 zgc:77517 Dr.76027 393540 zgc:77517 zgc:77651 Dr.29076 406530 zgc:77651 zgc:77727 Dr.89530 393830 zgc:77727 zgc:77784 Dr.118146 402947 zgc:77784 zgc:77855 Dr.88688 393836 zgc:77855 zgc:77861 Dr.77739 393823 zgc:77861 zgc:77862 Dr.132662 406474 zgc:77862 zgc:77882 Dr.78307 323671 zgc:77882 zgc:77891 Dr.78475 402993 zgc:77891 zgc:77905 Dr.81416 393867 zgc:77905 zgc:85616 Dr.113645 406356 zgc:85616 zgc:85702 Dr.23665 321718 zgc:85702 zgc:85746 Dr.82666 407988 zgc:85746 zgc:85838 Dr.30318 405870 zgc:85838 zgc:85914 Dr.27758 406471 zgc:85914 zgc:85923 Dr.30256 406448 zgc:85923 zgc:85946 Dr.84990 406520 zgc:85946 zgc:85948 Dr.3014 406516 zgc:85948 zgc:85965 Dr.81190 405857 zgc:85965 zgc:86648 Dr.5098 447869 zgc:86648 zgc:86754 Dr.80284 415225 zgc:86754 zgc:86889 Dr.133321 415192 zgc:86889 zgc:86892 Dr.86400 436952 zgc:86892 zgc:86895 Dr.31063 415191 zgc:86895 zgc:86926 Dr.69080 415179 zgc:86926 zgc:86927 Dr.36067 415178 zgc:86927 zgc:91794 Dr.132314 431764 zgc:91794 zgc:91796 Dr.88264 431761 zgc:91796 zgc:91868 Dr.79974 445073 socs1 zgc:91880 Dr.105402 431733 zgc:91880 zgc:91915 Dr.84836 436595 zgc:91915 zgc:91940 Dr.81687 436942 zgc:91940 zgc:91959 Dr.32109 436939 zgc:91959 zgc:91963 Dr.85722 445108 zgc:91963 zgc:91964 Dr.81856 431715 zgc:91964 zgc:91984 Dr.32169 431775 zgc:91984 zgc:92083 Dr.117302 447860 zgc:92083 zgc:92086 Dr.18499 436643 zgc:92086 zgc:92097 Dr.133138 403013 zgc:92097 zgc:92109 Dr.81623 492328 zgc:92109 zgc:92137 Dr.33934 445049 zgc:92137 zgc:92161 Dr.114476 447817 zgc:92161 zgc:92162 Dr.87011 436622 zgc:92162 zgc:92167 Dr.111731 436621 zgc:92167 zgc:92191 Dr.33969 445029 zgc:92191 zgc:92192 Dr.90111 436612 zgc:92192 zgc:92225 Dr.132558 436906 zgc:92225 zgc:92236 Dr.88917 436901 zgc:92236 zgc:92267 Dr.102467 494035 zgc:92267 zgc:92306 Dr.113700 791456 zgc:92306 zgc:92317 Dr.76480 449545 zgc:92317 zgc:92367 Dr.81587 445119 zgc:92367 zgc:92420 Dr.28514 445069 zgc:92420 zgc:92423 Dr.141054 445067 zgc:92423 zgc:92456 Dr.86760 445287 zgc:92456 zgc:92530 Dr.77138 445052 zgc:92530 zgc:92608 Dr.134016 436979 zgc:92608 zgc:92647 Dr.29795 436707 zgc:92647 zgc:92662 Dr.83126 436697 zgc:92662 zgc:92754 Dr.32124 436840 zgc:92754 zgc:92762 Dr.84618 436834 zgc:92762 zgc:92791 Dr.85452 436816 zgc:92791 zgc:92833 Dr.109068 436776 zgc:92833 zgc:92849 Dr.86222 436767 zgc:92849 zgc:92851 Dr.10032 436766 zgc:92851 zgc:92890 Dr.88790 436742 zgc:92890 zgc:92926 Dr.80970 436797 zgc:92926 znf313 Dr.86280 414843 znf313 zp2l1 Dr.75593 555180 zp2l1 zp3.2 Dr.132632 574007 zp3.2
*UniGene clusters differentially regulated upon S. typhimurium wt infection were grouped into four categories. Category 1: immune specific by means of GO-annotation and overlap with the common host response gene set (Supplementary Table III); Category 2: described immune function but missed out on category 1; Category 3: functionally annotated but no association to an immune function was revealed by PubMed search using inflammation and immunity as key words; Category 4: no functional annotation
B. S. typhimurium Ra vs. control
Gene Symbol UniGene Code Entrez GeneID Category 1 Category 2 Category 3 Category 4 (build#105) abcb3 Dr.88570 368771 abcb3 accn2c Dr.120630 407670 accn2c aco1 Dr.40063 568448 aco1 ada Dr.120392 436919 ada adam8 Dr.86401 368917 adam8 agpat3 Dr.75961 406734 agpat3 aldh2 Dr.28434 393462 aldh2 amt Dr.121883 450000 amt arih1 Dr.75869 327005 arih1 arl2bp Dr.110760 393976 arl2bp aspn Dr.81771 65228 aspn atf3 Dr.77523 393939 atf3 atg4c Dr.121931 415193 atg4c atp6v1b2 Dr.132618 359840 atp6v1b2 auh Dr.2043 445182 auh baz1a Dr.36447 334173 baz1a bcl2 Dr.45607 570772 bcl2 bin1 Dr.132574 447863 bin1 c3b Dr.21006 30491 c3b c3c Dr.88584 30492 c3c c6 Dr.16392 393611 c6 c6orf83 Dr.134087 393343 c6orf83 camk1g Dr.9874 335654 camk1g ccdc43 Dr.85117 393631 ccdc43 ccdc52 Dr.85458 494093 ccdc52 cdon Dr.121780 280652 cdon cebpb Dr.79988 140814 cebpb cebpd Dr.1280 140817 cebpd cfb Dr.75096 30604 cfb CH211- CH211- Dr.112790 564179 119C20.3 119C20.3 CH211- CH211- Dr.132691 797776 133N4.6 133N4.6 CH211-89F7.4 Dr.133987 794891 CH211-89F7.4 chad Dr.80402 394038 chad churc1 Dr.79574 492508 churc1 ciapin1 Dr.120788 445283 ciapin1 cldnc Dr.12596 81582 cldnc cldnf Dr.76180 791933 cldnf copb2 Dr.14625 114454 copb2 cops8 Dr.78319 393198 cops8 cpa5 Dr.77201 246092 cpa5 crh Dr.96618 492507 crh cry1a Dr.82313 83777 cry1a crygm2b Dr.116427 553954 crygm2b crygm2d6 Dr.134350 415228 crygm2d6 crygm5 Dr.134555 474328 crygm5 crygm6 Dr.15363 553966 crygm6 crygn2 Dr.87252 445034 crygn2 ctsk Dr.76224 791982 ctsk ctssa Dr.81560 393398 ctssa cxcr3.2 Dr.82754 492348 cxcr3.2 cyp11a1 Dr.80336 80374 cyp11a1 cyp17a1 Dr.79318 399692 cyp17a1 cyp2j30 Dr.37032 492484 cyp2j30 dap1b Dr.76473 58094 dap1b dcps Dr.531 402850 dcps dctd Dr.39980 550332 dctd ddost Dr.1142 406408 ddost dedd1 Dr.78368 58125 dedd1 dhrs1 Dr.32174 368670 dhrs1 DKEY- DKEY- Dr.12004 572757 183C16.6 183C16.6
DKEYP-97G3.6 Dr.115457 561933 DKEYP-97G3.6 dnmt3 Dr.67521 30659 dnmt3 Dock8 Dr.27090 403040 Dock8 dohh Dr.2393 321732 dohh Dr.1026 Dr.1026 Dr.1026 Dr.104095 Dr.104095 Dr.104095 Dr.104849 Dr.104849 Dr.104849 Dr.105847 Dr.105847 Dr.105847 Dr.106669 Dr.106669 Dr.106669 Dr.107610 Dr.107610 Dr.107610 Dr.107715 Dr.107715 Dr.107715 Dr.107926 Dr.107926 Dr.107926 Dr.108104 Dr.108104 Dr.108104 Dr.10826 Dr.10826 Dr.10826 Dr.109938 Dr.109938 Dr.109938 Dr.110766 Dr.110766 Dr.110766 Dr.112862 Dr.112862 Dr.112862 Dr.114009 Dr.114009 Dr.114009 Dr.119809 Dr.119809 Dr.119809 Dr.12002 Dr.12002 Dr.12002 Dr.121349 Dr.121349 Dr.121349 Dr.121552 Dr.121552 Dr.121552 Dr.121588 Dr.121588 Dr.121588 Dr.121757 Dr.121757 Dr.121757 Dr.121765 Dr.121765 Dr.121765 Dr.121884 Dr.121884 Dr.121884 Dr.121913 Dr.121913 Dr.121913 Dr.121924 Dr.121924 Dr.121924 Dr.121974 Dr.121974 Dr.121974 Dr.122052 Dr.122052 Dr.122052 Dr.122080 Dr.122080 Dr.122080 Dr.122280 Dr.122280 Dr.122280 Dr.122410 Dr.122410 Dr.122410 Dr.122414 Dr.122414 Dr.122414 Dr.122521 Dr.122521 Dr.122521 Dr.122669 Dr.122669 Dr.122669 Dr.122738 Dr.122738 Dr.122738 Dr.122743 Dr.122743 Dr.122743 Dr.122769 Dr.122769 Dr.122769 Dr.122786 Dr.122786 Dr.122786 Dr.122810 Dr.122810 Dr.122810 Dr.122946 Dr.122946 Dr.122946 Dr.122988 Dr.122988 Dr.122988 Dr.122993 Dr.122993 Dr.122993 Dr.123072 Dr.123072 Dr.123072 Dr.123093 Dr.123093 Dr.123093 Dr.123119 Dr.123119 Dr.123119 Dr.123134 Dr.123134 Dr.123134 Dr.123175 Dr.123175 Dr.123175 Dr.123239 Dr.123239 Dr.123239 Dr.123312 Dr.123312 Dr.123312 Dr.123324 Dr.123324 Dr.123324 Dr.123372 Dr.123372 Dr.123372 Dr.123509 Dr.123509 Dr.123509 Dr.123516 Dr.123516 Dr.123516 Dr.123540 Dr.123540 Dr.123540 Dr.123541 Dr.123541 Dr.123541 Dr.123559 Dr.123559 Dr.123559 Dr.123575 Dr.123575 Dr.123575 Dr.123651 Dr.123651 Dr.123651 Dr.123661 Dr.123661 Dr.123661 Dr.123681 Dr.123681 Dr.123681 Dr.123742 Dr.123742 Dr.123742 Dr.123950 Dr.123950 Dr.123950 Dr.124020 Dr.124020 Dr.124020 Dr.124279 Dr.124279 Dr.124279 Dr.124535 Dr.124535 Dr.124535 Dr.124651 Dr.124651 Dr.124651 Dr.124668 Dr.124668 Dr.124668 Dr.124799 Dr.124799 Dr.124799 Dr.124888 Dr.124888 Dr.124888 Dr.124946 Dr.124946 Dr.124946 Dr.125080 Dr.125080 Dr.125080 Dr.125277 Dr.125277 Dr.125277 Dr.125570 Dr.125570 Dr.125570 Dr.125670 Dr.125670 Dr.125670 Dr.125824 Dr.125824 Dr.125824 Dr.126078 Dr.126078 Dr.126078 Dr.126130 Dr.126130 Dr.126130 Dr.126204 Dr.126204 Dr.126204 Dr.126534 Dr.126534 Dr.126534 Dr.126564 Dr.126564 Dr.126564 Dr.12823 Dr.12823 Dr.12823 Dr.128421 Dr.128421 Dr.128421 Dr.128681 Dr.128681 Dr.128681 Dr.128926 Dr.128926 Dr.128926 Dr.128938 Dr.128938 Dr.128938 Dr.129189 Dr.129189 Dr.129189 Dr.129433 Dr.129433 Dr.129433 Dr.129661 Dr.129661 Dr.129661 Dr.130083 Dr.130083 Dr.130083 Dr.130105 Dr.130105 Dr.130105 Dr.130502 Dr.130502 Dr.130502 Dr.130898 Dr.130898 Dr.130898 Dr.131054 Dr.131054 Dr.131054 Dr.131225 Dr.131225 Dr.131225 Dr.131275 Dr.131275 Dr.131275 Dr.131316 Dr.131316 Dr.131316 Dr.131335 Dr.131335 Dr.131335 Dr.131410 Dr.131410 Dr.131410 Dr.131719 Dr.131719 Dr.131719 Dr.131852 Dr.131852 Dr.131852 Dr.131919 Dr.131919 Dr.131919 Dr.132049 Dr.132049 Dr.132049 Dr.132082 Dr.132082 Dr.132082 Dr.132109 Dr.132109 Dr.132109 Dr.132130 Dr.132130 Dr.132130 Dr.132218 Dr.132218 Dr.132218 Dr.13241 Dr.13241 Dr.13241 Dr.132610 Dr.132610 Dr.132610 Dr.132683 Dr.132683 Dr.132683 Dr.132723 Dr.132723 Dr.132723 Dr.132748 Dr.132748 Dr.132748 Dr.132831 Dr.132831 Dr.132831 Dr.132994 Dr.132994 Dr.132994 Dr.133097 Dr.133097 Dr.133097 Dr.133119 Dr.133119 Dr.133119 Dr.133202 Dr.133202 Dr.133202 Dr.133343 Dr.133343 Dr.133343 Dr.133363 Dr.133363 Dr.133363 Dr.133397 Dr.133397 Dr.133397 Dr.133400 Dr.133400 Dr.133400 Dr.133403 Dr.133403 Dr.133403 Dr.133426 Dr.133426 Dr.133426 Dr.133437 Dr.133437 Dr.133437 Dr.133494 Dr.133494 Dr.133494 Dr.133523 Dr.133523 Dr.133523 Dr.133641 Dr.133641 Dr.133641 Dr.133731 Dr.133731 Dr.133731 Dr.133746 Dr.133746 Dr.133746 Dr.133747 Dr.133747 Dr.133747 Dr.133752 Dr.133752 Dr.133752 Dr.133882 Dr.133882 Dr.133882 Dr.134395 Dr.134395 Dr.134395 Dr.134581 Dr.134581 Dr.134581 Dr.134582 Dr.134582 Dr.134582 Dr.134747 Dr.134747 Dr.134747 Dr.134771 Dr.134771 Dr.134771 Dr.13481 Dr.13481 Dr.13481 Dr.134954 Dr.134954 Dr.134954 Dr.135155 Dr.135155 Dr.135155 Dr.135158 Dr.135158 Dr.135158 Dr.135386 Dr.135386 Dr.135386 Dr.13598 Dr.13598 Dr.13598 Dr.137711 Dr.137711 Dr.137711 Dr.13801 Dr.13801 Dr.13801 Dr.13837 Dr.13837 Dr.13837 Dr.13875 Dr.13875 Dr.13875 Dr.140503 Dr.140503 Dr.140503 Dr.140570 Dr.140570 Dr.140570 Dr.140627 Dr.140627 Dr.140627 Dr.140672 Dr.140672 Dr.140672 Dr.140743 Dr.140743 Dr.140743 