DOCSLIB.ORG

Supplementary Table I. Morpholino Oligonucleotides and Primer Sequences Used in This Study

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Table I. Morpholino Oligonucleotides and Primer Sequences Used in This Study Supplementary Table I. Morpholino oligonucleotides and primer sequences used in this study Oligonucleotide Name Accession Sequence Morpholinos tlr5a AY389449 5'-AAAGTGTATGTAGCTGCCATTCTGG tlr5b AY389450 5'-TGAATGTATATCCCATTCTGTGAGC myd88 AY388401 5'-TAGCAAAACCTCTGTTATCCAGCGA myd88 5bp mismatch AY388401 5'-TAcCAtAACCTgTGTTATCgAGgGA standard control morpholino 5'-CCTCTTACCTCAGTTACAATTTATA qRT-PCR ppial-qP1-Fw AY391451 5’- ACACTGAAACACGGAGGCAAAG ppial-qP2-Rev 5’- CATCCACAACCTTCCCGAACAC irak3-qP1-Fw CK026195 5’- TGAGGTCTACTGTGGACGATGG irak3-qP2-Rev 5’- ATGTTAGGATGCTGGTTGAGTTGG tlr5a-qP1-Fw AY389449 5’-ATTCTGGTGGTGCTTGTTGTAG tlr5a-qP2-Rev 5’-ACGAGGTAACTTCTGTTCTCAATG tlr5b-qP3-Fw AY389450 5’-GCGTTGTTGAAGAGGCTGGAC tlr5b-qP4-Rev 5’-TTCTGGATGGCCACTTCTCATATTGG mmp9-qP3-Fw NM_213123 5’-CATTAAAGATGCCCTGATGTATCCC mmp9-qP4-Rev 5’-AGTGGTGGTCCGTGGTTGAG il1b-qP1-Fw NM_212844 5’-GAACAGAATGAAGCACATCAAACC il1b-qP2-Rev 5’-ACGGCACTGAATCCACCAC il8-qP1-Fw XM_001342570 5’-TGTGTTATTGTTTTCCTGGCATTTC il8-qP2-Rev 5’-GCGACAGCGTGGATCTACAG ifn1-qP3-Fw NM_207640 5’- TTAATACACGCAAAGATGAGAACTC ifn1-qP4-Rev 5’- GCCAAGCCATTCGCAAGTAG tnfa-qP5-Fw NM_212829 5’- AGACCTTAGACTGGAGAGATGAC tnfa-qP6-Rev 5’- CAAAGACACCTGGCTGTAGAC cxcl-C1c-qP1-Fw NM_001115060 5’- GGCATTCACACCCAAAGCG cxcl-C1c-qP2_Rev 5’- GCGAGCACGATTCACGAGAG * In situ ccl-C5a-Fw NM_001082906 5’- CATCACTAGGAAAGGATTGAAC ccl-C5a-Rev-T7 5’- TAATACGACTCACTATAGGGGATGTCAAAGACTTTATTCAC cxcl-C1c-Fw NM_001115060 5’- GTTAAACATAAATAACACCGACTC cxcl-C1c-Rev-T7 5’- TAATACGACTCACTATAGGGACACCCTATAAAACTGAGTA irak3-Fw CK026195 5’- CAGTGAGAGAGGCATGAAACATC irak3-Rev-T7 5’- TAATACGACTCACTATAGGGGCAGCTTTGGTCACCAGAGTG socs3-Fw NM_199950 5’- CACTGTTTCTCCATCATCATCAG socs3-Rev-T7 5’- TAATACGACTCACTATAGGGGTCTACGAGTTGTTTCTCAACAG * The T7 promoter sequence was placed at the 5’ end of the in situ reverse primer and is indicated in italics. Supplementary Table II. UniGene clusters up-regulated upon S. typhimurium wt and/or S. typhimurium Ra infection* Gene Description UniGene Code Entrez GeneID Ra 2h Ra 2h Ra 5h Ra 5h Ra 8h Ra 8h Ra 24h Ra 24h wt 2h wt 2h wt 5h wt 5h wt 8h wt 8h wt 24h wt 24h Symbol (build # 105) Fold Change P-value Fold Change P-value Fold Change P-value Fold Change P-value Fold Change P-value Fold Change P-value Fold Change P-value Fold Change P-value 9-Sep Septin 9 Dr.121586 337243 2.156 1.25E-16 aanat2 Arylalkylamine N-acetyltransferase Dr.81299 30685 1.728 5.27E-17 aars Alanyl-tRNA synthetase Dr.75848 324940 4.080 0.00E+00 abat 4-aminobutyrate aminotransferase Dr.76989 378968 2.192 0.00E+00 ATP-binding cassette, sub-family A abca12 Dr.75341 321215 1.852 7.80E-16 (ABC1), member 12 ATP-binding cassette, sub-family B abcb3 Dr.88570 30695 4.488 3.45E-09 7.622 2.45E-39 6.005 1.93E-11 4.110 1.49E-25 12.152 2.80E-45 33.977 0.00E+00 (MDR/TAP), member 3 ATP-binding cassette, sub-family C abcc2 Dr.24063 393561 2.265 3.38E-24 (CFTR/MRP), member 2 ATP-binding cassette, sub-family D abcd1 Dr.103366 566367 2.211 7.36E-11 (ALD), member 1 ATP-binding cassette, sub-family F abcf1 Dr.32961 406467 3.295 0.00E+00 (GCN20), member 1 