DOCSLIB.ORG

Isolation of a Pyrophosphoryl Form of Pyruvate, Phosphate Dikinase from Propionibacteria* (Phosphoenolpyruvate/ATP/Enzyme) YORAM MILNER and HARLAND G

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Isolation of a Pyrophosphoryl Form of Pyruvate, Phosphate Dikinase from Propionibacteria* (Phosphoenolpyruvate/ATP/Enzyme) YORAM MILNER and HARLAND G Proc. Nat. Acad. Sci. USA Vol. 69, No. 9, pp. 2463-2468, September 1972 Isolation of a Pyrophosphoryl Form of Pyruvate, Phosphate Dikinase from Propionibacteria* (phosphoenolpyruvate/ATP/enzyme) YORAM MILNER AND HARLAND G. WOOD Department of Biochemistry, Case Western Reserve University School of Medicine, Cleveland, Ohio 44106 Contributed by Harland G. Wood, June 15, 1972 ABSTRACT Pyruvate, phosphate dikinase from Pro- Enzyme-P + pyruvate ;. enzyme + P-enolpyruvate [ic] pionibacterium shermanii catalyzes the formation of P- enolpyruvate, AMP, and inorganic pyrophosphate from P-enolpyruvate synthase of Escherichia coli, which catalyzes pyruvate, ATP, and orthophosphate; the mechanism reaction 2, likewise uses a mechanism that does not involve a involves three partial reactions and three forms of the enzyme: pyrophosphoryl-enzyme, phosphoryl-enzyme, stable, free diphosphoryl-enzyme (3). and free enzyme. The phosphoryl-enzyme was prepared by -- AMP Pi incubation with P-enolpyruvate and isolated by gel- ATP + pyruvate P-enolpyruvate + + [2] chromatography. The phosphoryl-enzyme was converted These observations led us to reinvestigate the validity of the to 32P31P-enzyme and [32P]Pi by incubation with [32P]PPi; 1 mol of pyrophosphoryl-enzyme was formed per mol of Evans-Wood mechanism. Steady-state and exchange kinetics enzyme of molecular weight 150,000. The labeled enzyme have shown clearly that the pyruvate, phosphate dikinase of released its radioactivity upon incubation with Pi or propionibacteria proceeds via a tri(uni,uni) ping-pong se- AMP to produce the expected [33PJPPi or [y-y3P]ATP, re- quence, as expected from the Evans-Wood mechanism (4). We spectively. Hydrolysis of the pyrophosphoryl-enzyme with here the isolation of the form of the dilute acid yielded PPi. The #,'y-methylene analogue of report pyrophosphoryl ATP was reactive in exchange reactions with [14C]AMP. To enzyme. our knowledge, this is the first proven example of a pyro- phosphoryl-enzyme. METHODS Pyruvate, phosphate dikinase catalyzes the following overall Materials. Radiochemicals were purchased from New reaction England Nuclear, including Na4 2P207, 1770 Ci/mol; diam- monium [U-_4C]AMP; 422 Ci/mol; and [3-'4C]sodium ATP + pyruvate + Pi i. AMP pyruvate, 5 Ci/mol. [3-14C]P-enolpyruvate was synthesized + P-enolpyruvate + PPi [1] by incubation of the above [3-14C]pyruvate with pyruvate, phosphate dikinase, ATP, Pi, Mg++, NH4+, and inorganic Evans and Wood (1) have presented evidence by deter- pyrophosphatase. [14C]PEP was purified by chromatography mination of the requirements for exchange reactions that the on QAE-Sephadex-A25 (Pharmacia), as described in Fig. 3. mechanism involves three partial reactions: Lithium afl-methylene adenosine-5'-tetraphosphate (AP- CH2PPP); lithium ap-methylene-adenosine 5'-triphosphate Enzyme + ATP ¢± enzyme-P-O-P + AMP [la] (APCH2PP); and #,,y-methylene-adenosine 5'-triphosphoric acid (APPCH2P) were obtained from Milles Laboratories Enzyme-P-O-P + Pi T± enzyme-P + PPi [lbJ Inc. Na2ATP, NaAMP, P-enolpyruvate tricyclohexylamine, and sodium pyruvate were purchased from Sigma Chemical, Enzyme-P + pyruvate >z. enzyme + P-enolpyruvate [lc I Co. All other chemicals were of analytical grade from various They also succeeded in isolating the phosphoryl-enzyme firms. by incubation of the enzyme with [12PJP-enolpyruvate, and Protein was estimated by the modified biuret procedure chromatography on Sephadex G-50. In addition, they showed (5), with bovine serum albumin as a standard. that the distribution of 82p from various labeled substrates into products was in agreement with the above mechanism. Equilibrium Exchange Rates were calculated by the method However, an attempt to isolate the pyrophosphoryl-enzyme used by Yagil and Hoberman (6). by incubation of pyruvate, phosphate dikinase with [-y- Radioactivity Measurements were made by liquid scintilla- 12P]ATP failed for unknown reasons (1). tion on excised portions of paper chromatograms with a The pyruvate, phosphate dikinase from plants, on the Nuclear Chicago Unilux I Counter. other hand, uses (2) only two partial reactions, and a diphos- phorylated form of the enzyme was not implicated: Assay of Pyruvate, Phosphate Dikinase. The mixture at 250 in a total volume of 0.5 ml contained: 30 mM Tris-malate Enzyme + ATP + Pi :± enzyme-P + AMP + PPi [ld] buffer (pH = 6.7), 16 mM MgCl2, 2.4 mM P-enolpyruvate, 6 mM PPi, 4 mM AMP, and proper dilutions of the enzyme. * This is paper III in the series, "Pyruvate, phosphate dikinase," The reaction was terminated by addition of 0.3 ml of dinitro- Numbers I and II are refs. 1 and 7. phenylhydrazine reagent (0.1% in 2 N HCl), followed by 2463 Downloaded by guest on September 29, 2021 2464 Biochemistry: Milner and Wood Proc. Nat. Acad. Sci. USA 69 (1972) incubation for 15 min at room temperature. The amount of pyruvate formed was estimated I dinitrophenylhydrazone at 415 nm in a Gilford 300 spectrophotometer after addition E of 0.2 ml of water (6415 = 1 1 X 106). Ie* 70 Purification of Pyruvate, Phosphate Dikinase. The enzyme ,, E 50 1.0- E was purified essentially as described by Evans and Wood _"I 0.8- O (7) from Propionibacterium shermanii grown on a glycerol- 0'CL 'E. 'E 3 0 0.6- a. yeast extract medium. It had a specific activity of 1.0 E = 0.48 W (Amol/ min per mg), and the purity was about 50% as judged by IE10 0.2 E acrylamide gel electrophoresis in the presence of sodium do- 8 l2 16 20 24 28 decyl sulfate. The molecular weight was about 150,000 by FRACTION N2 gel filtration. Accordingly, 1 nmol of enzyme was equivalent FIG. 1. Isolation of pyrophosphoryl-pyruvate, phosphate to 0.3 mg of protein (0.3 units of enzyme). dikinase. Phosphoryl-enzyme (0.88 nmol, 0.26 mg of protein) in 2.0 ml containing 200 nmol of [32P]PPi (3.3 X 101 cpm/nmol), Preparation and Isolation of the Phosphoryl-Enzyme. This 2 jsmol of MgCI2, 10 umol of (NH4)2SO4, and 15 ,mol of Tris-malate form of the enzyme was prepared by reversal of reaction lc. (pH 6.9) was incubated for 8 min at 250, then passed through a The enzyme (155 nmol, about 46 mg of protein) in 2.0 ml 1.1 X 55 cm Sephadex B-50 (fine) column equilibrated with final volume, containing 160 nmol of [3-14C]P-enolpyruvate 15 mM Tris-malate (pH = 6.9), 1 mM MgCl2, 0.3 mM EDTA, (2.14 X 103 cpm/nmol), 2 ,umol of MgCl2, 5 Jmol of (NH4)2- enzyme was same 0.1 mM 2-mercaptoethanol. The eluted with the SO4, and 15 ,umol of Tris-malate (pH = 6.9) was incubated buffer, at the rate of 8 ml/hr per cm2. 