DOCSLIB.ORG

Structure-Function Studies of Enzymes from Ribose Metabolism

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Structure-Function Studies of Enzymes from Ribose Metabolism Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology 939 Structure-Function Studies of Enzymes from Ribose Metabolism BY C. EVALENA ANDERSSON ACTA UNIVERSITATIS UPSALIENSIS UPPSALA 2004 !"" #$"" % & % % ' ( ) * + &( , +( !""( - . - % + / % 0 ( , ( 1#1( ( ( 2-3 1. 45 ." 2 * & & * % * &( , % . * % % ( ) % / ( 0 6 / % ,)' & % % & ( )* % 6 % 6 * ( 0 6 * * % ( - % & 7 % & % & && ( ' && ,)' % /( 2 8 * ,)' & ,'.'' ( ) * % / % * 6 & & / 6 ( 0 . . . ( - * & * % %% & ( 9 * 6 / %% % ( -: % & * . & . , /( , & % * /( ) % / % & % ( ! 6 . . & / 6 % " # $ % # %& '()# %$# # *+',-. # ; ( + , !"" 2--3 ".!#!< 2-3 1. 45 ." $ $$$ .#111 = $>> (6(> ? @ $ $$$ .#111A List of Papers This thesis is based on the following papers, which are referred to in the text by their Roman numerals: I Andersson, C. E. & Mowbray, S. L. (2002). Activation of ribokinase by monovalent cations. J. Mol. Biol. 315, 409-19 II Zhang, R., Andersson, C. E., Savchenko, A., Skarina, T., Evdokimova, E., Beasley, S., Arrowsmith, C. H., Edwards, A. M., Joachimiak, A. & Mowbray, S. L. (2003). Structure of Escherichia coli ribose-5-phosphate isomerase: a ubiquitous enzyme of the pentose phosphate pathway and the Calvin cycle. Structure (Camb) 11, 31-42. III Zhang, R., Andersson, C. E., Savchenko, A., Skarina, T., Evdokimova, E., Beasley, S., Arrowsmith, C. H., Edwards, A. M., Joachimiak, A. & Mowbray, S. L. (2003)The 2.2 A resolution structure of RpiB/AlsB from Escherichia coli illustrates a new approach to the ribose-5-phosphate isomerase reaction. J Mol Biol 332(5): 1083-94. IV Andersson, C. E., Sigrell-Simon, J. A., Berg, F., Cameron, A. D., and Mowbray, S. L. (2004). Specificity and activity of Echerichia coli ribokinase. Manuscript. V Roos, A. K., Andersson, C. E., Bergfors, T., Jacobsson, M., Kareln, A., Unge, T., Jones, T. A. and Mowbray, S., L. (2004). Mycobacterium tuberculosis ribose-5-phosphate isomerase has a known fold, but a novel active site. J Mol Biol., 335(3): 799-809. The articles are reprinted with permission from the copyright holders. Contents Introduction.....................................................................................................1 General aspects of metabolism...................................................................1 The pentose phosphate pathway.................................................................2 Ribose uptake in Escherichia coli..............................................................4 Enzymes discussed in the thesis: Ribokinase and Ribose 5-phosphate isomerases ..................................................................................................4 Methods ..........................................................................................................6 Protein expression, purification and crystallization ...................................6 RK..........................................................................................................6 RpiA and RpiB ......................................................................................6 Crystallization........................................................................................6 Steady state kinetics ...................................................................................7 RK..........................................................................................................7 RpiA and RpiB ......................................................................................7 Treatment of data...................................................................................7 Dead end inhibition ....................................................................................8 Product inhibition.......................................................................................8 Fluorescence spectroscopy.........................................................................8 Crystallographic methods...........................................................................8 RK from E. coli.............................................................................................10 Overall structure of RK............................................................................11 Active site and substrate binding..............................................................12 Solved RK structures................................................................................13 Proposed mechanism................................................................................14 Objectives.................................................................................................14 Results: RK; paper I and IV .....................................................................15 Activation by monovalent ions............................................................15 Various aspects of RK structure ..........................................................17 Functional studies on wt RK................................................................19 Verification of the monovalent ion binding site: RK mutant S294K function and structure ..........................................................................22 Discussion ................................................................................................23 Ion binding...........................................................................................23 Binding of nucleotides and phosphates ...............................................24 Aspects of RK kinetic mechanism.......................................................25 Outlook.....................................................................................................27 Ribose 5-phosphate isomerases from E. coli ................................................28 The reaction..............................................................................................29 Objectives.................................................................................................30 Results: RpiA and RpiB; Paper II, III, V .................................................31 Structure of RpiA.................................................................................31 Structure of RpiB.................................................................................32 Structural analysis of the apo enzymes................................................33 Kinetics and inhibition.........................................................................34 Structure of RpiA with bound inhibitor...............................................35 Docking experiments...........................................................................36 Genome searches .................................................................................36 Discussion ................................................................................................37 Outlook.....................................................................................................39 Summary in Swedish ....................................................................................40 References.....................................................................................................42 Abbreviations RK Ribokinase AK Adenosine kinase tAK Adenosine kinase from Toxoplasma gondii RpiA/B Ribose 5-phosphate isomerase A/B RK-Cs RK structure in complex with cesium RK-ATP RK structure in complex with ATP RK-S294K RK mutant S294K structure ADP Adenosine diphosphate AMP-PCP ȕ-methyleneadenosine 5' triphosphate PDB Protein Data Bank O5* Atom bound to C5 of ribose 5C, 7C etc. Carbohydrates with 5 carbons, 7 carbons etc Introduction General aspects of metabolism Metabolism is the sum of all chemical transformations that occur in a cell or organism. It is a highly coordinated and directed cell activity, although it may at a first glance seem unordered and randomly arranged (Lehninger, 1993). Metabolism has been divided into two major branches. Catabolism is the set of reactions where nutrient molecules are converted into smaller products while energy and reductive power are produced in the form of ATP and NADH or NADPH. Anabolism (or biosynthesis) is another set of reactions where smaller molecules are arranged into more complex structures, which includes both production of the cell's own characteristic molecules, as well as production of fatty acids, proteins and other macromolecules. As catabolism is productive in terms of energy and reductive power, anabolism is demanding. It requires both energy and reductive power. Metabolic pathways can be linear, branched or even cyclic. In general, catabolic pathways are convergent and anabolic pathways are divergent. Since both anabolism and catabolism normally take place in an organism at the same time, some sort of regulation is needed so as to prevent wasteful reactions (for example, at the same time degrading and synthesizing the same fatty acid); when one occurs, the other is prevented. Although many
Load more

Recommended publications
  • Molecular Mechanisms Involved Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis
    Virginia Commonwealth University VCU Scholars Compass Theses and Dissertations Graduate School 2010 Molecular Mechanisms Involved Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis Ryan Fassnacht Virginia Commonwealth University Follow this and additional works at: https://scholarscompass.vcu.edu/etd Part of the Physiology Commons © The Author Downloaded from https://scholarscompass.vcu.edu/etd/2246 This Thesis is brought to you for free and open access by the Graduate School at VCU Scholars Compass. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected]. Ryan C. Fassnacht 2010 All Rights Reserved Molecular Mechanisms Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science at Virginia Commonwealth University. by Ryan Christopher Fassnacht, B.S. Hampden Sydney University, 2005 M.S. Virginia Commonwealth University, 2010 Director: Valeria Mas, Ph.D., Associate Professor of Surgery and Pathology Division of Transplant Department of Surgery Virginia Commonwealth University Richmond, Virginia July 9, 2010 Acknowledgement The Author wishes to thank his family and close friends for their support. He would also like to thank the members of the molecular transplant team for their help and advice. This project would not have been possible with out the help of Dr. Valeria Mas and her endearing
    [Show full text]
  • Isozymes of Pyruvate Kinase in Liver and Hepatomas of the Rat1
    [CANCER RESEARCH 34, 1439-1446, June 1974] Isozymes of Pyruvate Kinase in Liver and Hepatomas of the Rat1 Francis A. Farina,2 Jennie B. Shatton, Harold P. Morris, and Sidney Weinhouse The Fels Research Institute and the Department of Biochemistry, Temple University School oj Medicine, Philadelphia. Pennsylvania IV140 (F. A. F., J. B. S.. S. W.\, and the Department of Biochemistry. Howard University School of Medicine. Washington. D. C. 20001 [H. P. M .\ SUMMARY 23, 32, 41, 57). These alterations involve the replacement of those isozymes that are under dietary and hormonal control Pyruvate kinase (PK) (EC 2.7.1.40) isozymes were assayed by the host, and that have important metabolic functions in in normal rat liver and a series of transplantable rat the adult differentiated liver by other isozymes which are hepatomas ranging widely in growth rate and degree of normally either low in, or absent from, the adult tissue. As differentiation, with the use of gradient elution by chloride part of an ongoing study of this phenomenon, we have ion from columns of DEAE-cellulose. In agreement with examined the alteration of PK3 (EC 2.7.1.40) isozymes in other studies, three noninterconvertible forms were found in the Morris hepatomas (30. 31), a series of chemically rat tissues: isozyme I, the major form in adult rat liver: induced, transplantable rat hepatomas ranging widely in isozyme II, the sole form in heart and skeletal muscle: and growth rate and degree of differentiation. This enzyme isozyme III, the sole form in poorly differentiated hepato occupies a key position in the metabolism of cells and, as we mas, the major form in normal kidney and lung, and the pointed out previously (27, 28.
