Supplementary Table I. Morpholino oligonucleotides and primer sequences used in this study Oligonucleotide Name Accession Sequence Morpholinos tlr5a AY389449 5'-AAAGTGTATGTAGCTGCCATTCTGG tlr5b AY389450 5'-TGAATGTATATCCCATTCTGTGAGC myd88 AY388401 5'-TAGCAAAACCTCTGTTATCCAGCGA myd88 5bp mismatch AY388401 5'-TAcCAtAACCTgTGTTATCgAGgGA standard control morpholino 5'-CCTCTTACCTCAGTTACAATTTATA qRT-PCR ppial-qP1-Fw AY391451 5’- ACACTGAAACACGGAGGCAAAG ppial-qP2-Rev 5’- CATCCACAACCTTCCCGAACAC irak3-qP1-Fw CK026195 5’- TGAGGTCTACTGTGGACGATGG irak3-qP2-Rev 5’- ATGTTAGGATGCTGGTTGAGTTGG tlr5a-qP1-Fw AY389449 5’-ATTCTGGTGGTGCTTGTTGTAG tlr5a-qP2-Rev 5’-ACGAGGTAACTTCTGTTCTCAATG tlr5b-qP3-Fw AY389450 5’-GCGTTGTTGAAGAGGCTGGAC tlr5b-qP4-Rev 5’-TTCTGGATGGCCACTTCTCATATTGG mmp9-qP3-Fw NM_213123 5’-CATTAAAGATGCCCTGATGTATCCC mmp9-qP4-Rev 5’-AGTGGTGGTCCGTGGTTGAG il1b-qP1-Fw NM_212844 5’-GAACAGAATGAAGCACATCAAACC il1b-qP2-Rev 5’-ACGGCACTGAATCCACCAC il8-qP1-Fw XM_001342570 5’-TGTGTTATTGTTTTCCTGGCATTTC il8-qP2-Rev 5’-GCGACAGCGTGGATCTACAG ifn1-qP3-Fw NM_207640 5’- TTAATACACGCAAAGATGAGAACTC ifn1-qP4-Rev 5’- GCCAAGCCATTCGCAAGTAG tnfa-qP5-Fw NM_212829 5’- AGACCTTAGACTGGAGAGATGAC tnfa-qP6-Rev 5’- CAAAGACACCTGGCTGTAGAC cxcl-C1c-qP1-Fw NM_001115060 5’- GGCATTCACACCCAAAGCG cxcl-C1c-qP2_Rev 5’- GCGAGCACGATTCACGAGAG * In situ ccl-C5a-Fw NM_001082906 5’- CATCACTAGGAAAGGATTGAAC ccl-C5a-Rev-T7 5’- TAATACGACTCACTATAGGGGATGTCAAAGACTTTATTCAC cxcl-C1c-Fw NM_001115060 5’- GTTAAACATAAATAACACCGACTC cxcl-C1c-Rev-T7 5’- TAATACGACTCACTATAGGGACACCCTATAAAACTGAGTA irak3-Fw CK026195 5’- CAGTGAGAGAGGCATGAAACATC irak3-Rev-T7 5’- TAATACGACTCACTATAGGGGCAGCTTTGGTCACCAGAGTG socs3-Fw NM_199950 5’- CACTGTTTCTCCATCATCATCAG socs3-Rev-T7 5’- TAATACGACTCACTATAGGGGTCTACGAGTTGTTTCTCAACAG * The T7 promoter sequence was placed at the 5’ end of the in situ reverse primer and is indicated in italics. Supplementary Table II. UniGene clusters up-regulated upon S. typhimurium wt and/or S. typhimurium Ra infection* Gene Description UniGene Code Entrez GeneID Ra 2h Ra 2h Ra 5h Ra 5h Ra 8h Ra 8h Ra 24h Ra 24h wt 2h wt 2h wt 5h wt 5h wt 8h wt 8h wt 24h wt 24h Symbol (build # 105) Fold Change P-value Fold Change P-value Fold Change P-value Fold Change P-value Fold Change P-value Fold Change P-value Fold Change P-value Fold Change P-value 9-Sep Septin 9 Dr.121586 337243 2.156 1.25E-16 aanat2 Arylalkylamine N-acetyltransferase Dr.81299 30685 1.728 5.27E-17 aars Alanyl-tRNA synthetase Dr.75848 324940 4.080 0.00E+00 abat 4-aminobutyrate aminotransferase Dr.76989 378968 2.192 0.00E+00 ATP-binding cassette, sub-family A abca12 Dr.75341 321215 1.852 7.80E-16 (ABC1), member 12 ATP-binding cassette, sub-family B abcb3 Dr.88570 30695 4.488 3.45E-09 7.622 2.45E-39 6.005 1.93E-11 4.110 1.49E-25 12.152 2.80E-45 33.977 0.00E+00 (MDR/TAP), member 3 ATP-binding cassette, sub-family C abcc2 Dr.24063 393561 2.265 3.38E-24 (CFTR/MRP), member 2 ATP-binding cassette, sub-family D abcd1 Dr.103366 566367 2.211 7.36E-11 (ALD), member 1 ATP-binding cassette, sub-family F abcf1 Dr.32961 406467 3.295 0.00E+00 (GCN20), member 1 abhd4 Abhydrolase domain containing 4 Dr.81194 550276 4.515 0.00E+00 abi1 Abl-interactor 1 Dr.107659 393711 1.938 2.93E-07 