1.85-ml fractions were for 15 min at 250. The mixture was then passed through a collected. 32p incorporated into the enzyme was calculated from Sephadex G-50 column (1.1 X 55 cm) equilibrated in 15 mM the specific activity of the ["2P]PPi (3.3 X 106 cpm/nmol) and Tris-malate (pH = 6.9), 2 mM MgC12, 0.5 mM EDTA, the units of enzyme (1 unit = 0.3 nmol of enzyme). For example, the peak fraction (no. 11) had 32.5 X 104 cpm/ml and 0.071 0.1 mM 2-mercaptoethanol. No radioactivity was found in units/ml. Thus, 0.2 nmol of Pi were incorporated (32.5 X 104/ the enzymatic peak, showing that P-enolpyruvate was not at- 1.65 X 106) into 0.24 nmol (0.071/0.3) of enzyme. The value of tached to the protein. Separate tests showed that [4C ]- 1.65 X 106 is used in these calculations because the specific pyruvate was released in an amount about equivalent to activity of Pi would be half that of the PPi. the nmol of enzyme present. The phosphoryl enzyme is rel- atively stable, and was kept frozen as a stock solution for further experiments. RESULTS Formation of P-Enolpyruvate from Phosphoryl-Enzyme TABLE 1. Distribution of radioactivity from and Pyruvate. According to reaction lc, phosphoryl-enzyme pyruvate should [I2P]pyrophosphoryl-enzyme after paper chromatography plus yield P-enolpyruvate. Phosphoryl- of hydrolyzed and unhydrolyzed ["2P]pyrophosphoryl-enzyme enzyme (20 nmol, about 6.0 mg of protein) was incubated for 5 min at 250 in 1 ml of 15 mM Tris-malate (pH 6.9), Pi PPi P of origin 1 mM MgCl2, 0.25 mM EDTA, 0.05 mM 2-mercaptoethanol containing 2.0 ,mol of [3-14C]pyruvate (3.85 X 103 cpm/ nmol). 5 uA was spotted on paper, and the pyruvate and P- nmol nmol nmol enolpyruvate were separated; their radioactivities were de- Enzyme cpm enzyme cpm enzyme cpm enzyme termined. 308 cpm was found in the P-enolpyruvate spot, 25 ,dI, or 61,500 cpm for the 1.0 ml of reaction mixture. Thus, there Treated was conversion of 16 nmol of pyruvate to P-enolpyruvate, with equivalent to 80% of the 20 nmol of phosphoryl-enzyme. HCl 798 0.11 4520 0.62 485 0.07 10 ,uA, Formation of the Pyrophosphoryl-Enzyme. This form of Not the enzyme was prepared by reversal of reaction lb by in- treated 286 0.08 1000 0.27 1560 0.42 cubation of phosphoryl-enzyme with [32P]PPi and isolation of the labeled enzyme by chromatography on Sephadex G-50. Enzyme (5.9 pmol) in 25 Al of fraction 11 of Fig. 1 was incubated The radioactivity and enzymatic activity were determined; with 25 ul of 0.02 N HCl for 6.0 hr at 21°, and 40 1Al was spotted the elution profiles are shown in Fig. 1. The mol of P incor- on a cellulose 6065 while thin-layer plate (Eastman, sheets) porated per mol of enzyme was essentially constant, and continuously being dried with an air stream.