    [Show full text]
  • Pyruvate Kinase: Function, Regulation and Role in Cancer
    Pyruvate kinase: Function, regulation and role in cancer The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Israelsen, William J., and Matthew G. Vander Heiden. “Pyruvate Kinase: Function, Regulation and Role in Cancer.” Seminars in Cell & Developmental Biology 43 (2015): 43–51. As Published http://dx.doi.org/10.1016/j.semcdb.2015.08.004 Publisher Elsevier Version Author's final manuscript Citable link http://hdl.handle.net/1721.1/105833 Terms of Use Creative Commons Attribution-NonCommercial-NoDerivs License Detailed Terms http://creativecommons.org/licenses/by-nc-nd/4.0/ HHS Public Access Author manuscript Author Manuscript Author ManuscriptSemin Cell Author Manuscript Dev Biol. Author Author Manuscript manuscript; available in PMC 2016 August 13. Published in final edited form as: Semin Cell Dev Biol. 2015 July ; 43: 43–51. doi:10.1016/j.semcdb.2015.08.004. Pyruvate kinase: function, regulation and role in cancer William J. Israelsena,1,* and Matthew G. Vander Heidena,b,* aKoch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, MA 02139, USA bDepartment of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA 02115, USA Abstract Pyruvate kinase is an enzyme that catalyzes the conversion of phosphoenolpyruvate and ADP to pyruvate and ATP in glycolysis and plays a role in regulating cell metabolism. There are four mammalian pyruvate kinase isoforms with unique tissue expression patterns and regulatory properties. The M2 isoform of pyruvate kinase (PKM2) supports anabolic metabolism and is expressed both in cancer and normal tissue. The enzymatic activity of PKM2 is allosterically regulated by both intracellular signaling pathways and metabolites; PKM2 thus integrates signaling and metabolic inputs to modulate glucose metabolism according to the needs of the cell.
    [Show full text]
  • Polymerase Ribozyme with Promoter Recognition
    In vitro Evolution of a Processive Clamping RNA Polymerase Ribozyme with Promoter Recognition by Razvan Cojocaru BSc, Simon Fraser University, 2014 Thesis Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in the Department of Molecular Biology and Biochemistry Faculty of Science © Razvan Cojocaru 2021 SIMON FRASER UNIVERSITY Summer 2021 Copyright in this work is held by the author. Please ensure that any reproduction or re-use is done in accordance with the relevant national copyright legislation. Declaration of Committee Name: Razvan Cojocaru Degree: Doctor of Philosophy Title: In vitro Evolution of a Processive Clamping RNA Polymerase Ribozyme with Promoter Recognition Committee: Chair: Lisa Craig Professor, Molecular Biology and Biochemistry Peter Unrau Supervisor Professor, Molecular Biology and Biochemistry Dipankar Sen Committee Member Professor, Molecular Biology and Biochemistry Michel Leroux Committee Member Professor, Molecular Biology and Biochemistry Mani Larijani Internal Examiner Associate Professor, Molecular Biology and Biochemistry Gerald Joyce External Examiner Professor, Jack H. Skirball Center for Chemical Biology and Proteomics Salk Institute for Biological Studies Date Defended/Approved: August 12, 2021 ii Abstract The RNA World hypothesis proposes that the early evolution of life began with RNAs that can serve both as carriers of genetic information and as catalysts. Later in evolution, these functions were gradually replaced by DNA and enzymatic proteins in cellular biology. I start by reviewing the naturally occurring catalytic RNAs, ribozymes, as they play many important roles in biology today. These ribozymes are central to protein synthesis and the regulation of gene expression, creating a landscape that strongly supports an early RNA World.