abhd4 Abhydrolase domain containing 4 Dr.81194 550276 4.515 0.00E+00 abi1 Abl-interactor 1 Dr.107659 393711 1.938 2.93E-07 Amiloride-sensitive cation channel accn2b Dr.98481 407671 2.813 6.56E-07 2 b Angiotensin I converting enzyme ace2 Dr.76987 492331 3.944 7.52E-06 (peptidyl-dipeptidase A) 2 aco1 Aconitase 1, soluble Dr.40063 568448 1.962 7.24E-09 2.826 4.76E-08 1.902 2.03E-07 3.323 1.42E-24 Acyl-CoA synthetase long-chain acsl4 Dr.78711 393622 1.655 1.84E-16 family member 4 ada Adenosine deaminase Dr.120392 436919 3.743 2.49E-12 3.864 6.58E-13 A disintegrin and metalloproteinase adam8 Dr.86401 368917 1.965 0.00E+00 1.589 9.68E-23 1.606 0.00E+00 2.643 0.00E+00 6.805 0.00E+00 domain 8 adcy6 Adenylate cyclase 6 Dr.42208 570652 1.545 4.64E-07 add3 Adducin 3 (gamma) Dr.10904 556762 1.561 0.00E+00 adipor2 Adiponectin receptor 2 Dr.114625 560140 1.768 6.79E-20 adora2b Adenosine A2b receptor Dr.141253 560100 4.104 1.82E-11 agk Acylglycerol kinase Dr.80681 334270 1.557 5.00E-05 1-acylglycerol-3-phosphate O- agpat3 Dr.75961 406734 1.615 4.00E-05 1.508 6.67E-07 acyltransferase 3 1-acylglycerol-3-phosphate O- agpat4 acyltransferase 4 (lysophosphatidic Dr.78538 406265 1.668 3.10E-16 acid acyltransferase, delta) agt Angiotensinogen Dr.3585 322485 5.100 0.00E+00 Aminolevulinate, delta-, synthetase alas1 Dr.4829 64608 2.562 0.00E+00 1 Aldehyde dehydrogenase 2 family aldh2 Dr.28434 393462 3.575 3.69E-24 2.359 1.82E-08 (mitochondrial) Aldehyde dehydrogenase 3 family, aldh3d1 Dr.76675 282559 2.067 5.62E-07 member D1 aldoc Aldolase c, fructose-bisphosphate Dr.19223 369193 2.694 3.58E-16 Asparagine-linked glycosylation 2 alg2 homolog (S. cerevisiae, alpha-1,3- Dr.83082 403068 2.826 1.12E-15 mannosyltransferase) Asparagine-linked glycosylation 5 alg5 homolog (yeast, dolichyl-phosphate Dr.75542 334646 1.611 9.74E-27 beta-glucosyltransferase) alox12 Arachidonate 12-lipoxygenase Dr.132326 322732 1.702 1.46E-14 Adenosine monophosphate ampd3 Dr.11670 333997 1.839 1.32E-12 deaminase 3 amt Aminomethyltransferase Dr.121883 450000 1.854 2.75E-10 ankh Ankylosis, progressive homolog Dr.4277 323738 1.540 1.60E-21 anxa13 Annexin A13 Dr.11764 81880 3.661 0.00E+00 anxa2a Annexin A2a Dr.75997 325557 4.645 2.16E-43 anxa4 Annexin A4 Dr.91161 353362 3.382 1.59E-17 anxa5 Annexin A5 Dr.75805 337132 1.892 5.49E-09 apaf1 Apoptotic protease activating factor Dr.78833 58131 2.157 0.00E+00 Amyloid beta (A4) precursor protein- apbb1ip binding, family B, member 1 Dr.88358 393607 1.995 1.56E-17 2.764 1.61E-13 interacting protein apoa1 Apolipoprotein A-I Dr.75775 30355 1.633 6.70E-09 arg2 Arginase, type II Dr.77297 322614 1.635 1.03E-18 16.086 0.00E+00 Rho guanine nucleotide exchange arhgef1 Dr.133654 368266 1.591 3.00E-05 3.261 1.52E-34 factor (GEF) 1 Rho/rac guanine nucleotide arhgef18 Dr.32570 407987 1.694 1.02E-10 exchange factor (GEF) 18 ADP-ribosylation factor-like 2 arl2bp Dr.110760 393976 1.696 9.50E-07 1.522 5.00E-05 binding protein arl8b ADP-ribosylation factor-like 8B Dr.78116 337424 2.045 6.97E-26 arrdc1 Arrestin domain containing 1 Dr.114902 378740 1.603 4.49E-10 arrdc2 Arrestin domain containing 2 Dr.26118 335206 4.595 1.33E-08 arrdc3 Arrestin domain containing 3 Dr.103751 324193 3.986 0.00E+00 asns Asparagine synthetase Dr.25168 394138 1.687 1.03E-10 4.061 2.97E-36 aspn Asporin (LRR class 