Dr.140871 Dr.140871 Dr.140871 Dr.141327 Dr.141327 Dr.141327 Dr.14167 Dr.14167 Dr.14167 Dr.14578 Dr.14578 Dr.14578 Dr.14870 Dr.14870 Dr.14870 Dr.15245 Dr.15245 Dr.15245 Dr.15365 Dr.15365 Dr.15365 Dr.15519 Dr.15519 Dr.15519 Dr.15621 Dr.15621 Dr.15621 Dr.16786 Dr.16786 Dr.16786 Dr.17 Dr.17 Dr.17 Dr.17702 Dr.17702 Dr.17702 Dr.18912 Dr.18912 Dr.18912 Dr.21599 Dr.21599 Dr.21599 Dr.21609 Dr.21609 Dr.21609 Dr.22350 Dr.22350 Dr.22350 Dr.23568 Dr.23568 Dr.23568 Dr.23571 Dr.23571 Dr.23571 Dr.26104 Dr.26104 Dr.26104 Dr.27927 Dr.27927 Dr.27927 Dr.28032 Dr.28032 Dr.28032 Dr.28338 Dr.28338 Dr.28338 Dr.28585 Dr.28585 Dr.28585 Dr.28905 Dr.28905 Dr.28905 Dr.29633 Dr.29633 Dr.29633 Dr.40900 Dr.40900 Dr.40900 Dr.44448 Dr.44448 Dr.44448 Dr.45458 Dr.45458 Dr.45458 Dr.48126 Dr.48126 Dr.48126 Dr.51495 Dr.51495 Dr.51495 Dr.67299 Dr.67299 Dr.67299 Dr.74678 Dr.74678 Dr.74678 Dr.75197 Dr.75197 Dr.75197 Dr.75718 Dr.75718 Dr.75718 Dr.76018 Dr.76018 Dr.76018 Dr.76346 Dr.76346 Dr.76346 Dr.76544 Dr.76544 Dr.76544 Dr.76591 Dr.76591 Dr.76591 Dr.76725 Dr.76725 Dr.76725 Dr.78420 Dr.78420 Dr.78420 Dr.78817 Dr.78817 Dr.78817 Dr.78846 Dr.78846 Dr.78846 Dr.78997 Dr.78997 Dr.78997 Dr.79238 Dr.79238 Dr.79238 Dr.79468 Dr.79468 Dr.79468 Dr.79956 Dr.79956 Dr.79956 Dr.80215 Dr.80215 Dr.80215 Dr.80221 Dr.80221 Dr.80221 Dr.80672 Dr.80672 Dr.80672 Dr.80786 Dr.80786 Dr.80786 Dr.80902 Dr.80902 Dr.80902 Dr.81063 Dr.81063 Dr.81063 Dr.81575 Dr.81575 Dr.81575 Dr.81762 Dr.81762 Dr.81762 Dr.81922 Dr.81922 Dr.81922 Dr.82462 Dr.82462 Dr.82462 Dr.82700 Dr.82700 Dr.82700 Dr.82741 Dr.82741 Dr.82741 Dr.82821 Dr.82821 Dr.82821 Dr.82883 Dr.82883 Dr.82883 Dr.83069 Dr.83069 Dr.83069 Dr.83104 Dr.83104 Dr.83104 Dr.83137 Dr.83137 Dr.83137 Dr.83144 Dr.83144 Dr.83144 Dr.83201 Dr.83201 Dr.83201 Dr.83251 Dr.83251 Dr.83251 Dr.83390 Dr.83390 Dr.83390 Dr.83434 Dr.83434 Dr.83434 Dr.83460 Dr.83460 Dr.83460 Dr.83483 Dr.83483 Dr.83483 Dr.83658 Dr.83658 Dr.83658 Dr.83752 Dr.83752 Dr.83752 Dr.83826 Dr.83826 Dr.83826 Dr.83842 Dr.83842 Dr.83842 Dr.83922 Dr.83922 Dr.83922 Dr.83951 Dr.83951 Dr.83951 Dr.83994 Dr.83994 Dr.83994 Dr.84001 Dr.84001 Dr.84001 Dr.84041 Dr.84041 Dr.84041 Dr.84292 Dr.84292 Dr.84292 Dr.84330 Dr.84330 Dr.84330 Dr.84373 Dr.84373 Dr.84373 Dr.84409 Dr.84409 Dr.84409 Dr.84597 Dr.84597 Dr.84597 Dr.84632 Dr.84632 Dr.84632 Dr.84675 Dr.84675 Dr.84675 Dr.84755 Dr.84755 Dr.84755 Dr.84756 Dr.84756 Dr.84756 Dr.84837 Dr.84837 Dr.84837 Dr.84839 Dr.84839 Dr.84839 Dr.84864 Dr.84864 Dr.84864 Dr.85154 Dr.85154 Dr.85154 Dr.85215 Dr.85215 Dr.85215 Dr.85425 Dr.85425 Dr.85425 Dr.85557 Dr.85557 Dr.85557 Dr.85649 Dr.85649 Dr.85649 Dr.85684 Dr.85684 Dr.85684 Dr.85933 Dr.85933 Dr.85933 Dr.85965 Dr.85965 Dr.85965 Dr.86052 Dr.86052 Dr.86052 Dr.86115 Dr.86115 Dr.86115 Dr.86201 Dr.86201 Dr.86201 Dr.86498 Dr.86498 Dr.86498 Dr.87006 Dr.87006 Dr.87006 Dr.88798 Dr.88798 Dr.88798 Dr.88858 Dr.88858 Dr.88858 Dr.89189 Dr.89189 Dr.89189 Dr.89553 Dr.89553 Dr.89553 Dr.89615 Dr.89615 Dr.89615 Dr.89651 Dr.89651 Dr.89651 Dr.89757 Dr.89757 Dr.89757 Dr.90284 Dr.90284 Dr.90284 Dr.90455 Dr.90455 Dr.90455 Dr.90533 Dr.90533 Dr.90533 Dr.90564 Dr.90564 Dr.90564 Dr.90573 Dr.90573 Dr.90573 Dr.90589 Dr.90589 Dr.90589 Dr.90629 Dr.90629 Dr.90629 Dr.90695 Dr.90695 Dr.90695 Dr.90757 Dr.90757 Dr.90757 Dr.90773 Dr.90773 Dr.90773 Dr.90792 Dr.90792 Dr.90792 Dr.90818 Dr.90818 Dr.90818 Dr.91146 Dr.91146 Dr.91146 Dr.92037 Dr.92037 Dr.92037 Dr.92084 Dr.92084 Dr.92084 Dr.92105 Dr.92105 Dr.92105 Dr.92138 Dr.92138 Dr.92138 Dr.92257 Dr.92257 Dr.92257 Dr.92303 Dr.92303 Dr.92303 Dr.92368 Dr.92368 Dr.92368 Dr.94477 Dr.94477 Dr.94477 Dr.9594 Dr.9594 Dr.9594 Dr.99729 Dr.99729 Dr.99729 egln3 Dr.9457 406602 egln3 eif3s8 Dr.117110 334234 eif3s8 eif4e1a Dr.5294 79380 eif4e1a elf3 Dr.76707 336816 elf3 emx3 Dr.75757 30536 emx3 eng1a Dr.75072 30244 eng1a env Dr.132764 402813 env exosc4 Dr.107456 393712 exosc4 exosc8 Dr.116761 323016 exosc8 fbxl5 Dr.76970 322181 fbxl5 fez1 Dr.116746 406705 fez1 fgfrl1b Dr.37960 497135 fgfrl1b fgl2 Dr.81522 565637 fgl2 fkrp Dr.11951 571426 fkrp flj11749l Dr.77489 445397 flj11749l flot1 Dr.140639 30069 flot1 fn1b Dr.24233 334613 fn1b fos Dr.12986 394198 fos foxc1b Dr.83301 79375 foxc1b fxyd6 Dr.26591 333987 fxyd6 gdf7 Dr.88610 30642 gdf7 gfra1a Dr.119737 79376 gfra1a gltscr1 Dr.75629 386775 gltscr1 gnb3l Dr.32120 436710 gnb3l gngt2 Dr.19203 335655 gngt2 gnptg Dr.3328 415147 gnptg gnrh2 Dr.84757 353222 gnrh2 got2 Dr.17618 406688 got2 grb10 Dr.105808 446167 grb10 h2afza Dr.29040 403077 h2afza hamp1 Dr.89447 402837 hamp1 hbbe1 Dr.114511 81538 hbbe1 hbbe3 Dr.29153 30596 hbbe3 hm:zehn2160 Dr.107623 337758 hm:zehn2160 Hrc Dr.79314 553296 Hrc hsp70 Dr.114305 30671 hsp70 iclp1 Dr.7740 58113 iclp1 ift81 Dr.18625 432390 ift81 il10 Dr.135567 553957 il10 il12a Dr.135199 445410 il12a il15l Dr.37800 553172 il15l il17-3 Dr.135566 553960 il17-3 il1b Dr.30443 405770 il1b im:6894100 Dr.133462 552929 im:6894100 im:6910535 Dr.108863 448892 im:6910535 im:6911368 Dr.80514 448895 im:6911368 im:7136115 Dr.83392 497312 im:7136115 im:7141573 Dr.90963 492566 im:7141573 im:7145101 Dr.79495 553460 im:7145101 im:7145328 Dr.104946 497482 im:7145328 im:7149072 Dr.91280 445153 im:7149072 im:7149561 Dr.124869 503989 im:7149561 im:7150721 Dr.78394 550189 im:7150721 im:7151086 Dr.66408 492698 im:7151086 im:7156740 Dr.105408 550315 im:7156740 ins Dr.75811 30262 ins ipo9 Dr.33564 406860 ipo9 ipo9 Dr.132506 406860 ipo9 irf6 Dr.81664 393570 irf6 irx2a Dr.88466 394032 irx2a junb Dr.10326 407086 junb junbl Dr.737 336038 junbl klhl Dr.132373 323332 klhl lim2.4 Dr.88040 436680 lim2.4
LOC100000144 Dr.85734 100000144 LOC100000144
LOC100000306 Dr.116123 100000306 LOC100000306
LOC100000455 Dr.115115 100000455 LOC100000455
LOC100000608 Dr.85440 100000608 LOC100000608
LOC100000643 Dr.84913 100000643 LOC100000643
LOC100000934 Dr.48801 100000934 LOC100000934
LOC100001075 Dr.117939 100001075 LOC100001075
LOC100001243 Dr.117997 100001243 LOC100001243
LOC100001612 Dr.90930 100001612 LOC100001612
LOC100001701 Dr.82051 100001701 LOC100001701
LOC100001785 Dr.132540 100001785 LOC100001785
LOC100001935 Dr.44195 100001935 LOC100001935
LOC100001968 Dr.23709 100001968 LOC100001968
LOC100002043 Dr.121481 100002043 LOC100002043
LOC100002165 Dr.9483 100002165 LOC100002165
LOC100002334 Dr.23240 100002334 LOC100002334
LOC100002439 Dr.120617 100002439 LOC100002439
LOC100002471 Dr.114497 100002471 LOC100002471
LOC100002510 Dr.24948 100002510 LOC100002510
LOC100002523 Dr.116473 100002523 LOC100002523
LOC100003336 Dr.134946 100003336 LOC100003336
LOC100003425 Dr.116650 100003425 LOC100003425
LOC100003911 Dr.92011 100003911 LOC100003911
LOC100003936 Dr.114594 100003936 LOC100003936
LOC100003959 Dr.78376 100003959 LOC100003959
LOC100004438 Dr.116159 100004438 LOC100004438
LOC100004573 Dr.117748 100004573 LOC100004573
LOC100004989 Dr.80969 100004989 LOC100004989
LOC100005077 Dr.65913 100005077 LOC100005077
LOC100005148 Dr.75914 100005148 LOC100005148
LOC100005753 Dr.79723 100005753 LOC100005753
LOC100006524 Dr.13947 100006524 LOC100006524
LOC100006949 Dr.113861 100006949 LOC100006949
LOC100007087 Dr.81777 100007087 LOC100007087
LOC100007403 Dr.119610 100007403 LOC100007403
LOC100007489 Dr.118558 100007489 LOC100007489
LOC100007692 Dr.133450 100007692 LOC100007692
LOC100007768 Dr.86350 100007768 LOC100007768
LOC100007780 Dr.3155 100007780 LOC100007780
LOC100008328 Dr.121267 100008328 LOC100008328
LOC100008526 Dr.121323 100008526 LOC100008526
LOC402857 Dr.27086 402857 LOC402857 LOC407694 Dr.77359 407694 LOC407694 LOC553422 Dr.72102 553422 LOC553422 LOC553527 Dr.118110 553527 LOC553527 LOC555409 Dr.76106 555409 LOC555409 LOC556392 Dr.82835 556392 LOC556392 LOC556395 Dr.78388 334287 LOC556395 LOC556467 Dr.77730 556467 LOC556467 LOC556826 Dr.96241 556826 LOC556826 LOC557160 Dr.81603 767707 LOC557160 LOC557301 Dr.86980 557301 LOC557301 LOC557591 Dr.120883 557591 LOC557591 LOC557654 Dr.121062 557654 LOC557654 LOC557752 Dr.100975 557752 LOC557752 LOC558030 Dr.75664 558030 LOC558030 LOC558391 Dr.90300 558391 LOC558391 LOC558498 Dr.74654 558498 LOC558498 LOC558513 Dr.4251 558513 LOC558513 LOC558698 Dr.77128 558698 LOC558698 LOC558933 Dr.81136 558933 LOC558933 LOC558956 Dr.114892 558956 LOC558956 LOC559247 Dr.116367 559247 LOC559247 LOC559420 Dr.84169 559420 LOC559420 LOC559603 Dr.77445 559603 LOC559603 LOC560138 Dr.84738 560138 LOC560138 LOC560193 Dr.119093 560193 LOC560193 LOC560532 Dr.17331 560532 LOC560532 LOC560548 Dr.115738 560548 LOC560548 LOC560828 Dr.118752 560828 LOC560828 LOC561001 Dr.74671 561001 LOC561001 LOC561108 Dr.86831 561108 LOC561108 LOC561659 Dr.82380 561659 LOC561659 LOC561676 Dr.118857 561676 LOC561676 LOC561790 Dr.87994 561790 LOC561790 LOC562071 Dr.82437 562071 LOC562071 LOC562205 Dr.84374 562205 LOC562205 LOC562207 Dr.133880 562207 LOC562207 LOC562246 Dr.117585 562246 LOC562246 LOC562343 Dr.83172 562343 LOC562343 LOC562579 Dr.12491 562579 LOC562579 LOC562744 Dr.120600 562744 LOC562744 LOC563193 Dr.117168 563193 LOC563193 LOC563512 Dr.115387 563512 LOC563512 LOC563546 Dr.82629 563546 LOC563546 LOC563682 Dr.83443 563682 LOC563682 LOC563686 Dr.24876 563686 LOC563686 LOC563864 Dr.81746 563864 LOC563864 LOC563952 Dr.29197 563952 LOC563952 LOC564696 Dr.121542 564696 LOC564696 LOC565603 Dr.119617 565603 LOC565603 LOC565649 Dr.14946 565649 LOC565649 LOC565701 Dr.78739 565701 LOC565701 LOC565777 Dr.86193 798514 LOC565777 LOC565793 Dr.108314 565793 LOC565793 LOC565811 Dr.115851 565811 LOC565811 LOC565937 Dr.85590 565937 LOC565937 LOC566122 Dr.79668 566122 