Load more

Recommended publications
  • TRYPTOPHANYL TRANSF'er RNA SYNTHETASE and EXPRESSION of the TRYPTOPHAN OPERON in the Trp8 MUTANTS of ESCHERICHIA COLI I N Additi
    TRYPTOPHANYL TRANSF'ER RNA SYNTHETASE AND EXPRESSION OF THE TRYPTOPHAN OPERON IN THE trp8 MUTANTS OF ESCHERICHIA COLI KOREAKI ITO, SOTA HIRAGA AND TAKASHI WRA Institute for Virus Research, Kyoto Uniuersity, Kyoto, Japan Received November 15, 1968 INaddition to their role in protein synthesis, aminoacyl tRNA synthetases in bacteria have been shown to have a regulatory role in the formation of enzymes involved in the synthesis of corresponding amino acids. This has been demon- strated at least in the case of isoleucine and valine (EIDLICand NEIDHARDT1965; YANIV,JACOB and GROS1965) and histidine (SCHLESINGERand MAGASANIK1964; ROTH, ANTONand HARTMAN1966; ROTH and AMES1966). Transfer RNA (tRNA) also appears to be involved in the regulation of these systems (FREUND- LICH 1967; SILBERT,FINK and AMES1966). The expression of the genes determining the tryptophan biosynthetic enzymes, the tryptophan operon in Escherichia coli, is subject to repression by excess L-tryptophan, the end product of the pathway. The mutants of a regulatory gene, trpR, located outside of this operon, exhibit constitutive synthesis of the biosyn- thetic enzymes (COHENand JACOB1959). In addition, we have previously reported tryptophan auxotrophic mutants in which the known structural genes of the tryptophan operon remain intact. One of these mutants, designated trpiS5, has been mapped near strA on the chromosome (HIRAGA,ITO, HAMADA and YURA 1967a). In the present paper, we report on further characterization of the trpS5 mutant and discuss the possible role of the trpS gene in the regulation of the tryptophan operon. The results suggest that trpS, located between strA and maZA, is the structural gene for tryptophanyl tRNA synthetase, and that tryptophanyl tRNA synthetase is somehow involved in the repression of the tryptophan operon.
    [Show full text]
  • Indications for a Central Role of Hexokinase Activity in Natural Variation of Heat Acclimation in Arabidopsis Thaliana
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 14 June 2020 doi:10.20944/preprints202006.0169.v1 Article Indications for a central role of hexokinase activity in natural variation of heat acclimation in Arabidopsis thaliana Vasil Atanasov §, Lisa Fürtauer § and Thomas Nägele * LMU Munich, Plant Evolutionary Cell Biology, Großhaderner Str. 2-4, 82152 Planegg, Germany § Authors contributed equally * Correspondence: [email protected] Abstract: Diurnal and seasonal changes of abiotic environmental factors shape plant performance and distribution. Changes of growth temperature and light intensity may vary significantly on a diurnal, but also on a weekly or seasonal scale. Hence, acclimation to a changing temperature and light regime is essential for plant survival and propagation. In the present study, we analyzed photosynthetic CO2 assimilation and metabolic regulation of the central carbohydrate metabolism in two natural accessions of Arabidopsis thaliana originating from Russia and south Italy during exposure to heat and a combination of heat and high light. Our findings indicate that it is hardly possible to predict photosynthetic capacities to fix CO2 under combined stress from single stress experiments. Further, capacities of hexose phosphorylation were found to be significantly lower in the Italian than in the Russian accession which could explain an inverted sucrose-to-hexose ratio. Together with the finding of significantly stronger accumulation of anthocyanins under heat/high light these observations indicate a central role of hexokinase activity in stabilization of photosynthetic capacities within a changing environment. Keywords: photosynthesis; carbohydrate metabolism; hexokinase; heat acclimation; environmental changes; natural variation; high light; combined stress. 1. Introduction Changes of growth temperature and light intensity broadly affect plant molecular, physiological and developmental processes.
