DOCSLIB.ORG

Nuclear Import Protein KPNA7 and Its Cargos Acta Universitatis Tamperensis 2346

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Nuclear Import Protein KPNA7 and Its Cargos Acta Universitatis Tamperensis 2346 ELISA VUORINEN Nuclear Import Protein KPNA7 and its Cargos ELISA Acta Universitatis Tamperensis 2346 ELISA VUORINEN Nuclear Import Protein KPNA7 and its Cargos Diverse roles in the regulation of cancer cell growth, mitosis and nuclear morphology AUT 2346 AUT ELISA VUORINEN Nuclear Import Protein KPNA7 and its Cargos Diverse roles in the regulation of cancer cell growth, mitosis and nuclear morphology ACADEMIC DISSERTATION To be presented, with the permission of the Faculty Council of the Faculty of Medicine and Life Sciences of the University of Tampere, for public discussion in the auditorium F114 of the Arvo building, Arvo Ylpön katu 34, Tampere, on 9 February 2018, at 12 o’clock. UNIVERSITY OF TAMPERE ELISA VUORINEN Nuclear Import Protein KPNA7 and its Cargos Diverse roles in the regulation of cancer cell growth, mitosis and nuclear morphology Acta Universitatis Tamperensis 2346 Tampere University Press Tampere 2018 ACADEMIC DISSERTATION University of Tampere, Faculty of Medicine and Life Sciences Finland Supervised by Reviewed by Professor Anne Kallioniemi Docent Pia Vahteristo University of Tampere University of Helsinki Finland Finland Docent Maria Vartiainen University of Helsinki Finland The originality of this thesis has been checked using the Turnitin OriginalityCheck service in accordance with the quality management system of the University of Tampere. Copyright ©2018 Tampere University Press and the author Cover design by Mikko Reinikka Acta Universitatis Tamperensis 2346 Acta Electronica Universitatis Tamperensis 1851 ISBN 978-952-03-0641-0 (print) ISBN 978-952-03-0642-7 (pdf) ISSN-L 1455-1616 ISSN 1456-954X ISSN 1455-1616 http://tampub.uta.fi Suomen Yliopistopaino Oy – Juvenes Print Tampere 2018 441 729 Painotuote CONTENTS List of original communications ................................................................................................. 7 Abbreviations ............................................................................................................................... 9 Abstract ....................................................................................................................................... 11 Tiivistelmä .................................................................................................................................. 13 1 Introduction .................................................................................................................... 15 2 Review of the literature .................................................................................................. 17 2.1 Nuclear import cycle .......................................................................................... 17 2.2 Karyopherin alpha protein family ..................................................................... 19 2.2.1 KPNA7.............................................................................................. 21 2.3 Roles of karyopherin alphas in cancer .............................................................. 21 2.3.1 Alpha 1 subfamily: KPNA2 ............................................................. 23 2.3.2 Alpha 2 subfamily: KPNA3 and KPNA4 ...................................... 24 2.3.3 Alpha 3 subfamily: KPNA1, KPNA5 and KPNA6 ...................... 25 2.3.4 KPNAs as biomarkers and prognostic tools in cancer ................. 25 2.4 Functions of karyopherins beyond nuclear transport ..................................... 26 2.4.1 Formation of the mitotic spindle .................................................... 27 2.4.2 Reassembly of the nuclear envelope ............................................... 27 2.4.3 Regulation of gene expression ......................................................... 28 2.4.4 Cytoplasmic retention of cargo proteins ........................................ 28 3 Aims of the study ........................................................................................................... 29 4 Materials and methods ................................................................................................... 30 4.1 Cell lines (I, II, III) and RNA samples (I, II) ....................................................30 4.2 qRT-PCR (I, II, III) ............................................................................................30 4.3 Transfections .......................................................................................................31 4.3.1 Transfection of small interfering RNAs (siRNAs) (I, II, III) .......................................................................................................31 4.3.2 Transfection of plasmids (III) ..........................................................32 4.4 Immunofluorescence (IF) assays (I, II, III) ......................................................32 4.5 Functional assays .................................................................................................32 4.5.1 Cell proliferation (I, II, III) ...............................................................32 4.5.2 Cell cycle and apoptosis assays (I, II) ..............................................33 4.5.3 Colony formation (I) .........................................................................33 4.5.4 Autophagy (I) .....................................................................................33 4.6 Western blotting (I, II, III) .................................................................................33 4.6.1 Protein extraction (I, II) ....................................................................33 4.6.2 Nuclear-cytoplasmic fractionation (I, III) .......................................34 4.6.3 Gel electrophoresis and protein