1) Dr.81771 65228 1.506 4.33E-09 1.595 7.15E-08 1.774 3.42E-13 2.227 1.65E-11 atf3 Activating transcription factor 3 Dr.77523 393939 2.134 4.46E-20 2.501 2.00E-05 2.720 4.97E-21 2.721 0.00E+00 7.882 5.23E-20 33.665 0.00E+00 atg4c Autophagy-related 4C (yeast) Dr.121931 415193 1.803 2.00E-05 2.261 4.92E-10 atoh1a Atonal homolog 1a Dr.566 30303 1.718 1.82E-12 ATPase, Na+/K+ transporting, atp1a1 Dr.75307 64612 1.512 3.00E-05 alpha 1 polypeptide ATPase, Ca++ transporting, atp2a2a Dr.16838 393940 1.868 1.50E-15 cardiac muscle, slow twitch 2a ATPase, H+ transporting, atp6ap1 Dr.76858 195824 1.930 4.09E-40 lysosomal accessory protein 1 ATPase, H+ transporting, atp6ap2 Dr.120094 406296 1.527 1.78E-07 lysosomal accessory protein 2 ATPase, H+ transporting, atp6v0a1 Dr.114200 324307 2.315 1.80E-09 lysosomal V0 subunit a isoform 1 ATPase, H+ transporting, V0 atp6v0d1 Dr.77332 322811 1.755 4.84E-33 subunit D isoform 1 ATPase, H+ transporting, atp6v1a Dr.9240 337583 1.719 4.55E-14 lysosomal 70kDa, V1 subunit A ATPase, H+ transporting, atp6v1b2 Dr.132618 359840 1.604 2.00E-05 2.359 3.16E-10 1.597 2.29E-06 2.432 3.25E-11 lysosomal 56/58kDa, V1 subunit B2 ATPase, H+ transporting, atp6v1c1 Dr.106389 368907 1.594 1.05E-06 lysosomal, V1 subunit C, isoform 1 ATPase, H+ transporting, atp6v1c1l lysosomal, V1 subunit C, isoform 1, Dr.14847 449655 1.530 1.39E-23 like ATPase, Cu++ transporting, alpha atp7a Dr.21520 564924 2.114 6.27E-10 polypeptide (Menkes syndrome) AU RNA binding protein/enoyl- auh Dr.2043 445182 1.862 5.00E-05 Coenzyme A hydratase Apoptosis, caspase activation aven Dr.21346 561418 1.521 3.80E-09 inhibitor UDP-GlcNAc:betaGal beta-1,3-N- b3gnt5 Dr.76667 336526 1.561 3.00E-05 acetylglucosaminyltransferase 5 UDP-GlcNAc:betaGal beta-1,3-N- b3gnt7 Dr.14659 286748 3.791 1.48E-06 acetylglucosaminyltransferase 7 bag3 BCL2-associated athanogene 3 Dr.79182 445139 2.514 6.62E-24 baiap2l1a BAI1-associated protein 2-like 1a Dr.81674 387261 2.074 1.11E-39 baiap2l1b BAI1-associated protein 2-like 1b Dr.108513 550528 4.861 4.25E-12 bax Bcl2-associated X protein Dr.78968 58081 2.158 0.00E+00 Bromodomain adjacent to zinc baz1a Dr.36447 334173 1.604 1.55E-13 finger domain, 1A bbc3 BCL2 binding component 3 Dr.26003 751763 5.717 8.14E-10 Putative breast adenocarcinoma bc2 Dr.117290 406838 2.185 1.16E-36 marker bcan Brevican Dr.80617 334113 6.339 4.02E-07 B-cell receptor-associated protein bcap31 Dr.78455 368488 1.711 2.90E-36 31 Breast carcinoma amplified bcas3 Dr.27111 393594 2.181 2.60E-27 sequence 3 Branched chain aminotransferase bcat1 Dr.80309 337412 1.858 3.33E-07 5.481 0.00E+00 1, cytosolic Beta-carotene 15, 15-dioxygenase bcdo2 Dr.82050 678554 2.858 1.40E-20 2 B-cell CLL/lymphoma 6 (zinc finger bcl6 Dr.115290 393707 1.735 5.01E-09 protein 51) bdnf Brain-derived neurotrophic factor Dr.132862 58118 2.825 3.41E-16 Basic helix-loop-helix domain bhlhb2 Dr.78721 324413 2.893 4.73E-42 containing, class B, 2 Basic helix-loop-helix domain bhlhb3l Dr.85246 563771 4.433 1.31E-12 containing, class B, 3 like BH3 interacting domain death bida Dr.84878 559425 1.569 1.79E-09 3.239 5.47E-10 agonist BCL2-interacting killer (apoptosis- bik Dr.82304 564030 2.726 5.00E-05 inducing) bin1 Bridging
Load more

Recommended publications
  • Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis.