Amiloride-sensitive cation channel accn2b Dr.98481 407671 2.813 6.56E-07 2 b Angiotensin I converting enzyme ace2 Dr.76987 492331 3.944 7.52E-06 (peptidyl-dipeptidase A) 2 aco1 Aconitase 1, soluble Dr.40063 568448 1.962 7.24E-09 2.826 4.76E-08 1.902 2.03E-07 3.323 1.42E-24 Acyl-CoA synthetase long-chain acsl4 Dr.78711 393622 1.655 1.84E-16 family member 4 ada Adenosine deaminase Dr.120392 436919 3.743 2.49E-12 3.864 6.58E-13 A disintegrin and metalloproteinase adam8 Dr.86401 368917 1.965 0.00E+00 1.589 9.68E-23 1.606 0.00E+00 2.643 0.00E+00 6.805 0.00E+00 domain 8 adcy6 Adenylate cyclase 6 Dr.42208 570652 1.545 4.64E-07 add3 Adducin 3 (gamma) Dr.10904 556762 1.561 0.00E+00 adipor2 Adiponectin receptor 2 Dr.114625 560140 1.768 6.79E-20 adora2b Adenosine A2b receptor Dr.141253 560100 4.104 1.82E-11 agk Acylglycerol kinase Dr.80681 334270 1.557 5.00E-05 1-acylglycerol-3-phosphate O- agpat3 Dr.75961 406734 1.615 4.00E-05 1.508 6.67E-07 acyltransferase 3 1-acylglycerol-3-phosphate O- agpat4 acyltransferase 4 (lysophosphatidic Dr.78538 406265 1.668 3.10E-16 acid acyltransferase, delta) agt Angiotensinogen Dr.3585 322485 5.100 0.00E+00 Aminolevulinate, delta-, synthetase alas1 Dr.4829 64608 2.562 0.00E+00 1 Aldehyde dehydrogenase 2 family aldh2 Dr.28434 393462 3.575 3.69E-24 2.359 1.82E-08 (mitochondrial) Aldehyde dehydrogenase 3 family, aldh3d1 Dr.76675 282559 2.067 5.62E-07 member D1 aldoc Aldolase c, fructose-bisphosphate Dr.19223 369193 2.694 3.58E-16 Asparagine-linked glycosylation 2 alg2 homolog (S. cerevisiae, alpha-1,3- Dr.83082 403068 2.826 1.12E-15 mannosyltransferase) Asparagine-linked glycosylation 5 alg5 homolog (yeast, dolichyl-phosphate Dr.75542 334646 1.611 9.74E-27 beta-glucosyltransferase) alox12 Arachidonate 12-lipoxygenase Dr.132326 322732 1.702 1.46E-14 Adenosine monophosphate ampd3 Dr.11670 333997 1.839 1.32E-12 deaminase 3 amt Aminomethyltransferase Dr.121883 450000 1.854 2.75E-10 ankh Ankylosis, progressive homolog Dr.4277 323738 1.540 1.60E-21 anxa13 Annexin A13 Dr.11764 81880 3.661 0.00E+00 anxa2a Annexin A2a Dr.75997 325557 4.645 2.16E-43 anxa4 Annexin A4 Dr.91161 353362 3.382 1.59E-17 anxa5 Annexin A5 Dr.75805 337132 1.892 5.49E-09 apaf1 Apoptotic protease activating factor Dr.78833 58131 2.157 0.00E+00 Amyloid beta (A4) precursor protein- apbb1ip binding, family B, member 1 Dr.88358 393607 1.995 1.56E-17 2.764 1.61E-13 interacting protein apoa1 Apolipoprotein A-I Dr.75775 30355 1.633 6.70E-09 arg2 Arginase, type II Dr.77297 322614 1.635 1.03E-18 16.086 0.00E+00 Rho guanine nucleotide exchange arhgef1 Dr.133654 368266 1.591 3.00E-05 3.261 1.52E-34 factor (GEF) 1 Rho/rac guanine nucleotide arhgef18 Dr.32570 407987 1.694 1.02E-10 exchange factor (GEF) 18 ADP-ribosylation factor-like 2 arl2bp Dr.110760 393976 1.696 9.50E-07 1.522 5.00E-05 binding protein arl8b ADP-ribosylation factor-like 8B Dr.78116 337424 2.045 6.97E-26 arrdc1 Arrestin domain containing 1 Dr.114902 378740 1.603 4.49E-10 arrdc2 Arrestin domain containing 2 Dr.26118 335206 4.595 1.33E-08 arrdc3 Arrestin domain containing 3 Dr.103751 324193 3.986 0.00E+00 asns Asparagine synthetase Dr.25168 394138 1.687 1.03E-10 4.061 2.97E-36 aspn Asporin (LRR class 1) Dr.81771 