    [Show full text]
  • Yeast Genome Gazetteer P35-65
    gazetteer Metabolism 35 tRNA modification mitochondrial transport amino-acid metabolism other tRNA-transcription activities vesicular transport (Golgi network, etc.) nitrogen and sulphur metabolism mRNA synthesis peroxisomal transport nucleotide metabolism mRNA processing (splicing) vacuolar transport phosphate metabolism mRNA processing (5’-end, 3’-end processing extracellular transport carbohydrate metabolism and mRNA degradation) cellular import lipid, fatty-acid and sterol metabolism other mRNA-transcription activities other intracellular-transport activities biosynthesis of vitamins, cofactors and RNA transport prosthetic groups other transcription activities Cellular organization and biogenesis 54 ionic homeostasis organization and biogenesis of cell wall and Protein synthesis 48 plasma membrane Energy 40 ribosomal proteins organization and biogenesis of glycolysis translation (initiation,elongation and cytoskeleton gluconeogenesis termination) organization and biogenesis of endoplasmic pentose-phosphate pathway translational control reticulum and Golgi tricarboxylic-acid pathway tRNA synthetases organization and biogenesis of chromosome respiration other protein-synthesis activities structure fermentation mitochondrial organization and biogenesis metabolism of energy reserves (glycogen Protein destination 49 peroxisomal organization and biogenesis and trehalose) protein folding and stabilization endosomal organization and biogenesis other energy-generation activities protein targeting, sorting and translocation vacuolar and lysosomal
    [Show full text]
  • Prevalence of Pyruvate Kinase Deficiency
    P3513 Prevalence of Red Cell Pyruvate Kinase Deficiency: A Systematic Literature Review Mike Storm1, Matthew H Secrest2*, Courtney Carrington2, Deb Casso2, Keely Gilroy1, Leanne Pladson1, Audra N Boscoe1 1Agios Pharmaceuticals Inc., Cambridge, MA, USA; 2IQVIA Epidemiology & Drug Safety, Seattle, WA and Cambridge, MA, USA; *Affiliation at the time research was conducted BACKGROUND METHODS (continued) RESULTS (continued) RESULTS (continued) • Pyruvate Kinase (PK) deficiency is a rare congenital hemolytic anemia Exclusion Criteria The remaining 34 studies were grouped based on methods and study Among these 4 studies, an important distinction was made between studies characterized by diminished activity of the PK enzyme in red blood population (Table 1). reporting diagnosed prevalence (n=3) and overall disease prevalence cells (RBC).1 • Non-human studies; (diagnosed and undiagnosed PK deficiency; n=1). Table 1. Distribution of extracted studies by type of study (n=34) • Low PK enzyme activity can lead to lifelong chronic hemolysis with • Publications that were not the primary report of the data • Two studies estimated diagnosed PK deficiency prevalence as 3.2 per associated symptoms and complications such as anemia, jaundice, (e.g., literature reviews); Type of study Number million4 and 8.5 per million5 by identifying diagnosed PK deficiency cases of studies gallstones, splenectomy and associated thrombosis, iron overload, and • Studies of PK deficiency prevalence/incidence conducted within a source from source populations of known size. liver cirrhosis.2 Population-based prevalence 2 population of patients with symptoms of PK deficiency such as anemia • We estimated the prevalence of diagnosed PK deficiency in a general • PK deficiency is caused by compound heterozygosity or homozygosity for or jaundice; Molecular PKLR screening in a general population 5 population to be 6.5 per million6 using data from another high-quality study 3 one or more of the >300 known mutations to the PKLR gene.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Pyruvate Kinase, Rbc
    Lab Dept: Chemistry Test Name: PYRUVATE KINASE, RBC General Information Lab Order Codes: PYKI Synonyms: Pyruvate Kinase, Erythrocytes CPT Codes: 84220 – Pyruvate kinase Test Includes: Pyruvate kinase RBC level reported in U/g Hb. Logistics Test Indications: Useful for the workup of cases of nonspherocytic hemolytic anemia, for a family workup to determine inheritance pattern (pyruvate kinase deficiency is autosomal recessive), and for genetic counseling. Lab Testing Sections: Chemistry - Sendouts Referred to: Mayo Medical Laboratories (MML Test: PK) Phone Numbers: MIN Lab: 612-813-6280 STP Lab: 651-220-6550 Test Availability: Daily, 24 hours Turnaround Time: 1 - 4 days, test set up Monday - Saturday Special Instructions: N/A Specimen Specimen Type: Whole blood Container: Yellow top (ACD- Solution B) tube Alternate tube: Lavender (EDTA) top tube Draw Volume: 6 mL (Minimum: 1 mL) blood Processed Volume: Same as Draw Volume Collection: Routine blood collection Special Processing: Lab Staff: Do Not centrifuge. Send whole blood refrigerated in original collection container. Do Not transfer blood to other containers. Store and ship at refrigerated temperatures. Forward promptly. Patient Preparation: None Sample Rejection: Specimen cannot be frozen; mislabeled or unlabeled specimens; gross hemolysis Interpretive Reference Range: ≥12 months: 6.7 – 14.3 U/g Hb Reference values have not been established for patients <12 months of age. Interpretation: Most hemolytic anemias due to pyruvate kinase (PK) deficiency are associated with activity levels less than 40% of mean normal. However, some patients with clinically significant hemolysis can have normal or only mildly decreased PK enzyme activity, which paradoxically may occur in individuals with most severe symptoms.