    [Show full text]
  • Labeled in Thecourse of Glycolysis, Since Phosphoglycerate Kinase
    THE STATE OF MAGNESIUM IN CELLS AS ESTIMATED FROM THE ADENYLATE KINASE EQUILIBRIUM* BY TRWIN A. RoSE THE INSTITUTE FOR CANCER RESEARCH, PHILADELPHIA Communicated by Thomas F. Anderson, August 30, 1968 Magnesium functions in many enzymatic reactions as a cofactor and in com- plex with nucleotides acting as substrates. Numerous examples of a possible regulatory role of Mg can be cited from studies with isolated enzymes,'- and it is known that Mg affects the structural integrity of macromolecules such as trans- fer RNA" and functional elements such as ribosomes.'0 The major problem in translating this information on isolated preparations to the functioning cell is the difficulty in determining the distribution of Mg and the nucleotides among the free and complexed forms that function in the region of the cell for which this information is desired. Nanningall based an attempt to calculate the free Mg2+ and Ca2+ ion concentrations of frog muscle on the total content of these metals and of the principal known ligands (adenosine 5'-triphosphate (ATP), creatine-P, and myosin) and the dissociation constants of the complexes. However, this method suffers from the necessity of evaluating the contribution of all ligands as well as from the assumption that all the known ligands are contributing their full complexing capacity. During studies concerned with the control of glycolysis in red cells and the control of the phosphoglycerate kinase step in particular, it became important to determine the fractions of the cell's ATP and adenosine 5'-diphosphate (ADP) that were present as Mg complexes. Just as the problem of determining the distribution of protonated and dissociated forms of an acid can be solved from a knowledge of pH and pKa of the acid, so it would be possible to determine the liganded and free forms of all rapidly established Mg complexes from a knowledge of Mg2+ ion concentration and the appropriate dissociation constants.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • S42003-019-0587-Z.Pdf
    Corrected: Author Correction ARTICLE https://doi.org/10.1038/s42003-019-0587-z OPEN High-resolution crystal structure of human asparagine synthetase enables analysis of inhibitor binding and selectivity Wen Zhu 1,10, Ashish Radadiya 1, Claudine Bisson2,10, Sabine Wenzel 3, Brian E. Nordin4,11, 1234567890():,; Francisco Martínez-Márquez3, Tsuyoshi Imasaki 3,5, Svetlana E. Sedelnikova2, Adriana Coricello 1,6,7, Patrick Baumann 1, Alexandria H. Berry8, Tyzoon K. Nomanbhoy4, John W. Kozarich 4, Yi Jin 1, David W. Rice 2, Yuichiro Takagi 3 & Nigel G.J. Richards 1,9 Expression of human asparagine synthetase (ASNS) promotes metastatic progression and tumor cell invasiveness in colorectal and breast cancer, presumably by altering cellular levels of L-asparagine. Human ASNS is therefore emerging as a bona fide drug target for cancer therapy. Here we show that a slow-onset, tight binding inhibitor, which exhibits nanomolar affinity for human ASNS in vitro, exhibits excellent selectivity at 10 μM concentration in HCT- 116 cell lysates with almost no off-target binding. The high-resolution (1.85 Å) crystal structure of human ASNS has enabled us to identify a cluster of negatively charged side chains in the synthetase domain that plays a key role in inhibitor binding. Comparing this structure with those of evolutionarily related AMP-forming enzymes provides insights into intermolecular interactions that give rise to the observed binding selectivity. Our findings demonstrate the feasibility of developing second generation human ASNS inhibitors as lead compounds for the discovery of drugs against metastasis. 1 School of Chemistry, Cardiff University, Cardiff, UK. 2 Department of Molecular Biology and Biotechnology, University of Sheffield, Sheffield, UK.
    [Show full text]
  • Novel Derivatives of Nicotinamide Adenine Dinucleotide (NAD) and Their Biological Evaluation Against NAD- Consuming Enzymes
    Novel derivatives of nicotinamide adenine dinucleotide (NAD) and their biological evaluation against NAD- Consuming Enzymes Giulia Pergolizzi University of East Anglia School of Pharmacy Thesis submitted for the degree of Doctor of Philosophy July, 2012 © This copy of the thesis has been supplied on condition that anyone who consults it is understood to recognise that its copyright rests with the author and that use of any information derived there from must be in accordance with current UK Copyright Law. In addition, any quotation or extract must include full attribution. ABSTRACT Nicotinamide adenine dinucleotide (β-NAD+) is a primary metabolite involved in fundamental biological processes. Its molecular structure with characteristic functional groups, such as the quaternary nitrogen of the nicotinamide ring, and the two high- energy pyrophosphate and nicotinamide N-glycosidic bonds, allows it to undergo different reactions depending on the reactive moiety. Well known as a redox substrate owing to the redox properties of the nicotinamide ring, β-NAD+ is also fundamental as a substrate of NAD+-consuming enzymes that cleave either high-energy bonds to catalyse their reactions. In this study, a panel of novel adenine-modified NAD+ derivatives was synthesized and biologically evaluated against different NAD+-consuming enzymes. The synthesis of NAD+ derivatives, modified in position 2, 6 or 8 of the adenine ring with aryl/heteroaryl groups, was accomplished by Suzuki-Miyaura cross-couplings. Their biological activity as inhibitors and/or non-natural substrates was assessed against a selected range of NAD+-consuming enzymes. The fluorescence of 8-aryl/heteroaryl NAD+ derivatives allowed their use as biochemical probes for the development of continuous biochemical assays to monitor NAD+-consuming enzyme activities.
