DOCSLIB.ORG

Pyruvate,Phosphate Dikinase from Bacteroides Symbiosus by RICHARD E

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Pyruvate,Phosphate Dikinase from Bacteroides Symbiosus by RICHARD E Biochem. J. (1971) 125, 531-539 531 Printed in Great Britain Pyruvate,Phosphate Dikinase from Bacteroides symbiosus By RICHARD E. REEVES Department of Biochemi8try, Loui8iana State Univer&Uy School of Medicine, New Orleans, La. 70112, U.S.A. (Received 9 July 1971) 1. An improved method is given for preparation of pyruvate,phosphate dikinase from Bacteroidec 8ymbio8sq. 2. The bacterial enzyme is stable, free from interfering enzyme activities, and does not require thiol compounds to maintain stability during storage or assay. 3. New direct assays of enzyme activity are based on acid evolution or consumption as measured at constant pH in apH-stat. 4. The optimum rate of reaction in the direction of pyruvate formation occurs at about pH 6.4; in the direction of phosphoenolpyruvate formation, it is at pH 7.2-7.8. 5. Newly determined substrate Km values for the enzyme are: AMP, 3.5 x 10-6M; ATP, 1 X 10-4M; pyruvate, 8 x 10-5M; Pi, 6 x 10-4M. 6. K+ may substitute for NH4+ in activating the reaction catalysed by the B. symbio&wu enzyme. 7. In the direction ofpyruvate formation the bivalent metal ion requirement ofthe enzyme is fulfilled by salts of nickel, manganese, magnesium and cobalt. In the other direction only magnesium salts were effective. 8. The nucleotide specificity of the enzyme is strictly limited to the adenine nucleotides. CTP and ITP strongly inhibit the reaction in the direction of phosphoenolpyruvate formation. The enzyme now called by the trivial name The present paper reports further work on the pyruvate,phosphate dikinase was first reported by preparation and properties of the enzyme from B. Hatch & Slack (1968) in plant sources. Reeves 8ymbio8u8. Enzyme from this source is very stable, (1968) found the enzyme in Entamoeba hi8tolytica. does not require thiols, and is readily prepared in Reeves, Menzies & Hsu (1968), Evans & Wood good yield in a state free from interfering enzyme (1968) and Benziman & Palgi (1970) identified it in activities. Additionally, methods of asay are bacterial sources. Reeves et al. (1968), working with introduced that are based on H+ consumption or the enzyme from Bacteroidec 8ymbio8u8, established evolution, according to the above equation. These that label from [32P]P? appears in the y-position methods avoid the restrictions imposed by linked- of ATP and labelled phosphate from phospho- enzyme systems and they offer advantages over enol pyruvate appears in the ,-position. They also fixed-term assays of enzyme products. found the observed equilibrium constant in the direction of pyruvate formation to be 1140 at pH 7 and that, over a wide pH range, it varied directly MATERIALS with the square of the H+ concentration. This indicates that two hydrogen ions are consumed or Bacteroides 8ymbio8su (A.T.C.C. 14940) was grown produced in the forward or reverse reactions, anaerobically in 400-litre lots at the Fermentation Plant of the Department of Biochemistry, University of Georgia, respectively. The reaction that occurs the pres- Athens, Ga., U.S.A. The medium contained (g/l): ence of Mg2+ was written as follows: Tryptone (Difoo-0123) (20), D-gluoose (10), yeast extract 2H+ +AMP2- + MgPP12- + phosphoenolpyruvate3 (Difoo) (2), NaCl (2.5), anhydrous K2HPO4 (1.5), mer- MgATP2-+P12-+pyruvate- captosuccinic acid (1.5), L-cysteine hydrochloride (0.79) and NaOH to pH7.0. Incubation was for 16-20h at Andrews & Hatch (1969) and Evans & Wood 370C. Cells were harvested on a Sharples supercentrifuge, (1971) have undertaken studies on the mechanism frozen in solid C02, and stored at -60°C until used. The of action of dikinase by using isotope-exchange yield of wet cell paste was approx. 