    [Show full text]
  • Polyphosphate-Dependent Synthesis of ATP and ADP by the Family-2 Polyphosphate Kinases in Bacteria
    Polyphosphate-dependent synthesis of ATP and ADP by the family-2 polyphosphate kinases in bacteria Boguslaw Noceka, Samvel Kochinyanb, Michael Proudfootb, Greg Brownb, Elena Evdokimovaa,b, Jerzy Osipiuka, Aled M. Edwardsa,b, Alexei Savchenkoa,b, Andrzej Joachimiaka,c,1, and Alexander F. Yakuninb,1 aMidwest Center for Structural Genomics and Structural Biology Center, Department of Biosciences, Argonne National Laboratory, 9700 South Cass Avenue, Building 202, Argonne, IL 60439; bBanting and Best Department of Medical Research, University of Toronto, Toronto, ON, Canada M5G 1L6; and cDepartment of Biochemistry and Molecular Biology, University of Chicago, 920 East 58th Street, Chicago, IL 60637 Edited by Robert Haselkorn, University of Chicago, Chicago, IL, and approved September 30, 2008 (received for review August 1, 2008) Inorganic polyphosphate (polyP) is a linear polymer of tens or hun- exopolysaccharide essential for the virulence of P. aeruginosa (12). dreds of phosphate residues linked by high-energy bonds. It is found In the social slime mold Dictyostelium discoideum, a different PPK in all organisms and has been proposed to serve as an energy source was found (DdPPK2) with sequence and properties similar to that in a pre-ATP world. This ubiquitous and abundant biopolymer plays of actin-related proteins (Arps) (14). DdPPK2 is a complex of 3 numerous and vital roles in metabolism and regulation in prokaryotes Arps (Arp1, Arp2, and Arpx) and resembles the actin family in and eukaryotes, but the underlying molecular mechanisms for most molecular weight, sequence, and filamentous structure. Remark- activities of polyP remain unknown. In prokaryotes, the synthesis and ably, DdPPK2 can polymerize into an actin-like filament concurrent utilization of polyP are catalyzed by 2 families of polyP kinases, PPK1 with the synthesis of polyP (14).
    [Show full text]
  • The Cross-Talk Between Methylation and Phosphorylation in Lymphoid-Specific Helicase Drives Cancer Stem-Like Properties
    Signal Transduction and Targeted Therapy www.nature.com/sigtrans ARTICLE OPEN The cross-talk between methylation and phosphorylation in lymphoid-specific helicase drives cancer stem-like properties Na Liu1,2,3, Rui Yang1,2, Ying Shi1,2, Ling Chen1,2, Yating Liu1,2, Zuli Wang1,2, Shouping Liu1,2, Lianlian Ouyang4, Haiyan Wang1,2, Weiwei Lai1,2, Chao Mao1,2, Min Wang1,2, Yan Cheng5, Shuang Liu4, Xiang Wang6, Hu Zhou7, Ya Cao1,2, Desheng Xiao1 and Yongguang Tao1,2,6 Posttranslational modifications (PTMs) of proteins, including chromatin modifiers, play crucial roles in the dynamic alteration of various protein properties and functions including stem-cell properties. However, the roles of Lymphoid-specific helicase (LSH), a DNA methylation modifier, in modulating stem-like properties in cancer are still not clearly clarified. Therefore, exploring PTMs modulation of LSH activity will be of great significance to further understand the function and activity of LSH. Here, we demonstrate that LSH is capable to undergo PTMs, including methylation and phosphorylation. The arginine methyltransferase PRMT5 can methylate LSH at R309 residue, meanwhile, LSH could as well be phosphorylated by MAPK1 kinase at S503 residue. We further show that the accumulation of phosphorylation of LSH at S503 site exhibits downregulation of LSH methylation at R309 residue, which eventually promoting stem-like properties in lung cancer. Whereas, phosphorylation-deficient LSH S503A mutant promotes the accumulation of LSH methylation at R309 residue and attenuates stem-like properties, indicating the critical roles of LSH PTMs in modulating stem-like properties. Thus, our study highlights the importance of the crosstalk between LSH PTMs in determining its activity and function in lung cancer stem-cell maintenance.