    [Show full text]
  • Review Galactokinase: Structure, Function and Role in Type II
    CMLS, Cell. Mol. Life Sci. 61 (2004) 2471–2484 1420-682X/04/202471-14 DOI 10.1007/s00018-004-4160-6 CMLS Cellular and Molecular Life Sciences © Birkhäuser Verlag, Basel, 2004 Review Galactokinase: structure, function and role in type II galactosemia H. M. Holden a,*, J. B. Thoden a, D. J. Timson b and R. J. Reece c,* a Department of Biochemistry, University of Wisconsin, Madison, Wisconsin 53706 (USA), Fax: +1 608 262 1319, e-mail: [email protected] b School of Biology and Biochemistry, Queen’s University Belfast, Medical Biology Centre, 97 Lisburn Road, Belfast BT9 7BL, (United Kingdom) c School of Biological Sciences, The University of Manchester, The Michael Smith Building, Oxford Road, Manchester M13 9PT, (United Kingdom), Fax: +44 161 275 5317, e-mail: [email protected] Received 13 April 2004; accepted 7 June 2004 Abstract. The conversion of beta-D-galactose to glucose unnatural sugar 1-phosphates. Additionally, galactoki- 1-phosphate is accomplished by the action of four en- nase-like molecules have been shown to act as sensors for zymes that constitute the Leloir pathway. Galactokinase the intracellular concentration of galactose and, under catalyzes the second step in this pathway, namely the con- suitable conditions, to function as transcriptional regula- version of alpha-D-galactose to galactose 1-phosphate. tors. This review focuses on the recent X-ray crystallo- The enzyme has attracted significant research attention graphic analyses of galactokinase and places the molecu- because of its important metabolic role, the fact that de- lar architecture of this protein in context with the exten- fects in the human enzyme can result in the diseased state sive biochemical data that have accumulated over the last referred to as galactosemia, and most recently for its uti- 40 years regarding this fascinating small molecule ki- lization via ‘directed evolution’ to create new natural and nase.
    [Show full text]
  • Hemolytic Anemia with Impaired Hexokinase Activity
    Hemolytic anemia with impaired hexokinase activity Alan S. Keitt J Clin Invest. 1969;48(11):1997-2007. https://doi.org/10.1172/JCI106165. Research Article Analyses of key glycolytic intermediates in freshly drawn red cells from six related individuals suggest that decreased hexokinase activity underlies the hemolytic process in the two members with overt hemolysis. Low red cell glucose 6- phosphate (G6P) was observed not only in the anemic patients but in the presumptive heterozygotes as well and served as a useful marker for the presence of the trait. Hexokinase activity was labile in distilled water hemolysates but was only slightly low when protected by glucose, mercaptoethanol, and ethylenediaminetetraacetate (EDTA). Normal red cell hexokinase was demonstrated to be dependent on glucose for maintenance of activity after heating to 45°C. The cells of the proposita are unable to utilize glucose efficiently at glucose concentrations lower than 0.2 mmole/liter whereas normal cells maintain linear glucose consumption to at least 0.05 mM glucose. These qualitative abnormalities could result from the presence of a mutant hexokinase with an abnormally reactive sulfhydryl group and altered substrate affinity in the red cells of this kindred. Find the latest version: https://jci.me/106165/pdf Hemolytic Anemia with Impaired Hexokinase Activity ALAN S. KErrr From the Department of Medicine, University of Florida College of Medicine, Gainesville, Florida 32601 A B S T R A C T Analyses of key glycolytic intermediates cells of a young girl with moderately severe chronic in freshly drawn red cells from six related individuals anemia. Although hexokinase activity was only slightly suggest that decreased hexokinase activity underlies the below the range of normal, a comparison between the hemolytic process in the two members with overt he- activity of red cell hexokinase in the affected proposita molysis.