5.7g/l. reactions. These workers noted certain difficulties Nucleoside mono- and tri-phosphates and the pyridine nucleotides were obtained from P-L Laboratories, with enzyme prepared from plant sources and Milwaukee, Wis., U.S.A. Sigma Chemical Co., St Louis, propionibacteria. The enzyme was cold-labile and Mo., U.S.A., supplied hexokinase, phosphoenolpyruvate required the presence of thiol compounds during (tricyclohexylammoniumsalt)andDEAE-eellulose. Lyso- storage and assay. zyme was from Nutritional Bioehemioals Inc., Cleveland, 532 R. E. REEVES 1971 Ohio, U.S.A. Bio-Gel P-300 was from Bio-Rad Labora- gradient achieved by allowing buffer containing 0.5m- tories, Richmond, Calif., U.S.A. Mercaptosuccinic acid NaCl to flow into the closed reservoir containing 600ml of and pyruvic acid were from Eastman Chemical Co., 75 mm-NaCl-buffer. The effluent was collected in frac- Rochester, N.Y., U.S.A. The pyruvic acid was distilled tions of 36ml. Enzyme was eluted immediately after the before use. Glucose 6-phosphate dehydrogenase and highly coloured material. Fractions 19-23 comprising lactate dehydrogenase were from Boehringer und Sohne, most of the enzyme peak were combined and dialysed Mannheim, Germany. Inorganic pyrophosphatase was against buffer. prepared from E8cherichia coli. Crude enzyme was The dialysed solution from the first column was placed prepared by the method of Blumenthal, Johnson & on a second column prepared from 20g of DEAE-cellulose, Johnson (1967). It was concentrated by vacuum dialysis similarly preconditioned. The enzyme solution was against lOmx-tris-HCl buffer, pH7.2, containing 1mM- applied and the column washed with 300 ml of the 75 mm- MgSO4. It was purified by chromatography on a column NaCl-buffer. Enzyme was eluted with a linear gradient containing BOg of Sephadex G-25 (Pharmacia), by elution prepared by allowing 600ml of0.4M-NaCl in buffer to flow with the same buffer. The peak fractions of enzyme from into an open reservoir containing an equal volume of the column were used. The inorganic pyrophosphatase 75mm-NaCl-buffer. Effluent was collected in 32ml was free from non-specific phosphatases. fractions. Enzyme appeared in fraction 14, immediately DEAE-cellulose was prepared for column use by after a slightly coloured material. Three fractions com- allowing 20g to sink in 1 litre of 1 m-NaOH. Then 750g of prising the enzyme peak were combined, and enzyme was cracked ice and 250ml of conc. HCI were added, with precipitated by stirring in solid (NH4)2SO4 (45g/100ml). cooling and stirring. The suspension, diluted to 4 litres The suspension was centrifuged in the cold and most ofthe with cold water, was washed by decantation until the supernatant solution was withdrawn and discarded. The free acid concentration fell below 0.01 m. Concentrated sediment was suspended in the remaining supernatant solutions of imidazole-HCl buffer, pH7, NH4C1, NaCI solution (11.5ml) and stored in the refrigerator. Portions and EDTA (sodium salt) were then added to final con- of this suspension were centrifuged. The sediment was centrations of 20, 20, 75 and 1 mm, respectively, and the dissolved in buffer, and dialysed twice against 300 vol. of suspension was adjusted to pH7 with NaOH. buffer. Such enzyme is referred to as enzyme from the second (NH4)2SO4 precipitation. A 4.5 ml portion ofthe above suspension was centrifuged. METHODS The sediment was dissolved in buffer and dialysed against 100vol. of buffer. This solution was placed on a column Enzyme assays were done at 25BC. The enzyme puri- prepared from lOg of Bio-Gel P-300 that had previously fication procedures were done at 0-40C except where been conditioned with SOOml of buffer. The sample otherwise noted. The buffer contained 20mm-imidazole volume was 6ml. It was eluted with buffer and collected base adjusted to pH7 with HCI, 20mm-NH4Cl and in 6ml fractions. Enzyme appeared in fractions 17-25. 