detection (I, II, III) .....................34 4.7 Generation of stable KPNA7-expressing cell lines (III)..................................35 4.8 Affinity chromatography (III) ............................................................................36 4.9 Mass spectrometry (III) ......................................................................................36 4.9.1 Web-based analysis of MS results (III) ............................................37 4.10 Validation of MS results (III) .............................................................................38 4.10.1 Co-immunoprecipitation (III) ..........................................................38 4.10.2 Functional validation of KPNA7 cargos (III) .................................38 4.11 Statistical analyses (I, II, III) ...............................................................................39 5 Summary of the results ...................................................................................................40 5.1 KPNA7 expression is reactivated in cancer cells (I, II) ...................................40 5.2 KPNA7 is a key regulator of cancer cell growth (I, II) ....................................40 5.3 High KPNA7 expression contributes to other cancer-associated phenotypes (I) ..................................................................................................... 42 5.4 Correct mitotic spindle formation is affected by KPNA7 depletion (II) ........................................................................................................................ 44 5.5 KPNA7 silencing leads to abnormal nuclear morphology (II) ....................... 45 5.6 Identification of KPNA7 cargo proteins (III) ................................................. 47 5.6.1 Putative KPNA7 cargo proteins contribute to a wide variety of biological processes ......................................................... 47 5.6.2 MVP and ZNF414 represent novel KPNA7 cargo proteins that regulate pancreatic cancer cell growth...................... 49 6 Discussion ....................................................................................................................... 50 6.1 KPNA7 is an important regulator of growth and malignant properties of cancer cells ................................................................................... 50 6.2 KPNA7 depletion induces mitotic defects and deformation of nuclei in cancer cells ...................................................................................................... 52 6.3 KPNA7 cargo proteins and their relevance in cancer ..................................... 55 6.3.1 Major vault protein ........................................................................... 56 6.3.2 Zinc finger protein 414 .................................................................... 57 7 Conclusions .................................................................................................................... 59 Acknowledgements .................................................................................................................... 61 References................................................................................................................................... 63 Original communications .......................................................................................................... 80 LIST OF ORIGINAL COMMUNICATIONS This thesis is based on the following communications, which are referred to in the text by the corresponding Roman numerals. I Laurila EM, Vuorinen E, Savinainen K, Rauhala HE, Kallioniemi A. KPNA7, a nuclear transport receptor, promotes malignant properties of pancreatic cancer cells in vitro. (2014). Experimental Cell Research 332:159-167. II Vuorinen EM*, Rajala NK*, Ihalainen TO, Kallioniemi A. Depletion of nuclear import protein karyopherin
Load more

Recommended publications
  • Global Characteristics of Csig-Associated Gene Expression Changes in Human Hek293 Cells and the Implications for Csig Regulating Cell Proliferation and Senescence
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Frontiers - Publisher Connector ORIGINAL RESEARCH published: 15 May 2015 doi: 10.3389/fendo.2015.00069 Global characteristics of CSIG-associated gene expression changes in human HEK293 cells and the implications for CSIG regulating cell proliferation and senescence Liwei Ma, Wenting Zhao, Feng Zhu, Fuwen Yuan, Nan Xie, Tingting Li, Pingzhang Wang and Tanjun Tong* Research Center on Aging. Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Peking University Health Science Center, Beijing Key Laboratory of Protein Posttranslational Modifications and Cell Function, Edited by: Beijing, China Wen Zhou, Columbia University, USA Reviewed by: Cellular senescence-inhibited gene (CSIG), also named as ribosomal_L1 domain-contain- Jian Zhong, ing 1 (RSL1D1), is implicated in various processes including cell cycle regulation, cellular Mayo Clinic, USA Xiaoxu Zheng, senescence, apoptosis, and tumor metastasis. However, little is known about the regulatory University of Maryland Baltimore, USA mechanism underlying its functions. To screen important targets and signaling pathways Wensi Tao, University of Miami, USA modulated by CSIG, we compared the gene expression profiles in CSIG-silencing and control *Correspondence: HEK293 cells using Affymetrix microarray Human Genome U133 Plus 2.0 GeneChips. A Tanjun Tong, total of 590 genes displayed statistically significant expression changes, with 279 genes Department of Biochemistry and up-regulated and 311 down-regulated, respectively. These genes are involved in a broad array Molecular Biology, Research Center on Aging, Peking University Health of biological processes, mainly in transcriptional regulation, cell cycle, signal transduction, Science Center, 38 Xueyuan Road, oxidation reduction, development, and cell adhesion.