    [Show full text]
  • Hypoxia and Oxygen-Sensing Signaling in Gene Regulation and Cancer Progression
    International Journal of Molecular Sciences Review Hypoxia and Oxygen-Sensing Signaling in Gene Regulation and Cancer Progression Guang Yang, Rachel Shi and Qing Zhang * Department of Pathology, University of Texas Southwestern Medical Center, Dallas, TX 75390, USA; [email protected] (G.Y.); [email protected] (R.S.) * Correspondence: [email protected]; Tel.: +1-214-645-4671 Received: 6 October 2020; Accepted: 29 October 2020; Published: 31 October 2020 Abstract: Oxygen homeostasis regulation is the most fundamental cellular process for adjusting physiological oxygen variations, and its irregularity leads to various human diseases, including cancer. Hypoxia is closely associated with cancer development, and hypoxia/oxygen-sensing signaling plays critical roles in the modulation of cancer progression. The key molecules of the hypoxia/oxygen-sensing signaling include the transcriptional regulator hypoxia-inducible factor (HIF) which widely controls oxygen responsive genes, the central members of the 2-oxoglutarate (2-OG)-dependent dioxygenases, such as prolyl hydroxylase (PHD or EglN), and an E3 ubiquitin ligase component for HIF degeneration called von Hippel–Lindau (encoding protein pVHL). In this review, we summarize the current knowledge about the canonical hypoxia signaling, HIF transcription factors, and pVHL. In addition, the role of 2-OG-dependent enzymes, such as DNA/RNA-modifying enzymes, JmjC domain-containing enzymes, and prolyl hydroxylases, in gene regulation of cancer progression, is specifically reviewed. We also discuss the therapeutic advancement of targeting hypoxia and oxygen sensing pathways in cancer. Keywords: hypoxia; PHDs; TETs; JmjCs; HIFs 1. Introduction Molecular oxygen serves as a co-factor in many biochemical processes and is fundamental for aerobic organisms to maintain intracellular ATP levels [1,2].
    [Show full text]
  • Distinct RNA N-Demethylation Pathways Catalyzed by Nonheme Iron ALKBH5 and FTO Enzymes Enable Regulation of Formaldehyde Release Rates
    Distinct RNA N-demethylation pathways catalyzed by nonheme iron ALKBH5 and FTO enzymes enable regulation of formaldehyde release rates Joel D. W. Toha,1, Steven W. M. Crossleya,1, Kevin J. Bruemmera, Eva J. Gea, Dan Hea, Diana A. Iovana, and Christopher J. Changa,b,2 aDepartment of Chemistry, University of California, Berkeley, CA 94720; and bDepartment of Molecular and Cell Biology, University of California, Berkeley, CA 94720 Edited by Amy C. Rosenzweig, Northwestern University, Evanston, IL, and approved August 24, 2020 (received for review April 17, 2020) The AlkB family of nonheme Fe(II)/2-oxoglutarate–dependent oxy- m6A (23) is relatively stable compared to other hydroxymethyl- genases are essential regulators of RNA epigenetics by serving as containing nucleobases and has been reported to decay to the free erasers of one-carbon marks on RNA with release of formaldehyde adenosine (A) base over 10 h (22). m6A is the most prominent (FA). Two major human AlkB family members, FTO and ALKBH5, modification of messenger RNA (mRNA) (24, 25) and is installed by both act as oxidative demethylases of N6-methyladenosine (m6A) the S-adenosylmethionine–dependent METTL3/14-WTAP writer but furnish different major products, N6-hydroxymethyladenosine complex (26) and removed by two human AlkB eraser enzymes, fat (hm6A) and adenosine (A), respectively. Here we identify founda- mass and obesity-associated protein (FTO) (4) and AlkB family tional mechanistic differences between FTO and ALKBH5 that pro- member 5 (ALKBH5) (27). Internal m6A modifications control the mote these distinct biochemical outcomes. In contrast to FTO, fate of mRNA (28–32) through translation, splicing, localization, which follows a traditional oxidative N-demethylation pathway stability, and decay and are connected to cancer progression, im- to catalyze conversion of m6A to hm6A with subsequent slow mune responses, and metabolic states (27, 29, 32–36).
