The UVB-Induced Gene Expression Profile of Human Epidermis in Vivo Is Different from That of Cultured Keratinocytes
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Formaldehyde Induces Bone Marrow Toxicity in Mice by Inhibiting Peroxiredoxin 2 Expression
MOLECULAR MEDICINE REPORTS 10: 1915-1920, 2014 Formaldehyde induces bone marrow toxicity in mice by inhibiting peroxiredoxin 2 expression GUANGYAN YU1, QIANG CHEN1, XIAOMEI LIU1, CAIXIA GUO2, HAIYING DU1 and ZHIWEI SUN1,2 1Department of Preventative Medicine, School of Public Health, Jilin University, Changchun, Jilin 130021; 2 Department of Hygenic Toxicology, School of Public Health, Capital Medical University, Beijing 100069, P.R. China Received November 4, 2013; Accepted June 5, 2014 DOI: 10.3892/mmr.2014.2473 Abstract. Peroxiredoxin 2 (Prx2), a member of the perox- Introduction iredoxin family, regulates numerous cellular processes through intracellular oxidative signal transduction pathways. Formaldehyde (FA) is an environmental agent commonly Formaldehyde (FA)-induced toxic damage involves reactive found in numerous products, including paint, cloth and oxygen species (ROS) that trigger subsequent toxic effects and exhaust gas, as well as other medicinal and industrial products. inflammatory responses. The present study aimed to inves- FA exposure has raised significant concerns due to mounting tigate the role of Prx2 in the development of bone marrow evidence suggesting its carcinogenic potential and severe toxicity caused by FA and the mechanism underlying FA effects on human health (1). Epidemiological and experi- toxicity. According to the results of the preliminary inves- mental data have demonstrated that FA may cause leukemia, tigations, the mice were divided into four groups (n=6 per particularly myeloid leukemia; however, the mechanism group). One group was exposed to ambient air and the other underlying this effect remains unclear (2-4). In the process three groups were exposed to different concentrations of FA of tumor formation, DNA damage may be the initiating (20, 40, 80 mg/m3) for 15 days in the respective inhalation factor (5), while myeloperoxidase (MPO) activity is associ- chambers, for 2 h a day. -
Peroxiredoxins in Neurodegenerative Diseases
antioxidants Review Peroxiredoxins in Neurodegenerative Diseases Monika Szeliga Mossakowski Medical Research Centre, Department of Neurotoxicology, Polish Academy of Sciences, 5 Pawinskiego Street, 02-106 Warsaw, Poland; [email protected]; Tel.: +48-(22)-6086416 Received: 31 October 2020; Accepted: 27 November 2020; Published: 30 November 2020 Abstract: Substantial evidence indicates that oxidative/nitrosative stress contributes to the neurodegenerative diseases. Peroxiredoxins (PRDXs) are one of the enzymatic antioxidant mechanisms neutralizing reactive oxygen/nitrogen species. Since mammalian PRDXs were identified 30 years ago, their significance was long overshadowed by the other well-studied ROS/RNS defense systems. An increasing number of studies suggests that these enzymes may be involved in the neurodegenerative process. This article reviews the current knowledge on the expression and putative roles of PRDXs in neurodegenerative disorders such as Alzheimer’s disease, Parkinson’s disease and dementia with Lewy bodies, multiple sclerosis, amyotrophic lateral sclerosis and Huntington’s disease. Keywords: peroxiredoxin (PRDX); oxidative stress; nitrosative stress; neurodegenerative disease 1. Introduction Under physiological conditions, reactive oxygen species (ROS, e.g., superoxide anion, O2 -; · hydrogen peroxide, H O ; hydroxyl radical, OH; organic hydroperoxide, ROOH) and reactive nitrogen 2 2 · species (RNS, e.g., nitric oxide, NO ; peroxynitrite, ONOO-) are constantly produced as a result of normal · cellular metabolism and play a crucial role in signal transduction, enzyme activation, gene expression, and regulation of immune response [1]. The cells are endowed with several enzymatic (e.g., glutathione peroxidase (GPx); peroxiredoxin (PRDX); thioredoxin (TRX); catalase (CAT); superoxide dismutase (SOD)), and non-enzymatic (e.g., glutathione (GSH); quinones; flavonoids) antioxidant systems that minimize the levels of ROS and RNS. -
Nuclear Import Protein KPNA7 and Its Cargos Acta Universitatis Tamperensis 2346