    [Show full text]
  • KPNA1 Antibody Cat
    KPNA1 Antibody Cat. No.: 5981 Western blot analysis of KPNA1 in Hela cell lysate with KPNA1 antibody at 1μg/mL. Immunocytochemistry of KPNA1 in HeLa cells with KPNA1 antibody at 2.5 μg/mL. Immunofluorescence of KPNA1 in K562 cells with KPNA1 antibody at 20 μg/mL. Specifications HOST SPECIES: Rabbit SPECIES REACTIVITY: Human, Mouse, Rat HOMOLOGY: Predicted species reactivity based on immunogen sequence: Bovine: (100%) KPNA1 antibody was raised against a 15 amino acid synthetic peptide near the amino terminus of human KPNA1. IMMUNOGEN: The immunogen is located within amino acids 30 - 80 of KPNA1. TESTED APPLICATIONS: ELISA, ICC, IF, WB September 30, 2021 1 https://www.prosci-inc.com/kpna1-antibody-5981.html KPNA1 antibody can be used for detection of KPNA1 by Western blot at 1 μg/mL. Antibody can also be used for immunocytochemistry starting at 2.5 μg/mL. For immunofluorescence start at 20 μg/mL. APPLICATIONS: Antibody validated: Western Blot in human samples; Immunocytochemistry in human samples and Immunofluorescence in human samples. All other applications and species not yet tested. POSITIVE CONTROL: 1) Cat. No. 1201 - HeLa Cell Lysate 2) Cat. No. 17-001 - HeLa Cell Slide 3) Cat. No. 17-004 - K-562 Cell Slide Properties PURIFICATION: KPNA1 Antibody is affinity chromatography purified via peptide column. CLONALITY: Polyclonal ISOTYPE: IgG CONJUGATE: Unconjugated PHYSICAL STATE: Liquid BUFFER: KPNA1 Antibody is supplied in PBS containing 0.02% sodium azide. CONCENTRATION: 1 mg/mL KPNA1 antibody can be stored at 4˚C for three months and -20˚C, stable for up to one STORAGE CONDITIONS: year.