LOC566122 LOC566198 Dr.34220 566198 LOC566198 LOC567217 Dr.113963 567217 LOC567217 LOC567256 Dr.117921 567256 LOC567256 LOC567444 Dr.90054 567444 irak3 LOC567537 Dr.111760 567537 LOC567537 LOC567669 Dr.121333 567669 LOC567669 LOC567953 Dr.39424 567953 LOC567953 LOC568005 Dr.91651 568005 LOC568005 LOC568476 Dr.85087 568476 LOC568476 LOC568537 Dr.78812 568537 LOC568537 LOC568653 Dr.133658 568653 LOC568653 LOC568763 Dr.83001 560020 LOC568763 LOC569164 Dr.82846 569164 LOC569164 LOC569187 Dr.83423 569187 LOC569187 LOC569586 Dr.119007 569586 LOC569586 LOC569609 Dr.115454 569609 LOC569609 LOC569969 Dr.41215 569969 LOC569969 LOC570148 Dr.19520 570148 LOC570148 LOC570757 Dr.121002 570757 LOC570757 LOC570832 Dr.107751 570832 LOC570832 LOC571448 Dr.84556 571448 LOC571448 LOC571608 Dr.75487 571608 LOC571608 LOC571720 Dr.3211 571720 LOC571720 LOC571747 Dr.84005 571747 LOC571747 LOC571991 Dr.77176 571991 LOC571991 LOC572121 Dr.104887 572121 LOC572121 LOC573376 Dr.116704 573376 LOC573376 LOC791474 Dr.6304 791474 LOC791474 LOC791930 Dr.79753 791930 LOC791930 LOC792364 Dr.95191 792364 LOC792364 LOC792428 Dr.118886 792428 LOC792428 LOC792472 Dr.119903 792472 LOC792472 LOC792511 Dr.120411 792511 LOC792511 LOC792525 Dr.139178 792525 LOC792525 LOC792601 Dr.17591 792601 LOC792601 LOC792613 Dr.120624 792613 LOC792613 LOC793171 Dr.97656 793171 LOC793171 LOC793280 Dr.132611 793280 LOC793280 LOC793374 Dr.86757 793374 LOC793374 LOC793872 Dr.78023 793872 LOC793872 LOC794028 Dr.26626 794028 LOC794028 LOC794073 Dr.15198 794073 LOC794073 LOC794313 Dr.86125 794313 LOC794313 LOC794413 Dr.116674 794413 LOC794413 LOC794621 Dr.116461 794621 LOC794621 LOC795305 Dr.116421 795305 LOC795305 LOC795529 Dr.80961 795529 LOC795529 LOC795597 Dr.89872 795597 LOC795597 LOC795785 Dr.113696 795785 LOC795785 LOC796163 Dr.118938 796163 LOC796163 LOC796750 Dr.40212 796750 LOC796750 LOC796842 Dr.120514 796842 LOC796842 LOC796878 Dr.113515 796878 LOC796878 LOC797099 Dr.120111 797099 LOC797099 LOC797263 Dr.115884 797263 LOC797263 LOC797351 Dr.120340 797351 LOC797351 LOC797508 Dr.117285 797508 LOC797508 LOC797787 Dr.104305 797787 LOC797787 LOC797833 Dr.84249 797833 LOC797833 LOC797946 Dr.107953 797946 LOC797946 LOC798073 Dr.120561 798073 LOC798073 LOC798122 Dr.114702 798122 LOC798122 LOC798123 Dr.107566 798123 LOC798123 LOC798492 Dr.84868 798492 LOC798492 LOC798623 Dr.79926 798623 LOC798623 LOC798772 Dr.115286 798772 LOC798772 LOC798868 Dr.67279 798868 LOC798868 LOC798960 Dr.114401 798960 LOC798960 LOC799067 Dr.81695 799067 LOC799067 LOC799214 Dr.118945 799214 LOC799214 LOC799377 Dr.117628 799377 LOC799377 LOC799605 Dr.120565 799605 LOC799605 LOC799689 Dr.86988 799689 LOC799689 LOC799825 Dr.77701 799825 LOC799825 lypla3 Dr.360 335008 lypla3 lyz Dr.83681 246089 lyz mg:db03g07 Dr.76103 326955 mg:db03g07 mmp13 Dr.81475 387293 mmp13 mmp9 Dr.76275 406397 mmp9 mtf1 Dr.118403 195821 mtf1 mtr Dr.75737 378847 mtr myh6 Dr.29034 386711 myh6 myhz2 Dr.132261 246275 myhz2 myod Dr.36017 30513 myod nbl1 Dr.82779 404629 nbl1 ncf1 Dr.2973 378966 ncf1 ndel1b Dr.7294 333957 ndel1b ndrg1l Dr.8090 393665 ndrg1l nfkb2 Dr.117553 415100 nfkb2 nfkbiab Dr.77409 323099 nfkbiab nmi Dr.80228 335331 nmi nppa Dr.72101 321442 nppa npsn Dr.79156 404039 npsn nr0b1 Dr.74816 100008590 nr0b1 Nr0b2 Dr.13394 403010 Nr0b2 nrp1a Dr.133652 353246 nrp1a ntn1b Dr.75773 30192 ntn1b nubp1 Dr.88416 503919 nubp1 nudt1 Dr.76941 406727 nudt1 olig3 Dr.117660 324857 olig3 oprl Dr.121451 402851 oprl or13.1 Dr.75767 58111 or13.1 ormdl1 Dr.27136 368632 ormdl1 pabpc1a Dr.24504 606498 pabpc1a parp3 Dr.78126 335495 parp3 pcca Dr.105309 437019 pcca pcdha Dr.88614 259184 pcdha pdcd7 Dr.82365 445020 pdcd7 pdk2 Dr.9528 393971 pdk2 pdzk1ip1l Dr.41116 368722 pdzk1ip1l pgm3 Dr.37649 474321 pgm3 pi4kII alpha Dr.79494 554275 pi4kII alpha pigc Dr.78451 323994 pigc pim1 Dr.78102 58054 pim1 pknox1.2 Dr.87714 170445 pknox1.2 plagl2 Dr.82515 259255 plagl2 plek Dr.29086 393814 plek plrg1 Dr.79159 406749 plrg1 pls1 Dr.113808 334273 pls1 polb Dr.116029 445402 polb polr1a Dr.101226 327078 polr1a pou1f1 Dr.89712 405777 pou1f1 prkg1 Dr.26605 394005 prkg1 prss35 Dr.118662 431759 prss35 psma6b Dr.82172 83917 psma6b psme1 Dr.81309 30648 psme1 psme2 Dr.76266 30647 psme2 ptger2l Dr.87881 393608 ptger2l ptgs1 Dr.115126 246226 ptgs1 pth1 Dr.86325 405886 pth1 pvalb2 Dr.460 58028 pvalb2 rab11a Dr.80427 492487 rab11a rab32 Dr.119612 378969 rab32 rad17 Dr.31220 436934 rad17 ralgps2 Dr.17213 393446 ralgps2 rbp2b Dr.89689 432384 rbp2b rdh1 Dr.97099 378440 rdh1 rel Dr.86023 415101 rel rgs12 Dr.84135 378970 rgs12 rgs14 Dr.80473 327368 rgs14 rgs4 Dr.75538 321256 rgs4 rhobtb2a Dr.115039 553415 rhobtb2a riok3 Dr.34142 445220 riok3 ripk2 Dr.28180 373874 ripk2 rp2 Dr.80773 406755 rp2 rpl10 Dr.75581 336712 rpl10 rpl24 Dr.1310 192301 rpl24 rpl8 Dr.4091 393686 rpl8 rpsa Dr.75127 394027 rpsa rs1 Dr.133096 445044 rs1 rtn4ip1 Dr.16642 393323 rtn4ip1 rtn4rl2a Dr.91444 403307 rtn4rl2a sb:cb230 Dr.81902 321163 sb:cb230 sb:cb26 Dr.77174 321046 sb:cb26 sb:cb339 Dr.100378 321210 sb:cb339 scamp2 Dr.121550 406687 scamp2 scarf1 Dr.74559 336834 scarf1 sccpdha Dr.77107 436632 sccpdha scn12ab Dr.110026 566868 scn12ab sdf2l1 Dr.51929 445275 sdf2l1 sec13 Dr.5496 406644 sec13 serpinb1l1 Dr.82062 494155 serpinb1l1 si:busm1- si:busm1- Dr.45761 368518 180o5.3 180o5.3 si:busm1- si:busm1- Dr.87489 566732 189a20.4 189a20.4 si:busm1- si:busm1- Dr.81772 368857 241h12.4 241h12.4 si:ch211- si:ch211- Dr.122452 337530 191d7.3 191d7.3 si:ch211- si:ch211- Dr.91260 445293 192k9.1 192k9.1 si:ch211- si:ch211- Dr.42900 557836 198b3.2 198b3.2 si:ch211- si:ch211- Dr.87374 553387 202c21.3 202c21.3 si:ch211- si:ch211- Dr.108675 323050 203h15.3 203h15.3 si:ch211- si:ch211- Dr.48022 561047 237l4.2 237l4.2 si:ch211- si:ch211- Dr.42682 336755 244b2.4 244b2.4 si:ch211- si:ch211- Dr.85745 563420 245h14.1 245h14.1 si:ch211- si:ch211- Dr.76284 336776 272f3.3 272f3.3 si:dkey-114f6.1 Dr.56035 327573 si:dkey-114f6.1
si:dkey-222b8.2 Dr.41221 567959 si:dkey-222b8.2 si:dkey- si:dkey- Dr.36001 322415 236e20.5 236e20.5 si:dkey- si:dkey- Dr.4570 386996 253d23.1 253d23.1 si:dkey-25e12.3 Dr.78146 569300 si:dkey-25e12.3 si:dkey- si:dkey- Dr.74466 557132 264g21.1 264g21.1 si:dkey-266j7.1 Dr.22774 336156 si:dkey-266j7.1 si:dkey-63j1.8 Dr.79402 335416 si:dkey-63j1.8 si:dkey-72l14.4 Dr.7451 562545 si:dkey-72l14.4
si:dkey-91f15.6 Dr.34109 564304 si:dkey-91f15.6 si:dkeyp- si:dkeyp- Dr.25788 368326 110c7.6 110c7.6 si:dkeyp- si:dkeyp- Dr.81070 336053 113f10.1 113f10.1 si:dkeyp-38g8.3 Dr.140675 567017 si:dkeyp-38g8.3
si:dkeyp-59a8.2 Dr.84529 563208 si:dkeyp-59a8.2
si:dkeyp-90a8.2 Dr.77261 562273 si:dkeyp-90a8.2 six7 Dr.75839 30625 six7 slc10a2 Dr.88326 393329 slc10a2 slc16a9a Dr.7340 393382 slc16a9a slc16a9b Dr.140314 445158 slc16a9b slc25a12 Dr.76801 337675 slc25a12 slc25a16 Dr.78884 324578 slc25a16 slc2a12 Dr.28449 393510 slc2a12 slmap Dr.81986 393146 slmap smoc2 Dr.108698 550416 smoc2 snx1 Dr.140305 337386 snx1 socs3 Dr.6431 335409 socs3a sox21b Dr.116538 406246 sox21b spi1 Dr.34508 30117 spi1 spint1l Dr.75391 406426 spint1l stard3nl Dr.75372 436592 stard3nl stat4 Dr.34491 368519 stat4 stat5.1 Dr.133576 369197 stat5.1 stc1 Dr.88421 393511 stc1 stub1 Dr.78513 324243 stub1 stx3a Dr.82925 393515 stx3a tcea2 Dr.85125 393961 tcea2 tceb2 Dr.33340 192341 tceb2 timp2l Dr.102602 406650 timp2l tlr5a Dr.89423 403138 tlr5a tlr5b Dr.89707 751829 tlr5b tmem177 Dr.3515 322274 tmem177 tnfa Dr.89727 405785 tnfa tnfaip8 Dr.105711 393303 tnfaip8 tnfaip8l Dr.88310 393345 tnfaip8l tnfb Dr.94015 554167 tnfb tnfsf10l2 Dr.86839 436866 tnfsf10l2 tnnt1 Dr.13906 353248 tnnt1 tomm22 Dr.117210 321232 tomm22 tomm40l Dr.84273 405895 tomm40l tp73 Dr.24319 368221 tp73 trpv6 Dr.118447 415109 trpv6 twsg1b Dr.83049 259304 twsg1b uba52 Dr.35198 641289 uba52 usp39 Dr.77033 790924 usp39 vezf1 Dr.103946 556915 vezf1 wnt1 Dr.85371 30128 wnt1 wnt16 Dr.87285 404628 wnt16 wu:fa01c11 Dr.75374 334720 wu:fa01c11 wu:fa04g06 Dr.75459 334833 wu:fa04g06 wu:fa04h11 Dr.34097 325495 wu:fa04h11 wu:fa06h01 Dr.13577 334875 wu:fa06h01 wu:fa14a01 Dr.75919 334589 wu:fa14a01 wu:fa91d01 Dr.76189 336652 wu:fa91d01 wu:fa91f10 Dr.76195 336665 wu:fa91f10 wu:fa92h10 Dr.76239 336699 wu:fa92h10 wu:fa92h11 Dr.132222 336700 wu:fa92h11 wu:fa94h07 Dr.23516 336758 wu:fa94h07 wu:fa95e03 Dr.1101 337025 wu:fa95e03 wu:fa97h07 Dr.104634 337111 wu:fa97h07 wu:fa98d10 Dr.27231 337125 wu:fa98d10 wu:fa98e11 Dr.76350 337130 wu:fa98e11 wu:fb08g12 Dr.51536 336378 wu:fb08g12 wu:fb09h07 Dr.23437 336413 wu:fb09h07 wu:fb10a09 Dr.51646 336418 wu:fb10a09 wu:fb11a04 Dr.3436 336451 wu:fb11a04 wu:fb11h05 Dr.76693 336493 wu:fb11h05 wu:fb13g09 Dr.76665 336563 wu:fb13g09 wu:fb14c11 Dr.32415 336586 wu:fb14c11 wu:fb15h11 Dr.5716 336638 wu:fb15h11 wu:fb17f01 Dr.76619 321500 wu:fb17f01 wu:fb18b12 Dr.23649 321526 wu:fb18b12 wu:fb19b08 Dr.24364 321557 wu:fb19b08 wu:fb25h12 Dr.76766 321668 wu:fb25h12 wu:fb26f10 Dr.76802 321684 wu:fb26f10 wu:fb37a10 Dr.11310 321850 wu:fb37a10 wu:fb48a08 Dr.77186 322050 wu:fb48a08 wu:fb49h10 Dr.23738 322096 wu:fb49h10 wu:fb54d07 Dr.33295 322245 wu:fb54d07 wu:fb57b02 Dr.4216 322299 wu:fb57b02 wu:fb57f08 Dr.23725 322318 wu:fb57f08 wu:fb58f04 Dr.132301 322344 wu:fb58f04 wu:fb60c02 Dr.77169 322409 wu:fb60c02 wu:fb61e06 Dr.77125 322446 wu:fb61e06 wu:fb63d05 Dr.132313 322510 wu:fb63d05 wu:fb64e03 Dr.76413 322540 wu:fb64e03 wu:fb66c11 Dr.105221 322582 wu:fb66c11 wu:fb67h05 Dr.77299 322620 wu:fb67h05 wu:fb72c11 Dr.129593 322739 wu:fb72c11 wu:fb72c11 Dr.75160 322739 wu:fb72c11 