    [Show full text]
  • Nuclear Import Protein KPNA7 and Its Cargos Acta Universitatis Tamperensis 2346
    ELISA VUORINEN Nuclear Import Protein KPNA7 and its Cargos ELISA Acta Universitatis Tamperensis 2346 ELISA VUORINEN Nuclear Import Protein KPNA7 and its Cargos Diverse roles in the regulation of cancer cell growth, mitosis and nuclear morphology AUT 2346 AUT ELISA VUORINEN Nuclear Import Protein KPNA7 and its Cargos Diverse roles in the regulation of cancer cell growth, mitosis and nuclear morphology ACADEMIC DISSERTATION To be presented, with the permission of the Faculty Council of the Faculty of Medicine and Life Sciences of the University of Tampere, for public discussion in the auditorium F114 of the Arvo building, Arvo Ylpön katu 34, Tampere, on 9 February 2018, at 12 o’clock. UNIVERSITY OF TAMPERE ELISA VUORINEN Nuclear Import Protein KPNA7 and its Cargos Diverse roles in the regulation of cancer cell growth, mitosis and nuclear morphology Acta Universitatis Tamperensis 2346 Tampere University Press Tampere 2018 ACADEMIC DISSERTATION University of Tampere, Faculty of Medicine and Life Sciences Finland Supervised by Reviewed by Professor Anne Kallioniemi Docent Pia Vahteristo University of Tampere University of Helsinki Finland Finland Docent Maria Vartiainen University of Helsinki Finland The originality of this thesis has been checked using the Turnitin OriginalityCheck service in accordance with the quality management system of the University of Tampere. Copyright ©2018 Tampere University Press and the author Cover design by Mikko Reinikka Acta Universitatis Tamperensis 2346 Acta Electronica Universitatis Tamperensis 1851 ISBN 978-952-03-0641-0 (print) ISBN 978-952-03-0642-7 (pdf) ISSN-L 1455-1616 ISSN 1456-954X ISSN 1455-1616 http://tampub.uta.fi Suomen Yliopistopaino Oy – Juvenes Print Tampere 2018 441 729 Painotuote CONTENTS List of original communications ................................................................................................
    [Show full text]
  • Potential for and Distribution of Enzymatic Biodegradation of Polystyrene by Environmental Microorganisms
    materials Communication Potential for and Distribution of Enzymatic Biodegradation of Polystyrene by Environmental Microorganisms Liyuan Hou and Erica L.-W. Majumder * Department of Chemistry, SUNY College of Environmental Science and Forestry, Syracuse, NY 13210, USA; [email protected] * Correspondence: [email protected] or [email protected]; Tel.: +1-3154706854 Abstract: Polystyrene (PS) is one of the main polymer types of plastic wastes and is known to be resistant to biodegradation, resulting in PS waste persistence in the environment. Although previous studies have reported that some microorganisms can degrade PS, enzymes and mechanisms of microorganism PS biodegradation are still unknown. In this study, we summarized microbial species that have been identified to degrade PS. By screening the available genome information of microorganisms that have been reported to degrade PS for enzymes with functional potential to depolymerize PS, we predicted target PS-degrading enzymes. We found that cytochrome P4500s, alkane hydroxylases and monooxygenases ranked as the top potential enzyme classes that can degrade PS since they can break C–C bonds. Ring-hydroxylating dioxygenases may be able to break the side-chain of PS and oxidize the aromatic ring compounds generated from the decomposition of PS. These target enzymes were distributed in Proteobacteria, Actinobacteria, Bacteroidetes, and Firmicutes, suggesting a broad potential for PS biodegradation in various earth environments and microbiomes. Our results provide insight into the enzymatic degradation of PS and suggestions for realizing the biodegradation of this recalcitrant plastic. Citation: Hou, L.; Majumder, E.L. Keywords: plastics; polystyrene biodegradation; enzymatic biodegradation; monooxygenase; alkane Potential for and Distribution of hydroxylase; cytochrome P450 Enzymatic Biodegradation of Polystyrene by Environmental Microorganisms.