    [Show full text]
  • Toxicogenomics Article
    Toxicogenomics Article Discovery of Novel Biomarkers by Microarray Analysis of Peripheral Blood Mononuclear Cell Gene Expression in Benzene-Exposed Workers Matthew S. Forrest,1 Qing Lan,2 Alan E. Hubbard,1 Luoping Zhang,1 Roel Vermeulen,2 Xin Zhao,1 Guilan Li,3 Yen-Ying Wu,1 Min Shen,2 Songnian Yin,3 Stephen J. Chanock,2 Nathaniel Rothman,2 and Martyn T. Smith1 1School of Public Health, University of California, Berkeley, California, USA; 2Division of Cancer Epidemiology and Genetics, National Cancer Institute, Bethesda, Maryland, USA; 3National Institute of Occupational Health and Poison Control, Chinese Center for Disease Control and Prevention, Beijing, China were then ranked and selected for further exam- Benzene is an industrial chemical and component of gasoline that is an established cause of ination using several forms of statistical analysis. leukemia. To better understand the risk benzene poses, we examined the effect of benzene expo- We also specifically examined the expression sure on peripheral blood mononuclear cell (PBMC) gene expression in a population of shoe- of all cytokine genes on the array under the factory workers with well-characterized occupational exposures using microarrays and real-time a priori hypothesis that these key genes polymerase chain reaction (PCR). PBMC RNA was stabilized in the field and analyzed using a involved in immune function are likely to be comprehensive human array, the U133A/B Affymetrix GeneChip set. A matched analysis of six altered by benzene exposure (Aoyama 1986). exposed–control pairs was performed. A combination of robust multiarray analysis and ordering We then attempted to confirm the array find- of genes using paired t-statistics, along with bootstrapping to control for a 5% familywise error ings for the leading differentially expressed rate, was used to identify differentially expressed genes in a global analysis.
    [Show full text]
  • Amphioxus Adaptive Immune System: the Insights from Genes
    The Journal of Immunology Genes “Waiting” for Recruitment by the Adaptive Immune System: The Insights from Amphioxus1 Cuiling Yu,2* Meiling Dong,2* Xiaokun Wu,2* Shengguo Li,§ Shengfeng Huang,* Jing Su,* Jianwen Wei,* Yang Shen,* Chunyan Mou,* Xiaojin Xie,* Jianghai Lin,* Shaochun Yuan,* Xuesong Yu,* Yanhong Yu,* Jingchun Du,* Shicui Zhang,† Xuanxian Peng,‡ Mengqing Xiang,§ and Anlong Xu3* In seeking evidence of the existence of adaptive immune system (AIS) in ancient chordate, cDNA clones of six libraries from a protochordate, the Chinese amphioxus, were sequenced. Although the key molecules such as TCR, MHC, Ig, and RAG in AIS have not been identified from our database, we demonstrated in this study the extensive molecular evidence for the presence of genes homologous to many genes that are involved in AIS directly or indirectly, including some of which may represent the putative precursors of vertebrate AIS-related genes. The comparative analyses of these genes in different model organisms revealed the different fates of these genes during evolution. Their gene expression pattern suggested that the primitive digestive system is the pivotal place of the origin and evolution of the AIS. Our studies support the general statement that AIS appears after the jawless/jawed vertebrate split. However our study further reveals the fact that AIS is in its twilight in amphioxus and the evolution of the molecules in amphioxus are waiting for recruitment by the emergence of AIS. The Journal of Immunology, 2005, 174: 3493–3500. he hallmark of the adaptive immune system (AIS)4 is the brate (2, 3). The studies for the origin of the AIS focus on many presence of cells and molecules participating in the im- aspects: the origin of the Ag receptor, Ag processing and presen- T mune recognition of foreign pathogens and the memory tation system, and the effector cells (3, 4).