65228 1.506 4.33E-09 1.595 7.15E-08 1.774 3.42E-13 2.227 1.65E-11 atf3 Activating transcription factor 3 Dr.77523 393939 2.134 4.46E-20 2.501 2.00E-05 2.720 4.97E-21 2.721 0.00E+00 7.882 5.23E-20 33.665 0.00E+00 atg4c Autophagy-related 4C (yeast) Dr.121931 415193 1.803 2.00E-05 2.261 4.92E-10 atoh1a Atonal homolog 1a Dr.566 30303 1.718 1.82E-12 ATPase, Na+/K+ transporting, atp1a1 Dr.75307 64612 1.512 3.00E-05 alpha 1 polypeptide ATPase, Ca++ transporting, atp2a2a Dr.16838 393940 1.868 1.50E-15 cardiac muscle, slow twitch 2a ATPase, H+ transporting, atp6ap1 Dr.76858 195824 1.930 4.09E-40 lysosomal accessory protein 1 ATPase, H+ transporting, atp6ap2 Dr.120094 406296 1.527 1.78E-07 lysosomal accessory protein 2 ATPase, H+ transporting, atp6v0a1 Dr.114200 324307 2.315 1.80E-09 lysosomal V0 subunit a isoform 1 ATPase, H+ transporting, V0 atp6v0d1 Dr.77332 322811 1.755 4.84E-33 subunit D isoform 1 ATPase, H+ transporting, atp6v1a Dr.9240 337583 1.719 4.55E-14 lysosomal 70kDa, V1 subunit A ATPase, H+ transporting, atp6v1b2 Dr.132618 359840 1.604 2.00E-05 2.359 3.16E-10 1.597 2.29E-06 2.432 3.25E-11 lysosomal 56/58kDa, V1 subunit B2 ATPase, H+ transporting, atp6v1c1 Dr.106389 368907 1.594 1.05E-06 lysosomal, V1 subunit C, isoform 1 ATPase, H+ transporting, atp6v1c1l lysosomal, V1 subunit C, isoform 1, Dr.14847 449655 1.530 1.39E-23 like ATPase, Cu++ transporting, alpha atp7a Dr.21520 564924 2.114 6.27E-10 polypeptide (Menkes syndrome) AU RNA binding protein/enoyl- auh Dr.2043 445182 1.862 5.00E-05 Coenzyme A hydratase Apoptosis, caspase activation aven Dr.21346 561418 1.521 3.80E-09 inhibitor UDP-GlcNAc:betaGal beta-1,3-N- b3gnt5 Dr.76667 336526 1.561 3.00E-05 acetylglucosaminyltransferase 5 UDP-GlcNAc:betaGal beta-1,3-N- b3gnt7 Dr.14659 286748 3.791 1.48E-06 acetylglucosaminyltransferase 7 bag3 BCL2-associated athanogene 3 Dr.79182 445139 2.514 6.62E-24 baiap2l1a BAI1-associated protein 2-like 1a Dr.81674 387261 2.074 1.11E-39 baiap2l1b BAI1-associated protein 2-like 1b Dr.108513 550528 4.861 4.25E-12 bax Bcl2-associated X protein Dr.78968 58081 2.158 0.00E+00 Bromodomain adjacent to zinc baz1a Dr.36447 334173 1.604 1.55E-13 finger domain, 1A bbc3 BCL2 binding component 3 Dr.26003 751763 5.717 8.14E-10 Putative breast adenocarcinoma bc2 Dr.117290 406838 2.185 1.16E-36 marker bcan Brevican Dr.80617 334113 6.339 4.02E-07 B-cell receptor-associated protein bcap31 Dr.78455 368488 1.711 2.90E-36 31 Breast carcinoma amplified bcas3 Dr.27111 393594 2.181 2.60E-27 sequence 3 Branched chain aminotransferase bcat1 Dr.80309 337412 1.858 3.33E-07 5.481 0.00E+00 1, cytosolic Beta-carotene 15, 15-dioxygenase bcdo2 Dr.82050 678554 2.858 1.40E-20 2 B-cell CLL/lymphoma 6 (zinc finger bcl6 Dr.115290 393707 1.735 5.01E-09 protein 51) bdnf Brain-derived neurotrophic factor Dr.132862 58118 2.825 3.41E-16 Basic helix-loop-helix domain bhlhb2 Dr.78721 324413 2.893 4.73E-42 containing, class B, 2 Basic helix-loop-helix domain bhlhb3l Dr.85246 563771 4.433 1.31E-12 containing, class B, 3 like BH3 interacting domain death bida Dr.84878 559425 1.569 1.79E-09 3.239 5.47E-10 agonist BCL2-interacting killer (apoptosis- bik Dr.82304 564030 2.726 5.00E-05 inducing) bin1 Bridging