    [Show full text]
  • 14321 NAE1/APPBP1 (D9I4Z) Rabbit Mab
    Revision 1 C 0 2 - t NAE1/APPBP1 (D9I4Z) Rabbit mAb a e r o t S Orders: 877-616-CELL (2355) [email protected] 1 Support: 877-678-TECH (8324) 2 3 Web: [email protected] 4 www.cellsignal.com 1 # 3 Trask Lane Danvers Massachusetts 01923 USA For Research Use Only. Not For Use In Diagnostic Procedures. Applications: Reactivity: Sensitivity: MW (kDa): Source/Isotype: UniProt ID: Entrez-Gene Id: WB H M R Mk Endogenous 60 Rabbit IgG Q13564 8883 Product Usage Information 2. Huang, D.T. et al. (2005) Mol Cell 17, 341-50. 3. Liakopoulos, D. et al. (1998) EMBO J 17, 2208-14. Application Dilution 4. Gong, L. and Yeh, E.T. (1999) J Biol Chem 274, 12036-42. 5. Wada, H. et al. (2000) J Biol Chem 275, 17008-15. Western Blotting 1:1000 6. Sakata, E. et al. (2007) Nat Struct Mol Biol 14, 167-8. 7. Kawakami, T. et al. (2001) EMBO J 20, 4003-12. Storage 8. Podust, V.N. et al. (2000) Proc Natl Acad Sci USA 97, 4579-84. 9. Wu, K. et al. (2002) J Biol Chem 277, 516-27. Supplied in 10 mM sodium HEPES (pH 7.5), 150 mM NaCl, 100 µg/ml BSA, 50% 10. Amir, R.E. et al. (2002) J Biol Chem 277, 23253-9. glycerol and less than 0.02% sodium azide. Store at –20°C. Do not aliquot the antibody. 11. Herrmann, J. et al. (2007) Circ Res 100, 1276-91. 12. Walden, H. et al. (2003) Mol Cell 12, 1427-37.
    [Show full text]
  • Is APP Key to the Appbp1 Pathway?
    Open Access Full Text Article Austin Alzheimer’s and Parkinson’s Disease A Austin Publishing Group Review Article Cycle on Wheels: Is APP Key to the AppBp1 Pathway? Chen Y1,2*, Neve RN4, Zheng H3, Griffin WST1,2, Barger SW1,2 and Mrak RE5 Abstract 1Department of Geriatrics, University of Arkansas for Alzheimer’s disease (AD) is the gradual loss of the cognitive function due Medical Sciences, USA to neuronal death. Currently no therapy is available to slow down, reverse 2Department of Neurobiology and Developmental or prevent the disease. Here we analyze the existing data in literature and Sciences, University of Arkansas for Medical Sciences, hypothesize that the physiological function of the Amyloid Precursor Protein USA (APP) is activating the AppBp1 pathway and this function is gradually lost during 3Huffington Center on Aging, Baylor College of Medicine, the progression of AD pathogenesis. The AppBp1 pathway, also known as the USA neddylation pathway, activates the small ubiquitin-like protein nedd8, which 4Department of Brain and Cognitive Sciences, covalently modifies and switches on Cullin ubiquitin ligases, which are essential Massachusetts Institute of Technology, USA in the turnover of cell cycle proteins. Here we discuss how APP may activate the 5Department of Pathology, University of Toledo Health AppBp1 pathway, which downregulates cell cycle markers and protects genome Sciences Campus, USA integrity. More investigation of this mechanism-driven hypothesis may provide *Corresponding author: Chen Y, Department insights into disease treatment and prevention strategies. of Geriatrics and Department of Neurobiology and Keywords: APP; Alzheimer’s disease; Ubiquitination; Neddylation; Cell Developmental Sciences, University of Arkansas for cycle Medical Sciences, Little Rock, AR 72205, USA Received: September 02, 2014; Accepted: September 29, 2014; Published: September 30, 2014 Abbreviations at least 18 proteins have been identified to bind AICD [25-27].