wu:fb74g08 Dr.105194 322844 wu:fb74g08 wu:fb76g02 Dr.77277 322911 wu:fb76g02 wu:fb79e06 Dr.39734 323032 wu:fb79e06 wu:fb80f02 Dr.77380 323066 wu:fb80f02 wu:fb81c07 Dr.75682 323088 wu:fb81c07 wu:fb82f09 Dr.77559 323130 wu:fb82f09 wu:fb92f04 Dr.21193 323215 wu:fb92f04 wu:fb94e12 Dr.21224 323301 wu:fb94e12 wu:fb98c10 Dr.77747 323431 wu:fb98c10 wu:fb99e06 Dr.77781 323481 wu:fb99e06 wu:fc01f10 Dr.135376 323526 wu:fc01f10 wu:fc04b03 Dr.78003 323592 wu:fc04b03 wu:fc06e12 Dr.27420 323668 wu:fc06e12 wu:fc07b07 Dr.77935 323690 wu:fc07b07 wu:fc07b09 Dr.104714 323691 wu:fc07b09 wu:fc09e12 Dr.51867 323770 wu:fc09e12 wu:fc14a04 Dr.22881 323913 wu:fc14a04 wu:fc14h11 Dr.75449 323945 wu:fc14h11 wu:fc15f06 Dr.78434 474325 wu:fc15f06 wu:fc15g08 Dr.77881 323970 wu:fc15g08 wu:fc20g06 Dr.2805 324163 wu:fc20g06 wu:fc22a11 Dr.78496 324223 wu:fc22a11 wu:fc23d01 Dr.22938 793794 wu:fc23d01 wu:fc23f06 Dr.15418 324283 wu:fc23f06 wu:fc27b12 Dr.35817 324380 wu:fc27b12 wu:fc27f12 Dr.121895 324399 wu:fc27f12 wu:fc29c12 Dr.78749 324446 wu:fc29c12 wu:fc32b08 Dr.21617 324544 wu:fc32b08 wu:fc32g03 Dr.78845 324557 wu:fc32g03 wu:fc35a10 Dr.5234 324618 wu:fc35a10 wu:fc37g06 Dr.21483 324668 wu:fc37g06 wu:fc38b05 Dr.78588 324684 wu:fc38b05 wu:fc44e02 Dr.79112 324828 wu:fc44e02 wu:fc46a02 Dr.79391 324870 wu:fc46a02 wu:fc51b07 Dr.78979 325002 wu:fc51b07 wu:fc51f03 Dr.78985 325018 wu:fc51f03 wu:fc54b08 Dr.79013 325063 wu:fc54b08 wu:fc54g06 Dr.78101 325086 wu:fc54g06 wu:fc55a06 Dr.3915 325091 wu:fc55a06 wu:fc55g06 Dr.79035 325115 wu:fc55g06 wu:fc59c03 Dr.8738 325201 wu:fc59c03 wu:fc70h07 Dr.76504 619262 wu:fc70h07 wu:fc76c11 Dr.27582 325434 wu:fc76c11 wu:fc79b02 Dr.3325 325456 wu:fc79b02 wu:fc83a09 Dr.79472 325480 wu:fc83a09 wu:fc83f05 Dr.79478 325498 wu:fc83f05 wu:fc84c07 Dr.108582 325519 wu:fc84c07 wu:fc89a04 Dr.79591 325575 wu:fc89a04 wu:fc93b03 Dr.15376 402912 wu:fc93b03 wu:fd02c11 Dr.79060 325683 wu:fd02c11 wu:fd10a10 Dr.4005 325758 wu:fd10a10 wu:fd11d10 Dr.79713 325782 wu:fd11d10 wu:fd36h06 Dr.79872 325877 wu:fd36h06 wu:fd42f04 Dr.106615 325883 wu:fd42f04 wu:fd58b05 Dr.94688 100007552 wu:fd58b05 wu:fd59c01 Dr.52856 735312 wu:fd59c01 wu:fe01a07 Dr.80626 326635 wu:fe01a07 wu:fe05b03 Dr.80638 326679 wu:fe05b03 wu:fe11g10 Dr.79993 777631 wu:fe11g10 wu:fe11h11 Dr.74223 556186 wu:fe11h11 wu:fe16c03 Dr.106191 326770 wu:fe16c03 wu:fe16c11 Dr.122189 326772 wu:fe16c11 wu:fe24a06 Dr.132679 326807 wu:fe24a06 wu:fe24e09 Dr.106515 795458 wu:fe24e09 wu:fe47a12 Dr.76804 326892 wu:fe47a12 wu:fi11e03 Dr.17505 327443 wu:fi11e03 wu:fi12h09 Dr.122177 327466 wu:fi12h09 wu:fi15d04 Dr.79942 327519 wu:fi15d04 wu:fi32b04 Dr.132168 494042 wu:fi32b04 wu:fi37b05 Dr.7324 334231 wu:fi37b05 wu:fi40d02 Dr.140094 334318 wu:fi40d02 wu:fj01a12 Dr.80190 554089 wu:fj01a12 wu:fj04f08 Dr.80233 335346 wu:fj04f08 wu:fj05c06 Dr.80727 335354 wu:fj05c06 wu:fj05f05 Dr.80731 335362 wu:fj05f05 wu:fj19a05 Dr.22588 335520 wu:fj19a05 wu:fj20h08 Dr.122319 335545 wu:fj20h08 wu:fj22b05 Dr.80845 335563 wu:fj22b05 wu:fj29h10 Dr.79667 335617 wu:fj29h10 wu:fj38c09 Dr.81028 335932 wu:fj38c09 wu:fj48a06 Dr.76584 336088 wu:fj48a06 wu:fj49c01 Dr.76105 336116 wu:fj49c01 wu:fj53a05 Dr.81170 336163 wu:fj53a05 wu:fj53e10 Dr.80301 336172 wu:fj53e10 wu:fj59a01 Dr.81226 336240 wu:fj59a01 wu:fj62g02 Dr.81251 336305 wu:fj62g02 wu:fj67d03 Dr.132704 337431 wu:fj67d03 wu:fj84f01 Dr.81535 337578 wu:fj84f01 wu:fj85b02 Dr.81541 337585 wu:fj85b02 wu:fj85h12 Dr.81581 337599 wu:fj85h12 wu:fj86g03 Dr.132921 337607 wu:fj86g03 wu:fj87c06 Dr.9554 337619 wu:fj87c06 wu:fk14g08 Dr.81512 337300 wu:fk14g08 wu:fk31a07 Dr.23104 336938 wu:fk31a07 wu:fk34f03 Dr.104587 336960 wu:fk34f03 wu:fk35f04 Dr.76616 386925 wu:fk35f04 wu:fk36h04 Dr.23134 336972 wu:fk36h04 wu:fk54a10 Dr.81960 335663 wu:fk54a10 wu:fk81c02 Dr.82060 335157 wu:fk81c02 wu:fl02d04 Dr.122566 335264 wu:fl02d04 wu:fl03b09 Dr.10410 337704 wu:fl03b09 wu:fm82b06 Dr.122949 337686 wu:fm82b06 wu:fp52e02 Dr.85903 386835 wu:fp52e02 wu:fp56f09 Dr.122259 337698 wu:fp56f09 wu:fq77h11 Dr.108155 503777 wu:fq77h11 ythdf1 Dr.3039 327606 ythdf1 zbtb48 Dr.72135 325725 zbtb48 zcchc10 Dr.80591 334240 zcchc10 zdhhc23 Dr.83252 445301 zdhhc23 zfp36l1 Dr.105582 554684 zfp36l1 zgc:100846 Dr.82328 402895 zgc:100846 zgc:100849 Dr.77914 445144 zgc:100849 zgc:100897 Dr.23554 445297 zgc:100897 zgc:101066 Dr.88663 445178 zgc:101066 zgc:101100 Dr.90945 445169 zgc:101100 zgc:101659 Dr.37198 492798 zgc:101659 zgc:101739 Dr.80825 447890 zgc:101739 zgc:101741 Dr.84246 492766 zgc:101741 zgc:101811 Dr.77501 450028 zgc:101811 zgc:101818 Dr.117252 494076 zgc:101818 zgc:103433 Dr.91379 450017 zgc:103433 zgc:103438 Dr.86834 450015 zgc:103438 zgc:103473 Dr.84834 492477 zgc:103473 zgc:103566 Dr.119956 403071 zgc:103566 zgc:103575 Dr.85993 449806 zgc:103575 zgc:103594 Dr.76097 447942 zgc:103594 zgc:103755 Dr.12697 449988 zgc:103755 zgc:109896 Dr.26640 553543 zgc:109896 zgc:109969 Dr.78796 553560 zgc:109969 zgc:110025 Dr.135075 553578 zgc:110025 zgc:110152 Dr.27897 550551 zgc:110152 zgc:110354 Dr.88891 553612 zgc:110354 zgc:110361 Dr.40351 550478 zgc:110361 zgc:110617 Dr.45532 553639 zgc:110617 zgc:110848 Dr.118397 503751 zgc:110848 zgc:111976 Dr.85177 553663 zgc:111976 zgc:112118 Dr.87575 550435 zgc:112118 zgc:112143 Dr.76505 550429 zgc:112143 zgc:112148 Dr.82236 550424 zgc:112148 zgc:112172 Dr.90055 550415 zgc:112172 zgc:112208 Dr.82025 550398 zgc:112208 zgc:112232 Dr.90608 565258 zgc:112232 zgc:112236 Dr.132927 553693 zgc:112236 zgc:112304 Dr.41753 554050 zgc:112304 zgc:113102 Dr.134817 503754 zgc:113102 zgc:113232 Dr.43135 541546 zgc:113232 zgc:113277 Dr.87180 553814 zgc:113277 zgc:113516 Dr.79930 541449 zgc:113516 zgc:113527 Dr.88899 613245 zgc:113527 zgc:113947 Dr.140628 403081 zgc:113947 zgc:114066 Dr.84802 566506 zgc:114066 zgc:123046 Dr.114190 568429 zgc:123046 zgc:123047 Dr.20771 553283 zgc:123047 zgc:123218 Dr.86778 641321 zgc:123218 zgc:123236 Dr.110015 557480 zgc:123236 zgc:123291 Dr.39466 555725 zgc:123291 zgc:123339 Dr.15815 567972 zgc:123339 zgc:136228 Dr.76679 570276 zgc:136228 zgc:136569 Dr.85861 692318 zgc:136569 zgc:136632 Dr.80625 326634 zgc:136632 zgc:136816 Dr.825 723996 zgc:136816 zgc:136971 Dr.78531 678599 zgc:136971 zgc:152901 Dr.79170 566352 zgc:152901 zgc:152945 Dr.77704 767787 zgc:152945 zgc:152979 Dr.133940 767671 zgc:152979 zgc:153020 Dr.134726 560761 zgc:153020 zgc:153267 Dr.89419 767684 zgc:153267 zgc:153723 Dr.88985 767718 zgc:153723 zgc:153888 Dr.83167 768164 zgc:153888 zgc:158367 Dr.116845 571403 zgc:158367 zgc:158387 Dr.75902 567275 zgc:158387 zgc:158404 Dr.89148 557029 zgc:158404 zgc:158455 Dr.78061 790928 zgc:158455 zgc:158607 Dr.79190 569294 zgc:158607 zgc:158695 Dr.40378 791134 zgc:158695 zgc:158780 Dr.38076 503773 zgc:158780 zgc:158861 Dr.120725 100005434 zgc:158861 zgc:162162 Dr.84274 568747 zgc:162162 zgc:162198 Dr.66850 325787 zgc:162198 zgc:162235 Dr.86308 563648 zgc:162235 zgc:162280 Dr.92706 799608 zgc:162280 zgc:162290 Dr.16985 100007897 zgc:162290 zgc:162316 Dr.92977 100037372 zgc:162316 zgc:162651 Dr.115655 323364 zgc:162651 zgc:163057 Dr.87319 563335 zgc:163057 zgc:165461 Dr.108135 497419 zgc:165461 zgc:55292 Dr.1786 321491 zgc:55292 zgc:55396 Dr.115188 406835 zgc:55396 zgc:55398 Dr.80443 394023 zgc:55398 zgc:55764 Dr.116955 324211 zgc:55764 zgc:55794 Dr.80343 327593 zgc:55794 zgc:55863 Dr.82569 393937 zgc:55863 zgc:56085 Dr.11252 327506 zgc:56085 zgc:56141 Dr.42026 406277 zgc:56141 zgc:56417 Dr.79371 393258 zgc:56417 zgc:56567 Dr.117075 406725 zgc:56567 zgc:63792 Dr.75976 337333 zgc:63792 zgc:63934 Dr.26462 393316 zgc:63934 zgc:64013 Dr.119341 393333 zgc:64013 zgc:64031 Dr.82104 393338 zgc:64031 zgc:64042 Dr.84488 393609 zgc:64042 zgc:64085 Dr.12508 393380 zgc:64085 zgc:64106 Dr.78121 393348 zgc:64106 zgc:64114 Dr.82488 378866 zgc:64114 zgc:64141 Dr.78662 393353 zgc:64141 zgc:65788 Dr.77223 322420 zgc:65788 zgc:65909 Dr.75861 393504 zgc:65909 zgc:65996 Dr.18197 336641 zgc:65996 zgc:66026 Dr.18349 393549 zgc:66026 zgc:66125 Dr.96456 393796 zgc:66125 zgc:66168 Dr.75903 337810 zgc:66168 zgc:66326 Dr.76836 321842 zgc:66326 zgc:66350 Dr.29708 393493 zgc:66350 zgc:66353 Dr.4114 321378 zgc:66353 zgc:66409 Dr.23608 335407 zgc:66409 zgc:66443 Dr.114215 406856 zgc:66443 zgc:66449 Dr.13689 327407 zgc:66449 zgc:76875 Dr.82970 405849 zgc:76875 zgc:76951 Dr.79424 325410 zgc:76951 zgc:77002 Dr.83170 405846 zgc:77002 zgc:77033 Dr.23613 406598 zgc:77033 zgc:77038 Dr.81607 406596 socs3b zgc:77041 Dr.16044 404632 zgc:77041 zgc:77068 Dr.113519 405824 zgc:77068 zgc:77182 Dr.88453 402953 zgc:77182 zgc:77242 Dr.89035 402969 zgc:77242 zgc:77287 Dr.84139 404617 zgc:77287 zgc:77358 Dr.82216 402928 zgc:77358 zgc:77387 Dr.6336 324010 zgc:77387 zgc:77424 Dr.88467 404622 zgc:77424 zgc:77486 Dr.85913 405808 zgc:77486 zgc:77517 Dr.76027 393540 zgc:77517 zgc:77727 Dr.89530 393830 zgc:77727 zgc:77855 Dr.88688 393836 zgc:77855 zgc:77861 Dr.77739 393823 zgc:77861 zgc:77862 Dr.132662 406474 zgc:77862 zgc:77905 Dr.81416 393867 zgc:77905 zgc:77906 Dr.134550 402945 zgc:77906 zgc:85611 Dr.85105 406368 zgc:85611 zgc:85616 Dr.113645 406356 zgc:85616 zgc:85942 Dr.140429 405866 zgc:85942 zgc:85944 Dr.84638 571696 zgc:85944 zgc:85965 Dr.81190 405857 zgc:85965 zgc:86754 Dr.80284 415225 zgc:86754 zgc:86870 Dr.84307 436953 zgc:86870 zgc:86889 Dr.133321 415192 zgc:86889 zgc:86905 Dr.31087 415185 zgc:86905 zgc:86926 Dr.69080 415179 zgc:86926 zgc:91890 Dr.83427 431729 zgc:91890 zgc:91915 Dr.84836 436595 zgc:91915 zgc:91940 Dr.81687 436942 zgc:91940 zgc:91959 Dr.32109 436939 zgc:91959 zgc:91963 Dr.85722 445108 zgc:91963 zgc:91978 Dr.106802 436927 zgc:91978 zgc:92083 Dr.117302 447860 zgc:92083 zgc:92137 Dr.33934 445049 zgc:92137 zgc:92167 Dr.111731 436621 zgc:92167 zgc:92225 Dr.132558 436906 zgc:92225 zgc:92239 Dr.120620 494036 zgc:92239 zgc:92250 Dr.81554 447821 zgc:92250 zgc:92252 Dr.81006 436895 zgc:92252 zgc:92267 Dr.102467 494035 zgc:92267 zgc:92276 Dr.83119 445024 zgc:92276 zgc:92367 Dr.81587 445119 traf3 zgc:92420 Dr.28514 445069 zgc:92420 zgc:92446 Dr.115939 445112 zgc:92446 zgc:92456 Dr.86760 445287 zgc:92456 zgc:92591 Dr.18405 436997 zgc:92591 zgc:92608 Dr.134016 436979 zgc:92608 zgc:92647 Dr.29795 436707 zgc:92647 zgc:92754 Dr.32124 436840 zgc:92754 zgc:92762 Dr.84618 436834 zgc:92762 zgc:92833 Dr.109068 436776 zgc:92833 zgc:92849 Dr.86222 436767 zgc:92849 zgc:92866 Dr.121908 436755 zgc:92866 zgc:92866 Dr.76532 436755 zgc:92866 zgc:92890 Dr.88790 436742 zgc:92890 zgc:92913 Dr.115549 436804 zgc:92913 zgc:92926 Dr.80970 436797 zgc:92926 zp2l1 Dr.75593 555180 zp2l1