    [Show full text]
  • Inhibition of Spinach Phosphoribulokinase by DL-Glyceraldehyde by ANTONI R
    Biochem. J. (1976) 153, 613-619 613 Printed in Great Britain Inhibition of Spinach Phosphoribulokinase by DL-Glyceraldehyde By ANTONI R. SLABAS and DAVID A. WALKER Department ofBotany, University ofSheffield, Sheffield S1O 2TN, U.K. (Received 10 September 1975) Spinach chloroplast phosphoribulokinase is inhibited by DL-glyceraldehyde. The in- hibition is non-competitive with respect to ribulose 5-phosphate (Ki 19mM) and ATP (Ki 20mM). The inhibition is discussed in relation to a previously reported inhibition of CO2 assimilation in intact and envelope-free chloroplasts by DL-glyceraldehyde. It is concluded that the inhibition of phosphoribulokinase is insufficient to account for the inhibition, by DL-glyceraldehyde, of 02 evolution with ribose 5-phosphate as substrate and that a further site of inhibition is also present in this system. DL-Glyceraldehyde inhibits photosynthetic carbon glycylglycine buffer, pH7.4, in a total volume of assiniilation by intact chloroplasts and by the re- 13 ml. The reaction was terminated by the addition constituted chloroplast system (Stokes & Walker, of 2ml of 50 % (w/v) trichloroacetic acid and the pH 1972). The inhibition is most pronounced with intact was adjusted to pH8.0 with KOH. After the addition chloroplasts, a concentration of 1OmM being sufficient of Sml of 1.OM-barium acetate the solution was to suppress 02 evolution completely. It is important centrifuged and the precipitate discarded after because DL-glyceraldehyde is the only known inhibi- washing with Sml of water. Cold ethanol (4vol.) was tor of photosynthesis that is entirely without detect- added to the combined supernatants (total volume able effect on photophosphorylation or photo- 25.4ml); the new precipitate was recovered by synthetic electron transport.
    [Show full text]
  • Swiveling Domain Mechanism in Pyruvate Phosphate Dikinase†,‡ Kap Lim,§ Randy J
    Biochemistry 2007, 46, 14845-14853 14845 Swiveling Domain Mechanism in Pyruvate Phosphate Dikinase†,‡ Kap Lim,§ Randy J. Read,| Celia C. H. Chen,§ Aleksandra Tempczyk,§ Min Wei,⊥ Dongmei Ye,⊥ Chun Wu,⊥ Debra Dunaway-Mariano,⊥ and Osnat Herzberg*,§ Center for AdVanced Research in Biotechnology, UniVersity of Maryland Biotechnology Institute, RockVille, Maryland 20850, Department of Haematology, Cambridge Institute for Medical Research, UniVersity of Cambridge, Cambridge, United Kingdom, and Department of Chemistry, UniVersity of New Mexico, Albuquerque, New Mexico ReceiVed September 10, 2007; ReVised Manuscript ReceiVed October 17, 2007 ABSTRACT: Pyruvate phosphate dikinase (PPDK) catalyzes the reversible conversion of phosphoenolpyruvate (PEP), AMP, and Pi to pyruvate and ATP. The enzyme contains two remotely located reaction centers: the nucleotide partial reaction takes place at the N-terminal domain, and the PEP/pyruvate partial reaction takes place at the C-terminal domain. A central domain, tethered to the N- and C-terminal domains by two closely associated linkers, contains a phosphorylatable histidine residue (His455). The molecular architecture suggests a swiveling domain mechanism that shuttles a phosphoryl group between the two reaction centers. In an early structure of PPDK from Clostridium symbiosum, the His445-containing domain (His domain) was positioned close to the nucleotide binding domain and did not contact the PEP/pyruvate- binding domain. Here, we present the crystal structure of a second conformational state of C. symbiosum PPDK with the His domain adjacent to the PEP-binding domain. The structure was obtained by producing a three-residue mutant protein (R219E/E271R/S262D) that introduces repulsion between the His and nucleotide-binding domains but preserves viable interactions with the PEP/pyruvate-binding domain.