ELISA VUORINEN Nuclear Import Protein KPNA7 and its Cargos ELISA Acta Universitatis Tamperensis 2346 ELISA VUORINEN Nuclear Import Protein KPNA7 and its Cargos Diverse roles in the regulation of cancer cell growth, mitosis and nuclear morphology AUT 2346 AUT ELISA VUORINEN Nuclear Import Protein KPNA7 and its Cargos Diverse roles in the regulation of cancer cell growth, mitosis and nuclear morphology ACADEMIC DISSERTATION To be presented, with the permission of the Faculty Council of the Faculty of Medicine and Life Sciences of the University of Tampere, for public discussion in the auditorium F114 of the Arvo building, Arvo Ylpön katu 34, Tampere, on 9 February 2018, at 12 o’clock. UNIVERSITY OF TAMPERE ELISA VUORINEN Nuclear Import Protein KPNA7 and its Cargos Diverse roles in the regulation of cancer cell growth, mitosis and nuclear morphology Acta Universitatis Tamperensis 2346 Tampere University Press Tampere 2018 ACADEMIC DISSERTATION University of Tampere, Faculty of Medicine and Life Sciences Finland Supervised by Reviewed by Professor Anne Kallioniemi Docent Pia Vahteristo University of Tampere University of Helsinki Finland Finland Docent Maria Vartiainen University of Helsinki Finland The originality of this thesis has been checked using the Turnitin OriginalityCheck service in accordance with the quality management system of the University of Tampere. Copyright ©2018 Tampere University Press and the author Cover design by Mikko Reinikka Acta Universitatis Tamperensis 2346 Acta Electronica Universitatis Tamperensis 1851 ISBN 978-952-03-0641-0 (print) ISBN 978-952-03-0642-7 (pdf) ISSN-L 1455-1616 ISSN 1456-954X ISSN 1455-1616 http://tampub.uta.fi Suomen Yliopistopaino Oy – Juvenes Print Tampere 2018 441 729 Painotuote CONTENTS List of original communications ................................................................................................ -
Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-Like Mouse Models: Tracking the Role of the Hairless Gene
University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 5-2006 Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene Yutao Liu University of Tennessee - Knoxville Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Part of the Life Sciences Commons Recommended Citation Liu, Yutao, "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino- like Mouse Models: Tracking the Role of the Hairless Gene. " PhD diss., University of Tennessee, 2006. https://trace.tennessee.edu/utk_graddiss/1824 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Yutao Liu entitled "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Life Sciences. Brynn H. Voy, Major Professor We have read this dissertation and recommend its acceptance: Naima Moustaid-Moussa, Yisong Wang, Rogert Hettich Accepted for the Council: Carolyn R. -
Environmental Influences on Endothelial Gene Expression
ENDOTHELIAL CELL GENE EXPRESSION John Matthew Jeff Herbert Supervisors: Prof. Roy Bicknell and Dr. Victoria Heath PhD thesis University of Birmingham August 2012 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. ABSTRACT Tumour angiogenesis is a vital process in the pathology of tumour development and metastasis. Targeting markers of tumour endothelium provide a means of targeted destruction of a tumours oxygen and nutrient supply via destruction of tumour vasculature, which in turn ultimately leads to beneficial consequences to patients. Although current anti -angiogenic and vascular targeting strategies help patients, more potently in combination with chemo therapy, there is still a need for more tumour endothelial marker discoveries as current treatments have cardiovascular and other side effects. For the first time, the analyses of in-vivo biotinylation of an embryonic system is performed to obtain putative vascular targets. Also for the first time, deep sequencing is applied to freshly isolated tumour and normal endothelial cells from lung, colon and bladder tissues for the identification of pan-vascular-targets. Integration of the proteomic, deep sequencing, public cDNA libraries and microarrays, delivers 5,892 putative vascular targets to the science community. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Differences for Ectopic Versus Eutopic Cells