UniGene clusters differentially regulated upon S. typhimurium wt infection were grouped into four categories. Category 1: immune specific by means of GO-annotation and overlap with the common host response gene set (Supplementary Table III); Category 2: described immune function but missed out on category 1; Category 3: functionally annotated but no association to an immune function was revealed by PubMed search using inflammation and immunity as key words; Category 4: no functional annotation
B. S. typhimurium Ra vs. control
Gene Symbol UniGene Code Entrez GeneID Category 1 Category 2 Category 3 Category 4 (build#105) abcb3 Dr.88570 368771 abcb3 accn2c Dr.120630 407670 accn2c aco1 Dr.40063 568448 aco1 ada Dr.120392 436919 ada adam8 Dr.86401 368917 adam8 agpat3 Dr.75961 406734 agpat3 aldh2 Dr.28434 393462 aldh2 amt Dr.121883 450000 amt arih1 Dr.75869 327005 arih1 arl2bp Dr.110760 393976 arl2bp aspn Dr.81771 65228 aspn atf3 Dr.77523 393939 atf3 atg4c Dr.121931 415193 atg4c atp6v1b2 Dr.132618 359840 atp6v1b2 auh Dr.2043 445182 auh baz1a Dr.36447 334173 baz1a bcl2 Dr.45607 570772 bcl2 bin1 Dr.132574 447863 bin1 c3b Dr.21006 30491 c3b c3c Dr.88584 30492 c3c c6 Dr.16392 393611 c6 c6orf83 Dr.134087 393343 c6orf83 camk1g Dr.9874 335654 camk1g ccdc43 Dr.85117 393631 ccdc43 ccdc52 Dr.85458 494093 ccdc52 cdon Dr.121780 280652 cdon cebpb Dr.79988 140814 cebpb cebpd Dr.1280 140817 cebpd cfb Dr.75096 30604 cfb CH211- CH211- Dr.112790 564179 119C20.3 119C20.3
CH211-133N4.6 Dr.132691 797776 CH211-133N4.6
CH211-89F7.4 Dr.133987 794891 CH211-89F7.4 chad Dr.80402 394038 chad churc1 Dr.79574 492508 churc1 ciapin1 Dr.120788 445283 ciapin1 cldnc Dr.12596 81582 cldnc cldnf Dr.76180 791933 cldnf copb2 Dr.14625 114454 copb2 cops8 Dr.78319 393198 cops8 cpa5 Dr.77201 246092 cpa5 crh Dr.96618 492507 crh cry1a Dr.82313 83777 cry1a crygm2b Dr.116427 553954 crygm2b crygm2d6 Dr.134350 415228 crygm2d6 crygm5 Dr.134555 474328 crygm5 crygm6 Dr.15363 553966 crygm6 crygn2 Dr.87252 445034 crygn2 ctsk Dr.76224 791982 ctsk ctssa Dr.81560 393398 ctssa cxcr3.2 Dr.82754 492348 cxcr3.2 cyp11a1 Dr.80336 80374 cyp11a1 cyp17a1 Dr.79318 399692 cyp17a1 cyp2j30 Dr.37032 492484 cyp2j30 dap1b Dr.76473 58094 dap1b dcps Dr.531 402850 dcps dctd Dr.39980 550332 dctd ddost Dr.1142 406408 ddost dedd1 Dr.78368 58125 dedd1 dhrs1 Dr.32174 368670 dhrs1
DKEY-183C16.6 Dr.12004 572757 DKEY-183C16.6
DKEYP-97G3.6 Dr.115457 561933 DKEYP-97G3.6 dnmt3 Dr.67521 30659 dnmt3 Dock8 Dr.27090 403040 Dock8 dohh Dr.2393 321732 dohh Dr.1026 Dr.1026 Dr.1026 Dr.104095 Dr.104095 Dr.104095 Dr.104849 Dr.104849 Dr.104849 Dr.105847 Dr.105847 Dr.105847 Dr.106669 Dr.106669 Dr.106669 Dr.107610 Dr.107610 Dr.107610 Dr.107715 Dr.107715 Dr.107715 Dr.107926 Dr.107926 Dr.107926 Dr.108104 Dr.108104 Dr.108104 Dr.10826 Dr.10826 Dr.10826 Dr.109938 Dr.109938 Dr.109938 Dr.110766 Dr.110766 Dr.110766 Dr.112862 Dr.112862 Dr.112862 Dr.114009 Dr.114009 Dr.114009 Dr.119809 Dr.119809 Dr.119809 Dr.12002 Dr.12002 Dr.12002 Dr.121349 Dr.121349 Dr.121349 Dr.121552 Dr.121552 Dr.121552 Dr.121588 Dr.121588 Dr.121588 Dr.121757 Dr.121757 Dr.121757 Dr.121765 Dr.121765 Dr.121765 Dr.121884 Dr.121884 Dr.121884 Dr.121913 Dr.121913 Dr.121913 Dr.121924 Dr.121924 Dr.121924 Dr.121974 Dr.121974 Dr.121974 Dr.122052 Dr.122052 Dr.122052 Dr.122080 Dr.122080 Dr.122080 Dr.122280 Dr.122280 Dr.122280 Dr.122410 Dr.122410 Dr.122410 Dr.122414 Dr.122414 Dr.122414 Dr.122521 Dr.122521 Dr.122521 Dr.122669 Dr.122669 Dr.122669 Dr.122738 Dr.122738 Dr.122738 Dr.122743 Dr.122743 Dr.122743 Dr.122769 Dr.122769 Dr.122769 Dr.122786 Dr.122786 Dr.122786 Dr.122810 Dr.122810 Dr.122810 Dr.122946 Dr.122946 Dr.122946 Dr.122988 Dr.122988 Dr.122988 Dr.122993 Dr.122993 Dr.122993 Dr.123072 Dr.123072 Dr.123072 Dr.123093 Dr.123093 Dr.123093 Dr.123119 Dr.123119 Dr.123119 Dr.123134 Dr.123134 Dr.123134 Dr.123175 Dr.123175 Dr.123175 Dr.123239 Dr.123239 Dr.123239 Dr.123312 Dr.123312 Dr.123312 Dr.123324 Dr.123324 Dr.123324 Dr.123372 Dr.123372 Dr.123372 Dr.123509 Dr.123509 Dr.123509 Dr.123516 Dr.123516 Dr.123516 Dr.123540 Dr.123540 Dr.123540 Dr.123541 Dr.123541 Dr.123541 Dr.123559 Dr.123559 Dr.123559 Dr.123575 Dr.123575 Dr.123575 Dr.123651 Dr.123651 Dr.123651 Dr.123661 Dr.123661 Dr.123661 Dr.123681 Dr.123681 Dr.123681 Dr.123742 Dr.123742 Dr.123742 Dr.123950 Dr.123950 Dr.123950 Dr.124020 Dr.124020 Dr.124020 Dr.124279 Dr.124279 Dr.124279 Dr.124535 Dr.124535 Dr.124535 Dr.124651 Dr.124651 Dr.124651 Dr.124668 Dr.124668 Dr.124668 Dr.124799 Dr.124799 Dr.124799 Dr.124888 Dr.124888 Dr.124888 Dr.124946 Dr.124946 Dr.124946 Dr.125080 Dr.125080 Dr.125080 Dr.125277 Dr.125277 Dr.125277 Dr.125570 Dr.125570 Dr.125570 Dr.125670 Dr.125670 Dr.125670 Dr.125824 Dr.125824 Dr.125824 Dr.126078 Dr.126078 Dr.126078 Dr.126130 Dr.126130 Dr.126130 Dr.126204 Dr.126204 Dr.126204 Dr.126534 Dr.126534 Dr.126534 Dr.126564 Dr.126564 Dr.126564 Dr.12823 Dr.12823 Dr.12823 Dr.128421 Dr.128421 Dr.128421 Dr.128681 Dr.128681 Dr.128681 Dr.128926 Dr.128926 Dr.128926 Dr.128938 Dr.128938 Dr.128938 Dr.129189 Dr.129189 Dr.129189 Dr.129433 Dr.129433 Dr.129433 Dr.129661 Dr.129661 Dr.129661 Dr.130083 Dr.130083 Dr.130083 Dr.130105 Dr.130105 Dr.130105 Dr.130502 Dr.130502 Dr.130502 Dr.130898 Dr.130898 Dr.130898 Dr.131054 Dr.131054 Dr.131054 Dr.131225 Dr.131225 Dr.131225 Dr.131275 Dr.131275 Dr.131275 Dr.131316 Dr.131316 Dr.131316 Dr.131335 Dr.131335 Dr.131335 Dr.131410 Dr.131410 Dr.131410 Dr.131719 Dr.131719 Dr.131719 Dr.131852 Dr.131852 Dr.131852 Dr.131919 Dr.131919 Dr.131919 Dr.132049 Dr.132049 Dr.132049 Dr.132082 Dr.132082 Dr.132082 Dr.132109 Dr.132109 Dr.132109 Dr.132130 Dr.132130 Dr.132130 Dr.132218 Dr.132218 Dr.132218 Dr.13241 Dr.13241 Dr.13241 Dr.132610 Dr.132610 Dr.132610 Dr.132683 Dr.132683 Dr.132683 Dr.132723 Dr.132723 Dr.132723 Dr.132748 Dr.132748 Dr.132748 Dr.132831 Dr.132831 Dr.132831 Dr.132994 Dr.132994 Dr.132994 Dr.133097 Dr.133097 Dr.133097 Dr.133119 Dr.133119 Dr.133119 Dr.133202 Dr.133202 Dr.133202 Dr.133343 Dr.133343 Dr.133343 Dr.133363 Dr.133363 Dr.133363 Dr.133397 Dr.133397 Dr.133397 Dr.133400 Dr.133400 Dr.133400 Dr.133403 Dr.133403 Dr.133403 Dr.133426 Dr.133426 Dr.133426 Dr.133437 Dr.133437 Dr.133437 Dr.133494 Dr.133494 Dr.133494 Dr.133523 Dr.133523 Dr.133523 Dr.133641 Dr.133641 Dr.133641 Dr.133731 Dr.133731 Dr.133731 Dr.133746 Dr.133746 Dr.133746 Dr.133747 Dr.133747 Dr.133747 Dr.133752 Dr.133752 Dr.133752 Dr.133882 Dr.133882 Dr.133882 Dr.134395 Dr.134395 Dr.134395 Dr.134581 Dr.134581 Dr.134581 Dr.134582 Dr.134582 Dr.134582 Dr.134747 Dr.134747 Dr.134747 Dr.134771 Dr.134771 Dr.134771 Dr.13481 Dr.13481 Dr.13481 Dr.134954 Dr.134954 Dr.134954 Dr.135155 Dr.135155 Dr.135155 Dr.135158 Dr.135158 Dr.135158 Dr.135386 Dr.135386 Dr.135386 Dr.13598 Dr.13598 Dr.13598 Dr.137711 Dr.137711 Dr.137711 Dr.13801 Dr.13801 Dr.13801 Dr.13837 Dr.13837 Dr.13837 Dr.13875 Dr.13875 Dr.13875 Dr.140503 Dr.140503 Dr.140503 Dr.140570 Dr.140570 Dr.140570 Dr.140627 Dr.140627 Dr.140627 Dr.140672 Dr.140672 Dr.140672 Dr.140743 Dr.140743 Dr.140743 Dr.140871 Dr.140871 Dr.140871 Dr.141327 Dr.141327 Dr.141327 Dr.14167 Dr.14167 Dr.14167 Dr.14578 Dr.14578 Dr.14578 Dr.14870 Dr.14870 Dr.14870 Dr.15245 Dr.15245 Dr.15245 Dr.15365 Dr.15365 Dr.15365 Dr.15519 Dr.15519 Dr.15519 Dr.15621 Dr.15621 Dr.15621 Dr.16786 Dr.16786 Dr.16786 Dr.17 Dr.17 Dr.17 Dr.17702 Dr.17702 Dr.17702 Dr.18912 Dr.18912 Dr.18912 Dr.21599 Dr.21599 Dr.21599 Dr.21609 Dr.21609 Dr.21609 Dr.22350 Dr.22350 Dr.22350 Dr.23568 Dr.23568 Dr.23568 Dr.23571 Dr.23571 Dr.23571 Dr.26104 Dr.26104 Dr.26104 Dr.27927 Dr.27927 Dr.27927 Dr.28032 Dr.28032 Dr.28032 Dr.28338 Dr.28338 Dr.28338 Dr.28585 Dr.28585 Dr.28585 Dr.28905 Dr.28905 Dr.28905 Dr.29633 Dr.29633 Dr.29633 Dr.40900 Dr.40900 Dr.40900 Dr.44448 Dr.44448 Dr.44448 Dr.45458 Dr.45458 Dr.45458 Dr.48126 Dr.48126 Dr.48126 Dr.51495 Dr.51495 Dr.51495 Dr.67299 Dr.67299 Dr.67299 Dr.74678 Dr.74678 Dr.74678 Dr.75197 Dr.75197 Dr.75197 Dr.75718 Dr.75718 Dr.75718 Dr.76018 Dr.76018 Dr.76018 Dr.76346 Dr.76346 Dr.76346 Dr.76544 Dr.76544 Dr.76544 Dr.76591 Dr.76591 Dr.76591 Dr.76725 Dr.76725 Dr.76725 Dr.78420 Dr.78420 Dr.78420 Dr.78817 Dr.78817 Dr.78817 Dr.78846 Dr.78846 Dr.78846 Dr.78997 Dr.78997 Dr.78997 Dr.79238 Dr.79238 Dr.79238 Dr.79468 Dr.79468 Dr.79468 Dr.79956 Dr.79956 Dr.79956 Dr.80215 Dr.80215 Dr.80215 Dr.80221 Dr.80221 Dr.80221 Dr.80672 Dr.80672 Dr.80672 Dr.80786 Dr.80786 Dr.80786 Dr.80902 Dr.80902 Dr.80902 Dr.81063 Dr.81063 Dr.81063 Dr.81575 Dr.81575 Dr.81575 Dr.81762 Dr.81762 Dr.81762 Dr.81922 Dr.81922 Dr.81922 Dr.82462 Dr.82462 