    [Show full text]
  • The UVB-Induced Gene Expression Profile of Human Epidermis in Vivo Is Different from That of Cultured Keratinocytes
    Oncogene (2006) 25, 2601–2614 & 2006 Nature Publishing Group All rights reserved 0950-9232/06 $30.00 www.nature.com/onc ORIGINAL ARTICLE The UVB-induced gene expression profile of human epidermis in vivo is different from that of cultured keratinocytes CD Enk1, J Jacob-Hirsch2, H Gal3, I Verbovetski4, N Amariglio2, D Mevorach4, A Ingber1, D Givol3, G Rechavi2 and M Hochberg1 1Department of Dermatology, The Hadassah-Hebrew University Medical Center, Jerusalem, Israel; 2Department of Pediatric Hemato-Oncology and Functional Genomics, Safra Children’s Hospital, Sheba Medical Center and Sackler School of Medicine, Tel-Aviv University,Tel Aviv, Israel; 3Department of Molecular Cell Biology, Weizmann Institute of Science, Rehovot, Israel and 4The Laboratory for Cellular and Molecular Immunology, Department of Medicine, The Hadassah-Hebrew University Medical Center, Jerusalem, Israel In order to obtain a comprehensive picture of the radiation. UVB, with a wavelength range between 290 molecular events regulating cutaneous photodamage of and 320 nm, represents one of the most important intact human epidermis, suction blister roofs obtained environmental hazards affectinghuman skin (Hahn after a single dose of in vivo ultraviolet (UV)B exposure and Weinberg, 2002). To protect itself against the were used for microarray profiling. We found a changed DNA-damaging effects of sunlight, the skin disposes expression of 619 genes. Half of the UVB-regulated genes over highly complicated cellular programs, including had returned to pre-exposure baseline levels at 72 h, cell-cycle arrest, DNA repair and apoptosis (Brash et al., underscoring the transient character of the molecular 1996). Failure in selected elements of these defensive cutaneous UVB response.
    [Show full text]
  • (KPNA7), a Divergent Member of the Importin a Family of Nuclear Import
    Kelley et al. BMC Cell Biology 2010, 11:63 http://www.biomedcentral.com/1471-2121/11/63 RESEARCH ARTICLE Open Access Karyopherin a7 (KPNA7), a divergent member of the importin a family of nuclear import receptors Joshua B Kelley1, Ashley M Talley1, Adam Spencer1, Daniel Gioeli2, Bryce M Paschal1,3* Abstract Background: Classical nuclear localization signal (NLS) dependent nuclear import is carried out by a heterodimer of importin a and importin b. NLS cargo is recognized by importin a, which is bound by importin b. Importin b mediates translocation of the complex through the central channel of the nuclear pore, and upon reaching the nucleus, RanGTP binding to importin b triggers disassembly of the complex. To date, six importin a family members, encoded by separate genes, have been described in humans. Results: We sequenced and characterized a seventh member of the importin a family of transport factors, karyopherin a 7 (KPNA7), which is most closely related to KPNA2. The domain of KPNA7 that binds Importin b (IBB) is divergent, and shows stronger binding to importin b than the IBB domains from of other importin a family members. With regard to NLS recognition, KPNA7 binds to the retinoblastoma (RB) NLS to a similar degree as KPNA2, but it fails to bind the SV40-NLS and the human nucleoplasmin (NPM) NLS. KPNA7 shows a predominantly nuclear distribution under steady state conditions, which contrasts with KPNA2 which is primarily cytoplasmic. Conclusion: KPNA7 is a novel importin a family member in humans that belongs to the importin a2 subfamily. KPNA7 shows different subcellular localization and NLS binding characteristics compared to other members of the importin a family.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name karyopherin alpha 5 (importin alpha 6) Gene Symbol KPNA5 Organism Human Gene Summary The transport of molecules between the nucleus and the cytoplasm in eukaryotic cells is mediated by the nuclear pore complex (NPC) which consists of 60-100 proteins and is probably 120 million daltons in molecular size. Small molecules (up to 70 kD) can pass through the nuclear pore by nonselective diffusion; larger molecules are transported by an active process. Most nuclear proteins contain short basic amino acid sequences known as nuclear localization signals (NLSs). KPNA5 protein belongs to the importin alpha protein family and is thought to be involved in NLS-dependent protein import into the nucleus. Gene Aliases IPOA6, SRP6 RefSeq Accession No. NC_000006.11, NT_025741.15 UniGene ID Hs.182971 Ensembl Gene ID ENSG00000196911 Entrez Gene ID 3841 Assay Information Unique Assay ID qHsaCEP0055392 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000368564, ENST00000392517, ENST00000356348 Amplicon Context Sequence CCCCAGCATTGTACCTCAGGTGGATGAAAACCAACAACAGTTTATATTTCAGCAG CAGGAAGCACCAATGGATGGATTTCAACTTTAACTTACTGGAGGAAAAAAAATTT ATGGCTAAAAA Amplicon Length (bp) 91 Chromosome Location 6:117053399-117053519 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 94 R2 0.9992 cDNA Cq 23.2 Page 1/5 PrimePCR™Assay Validation Report cDNA Tm (Celsius) 79 gDNA Cq 24.6 Specificity (%) 100 Information to assist