556 RBMO VOLUME 39 ISSUE 4 2019 ARTICLE Chemosensitivity and chemoresistance in endometriosis – differences for ectopic versus eutopic cells BIOGRAPHY Andres Salumets is Professor of Reproductive Medicine at the University of Tartu, and Scientific Head at the Competence Centre on Health Technologies, Tartu, Estonia. He has been involved in assisted reproduction for 20 years, first as an embryologist and later as a researcher. His major interests are endometriosis, endometrial biology and implantation. Darja Lavogina1,2,*, Külli Samuel1, Arina Lavrits1,3, Alvin Meltsov1, Deniss Sõritsa1,4,5, Ülle Kadastik6, Maire Peters1,4, Ago Rinken2, Andres Salumets1,4,7, 8 KEY MESSAGE Akt/PKB inhibitor GSK690693, CK2 inhibitor ARC-775, MAPK pathway inhibitor sorafenib, proteasome inhibitor bortezomib, and microtubule-depolymerizing toxin MMAE showed higher cytotoxicity in eutopic cells. In contrast, 10 µmol/l of the anthracycline toxin doxorubicin caused cellular death in ectopic cells more effectively than in eutopic cells, underlining the potential of doxorubicin in endometriosis research. ABSTRACT Research question: Endometriosis is a common gynaecological disease defined by the presence of endometrium-like tissue outside the uterus. This complex disease, often accompanied by severe pain and infertility, causes a significant medical and socioeconomic burden; hence, novel strategies are being sought for the treatment of endometriosis. Here, we set out to explore the cytotoxic effects of a panel of compounds to find toxins with different efficiency in eutopic versus ectopic cells, thus highlighting alterations in the corresponding molecular pathways. Design: The effect on cellular viability of 14 compounds was established in a cohort of paired eutopic and ectopic endometrial stromal cell samples from 11 patients. -
Surface Phenotype Changes and Increased Response to Oxidative Stress in CD4+Cd25high T Cells
biomedicines Article Surface Phenotype Changes and Increased Response to Oxidative Stress in CD4+CD25high T Cells Yoshiki Yamamoto 1,*, Takaharu Negoro 2, Rui Tada 3 , Michiaki Narushima 4, Akane Hoshi 2, Yoichi Negishi 3,* and Yasuko Nakano 2 1 Department of Paediatrics, Tokyo Metropolitan Ebara Hospital, Tokyo 145-0065, Japan 2 Department of Pharmacogenomics, School of Pharmacy, Showa University, Tokyo 142-8555, Japan; [email protected] (T.N.); [email protected] (A.H.); [email protected] (Y.N.) 3 Department of Drug Delivery and Molecular Biopharmaceutics, School of Pharmacy, Tokyo University of Pharmacy and Life Sciences, Tokyo 192-0392, Japan; [email protected] 4 Department of Internal Medicine, Showa University Northern Yokohama Hospital, Kanagawa 224-8503, Japan; [email protected] * Correspondence: [email protected] (Y.Y.); [email protected] (Y.N.); Tel.: +81-3-5734-8000 (Y.Y.); +81-42-676-3182 (Y.N.) + + + + Abstract: Conversion of CD4 CD25 FOXP3 T regulatory cells (Tregs) from the immature (CD45RA ) to mature (CD45RO+) phenotype has been shown during development and allergic reactions. The relative frequencies of these Treg phenotypes and their responses to oxidative stress during devel- opment and allergic inflammation were analysed in samples from paediatric and adult subjects. The FOXP3lowCD45RA+ population was dominant in early childhood, while the percentage of high + FOXP3 CD45RO cells began increasing in the first year of life. These phenotypic changes were observed in subjects with and without asthma. Further, there was a significant increase in phospho- Citation: Yamamoto, Y.; Negoro, T.; + high rylated ERK1/2 (pERK1/2) protein in hydrogen peroxide (H2O2)-treated CD4 CD25 cells in Tada, R.; Narushima, M.; Hoshi, A.; adults with asthma compared with those without asthma. -
DNA Methylation Changes in Down Syndrome Derived Neural Ipscs Uncover Co-Dysregulation of ZNF and HOX3 Families of Transcription
Laan et al. Clinical Epigenetics (2020) 12:9 https://doi.org/10.1186/s13148-019-0803-1 RESEARCH Open Access DNA methylation changes in Down syndrome derived neural iPSCs uncover co- dysregulation of ZNF and HOX3 families of transcription factors Loora Laan1†, Joakim Klar1†, Maria Sobol1, Jan Hoeber1, Mansoureh Shahsavani2, Malin Kele2, Ambrin Fatima1, Muhammad Zakaria1, Göran Annerén1, Anna Falk2, Jens Schuster1 and Niklas Dahl1* Abstract Background: Down syndrome (DS) is characterized by neurodevelopmental abnormalities caused by partial or complete trisomy of human chromosome 21 (T21). Analysis of Down syndrome brain specimens has shown global epigenetic and transcriptional changes but their interplay during early neurogenesis remains largely unknown. We differentiated induced pluripotent stem cells (iPSCs) established from two DS patients with complete T21 and matched euploid donors into two distinct neural stages corresponding to early- and mid-gestational ages. Results: Using the Illumina Infinium 450K array, we assessed the DNA methylation pattern of known CpG regions and promoters across the genome in trisomic neural iPSC derivatives, and