Dr.82462 Dr.82700 Dr.82700 Dr.82700 Dr.82741 Dr.82741 Dr.82741 Dr.82821 Dr.82821 Dr.82821 Dr.82883 Dr.82883 Dr.82883 Dr.83069 Dr.83069 Dr.83069 Dr.83104 Dr.83104 Dr.83104 Dr.83137 Dr.83137 Dr.83137 Dr.83144 Dr.83144 Dr.83144 Dr.83201 Dr.83201 Dr.83201 Dr.83251 Dr.83251 Dr.83251 Dr.83390 Dr.83390 Dr.83390 Dr.83434 Dr.83434 Dr.83434 Dr.83460 Dr.83460 Dr.83460 Dr.83483 Dr.83483 Dr.83483 Dr.83658 Dr.83658 Dr.83658 Dr.83752 Dr.83752 Dr.83752 Dr.83826 Dr.83826 Dr.83826 Dr.83842 Dr.83842 Dr.83842 Dr.83922 Dr.83922 Dr.83922 Dr.83951 Dr.83951 Dr.83951 Dr.83994 Dr.83994 Dr.83994 Dr.84001 Dr.84001 Dr.84001 Dr.84041 Dr.84041 Dr.84041 Dr.84292 Dr.84292 Dr.84292 Dr.84330 Dr.84330 Dr.84330 Dr.84373 Dr.84373 Dr.84373 Dr.84409 Dr.84409 Dr.84409 Dr.84597 Dr.84597 Dr.84597 Dr.84632 Dr.84632 Dr.84632 Dr.84675 Dr.84675 Dr.84675 Dr.84755 Dr.84755 Dr.84755 Dr.84756 Dr.84756 Dr.84756 Dr.84837 Dr.84837 Dr.84837 Dr.84839 Dr.84839 Dr.84839 Dr.84864 Dr.84864 Dr.84864 Dr.85154 Dr.85154 Dr.85154 Dr.85215 Dr.85215 Dr.85215 Dr.85425 Dr.85425 Dr.85425 Dr.85557 Dr.85557 Dr.85557 Dr.85649 Dr.85649 Dr.85649 Dr.85684 Dr.85684 Dr.85684 Dr.85933 Dr.85933 Dr.85933 Dr.85965 Dr.85965 Dr.85965 Dr.86052 Dr.86052 Dr.86052 Dr.86115 Dr.86115 Dr.86115 Dr.86201 Dr.86201 Dr.86201 Dr.86498 Dr.86498 Dr.86498 Dr.87006 Dr.87006 Dr.87006 Dr.88798 Dr.88798 Dr.88798 Dr.88858 Dr.88858 Dr.88858 Dr.89189 Dr.89189 Dr.89189 Dr.89553 Dr.89553 Dr.89553 Dr.89615 Dr.89615 Dr.89615 Dr.89651 Dr.89651 Dr.89651 Dr.89757 Dr.89757 Dr.89757 Dr.90284 Dr.90284 Dr.90284 Dr.90455 Dr.90455 Dr.90455 Dr.90533 Dr.90533 Dr.90533 Dr.90564 Dr.90564 Dr.90564 Dr.90573 Dr.90573 Dr.90573 Dr.90589 Dr.90589 Dr.90589 Dr.90629 Dr.90629 Dr.90629 Dr.90695 Dr.90695 Dr.90695 Dr.90757 Dr.90757 Dr.90757 Dr.90773 Dr.90773 Dr.90773 Dr.90792 Dr.90792 Dr.90792 Dr.90818 Dr.90818 Dr.90818 Dr.91146 Dr.91146 Dr.91146 Dr.92037 Dr.92037 Dr.92037 Dr.92084 Dr.92084 Dr.92084 Dr.92105 Dr.92105 Dr.92105 Dr.92138 Dr.92138 Dr.92138 Dr.92257 Dr.92257 Dr.92257 Dr.92303 Dr.92303 Dr.92303 Dr.92368 Dr.92368 Dr.92368 Dr.94477 Dr.94477 Dr.94477 Dr.9594 Dr.9594 Dr.9594 Dr.99729 Dr.99729 Dr.99729 egln3 Dr.9457 406602 egln3 eif3s8 Dr.117110 334234 eif3s8 eif4e1a Dr.5294 79380 eif4e1a elf3 Dr.76707 336816 elf3 emx3 Dr.75757 30536 emx3 eng1a Dr.75072 30244 eng1a env Dr.132764 402813 env exosc4 Dr.107456 393712 exosc4 exosc8 Dr.116761 323016 exosc8 fbxl5 Dr.76970 322181 fbxl5 fez1 Dr.116746 406705 fez1 fgfrl1b Dr.37960 497135 fgfrl1b fgl2 Dr.81522 565637 fgl2 fkrp Dr.11951 571426 fkrp flj11749l Dr.77489 445397 flj11749l flot1 Dr.140639 30069 flot1 fn1b Dr.24233 334613 fn1b fos Dr.12986 394198 fos foxc1b Dr.83301 79375 foxc1b fxyd6 Dr.26591 333987 fxyd6 gdf7 Dr.88610 30642 gdf7 gfra1a Dr.119737 79376 gfra1a gltscr1 Dr.75629 386775 gltscr1 gnb3l Dr.32120 436710 gnb3l gngt2 Dr.19203 335655 gngt2 gnptg Dr.3328 415147 gnptg gnrh2 Dr.84757 353222 gnrh2 got2 Dr.17618 406688 got2 grb10 Dr.105808 446167 grb10 h2afza Dr.29040 403077 h2afza hamp1 Dr.89447 402837 hamp1 hbbe1 Dr.114511 81538 hbbe1 hbbe3 Dr.29153 30596 hbbe3 hm:zehn2160 Dr.107623 337758 hm:zehn2160 Hrc Dr.79314 553296 Hrc hsp70 Dr.114305 30671 hsp70 iclp1 Dr.7740 58113 iclp1 ift81 Dr.18625 432390 ift81 il10 Dr.135567 553957 il10 il12a Dr.135199 445410 il12a il15l Dr.37800 553172 il15l il17-3 Dr.135566 553960 il17-3 il1b Dr.30443 405770 il1b im:6894100 Dr.133462 552929 im:6894100 im:6910535 Dr.108863 448892 im:6910535 im:6911368 Dr.80514 448895 im:6911368 im:7136115 Dr.83392 497312 im:7136115 im:7141573 Dr.90963 492566 im:7141573 im:7145101 Dr.79495 553460 im:7145101 im:7145328 Dr.104946 497482 im:7145328 im:7149072 Dr.91280 445153 im:7149072 im:7149561 Dr.124869 503989 im:7149561 im:7150721 Dr.78394 550189 im:7150721 im:7151086 Dr.66408 492698 im:7151086 im:7156740 Dr.105408 550315 im:7156740 ins Dr.75811 30262 ins ipo9 Dr.33564 406860 ipo9 ipo9 Dr.132506 406860 ipo9 irf6 Dr.81664 393570 irf6 irx2a Dr.88466 394032 irx2a junb Dr.10326 407086 junb junbl Dr.737 336038 junbl klhl Dr.132373 323332 klhl lim2.4 Dr.88040 436680 lim2.4
LOC100000144 Dr.85734 100000144 LOC100000144
LOC100000306 Dr.116123 100000306 LOC100000306
LOC100000455 Dr.115115 100000455 LOC100000455
LOC100000608 Dr.85440 100000608 LOC100000608
LOC100000643 Dr.84913 100000643 LOC100000643
LOC100000934 Dr.48801 100000934 LOC100000934
LOC100001075 Dr.117939 100001075 LOC100001075
LOC100001243 Dr.117997 100001243 LOC100001243
LOC100001612 Dr.90930 100001612 LOC100001612
LOC100001701 Dr.82051 100001701 LOC100001701
LOC100001785 Dr.132540 100001785 LOC100001785
LOC100001935 Dr.44195 100001935 LOC100001935
LOC100001968 Dr.23709 100001968 LOC100001968
LOC100002043 Dr.121481 100002043 LOC100002043
LOC100002165 Dr.9483 100002165 LOC100002165
LOC100002334 Dr.23240 100002334 LOC100002334
LOC100002439 Dr.120617 100002439 LOC100002439
LOC100002471 Dr.114497 100002471 LOC100002471
LOC100002510 Dr.24948 100002510 LOC100002510
LOC100002523 Dr.116473 100002523 LOC100002523
LOC100003336 Dr.134946 100003336 LOC100003336
LOC100003425 Dr.116650 100003425 LOC100003425
LOC100003911 Dr.92011 100003911 LOC100003911
LOC100003936 Dr.114594 100003936 LOC100003936
LOC100003959 Dr.78376 100003959 LOC100003959
LOC100004438 Dr.116159 100004438 LOC100004438
LOC100004573 Dr.117748 100004573 LOC100004573
LOC100004989 Dr.80969 100004989 LOC100004989
LOC100005077 Dr.65913 100005077 LOC100005077
LOC100005148 Dr.75914 100005148 LOC100005148
LOC100005753 Dr.79723 100005753 LOC100005753
LOC100006524 Dr.13947 100006524 LOC100006524
LOC100006949 Dr.113861 100006949 LOC100006949
LOC100007087 Dr.81777 100007087 LOC100007087
LOC100007403 Dr.119610 100007403 LOC100007403
LOC100007489 Dr.118558 100007489 LOC100007489
LOC100007692 Dr.133450 100007692 LOC100007692
LOC100007768 Dr.86350 100007768 LOC100007768
LOC100007780 Dr.3155 100007780 LOC100007780
LOC100008328 Dr.121267 100008328 LOC100008328
LOC100008526 Dr.121323 100008526 LOC100008526
LOC402857 Dr.27086 402857 LOC402857 LOC407694 Dr.77359 407694 LOC407694 LOC553422 Dr.72102 553422 LOC553422 LOC553527 Dr.118110 553527 LOC553527 LOC555409 Dr.76106 555409 LOC555409 LOC556392 Dr.82835 556392 LOC556392 LOC556395 Dr.78388 334287 LOC556395 LOC556467 Dr.77730 556467 LOC556467 LOC556826 Dr.96241 556826 LOC556826 LOC557160 Dr.81603 767707 LOC557160 LOC557301 Dr.86980 557301 LOC557301 LOC557591 Dr.120883 557591 LOC557591 LOC557654 Dr.121062 557654 LOC557654 LOC557752 Dr.100975 557752 LOC557752 LOC558030 Dr.75664 558030 LOC558030 LOC558391 Dr.90300 558391 LOC558391 LOC558498 Dr.74654 558498 LOC558498 LOC558513 Dr.4251 558513 LOC558513 LOC558698 Dr.77128 558698 LOC558698 LOC558933 Dr.81136 558933 LOC558933 LOC558956 Dr.114892 558956 LOC558956 LOC559247 Dr.116367 559247 LOC559247 LOC559420 Dr.84169 559420 LOC559420 LOC559603 Dr.77445 559603 LOC559603 LOC560138 Dr.84738 560138 LOC560138 LOC560193 Dr.119093 560193 LOC560193 LOC560532 Dr.17331 560532 LOC560532 LOC560548 Dr.115738 560548 LOC560548 LOC560828 Dr.118752 560828 LOC560828 LOC561001 Dr.74671 561001 LOC561001 LOC561108 Dr.86831 561108 LOC561108 LOC561659 Dr.82380 561659 LOC561659 LOC561676 Dr.118857 561676 LOC561676 LOC561790 Dr.87994 561790 LOC561790 LOC562071 Dr.82437 562071 LOC562071 LOC562205 Dr.84374 562205 LOC562205 LOC562207 Dr.133880 562207 LOC562207 LOC562246 Dr.117585 562246 LOC562246 LOC562343 Dr.83172 562343 LOC562343 LOC562579 Dr.12491 562579 LOC562579 LOC562744 Dr.120600 562744 LOC562744 LOC563193 Dr.117168 563193 LOC563193 LOC563512 Dr.115387 563512 LOC563512 LOC563546 Dr.82629 563546 LOC563546 LOC563682 Dr.83443 563682 LOC563682 LOC563686 Dr.24876 563686 LOC563686 LOC563864 Dr.81746 563864 LOC563864 LOC563952 Dr.29197 563952 LOC563952 LOC564696 Dr.121542 564696 LOC564696 LOC565603 Dr.119617 565603 LOC565603 LOC565649 Dr.14946 565649 LOC565649 LOC565701 Dr.78739 565701 LOC565701 LOC565777 Dr.86193 798514 LOC565777 LOC565793 Dr.108314 565793 LOC565793 LOC565811 Dr.115851 565811 LOC565811 LOC565937 Dr.85590 565937 LOC565937 LOC566122 Dr.79668 566122 LOC566122 LOC566198 Dr.34220 566198 LOC566198 LOC567217 Dr.113963 567217 LOC567217 LOC567256 Dr.117921 567256 LOC567256 LOC567444 Dr.90054 567444 irak3 LOC567537 Dr.111760 567537 LOC567537 LOC567669 Dr.121333 567669 LOC567669 LOC567953 Dr.39424 567953 LOC567953 LOC568005 Dr.91651 568005 LOC568005 LOC568476 Dr.85087 568476 LOC568476 LOC568537 Dr.78812 568537 LOC568537 LOC568653 Dr.133658 568653 LOC568653 LOC568763 Dr.83001 560020 LOC568763 LOC569164 Dr.82846 569164 LOC569164 LOC569187 Dr.83423 569187 LOC569187 LOC569586 Dr.119007 569586 LOC569586 LOC569609 Dr.115454 569609 LOC569609 LOC569969 Dr.41215 569969 LOC569969 LOC570148 Dr.19520 570148 LOC570148 LOC570757 Dr.121002 570757 LOC570757 LOC570832 Dr.107751 570832 LOC570832 LOC571448 Dr.84556 571448 LOC571448 LOC571608 Dr.75487 571608 LOC571608 LOC571720 Dr.3211 571720 LOC571720 LOC571747 Dr.84005 571747 LOC571747 LOC571991 Dr.77176 571991 LOC571991 LOC572121 Dr.104887 572121 LOC572121 LOC573376 Dr.116704 573376 LOC573376 LOC791474 Dr.6304 791474 LOC791474 LOC791930 Dr.79753 791930 LOC791930 LOC792364 Dr.95191 792364 LOC792364 LOC792428 Dr.118886 792428 LOC792428 LOC792472 Dr.119903 792472 LOC792472 LOC792511 Dr.120411 792511 LOC792511 LOC792525 Dr.139178 792525 LOC792525 LOC792601 Dr.17591 792601 LOC792601 LOC792613 Dr.120624 792613 LOC792613 LOC793171 Dr.97656 793171 LOC793171 LOC793280 Dr.132611 793280 LOC793280 LOC793374 Dr.86757 793374 LOC793374 LOC793872 Dr.78023 793872 LOC793872 LOC794028 Dr.26626 794028 LOC794028 LOC794073 