    [Show full text]
  • Hexokinase Isozyme Patterns of Experimental Hepatomas of Rats1
    [CANCER RESEARCH 29, 1437-1446, July 1969] Hexokinase Isozyme Patterns of Experimental Hepatomas of Rats1 ••'<-*,V*:te¿-v*:.'J'. Shigeaki Sato, Taijiro Matsushima, and Takashi Sugimura Biochemistry Division, National Cancer Center Research Institute, Tsukiji, Chuo-ku, Tokyo, Japan SUMMARY tive factor for the rate of glycolysis in various tumor strains (29). Meanwhile Gonzalez et al. (6) in 1964 separated rat liver Hexokinase isozymes in rat tissues were electrophoretically hexokinase into four types with diethylaminoethyl cellulose separated on cellulose acetate membrane. The method was column chromatography. Katzen and Schimke (12) in 1965 very quick and gave reproducible results. By using this succeeded in separating four types of hexokinase in rat tissues method, hexokinase isozyme patterns were studied on normal with starch gel electrophoresis and mentioned the presence of rat liver and experimental hepatomas with differing growth the specific isozyme pattern in the specific tissue. Following rates and degrees of differentiation. these pioneering works, the hexokinase isozyme patterns of In normal rat liver, the hexokinase pattern obtained on cellu many tissues, including human materials, have been elucidated, lose acetate membrane was identical with that obtained on and the enzymatic properties of each type of isozyme have starch gel by previous workers. There were four types of hexo- been studied (3, 7, 10, 23). While many papers on isozyme kinases, which corresponded to Types I, II, III, and IV hexo- patterns of hexokinase in the normal tissues have been pub kinases according to Katzen and Schimke, in order of increas lished, there have been only recent reports by Gumaa and ing mobility from the origin to the anode.
    [Show full text]
  • Quantification of Pyrophosphate in Soil Solution by Pyrophosphatase
    Soil Biology & Biochemistry 74 (2014) 95e97 Contents lists available at ScienceDirect Soil Biology & Biochemistry journal homepage: www.elsevier.com/locate/soilbio Short communication Quantification of pyrophosphate in soil solution by pyrophosphatase hydrolysis Kasper Reitzel a,*, Benjamin L. Turner b a Department of Biology, University of Southern Denmark, Campusvej 55, 5230 Odense M, Denmark b Smithsonian Tropical Research Institute, Apartado 0843-03092, Balboa, Ancon, Panama article info abstract Article history: A commercial pyrophosphatase from Saccharomyces cerevisiae selectively hydrolyzed sodium pyro- Received 20 December 2013 phosphate, but showed no significant activity towards a range of other organic and condensed inorganic Received in revised form phosphorus compounds. Pyrophosphate determined by pyrophosphatase hydrolysis accounted for 8 February 2014 38 Æ 12% (mean Æ standard error of 19 sites) of the non-reactive phosphorus in soil solution obtained by Accepted 3 March 2014 centrifugation from a series of lowland tropical rain forest soils. Pyrophosphate concentrations were up Available online 17 March 2014 À to 89 mgPl 1 and correlated positively with microbial phosphorus, soil solution pH, and native phos- phomonoesterase activity in soil solution, but not with total soil pyrophosphate determined by NaOH Keywords: e 31 Pyrophosphate EDTA extraction and solution P NMR spectroscopy. In summary, we identify pyrophosphate as a major Phosphatase constituent of soil solution phosphorus in lowland tropical rain forests, and demonstrate that a com- Soil solution mercial pyrophosphatase can be used as a selective tool to quantify trace concentrations of pyrophos- Phosphorus phate in soil solution. Tropical forests Ó 2014 Elsevier Ltd. All rights reserved. Pyrophosphate is ubiquitous in soils, where it appears to origi- Bünemann, 2008).