1 mm-EDTA (sodium salt). All modifications of this Enzyme activity and E280 were parallel across the enzyme buffer are specifically noted in the text. peak. The Bio-Gel column was prepared and used at Extraction and purification of B. symbiosus dikinase. room temperature. This enzyme is referred to below as Frozen cells (107g) were thawed and washed by centri- column-purified enzyme. fugation with 1.5 litres of 0.15M-NaCl. The packed cells Enzyme a88ay8. Assay A. The standard enzyme assay were resuspended in 2 litres of buffer containing 5mM- was slightly modified from that described by Reeves et al. EDTA (sodium salt). The suspension was incubated at (1968). Cuvettes contained 50mM-imidazole-HCl buffer, 370C while 100mg of separately dissolved crystalline pH6.8; 5mM-MgCl2; 2OmM-NH4Cl; 1mm-AMP; lmM- lysozyme was added with stirring. Cell lysis was apparent phosphoenolpyruvate; 0.2 mM-NADH2; 4 units of lactate within 15min. After 35min the viscous suspension was dehydrogenase; and about 0.01 unit ofenzyme in a volume chilled in an ice bath and a solution containing lOg of of 0.39 ml. After monitoring the change in extinction at streptomycin base, as the sulphate, was added dropwise 340 nm for a few moments reaction was started by the with stirring. The suspension was centrifuged for 10min addition of 0.01 ml of 50mM-sodium pyrophosphate. The at 9000g and the sediment was discarded. To the super- final rate of extinction change was corrected for any rate natant solution was added 450g ofsolid (NH42004/1, with noted before the addition ofthe PP1. Such corrections were stirring. The precipitate was collected by centrifugation not needed with enzyme preparations obtained after the and redissolved in 204ml of buffer. stage of the second DEAE-cellulose-column step. One To the above solution was added sufficient 4M- unit ofenzyme activity is defined as the amount that would potassium acetate to make the concentration 0.05m with effect the oxidation of 1,mol of NADH2/min under the respect to acetate. The solution was chilled in an ice bath conditions of the assay. The molar extinction of NADH2 while 2m-acetic acid was added dropwise with stirring was taken to be 6.22 x 1031-molh-Icm-2 at 340nm.
Load more

Recommended publications
  • Indications for a Central Role of Hexokinase Activity in Natural Variation of Heat Acclimation in Arabidopsis Thaliana
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 14 June 2020 doi:10.20944/preprints202006.0169.v1 Article Indications for a central role of hexokinase activity in natural variation of heat acclimation in Arabidopsis thaliana Vasil Atanasov §, Lisa Fürtauer § and Thomas Nägele * LMU Munich, Plant Evolutionary Cell Biology, Großhaderner Str. 2-4, 82152 Planegg, Germany § Authors contributed equally * Correspondence: [email protected] Abstract: Diurnal and seasonal changes of abiotic environmental factors shape plant performance and distribution. Changes of growth temperature and light intensity may vary significantly on a diurnal, but also on a weekly or seasonal scale. Hence, acclimation to a changing temperature and light regime is essential for plant survival and propagation. In the present study, we analyzed photosynthetic CO2 assimilation and metabolic regulation of the central carbohydrate metabolism in two natural accessions of Arabidopsis thaliana originating from Russia and south Italy during exposure to heat and a combination of heat and high light. Our findings indicate that it is hardly possible to predict photosynthetic capacities to fix CO2 under combined stress from single stress experiments. Further, capacities of hexose phosphorylation were found to be significantly lower in the Italian than in the Russian accession which could explain an inverted sucrose-to-hexose ratio. Together with the finding of significantly stronger accumulation of anthocyanins under heat/high light these observations indicate a central role of hexokinase activity in stabilization of photosynthetic capacities within a changing environment. Keywords: photosynthesis; carbohydrate metabolism; hexokinase; heat acclimation; environmental changes; natural variation; high light; combined stress. 1. Introduction Changes of growth temperature and light intensity broadly affect plant molecular, physiological and developmental processes.