Dr.15198 794073 LOC794073 LOC794313 Dr.86125 794313 LOC794313 LOC794413 Dr.116674 794413 LOC794413 LOC794621 Dr.116461 794621 LOC794621 LOC795305 Dr.116421 795305 LOC795305 LOC795529 Dr.80961 795529 LOC795529 LOC795597 Dr.89872 795597 LOC795597 LOC795785 Dr.113696 795785 LOC795785 LOC796163 Dr.118938 796163 LOC796163 LOC796750 Dr.40212 796750 LOC796750 LOC796842 Dr.120514 796842 LOC796842 LOC796878 Dr.113515 796878 LOC796878 LOC797099 Dr.120111 797099 LOC797099 LOC797263 Dr.115884 797263 LOC797263 LOC797351 Dr.120340 797351 LOC797351 LOC797508 Dr.117285 797508 LOC797508 LOC797787 Dr.104305 797787 LOC797787 LOC797833 Dr.84249 797833 LOC797833 LOC797946 Dr.107953 797946 LOC797946 LOC798073 Dr.120561 798073 LOC798073 LOC798122 Dr.114702 798122 LOC798122 LOC798123 Dr.107566 798123 LOC798123 LOC798492 Dr.84868 798492 LOC798492 LOC798623 Dr.79926 798623 LOC798623 LOC798772 Dr.115286 798772 LOC798772 LOC798868 Dr.67279 798868 LOC798868 LOC798960 Dr.114401 798960 LOC798960 LOC799067 Dr.81695 799067 LOC799067 LOC799214 Dr.118945 799214 LOC799214 LOC799377 Dr.117628 799377 LOC799377 LOC799605 Dr.120565 799605 LOC799605 LOC799689 Dr.86988 799689 LOC799689 LOC799825 Dr.77701 799825 LOC799825 lypla3 Dr.360 335008 lypla3 lyz Dr.83681 246089 lyz mg:db03g07 Dr.76103 326955 mg:db03g07 mmp13 Dr.81475 387293 mmp13 mmp9 Dr.76275 406397 mmp9 mtf1 Dr.118403 195821 mtf1 mtr Dr.75737 378847 mtr myh6 Dr.29034 386711 myh6 myhz2 Dr.132261 246275 myhz2 myod Dr.36017 30513 myod nbl1 Dr.82779 404629 nbl1 ncf1 Dr.2973 378966 ncf1 ndel1b Dr.7294 333957 ndel1b ndrg1l Dr.8090 393665 ndrg1l nfkb2 Dr.117553 415100 nfkb2 nfkbiab Dr.77409 323099 nfkbiab nmi Dr.80228 335331 nmi nppa Dr.72101 321442 nppa npsn Dr.79156 404039 npsn nr0b1 Dr.74816 100008590 nr0b1 Nr0b2 Dr.13394 403010 Nr0b2 nrp1a Dr.133652 353246 nrp1a ntn1b Dr.75773 30192 ntn1b nubp1 Dr.88416 503919 nubp1 nudt1 Dr.76941 406727 nudt1 olig3 Dr.117660 324857 olig3 oprl Dr.121451 402851 oprl or13.1 Dr.75767 58111 or13.1 ormdl1 Dr.27136 368632 ormdl1 pabpc1a Dr.24504 606498 pabpc1a parp3 Dr.78126 335495 parp3 pcca Dr.105309 437019 pcca pcdha Dr.88614 259184 pcdha pdcd7 Dr.82365 445020 pdcd7 pdk2 Dr.9528 393971 pdk2 pdzk1ip1l Dr.41116 368722 pdzk1ip1l pgm3 Dr.37649 474321 pgm3 pi4kII alpha Dr.79494 554275 pi4kII alpha pigc Dr.78451 323994 pigc pim1 Dr.78102 58054 pim1 pknox1.2 Dr.87714 170445 pknox1.2 plagl2 Dr.82515 259255 plagl2 plek Dr.29086 393814 plek plrg1 Dr.79159 406749 plrg1 pls1 Dr.113808 334273 pls1 polb Dr.116029 445402 polb polr1a Dr.101226 327078 polr1a pou1f1 Dr.89712 405777 pou1f1 prkg1 Dr.26605 394005 prkg1 prss35 Dr.118662 431759 prss35 psma6b Dr.82172 83917 psma6b psme1 Dr.81309 30648 psme1 psme2 Dr.76266 30647 psme2 ptger2l Dr.87881 393608 ptger2l ptgs1 Dr.115126 246226 ptgs1 pth1 Dr.86325 405886 pth1 pvalb2 Dr.460 58028 pvalb2 rab11a Dr.80427 492487 rab11a rab32 Dr.119612 378969 rab32 rad17 Dr.31220 436934 rad17 ralgps2 Dr.17213 393446 ralgps2 rbp2b Dr.89689 432384 rbp2b rdh1 Dr.97099 378440 rdh1 rel Dr.86023 415101 rel rgs12 Dr.84135 378970 rgs12 rgs14 Dr.80473 327368 rgs14 rgs4 Dr.75538 321256 rgs4 rhobtb2a Dr.115039 553415 rhobtb2a riok3 Dr.34142 445220 riok3 ripk2 Dr.28180 373874 ripk2 rp2 Dr.80773 406755 rp2 rpl10 Dr.75581 336712 rpl10 rpl24 Dr.1310 192301 rpl24 rpl8 Dr.4091 393686 rpl8 rpsa Dr.75127 394027 rpsa rs1 Dr.133096 445044 rs1 rtn4ip1 Dr.16642 393323 rtn4ip1 rtn4rl2a Dr.91444 403307 rtn4rl2a sb:cb230 Dr.81902 321163 sb:cb230 sb:cb26 Dr.77174 321046 sb:cb26 sb:cb339 Dr.100378 321210 sb:cb339 scamp2 Dr.121550 406687 scamp2 scarf1 Dr.74559 336834 scarf1 sccpdha Dr.77107 436632 sccpdha scn12ab Dr.110026 566868 scn12ab sdf2l1 Dr.51929 445275 sdf2l1 sec13 Dr.5496 406644 sec13 serpinb1l1 Dr.82062 494155 serpinb1l1 si:busm1- si:busm1- Dr.45761 368518 180o5.3 180o5.3 si:busm1- si:busm1- Dr.87489 566732 189a20.4 189a20.4 si:busm1- si:busm1- Dr.81772 368857 241h12.4 241h12.4 si:ch211- si:ch211- Dr.122452 337530 191d7.3 191d7.3 si:ch211- si:ch211- Dr.91260 445293 192k9.1 192k9.1 si:ch211- si:ch211- Dr.42900 557836 198b3.2 198b3.2 si:ch211- si:ch211- Dr.87374 553387 202c21.3 202c21.3 si:ch211- si:ch211- Dr.108675 323050 203h15.3 203h15.3 si:ch211-237l4.2 Dr.48022 561047 si:ch211-237l4.2 si:ch211- si:ch211- Dr.42682 336755 244b2.4 244b2.4 si:ch211- si:ch211- Dr.85745 563420 245h14.1 245h14.1 si:ch211-272f3.3 Dr.76284 336776 si:ch211-272f3.3
si:dkey-114f6.1 Dr.56035 327573 si:dkey-114f6.1
si:dkey-222b8.2 Dr.41221 567959 si:dkey-222b8.2 si:dkey- si:dkey- Dr.36001 322415 236e20.5 236e20.5 si:dkey- si:dkey- Dr.4570 386996 253d23.1 253d23.1 si:dkey-25e12.3 Dr.78146 569300 si:dkey-25e12.3 si:dkey- si:dkey- Dr.74466 557132 264g21.1 264g21.1 si:dkey-266j7.1 Dr.22774 336156 si:dkey-266j7.1 si:dkey-63j1.8 Dr.79402 335416 si:dkey-63j1.8 si:dkey-72l14.4 Dr.7451 562545 si:dkey-72l14.4
si:dkey-91f15.6 Dr.34109 564304 si:dkey-91f15.6 si:dkeyp- si:dkeyp- Dr.25788 368326 110c7.6 110c7.6 si:dkeyp- si:dkeyp- Dr.81070 336053 113f10.1 113f10.1 si:dkeyp-38g8.3 Dr.140675 567017 si:dkeyp-38g8.3
si:dkeyp-59a8.2 Dr.84529 563208 si:dkeyp-59a8.2
si:dkeyp-90a8.2 Dr.77261 562273 si:dkeyp-90a8.2 six7 Dr.75839 30625 six7 slc10a2 Dr.88326 393329 slc10a2 slc16a9a Dr.7340 393382 slc16a9a slc16a9b Dr.140314 445158 slc16a9b slc25a12 Dr.76801 337675 slc25a12 slc25a16 Dr.78884 324578 slc25a16 slc2a12 Dr.28449 393510 slc2a12 slmap Dr.81986 393146 slmap smoc2 Dr.108698 550416 smoc2 snx1 Dr.140305 337386 snx1 socs3 Dr.6431 335409 socs3a sox21b Dr.116538 406246 sox21b spi1 Dr.34508 30117 spi1 spint1l Dr.75391 406426 spint1l stard3nl Dr.75372 436592 stard3nl stat4 Dr.34491 368519 stat4 stat5.1 Dr.133576 369197 stat5.1 stc1 Dr.88421 393511 stc1 stub1 Dr.78513 324243 stub1 stx3a Dr.82925 393515 stx3a tcea2 Dr.85125 393961 tcea2 tceb2 Dr.33340 192341 tceb2 timp2l Dr.102602 406650 timp2l tlr5a Dr.89423 403138 tlr5a tlr5b Dr.89707 751829 tlr5b tmem177 Dr.3515 322274 tmem177 tnfa Dr.89727 405785 tnfa tnfaip8 Dr.105711 393303 tnfaip8 tnfaip8l Dr.88310 393345 tnfaip8l tnfb Dr.94015 554167 tnfb tnfsf10l2 Dr.86839 436866 tnfsf10l2 tnnt1 Dr.13906 353248 tnnt1 tomm22 Dr.117210 321232 tomm22 tomm40l Dr.84273 405895 tomm40l tp73 Dr.24319 368221 tp73 trpv6 Dr.118447 415109 trpv6 twsg1b Dr.83049 259304 twsg1b uba52 Dr.35198 641289 uba52 usp39 Dr.77033 790924 usp39 vezf1 Dr.103946 556915 vezf1 wnt1 Dr.85371 30128 wnt1 wnt16 Dr.87285 404628 wnt16 wu:fa01c11 Dr.75374 334720 wu:fa01c11 wu:fa04g06 Dr.75459 334833 wu:fa04g06 wu:fa04h11 Dr.34097 325495 wu:fa04h11 wu:fa06h01 Dr.13577 334875 wu:fa06h01 wu:fa14a01 Dr.75919 334589 wu:fa14a01 wu:fa91d01 Dr.76189 336652 wu:fa91d01 wu:fa91f10 Dr.76195 336665 wu:fa91f10 wu:fa92h10 Dr.76239 336699 wu:fa92h10 wu:fa92h11 Dr.132222 336700 wu:fa92h11 wu:fa94h07 Dr.23516 336758 wu:fa94h07 wu:fa95e03 Dr.1101 337025 wu:fa95e03 wu:fa97h07 Dr.104634 337111 wu:fa97h07 wu:fa98d10 Dr.27231 337125 wu:fa98d10 wu:fa98e11 Dr.76350 337130 wu:fa98e11 wu:fb08g12 Dr.51536 336378 wu:fb08g12 wu:fb09h07 Dr.23437 336413 wu:fb09h07 wu:fb10a09 Dr.51646 336418 wu:fb10a09 wu:fb11a04 Dr.3436 336451 wu:fb11a04 wu:fb11h05 Dr.76693 336493 wu:fb11h05 wu:fb13g09 Dr.76665 336563 wu:fb13g09 wu:fb14c11 Dr.32415 336586 wu:fb14c11 wu:fb15h11 Dr.5716 336638 wu:fb15h11 wu:fb17f01 Dr.76619 321500 wu:fb17f01 wu:fb18b12 Dr.23649 321526 wu:fb18b12 wu:fb19b08 Dr.24364 321557 wu:fb19b08 wu:fb25h12 Dr.76766 321668 wu:fb25h12 wu:fb26f10 Dr.76802 321684 wu:fb26f10 wu:fb37a10 Dr.11310 321850 wu:fb37a10 wu:fb48a08 Dr.77186 322050 wu:fb48a08 wu:fb49h10 Dr.23738 322096 wu:fb49h10 wu:fb54d07 Dr.33295 322245 wu:fb54d07 wu:fb57b02 Dr.4216 322299 wu:fb57b02 wu:fb57f08 Dr.23725 322318 wu:fb57f08 wu:fb58f04 Dr.132301 322344 wu:fb58f04 wu:fb60c02 Dr.77169 322409 wu:fb60c02 wu:fb61e06 Dr.77125 322446 wu:fb61e06 wu:fb63d05 Dr.132313 322510 wu:fb63d05 wu:fb64e03 Dr.76413 322540 wu:fb64e03 wu:fb66c11 Dr.105221 322582 wu:fb66c11 wu:fb67h05 Dr.77299 322620 wu:fb67h05 wu:fb72c11 Dr.129593 322739 wu:fb72c11 wu:fb72c11 Dr.75160 322739 wu:fb72c11 wu:fb74g08 Dr.105194 322844 wu:fb74g08 wu:fb76g02 Dr.77277 322911 wu:fb76g02 wu:fb79e06 Dr.39734 323032 wu:fb79e06 wu:fb80f02 Dr.77380 323066 wu:fb80f02 wu:fb81c07 Dr.75682 323088 wu:fb81c07 wu:fb82f09 Dr.77559 323130 wu:fb82f09 wu:fb92f04 Dr.21193 323215 wu:fb92f04 wu:fb94e12 Dr.21224 323301 wu:fb94e12 wu:fb98c10 Dr.77747 323431 wu:fb98c10 wu:fb99e06 Dr.77781 323481 wu:fb99e06 wu:fc01f10 Dr.135376 323526 wu:fc01f10 wu:fc04b03 Dr.78003 323592 wu:fc04b03 wu:fc06e12 Dr.27420 323668 wu:fc06e12 wu:fc07b07 Dr.77935 323690 wu:fc07b07 wu:fc07b09 Dr.104714 323691 wu:fc07b09 wu:fc09e12 Dr.51867 323770 wu:fc09e12 wu:fc14a04 Dr.22881 323913 wu:fc14a04 wu:fc14h11 Dr.75449 323945 wu:fc14h11 wu:fc15f06 Dr.78434 474325 wu:fc15f06 wu:fc15g08 Dr.77881 323970 wu:fc15g08 wu:fc20g06 Dr.2805 324163 wu:fc20g06 wu:fc22a11 Dr.78496 324223 wu:fc22a11 wu:fc23d01 Dr.22938 793794 wu:fc23d01 wu:fc23f06 Dr.15418 324283 wu:fc23f06 wu:fc27b12 Dr.35817 324380 wu:fc27b12 wu:fc27f12 Dr.121895 324399 wu:fc27f12 wu:fc29c12 Dr.78749 324446 wu:fc29c12 wu:fc32b08 Dr.21617 324544 wu:fc32b08 wu:fc32g03 Dr.78845 324557 wu:fc32g03 wu:fc35a10 Dr.5234 324618 wu:fc35a10 wu:fc37g06 Dr.21483 324668 wu:fc37g06 wu:fc38b05 Dr.78588 324684 wu:fc38b05 wu:fc44e02 Dr.79112 324828 wu:fc44e02 wu:fc46a02 Dr.79391 324870 wu:fc46a02 wu:fc51b07 Dr.78979 325002 wu:fc51b07 wu:fc51f03 Dr.78985 325018 wu:fc51f03 wu:fc54b08 Dr.79013 325063 wu:fc54b08 wu:fc54g06 Dr.78101 325086 wu:fc54g06 wu:fc55a06 Dr.3915 325091 wu:fc55a06 wu:fc55g06 Dr.79035 