    [Show full text]
  • Supplementary Table S1. Table 1. List of Bacterial Strains Used in This Study Suppl
    Supplementary Material Supplementary Tables: Supplementary Table S1. Table 1. List of bacterial strains used in this study Supplementary Table S2. List of plasmids used in this study Supplementary Table 3. List of primers used for mutagenesis of P. intermedia Supplementary Table 4. List of primers used for qRT-PCR analysis in P. intermedia Supplementary Table 5. List of the most highly upregulated genes in P. intermedia OxyR mutant Supplementary Table 6. List of the most highly downregulated genes in P. intermedia OxyR mutant Supplementary Table 7. List of the most highly upregulated genes in P. intermedia grown in iron-deplete conditions Supplementary Table 8. List of the most highly downregulated genes in P. intermedia grown in iron-deplete conditions Supplementary Figures: Supplementary Figure 1. Comparison of the genomic loci encoding OxyR in Prevotella species. Supplementary Figure 2. Distribution of SOD and glutathione peroxidase genes within the genus Prevotella. Supplementary Table S1. Bacterial strains Strain Description Source or reference P. intermedia V3147 Wild type OMA14 isolated from the (1) periodontal pocket of a Japanese patient with periodontitis V3203 OMA14 PIOMA14_I_0073(oxyR)::ermF This study E. coli XL-1 Blue Host strain for cloning Stratagene S17-1 RP-4-2-Tc::Mu aph::Tn7 recA, Smr (2) 1 Supplementary Table S2. Plasmids Plasmid Relevant property Source or reference pUC118 Takara pBSSK pNDR-Dual Clonetech pTCB Apr Tcr, E. coli-Bacteroides shuttle vector (3) plasmid pKD954 Contains the Porpyromonas gulae catalase (4)
    [Show full text]
  • Identification of Molecules Relevant for the Invasiveness of Fibrosarcomas and Melanomas
    Helsinki University Biomedical Dissertations No. 148 IDENTIFICATION OF MOLECULES RELEVANT FOR THE INVASIVENESS OF FIBROSARCOMAS AND MELANOMAS Pirjo Nummela Department of Pathology Haartman Institute Faculty of Medicine and Division of Biochemistry Department of Biosciences Faculty of Biological and Environmental Sciences University of Helsinki Finland Academic dissertation To be presented for public examination with the permission of the Faculty of Biological and Environmental Sciences of the University of Helsinki in the Lecture Hall 2 of Haartman Institute (Haartmaninkatu 3, Helsinki), on 13.5.2011 at 12 o’clock noon. Helsinki 2011 Supervisor Docent Erkki Hölttä, M.D., Ph.D. Department of Pathology Haartman Institute University of Helsinki Thesis committee Docent Jouko Lohi, M.D., Ph.D. Department of Pathology Haartman Institute University of Helsinki and Pirjo Nikula-Ijäs, Ph.D. Division of Biochemistry Department of Biosciences University of Helsinki Reviewers Professor Veli-Matti Kähäri, M.D., Ph.D. Department of Dermatology University of Turku and Turku University Hospital and Docent Jouko Lohi, M.D., Ph.D. Opponent Professor Jyrki Heino, M.D., Ph.D. Department of Biochemistry and Food Chemistry University of Turku Custos Professor Kari Keinänen, Ph.D. Division of Biochemistry Department of Biosciences University of Helsinki ISBN 978-952-92-8821-2 (paperback) ISBN 978-952-10-6924-6 (PDF) ISSN 1457-8433 http://ethesis.helsinki.fi Helsinki University Print Helsinki 2011 To Juha, Joona, and Joel TABLE OF CONTENTS LIST OF ORIGINAL PUBLICATIONS
    [Show full text]
  • Amphioxus Adaptive Immune System: the Insights from Genes
    The Journal of Immunology Genes “Waiting” for Recruitment by the Adaptive Immune System: The Insights from Amphioxus1 Cuiling Yu,2* Meiling Dong,2* Xiaokun Wu,2* Shengguo Li,§ Shengfeng Huang,* Jing Su,* Jianwen Wei,* Yang Shen,* Chunyan Mou,* Xiaojin Xie,* Jianghai Lin,* Shaochun Yuan,* Xuesong Yu,* Yanhong Yu,* Jingchun Du,* Shicui Zhang,† Xuanxian Peng,‡ Mengqing Xiang,§ and Anlong Xu3* In seeking evidence of the existence of adaptive immune system (AIS) in ancient chordate, cDNA clones of six libraries from a protochordate, the Chinese amphioxus, were sequenced. Although the key molecules such as TCR, MHC, Ig, and RAG in AIS have not been identified from our database, we demonstrated in this study the extensive molecular evidence for the presence of genes homologous to many genes that are involved in AIS directly or indirectly, including some of which may represent the putative precursors of vertebrate AIS-related genes. The comparative analyses of these genes in different model organisms revealed the different fates of these genes during evolution. Their gene expression pattern suggested that the primitive digestive system is the pivotal place of the origin and evolution of the AIS. Our studies support the general statement that AIS appears after the jawless/jawed vertebrate split. However our study further reveals the fact that AIS is in its twilight in amphioxus and the evolution of the molecules in amphioxus are waiting for recruitment by the emergence of AIS. The Journal of Immunology, 2005, 174: 3493–3500. he hallmark of the adaptive immune system (AIS)4 is the brate (2, 3). The studies for the origin of the AIS focus on many presence of cells and molecules participating in the im- aspects: the origin of the Ag receptor, Ag processing and presen- T mune recognition of foreign pathogens and the memory tation system, and the effector cells (3, 4).
    [Show full text]