    [Show full text]
  • The Oleaginous Astaxanthin-Producing Alga
    Zhang et al. Biotechnol Biofuels (2021) 14:119 https://doi.org/10.1186/s13068-021-01969-z Biotechnology for Biofuels REVIEW Open Access The oleaginous astaxanthin-producing alga Chromochloris zofngiensis: potential from production to an emerging model for studying lipid metabolism and carotenogenesis Yu Zhang, Ying Ye, Fan Bai and Jin Liu* Abstract The algal lipids-based biodiesel, albeit having advantages over plant oils, still remains high in the production cost. Co-production of value-added products with lipids has the potential to add benefts and is thus believed to be a promising strategy to improve the production economics of algal biodiesel. Chromochloris zofngiensis, a unicellular green alga, has been considered as a promising feedstock for biodiesel production because of its robust growth and ability of accumulating high levels of triacylglycerol under multiple trophic conditions. This alga is also able to synthesize high-value keto-carotenoids and has been cited as a candidate producer of astaxanthin, the strongest antioxidant found in nature. The concurrent accumulation of triacylglycerol and astaxanthin enables C. zofngiensis an ideal cell factory for integrated production of the two compounds and has potential to improve algae-based production economics. Furthermore, with the advent of chromosome-level whole genome sequence and genetic tools, C. zofngiensis becomes an emerging model for studying lipid metabolism and carotenogenesis. In this review, we summarize recent progress on the production of triacylglycerol and astaxanthin by C. zofngiensis. We also update our understanding in the distinctive molecular mechanisms underlying lipid metabolism and carotenogenesis, with an emphasis on triacylglycerol and astaxanthin biosynthesis and crosstalk between the two pathways.
    [Show full text]
  • Downregulation of Carnitine Acyl-Carnitine Translocase by Mirnas
    Page 1 of 288 Diabetes 1 Downregulation of Carnitine acyl-carnitine translocase by miRNAs 132 and 212 amplifies glucose-stimulated insulin secretion Mufaddal S. Soni1, Mary E. Rabaglia1, Sushant Bhatnagar1, Jin Shang2, Olga Ilkayeva3, Randall Mynatt4, Yun-Ping Zhou2, Eric E. Schadt6, Nancy A.Thornberry2, Deborah M. Muoio5, Mark P. Keller1 and Alan D. Attie1 From the 1Department of Biochemistry, University of Wisconsin, Madison, Wisconsin; 2Department of Metabolic Disorders-Diabetes, Merck Research Laboratories, Rahway, New Jersey; 3Sarah W. Stedman Nutrition and Metabolism Center, Duke Institute of Molecular Physiology, 5Departments of Medicine and Pharmacology and Cancer Biology, Durham, North Carolina. 4Pennington Biomedical Research Center, Louisiana State University system, Baton Rouge, Louisiana; 6Institute for Genomics and Multiscale Biology, Mount Sinai School of Medicine, New York, New York. Corresponding author Alan D. Attie, 543A Biochemistry Addition, 433 Babcock Drive, Department of Biochemistry, University of Wisconsin-Madison, Madison, Wisconsin, (608) 262-1372 (Ph), (608) 263-9608 (fax), [email protected]. Running Title: Fatty acyl-carnitines enhance insulin secretion Abstract word count: 163 Main text Word count: 3960 Number of tables: 0 Number of figures: 5 Diabetes Publish Ahead of Print, published online June 26, 2014 Diabetes Page 2 of 288 2 ABSTRACT We previously demonstrated that micro-RNAs 132 and 212 are differentially upregulated in response to obesity in two mouse strains that differ in their susceptibility to obesity-induced diabetes. Here we show the overexpression of micro-RNAs 132 and 212 enhances insulin secretion (IS) in response to glucose and other secretagogues including non-fuel stimuli. We determined that carnitine acyl-carnitine translocase (CACT, Slc25a20) is a direct target of these miRNAs.
    [Show full text]