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Diversification of Importin-Α Isoforms in Cellular Trafficking and Disease States
    Thomas Jefferson University Jefferson Digital Commons Department of Biochemistry and Molecular Biology Department of Biochemistry and Molecular Biology Faculty Papers 2-15-2015 Diversification of importin-α isoforms in cellular trafficking and disease states. Ruth A. Pumroy Thomas Jefferson University, [email protected] Gino Cingolani Thomas Jefferson University, [email protected] Let us know how access to this document benefits ouy Follow this and additional works at: https://jdc.jefferson.edu/bmpfp Part of the Medical Biochemistry Commons Recommended Citation Pumroy, Ruth A. and Cingolani, Gino, "Diversification of importin-α isoforms in cellular trafficking and disease states." (2015). Department of Biochemistry and Molecular Biology Faculty Papers. Paper 107. https://jdc.jefferson.edu/bmpfp/107 This Article is brought to you for free and open access by the Jefferson Digital Commons. The effeJ rson Digital Commons is a service of Thomas Jefferson University's Center for Teaching and Learning (CTL). The ommonC s is a showcase for Jefferson books and journals, peer-reviewed scholarly publications, unique historical collections from the University archives, and teaching tools. The effeJ rson Digital Commons allows researchers and interested readers anywhere in the world to learn about and keep up to date with Jefferson scholarship. This article has been accepted for inclusion in Department of Biochemistry and Molecular Biology Faculty Papers by an authorized administrator of the Jefferson Digital Commons. For more information, please contact: [email protected]. HHS Public Access Author manuscript Author Manuscript Author ManuscriptBiochem Author Manuscript J. Author manuscript; Author Manuscript available in PMC 2015 April 21. Published in final edited form as: Biochem J.
    [Show full text]
  • Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
    Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • Stem Cells® Original Article
    ® Stem Cells Original Article Properties of Pluripotent Human Embryonic Stem Cells BG01 and BG02 XIANMIN ZENG,a TAKUMI MIURA,b YONGQUAN LUO,b BHASKAR BHATTACHARYA,c BRIAN CONDIE,d JIA CHEN,a IRENE GINIS,b IAN LYONS,d JOSEF MEJIDO,c RAJ K. PURI,c MAHENDRA S. RAO,b WILLIAM J. FREEDa aCellular Neurobiology Research Branch, National Institute on Drug Abuse, Department of Health and Human Services (DHHS), Baltimore, Maryland, USA; bLaboratory of Neuroscience, National Institute of Aging, DHHS, Baltimore, Maryland, USA; cLaboratory of Molecular Tumor Biology, Division of Cellular and Gene Therapies, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, Maryland, USA; dBresaGen Inc., Athens, Georgia, USA Key Words. Embryonic stem cells · Differentiation · Microarray ABSTRACT Human ES (hES) cell lines have only recently been compared with pooled human RNA. Ninety-two of these generated, and differences between human and mouse genes were also highly expressed in four other hES lines ES cells have been identified. In this manuscript we (TE05, GE01, GE09, and pooled samples derived from describe the properties of two human ES cell lines, GE01, GE09, and GE07). Included in the list are genes BG01 and BG02. By immunocytochemistry and reverse involved in cell signaling and development, metabolism, transcription polymerase chain reaction, undifferenti- transcription regulation, and many hypothetical pro- ated cells expressed markers that are characteristic of teins. Two focused arrays designed to examine tran- ES cells, including SSEA-3, SSEA-4, TRA-1-60, TRA-1- scripts associated with stem cells and with the 81, and OCT-3/4. Both cell lines were readily main- transforming growth factor-β superfamily were tained in an undifferentiated state and could employed to examine differentially expressed genes.
    [Show full text]