325115 wu:fc55g06 wu:fc59c03 Dr.8738 325201 wu:fc59c03 wu:fc70h07 Dr.76504 619262 wu:fc70h07 wu:fc76c11 Dr.27582 325434 wu:fc76c11 wu:fc79b02 Dr.3325 325456 wu:fc79b02 wu:fc83a09 Dr.79472 325480 wu:fc83a09 wu:fc83f05 Dr.79478 325498 wu:fc83f05 wu:fc84c07 Dr.108582 325519 wu:fc84c07 wu:fc89a04 Dr.79591 325575 wu:fc89a04 wu:fc93b03 Dr.15376 402912 wu:fc93b03 wu:fd02c11 Dr.79060 325683 wu:fd02c11 wu:fd10a10 Dr.4005 325758 wu:fd10a10 wu:fd11d10 Dr.79713 325782 wu:fd11d10 wu:fd36h06 Dr.79872 325877 wu:fd36h06 wu:fd42f04 Dr.106615 325883 wu:fd42f04 wu:fd58b05 Dr.94688 100007552 wu:fd58b05 wu:fd59c01 Dr.52856 735312 wu:fd59c01 wu:fe01a07 Dr.80626 326635 wu:fe01a07 wu:fe05b03 Dr.80638 326679 wu:fe05b03 wu:fe11g10 Dr.79993 777631 wu:fe11g10 wu:fe11h11 Dr.74223 556186 wu:fe11h11 wu:fe16c03 Dr.106191 326770 wu:fe16c03 wu:fe16c11 Dr.122189 326772 wu:fe16c11 wu:fe24a06 Dr.132679 326807 wu:fe24a06 wu:fe24e09 Dr.106515 795458 wu:fe24e09 wu:fe47a12 Dr.76804 326892 wu:fe47a12 wu:fi11e03 Dr.17505 327443 wu:fi11e03 wu:fi12h09 Dr.122177 327466 wu:fi12h09 wu:fi15d04 Dr.79942 327519 wu:fi15d04 wu:fi32b04 Dr.132168 494042 wu:fi32b04 wu:fi37b05 Dr.7324 334231 wu:fi37b05 wu:fi40d02 Dr.140094 334318 wu:fi40d02 wu:fj01a12 Dr.80190 554089 wu:fj01a12 wu:fj04f08 Dr.80233 335346 wu:fj04f08 wu:fj05c06 Dr.80727 335354 wu:fj05c06 wu:fj05f05 Dr.80731 335362 wu:fj05f05 wu:fj19a05 Dr.22588 335520 wu:fj19a05 wu:fj20h08 Dr.122319 335545 wu:fj20h08 wu:fj22b05 Dr.80845 335563 wu:fj22b05 wu:fj29h10 Dr.79667 335617 wu:fj29h10 wu:fj38c09 Dr.81028 335932 wu:fj38c09 wu:fj48a06 Dr.76584 336088 wu:fj48a06 wu:fj49c01 Dr.76105 336116 wu:fj49c01 wu:fj53a05 Dr.81170 336163 wu:fj53a05 wu:fj53e10 Dr.80301 336172 wu:fj53e10 wu:fj59a01 Dr.81226 336240 wu:fj59a01 wu:fj62g02 Dr.81251 336305 wu:fj62g02 wu:fj67d03 Dr.132704 337431 wu:fj67d03 wu:fj84f01 Dr.81535 337578 wu:fj84f01 wu:fj85b02 Dr.81541 337585 wu:fj85b02 wu:fj85h12 Dr.81581 337599 wu:fj85h12 wu:fj86g03 Dr.132921 337607 wu:fj86g03 wu:fj87c06 Dr.9554 337619 wu:fj87c06 wu:fk14g08 Dr.81512 337300 wu:fk14g08 wu:fk31a07 Dr.23104 336938 wu:fk31a07 wu:fk34f03 Dr.104587 336960 wu:fk34f03 wu:fk35f04 Dr.76616 386925 wu:fk35f04 wu:fk36h04 Dr.23134 336972 wu:fk36h04 wu:fk54a10 Dr.81960 335663 wu:fk54a10 wu:fk81c02 Dr.82060 335157 wu:fk81c02 wu:fl02d04 Dr.122566 335264 wu:fl02d04 wu:fl03b09 Dr.10410 337704 wu:fl03b09 wu:fm82b06 Dr.122949 337686 wu:fm82b06 wu:fp52e02 Dr.85903 386835 wu:fp52e02 wu:fp56f09 Dr.122259 337698 wu:fp56f09 wu:fq77h11 Dr.108155 503777 wu:fq77h11 ythdf1 Dr.3039 327606 ythdf1 zbtb48 Dr.72135 325725 zbtb48 zcchc10 Dr.80591 334240 zcchc10 zdhhc23 Dr.83252 445301 zdhhc23 zfp36l1 Dr.105582 554684 zfp36l1 zgc:100846 Dr.82328 402895 zgc:100846 zgc:100849 Dr.77914 445144 zgc:100849 zgc:100897 Dr.23554 445297 zgc:100897 zgc:101066 Dr.88663 445178 zgc:101066 zgc:101100 Dr.90945 445169 zgc:101100 zgc:101659 Dr.37198 492798 zgc:101659 zgc:101739 Dr.80825 447890 zgc:101739 zgc:101741 Dr.84246 492766 zgc:101741 zgc:101811 Dr.77501 450028 zgc:101811 zgc:101818 Dr.117252 494076 zgc:101818 zgc:103433 Dr.91379 450017 zgc:103433 zgc:103438 Dr.86834 450015 zgc:103438 zgc:103473 Dr.84834 492477 zgc:103473 zgc:103566 Dr.119956 403071 zgc:103566 zgc:103575 Dr.85993 449806 zgc:103575 zgc:103594 Dr.76097 447942 zgc:103594 zgc:103755 Dr.12697 449988 zgc:103755 zgc:109896 Dr.26640 553543 zgc:109896 zgc:109969 Dr.78796 553560 zgc:109969 zgc:110025 Dr.135075 553578 zgc:110025 zgc:110152 Dr.27897 550551 zgc:110152 zgc:110354 Dr.88891 553612 zgc:110354 zgc:110361 Dr.40351 550478 zgc:110361 zgc:110617 Dr.45532 553639 zgc:110617 zgc:110848 Dr.118397 503751 zgc:110848 zgc:111976 Dr.85177 553663 zgc:111976 zgc:112118 Dr.87575 550435 zgc:112118 zgc:112143 Dr.76505 550429 zgc:112143 zgc:112148 Dr.82236 550424 zgc:112148 zgc:112172 Dr.90055 550415 zgc:112172 zgc:112208 Dr.82025 550398 zgc:112208 zgc:112232 Dr.90608 565258 zgc:112232 zgc:112236 Dr.132927 553693 zgc:112236 zgc:112304 Dr.41753 554050 zgc:112304 zgc:113102 Dr.134817 503754 zgc:113102 zgc:113232 Dr.43135 541546 zgc:113232 zgc:113277 Dr.87180 553814 zgc:113277 zgc:113516 Dr.79930 541449 zgc:113516 zgc:113527 Dr.88899 613245 zgc:113527 zgc:113947 Dr.140628 403081 zgc:113947 zgc:114066 Dr.84802 566506 zgc:114066 zgc:123046 Dr.114190 568429 zgc:123046 zgc:123047 Dr.20771 553283 zgc:123047 zgc:123218 Dr.86778 641321 zgc:123218 zgc:123236 Dr.110015 557480 zgc:123236 zgc:123291 Dr.39466 555725 zgc:123291 zgc:123339 Dr.15815 567972 zgc:123339 zgc:136228 Dr.76679 570276 zgc:136228 zgc:136569 Dr.85861 692318 zgc:136569 zgc:136632 Dr.80625 326634 zgc:136632 zgc:136816 Dr.825 723996 zgc:136816 zgc:136971 Dr.78531 678599 zgc:136971 zgc:152901 Dr.79170 566352 zgc:152901 zgc:152945 Dr.77704 767787 zgc:152945 zgc:152979 Dr.133940 767671 zgc:152979 zgc:153020 Dr.134726 560761 zgc:153020 zgc:153267 Dr.89419 767684 zgc:153267 zgc:153723 Dr.88985 767718 zgc:153723 zgc:153888 Dr.83167 768164 zgc:153888 zgc:158367 Dr.116845 571403 zgc:158367 zgc:158387 Dr.75902 567275 zgc:158387 zgc:158404 Dr.89148 557029 zgc:158404 zgc:158455 Dr.78061 790928 zgc:158455 zgc:158607 Dr.79190 569294 zgc:158607 zgc:158695 Dr.40378 791134 zgc:158695 zgc:158780 Dr.38076 503773 zgc:158780 zgc:158861 Dr.120725 100005434 zgc:158861 zgc:162162 Dr.84274 568747 zgc:162162 zgc:162198 Dr.66850 325787 zgc:162198 zgc:162235 Dr.86308 563648 zgc:162235 zgc:162280 Dr.92706 799608 zgc:162280 zgc:162290 Dr.16985 100007897 zgc:162290 zgc:162316 Dr.92977 100037372 zgc:162316 zgc:162651 Dr.115655 323364 zgc:162651 zgc:163057 Dr.87319 563335 zgc:163057 zgc:165461 Dr.108135 497419 zgc:165461 zgc:55292 Dr.1786 321491 zgc:55292 zgc:55396 Dr.115188 406835 zgc:55396 zgc:55398 Dr.80443 394023 zgc:55398 zgc:55764 Dr.116955 324211 zgc:55764 zgc:55794 Dr.80343 327593 zgc:55794 zgc:55863 Dr.82569 393937 zgc:55863 zgc:56085 Dr.11252 327506 zgc:56085 zgc:56141 Dr.42026 406277 zgc:56141 zgc:56417 Dr.79371 393258 zgc:56417 zgc:56567 Dr.117075 406725 zgc:56567 zgc:63792 Dr.75976 337333 zgc:63792 zgc:63934 Dr.26462 393316 zgc:63934 zgc:64013 Dr.119341 393333 zgc:64013 zgc:64031 Dr.82104 393338 zgc:64031 zgc:64042 Dr.84488 393609 zgc:64042 zgc:64085 Dr.12508 393380 zgc:64085 zgc:64106 Dr.78121 393348 zgc:64106 zgc:64114 Dr.82488 378866 zgc:64114 zgc:64141 Dr.78662 393353 zgc:64141 zgc:65788 Dr.77223 322420 zgc:65788 zgc:65909 Dr.75861 393504 zgc:65909 zgc:65996 Dr.18197 336641 zgc:65996 zgc:66026 Dr.18349 393549 zgc:66026 zgc:66125 Dr.96456 393796 zgc:66125 zgc:66168 Dr.75903 337810 zgc:66168 zgc:66326 Dr.76836 321842 zgc:66326 zgc:66350 Dr.29708 393493 zgc:66350 zgc:66353 Dr.4114 321378 zgc:66353 zgc:66409 Dr.23608 335407 zgc:66409 zgc:66443 Dr.114215 406856 zgc:66443 zgc:66449 Dr.13689 327407 zgc:66449 zgc:76875 Dr.82970 405849 zgc:76875 zgc:76951 Dr.79424 325410 zgc:76951 zgc:77002 Dr.83170 405846 zgc:77002 zgc:77033 Dr.23613 406598 zgc:77033 zgc:77038 Dr.81607 406596 socs3b zgc:77041 Dr.16044 404632 zgc:77041 zgc:77068 Dr.113519 405824 zgc:77068 zgc:77182 Dr.88453 402953 zgc:77182 zgc:77242 Dr.89035 402969 zgc:77242 zgc:77287 Dr.84139 404617 zgc:77287 zgc:77358 Dr.82216 402928 zgc:77358 zgc:77387 Dr.6336 324010 zgc:77387 zgc:77424 Dr.88467 404622 zgc:77424 zgc:77486 Dr.85913 405808 zgc:77486 zgc:77517 Dr.76027 393540 zgc:77517 zgc:77727 Dr.89530 393830 zgc:77727 zgc:77855 Dr.88688 393836 zgc:77855 zgc:77861 Dr.77739 393823 zgc:77861 zgc:77862 Dr.132662 406474 zgc:77862 zgc:77905 Dr.81416 393867 zgc:77905 zgc:77906 Dr.134550 402945 zgc:77906 zgc:85611 Dr.85105 406368 zgc:85611 zgc:85616 Dr.113645 406356 zgc:85616 zgc:85942 Dr.140429 405866 zgc:85942 zgc:85944 Dr.84638 571696 zgc:85944 zgc:85965 Dr.81190 405857 zgc:85965 zgc:86754 Dr.80284 415225 zgc:86754 zgc:86870 Dr.84307 436953 zgc:86870 zgc:86889 Dr.133321 415192 zgc:86889 zgc:86905 Dr.31087 415185 zgc:86905 zgc:86926 Dr.69080 415179 zgc:86926 zgc:91890 Dr.83427 431729 zgc:91890 zgc:91915 Dr.84836 436595 zgc:91915 zgc:91940 Dr.81687 436942 zgc:91940 zgc:91959 Dr.32109 436939 zgc:91959 zgc:91963 Dr.85722 445108 zgc:91963 zgc:91978 Dr.106802 436927 zgc:91978 zgc:92083 Dr.117302 447860 zgc:92083 zgc:92137 Dr.33934 445049 zgc:92137 zgc:92167 Dr.111731 436621 zgc:92167 zgc:92225 Dr.132558 436906 zgc:92225 zgc:92239 Dr.120620 494036 zgc:92239 zgc:92250 Dr.81554 447821 zgc:92250 zgc:92252 Dr.81006 436895 zgc:92252 zgc:92267 Dr.102467 494035 zgc:92267 zgc:92276 Dr.83119 445024 zgc:92276 zgc:92367 Dr.81587 445119 traf3 zgc:92420 Dr.28514 445069 zgc:92420 zgc:92446 Dr.115939 445112 zgc:92446 zgc:92456 Dr.86760 445287 zgc:92456 zgc:92591 Dr.18405 436997 zgc:92591 zgc:92608 Dr.134016 436979 zgc:92608 zgc:92647 Dr.29795 436707 zgc:92647 zgc:92754 Dr.32124 436840 zgc:92754 zgc:92762 Dr.84618 436834 zgc:92762 zgc:92833 Dr.109068 436776 zgc:92833 zgc:92849 Dr.86222 436767 zgc:92849 zgc:92866 Dr.121908 436755 zgc:92866 zgc:92866 Dr.76532 436755 zgc:92866 zgc:92890 Dr.88790 436742 zgc:92890 zgc:92913 Dr.115549 436804 zgc:92913 zgc:92926 Dr.80970 436797 zgc:92926 zp2l1 Dr.75593 555180 zp2l1
UniGene clusters differentially regulated upon S. typhimurium wt infection were grouped into four categories. Category 1: immune specific by means of GO-annotation and overlap with the common host response gene set (Supplementary Table III); Category 2: described immune function but missed out on category 1; Category 3: functionally annotated but no association to an immune function was revealed by PubMed search using inflammation and immunity as key words; Category 4: no functional annotation