we identified a total of 500 stably and differentially methylated CpGs that were annotated to CpG islands of 151 genes. The genes were enriched within the DNA binding category, uncovering 37 factors of importance for transcriptional regulation and chromatin structure. In particular, we observed regional epigenetic changes of the transcription factor genes ZNF69, ZNF700 and ZNF763 as well as the HOXA3, HOXB3 and HOXD3 genes. A similar clustering of differential methylation was found in the CpG islands of the HIST1 genes suggesting effects on chromatin remodeling. Conclusions: The study shows that early established differential methylation in neural iPSC derivatives with T21 are associated with a set of genes relevant for DS brain development, providing a novel framework for further studies on epigenetic changes and transcriptional dysregulation during T21 neurogenesis. -
Download Download
Supplementary Figure S1. Results of flow cytometry analysis, performed to estimate CD34 positivity, after immunomagnetic separation in two different experiments. As monoclonal antibody for labeling the sample, the fluorescein isothiocyanate (FITC)- conjugated mouse anti-human CD34 MoAb (Mylteni) was used. Briefly, cell samples were incubated in the presence of the indicated MoAbs, at the proper dilution, in PBS containing 5% FCS and 1% Fc receptor (FcR) blocking reagent (Miltenyi) for 30 min at 4 C. Cells were then washed twice, resuspended with PBS and analyzed by a Coulter Epics XL (Coulter Electronics Inc., Hialeah, FL, USA) flow cytometer. only use Non-commercial 1 Supplementary Table S1. Complete list of the datasets used in this study and their sources. GEO Total samples Geo selected GEO accession of used Platform Reference series in series samples samples GSM142565 GSM142566 GSM142567 GSM142568 GSE6146 HG-U133A 14 8 - GSM142569 GSM142571 GSM142572 GSM142574 GSM51391 GSM51392 GSE2666 HG-U133A 36 4 1 GSM51393 GSM51394 only GSM321583 GSE12803 HG-U133A 20 3 GSM321584 2 GSM321585 use Promyelocytes_1 Promyelocytes_2 Promyelocytes_3 Promyelocytes_4 HG-U133A 8 8 3 GSE64282 Promyelocytes_5 Promyelocytes_6 Promyelocytes_7 Promyelocytes_8 Non-commercial 2 Supplementary Table S2. Chromosomal regions up-regulated in CD34+ samples as identified by the LAP procedure with the two-class statistics coded in the PREDA R package and an FDR threshold of 0.5. Functional enrichment analysis has been performed using DAVID (http://david.abcc.ncifcrf.gov/) -
Peripherally Generated Foxp3+ Regulatory T Cells Mediate the Immunomodulatory Effects of Ivig in Allergic Airways Disease
Peripherally Generated Foxp3+ Regulatory T Cells Mediate the Immunomodulatory Effects of IVIg in Allergic Airways Disease This information is current as Amir H. Massoud, Gabriel N. Kaufman, Di Xue, Marianne of September 26, 2021. Béland, Marieme Dembele, Ciriaco A. Piccirillo, Walid Mourad and Bruce D. Mazer J Immunol published online 20 February 2017 http://www.jimmunol.org/content/early/2017/02/18/jimmun ol.1502361 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2017/02/18/jimmunol.150236 Material 1.DCSupplemental http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 26, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2017 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published February 20, 2017, doi:10.4049/jimmunol.1502361 The Journal of Immunology Peripherally Generated Foxp3+ Regulatory T Cells Mediate the Immunomodulatory Effects of IVIg in Allergic Airways Disease Amir H. Massoud,*,†,1 Gabriel N. Kaufman,* Di Xue,* Marianne Be´land,* Marieme Dembele,* Ciriaco A. -
(NM 001142939) Mouse Untagged Clone – MC215669
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MC215669 Gm20604 (NM_001142939) Mouse Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Gm20604 (NM_001142939) Mouse Untagged Clone Tag: Tag Free Symbol: Gm20604 Synonyms: AK010878-Moap1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >MC215669 representing NM_001142939 Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCTTTCGGGCGAGTACGTCGGTTGTGACGGGGAGCCGCAGCGGCTACGAGTGTCCTGTGAGGCGT CGGGAGACGCGGACCCTCTCCAGAGCCTGTCGGCGGGCGTGGTCCGGATGAAGGAGTTGGTAGCGGAGTT CTTCGGGACCCTAGTGGAGCAGGACGCGCAAGGCTTGGCGGAAGATCCGGACGACGCTTTGGATGGCTCC CGGACCTCTGCGTGTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA Restriction Sites: SgfI-MluI ACCN: NM_001142939 Insert Size: 228 bp OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). RefSeq: NM_001142939.1, NP_001136411.1 RefSeq Size: 3835 bp RefSeq ORF: 228 bp This product is to be used for