    [Show full text]
  • 200703 Supplemental Magnani Et Al Clean Version
    Supplemental Data Sleeping Beauty-engineered CAR T cells achieve anti-leukemic activity without severe toxicities Chiara F. Magnani, Giuseppe Gaipa, Federico Lussana, Daniela Belotti, Giuseppe Gritti, Sara Napolitano, Giada Matera, Benedetta Cabiati, Chiara Buracchi, Gianmaria Borleri, Grazia Fazio, Silvia Zaninelli, Sarah Tettamanti, Stefania Cesana, Valentina Colombo, Michele Quaroni, Giovanni Cazzaniga, Attilio Rovelli, Ettore Biagi, Stefania Galimberti, Andrea Calabria, Fabrizio Benedicenti, Eugenio Montini, Silvia Ferrari, Martino Introna, Adriana Balduzzi, Maria Grazia Valsecchi, Giuseppe Dastoli, Alessandro Rambaldi, Andrea Biondi Table of Contents: Supplemental Methods ...................................................................................................... 2 Supplemental Figure 1. .................................................................................................... 13 Supplemental Figure 2. .................................................................................................... 14 Supplemental Figure 3. .................................................................................................... 15 Supplemental Figure 4. .................................................................................................... 16 Supplemental Figure 5. .................................................................................................... 17 Supplemental Figure 6. .................................................................................................... 18 Supplemental
    [Show full text]
  • Posttranslational Regulation of Pyruvate, Orthophosphate Dikinase in Developing Rice (Oryza Sativa) Seeds
    Planta (2006) DOI 10.1007/s00425-006-0259-3 ORIGINAL ARTICLE Chris J. Chastain Æ Jarrod W. Heck Thomas A. Colquhoun Æ Dylan G. Voge Xing-You Gu Posttranslational regulation of pyruvate, orthophosphate dikinase in developing rice (Oryza sativa) seeds Received: 16 January 2006 / Accepted: 25 February 2006 Ó Springer-Verlag 2006 Abstract Pyruvate, orthophosphate dikinase (PPDK; (PPDK inactivation) and protein degradation. Immu- E.C.2.7.9.1) is most well known as a photosynthetic noblot analysis of separated seed tissue fractions enzyme in C4 plants. The enzyme is also ubiquitous in (pericarp, embryo + aleurone, seed embryo) revealed C3 plant tissues, although a precise non-photosynthetic that regulatory phosphorylation of PPDK occurs in the C3 function(s) is yet to be validated, owing largely to its non-green seed embryo and green outer pericarp layer, low abundance in most C3 organs. The single C3 organ but not in the endosperm + aleurone layer. The type where PPDK is in high abundance, and, therefore, modestly abundant pool of inactive PPDK (phosphor- where its function is most amenable to elucidation, are ylated + dephosphorylated) that was found to persist the developing seeds of graminaceous cereals. In this in mature rice seeds was shown to remain largely un- report, we suggest a non-photosynthetic function for C3 changed (inactive) upon seed germination, suggesting PPDK by characterizing its abundance and posttrans- that PPDK in rice seeds function in developmental lational regulation in developing Oryza sativa (rice) rather than in post-developmental processes. These and seeds. Using primarily an immunoblot-based approach, related observations lead us to postulate a putative we show that PPDK is a massively expressed protein function for the enzyme that aligns its PEP to pyruvate- during the early syncitial-endosperm/-cellularization forming reaction with biosynthetic processes that are stage of seed development.
    [Show full text]