    [Show full text]
  • Labeled in Thecourse of Glycolysis, Since Phosphoglycerate Kinase
    THE STATE OF MAGNESIUM IN CELLS AS ESTIMATED FROM THE ADENYLATE KINASE EQUILIBRIUM* BY TRWIN A. RoSE THE INSTITUTE FOR CANCER RESEARCH, PHILADELPHIA Communicated by Thomas F. Anderson, August 30, 1968 Magnesium functions in many enzymatic reactions as a cofactor and in com- plex with nucleotides acting as substrates. Numerous examples of a possible regulatory role of Mg can be cited from studies with isolated enzymes,'- and it is known that Mg affects the structural integrity of macromolecules such as trans- fer RNA" and functional elements such as ribosomes.'0 The major problem in translating this information on isolated preparations to the functioning cell is the difficulty in determining the distribution of Mg and the nucleotides among the free and complexed forms that function in the region of the cell for which this information is desired. Nanningall based an attempt to calculate the free Mg2+ and Ca2+ ion concentrations of frog muscle on the total content of these metals and of the principal known ligands (adenosine 5'-triphosphate (ATP), creatine-P, and myosin) and the dissociation constants of the complexes. However, this method suffers from the necessity of evaluating the contribution of all ligands as well as from the assumption that all the known ligands are contributing their full complexing capacity. During studies concerned with the control of glycolysis in red cells and the control of the phosphoglycerate kinase step in particular, it became important to determine the fractions of the cell's ATP and adenosine 5'-diphosphate (ADP) that were present as Mg complexes. Just as the problem of determining the distribution of protonated and dissociated forms of an acid can be solved from a knowledge of pH and pKa of the acid, so it would be possible to determine the liganded and free forms of all rapidly established Mg complexes from a knowledge of Mg2+ ion concentration and the appropriate dissociation constants.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Review Galactokinase: Structure, Function and Role in Type II
    CMLS, Cell. Mol. Life Sci. 61 (2004) 2471–2484 1420-682X/04/202471-14 DOI 10.1007/s00018-004-4160-6 CMLS Cellular and Molecular Life Sciences © Birkhäuser Verlag, Basel, 2004 Review Galactokinase: structure, function and role in type II galactosemia H. M. Holden a,*, J. B. Thoden a, D. J. Timson b and R. J. Reece c,* a Department of Biochemistry, University of Wisconsin, Madison, Wisconsin 53706 (USA), Fax: +1 608 262 1319, e-mail: [email protected] b School of Biology and Biochemistry, Queen’s University Belfast, Medical Biology Centre, 97 Lisburn Road, Belfast BT9 7BL, (United Kingdom) c School of Biological Sciences, The University of Manchester, The Michael Smith Building, Oxford Road, Manchester M13 9PT, (United Kingdom), Fax: +44 161 275 5317, e-mail: [email protected] Received 13 April 2004; accepted 7 June 2004 Abstract. The conversion of beta-D-galactose to glucose unnatural sugar 1-phosphates. Additionally, galactoki- 1-phosphate is accomplished by the action of four en- nase-like molecules have been shown to act as sensors for zymes that constitute the Leloir pathway. Galactokinase the intracellular concentration of galactose and, under catalyzes the second step in this pathway, namely the con- suitable conditions, to function as transcriptional regula- version of alpha-D-galactose to galactose 1-phosphate. tors. This review focuses on the recent X-ray crystallo- The enzyme has attracted significant research attention graphic analyses of galactokinase and places the molecu- because of its important metabolic role, the fact that de- lar architecture of this protein in context with the exten- fects in the human enzyme can result in the diseased state sive biochemical data that have accumulated over the last referred to as galactosemia, and most recently for its uti- 40 years regarding this fascinating small molecule ki- lization via ‘directed evolution’ to create new natural and nase.
    [Show full text]
  • Hemolytic Anemia with Impaired Hexokinase Activity
    Hemolytic anemia with impaired hexokinase activity Alan S. Keitt J Clin Invest. 1969;48(11):1997-2007. https://doi.org/10.1172/JCI106165. Research Article Analyses of key glycolytic intermediates in freshly drawn red cells from six related individuals suggest that decreased hexokinase activity underlies the hemolytic process in the two members with overt hemolysis. Low red cell glucose 6- phosphate (G6P) was observed not only in the anemic patients but in the presumptive heterozygotes as well and served as a useful marker for the presence of the trait. Hexokinase activity was labile in distilled water hemolysates but was only slightly low when protected by glucose, mercaptoethanol, and ethylenediaminetetraacetate (EDTA). Normal red cell hexokinase was demonstrated to be dependent on glucose for maintenance of activity after heating to 45°C. The cells of the proposita are unable to utilize glucose efficiently at glucose concentrations lower than 0.2 mmole/liter whereas normal cells maintain linear glucose consumption to at least 0.05 mM glucose. These qualitative abnormalities could result from the presence of a mutant hexokinase with an abnormally reactive sulfhydryl group and altered substrate affinity in the red cells of this kindred. Find the latest version: https://jci.me/106165/pdf Hemolytic Anemia with Impaired Hexokinase Activity ALAN S. KErrr From the Department of Medicine, University of Florida College of Medicine, Gainesville, Florida 32601 A B S T R A C T Analyses of key glycolytic intermediates cells of a young girl with moderately severe chronic in freshly drawn red cells from six related individuals anemia. Although hexokinase activity was only slightly suggest that decreased hexokinase activity underlies the below the range of normal, a comparison between the hemolytic process in the two members with overt he- activity of red cell hexokinase in the affected proposita molysis.
    [Show full text]
  • Isolation of a Pyrophosphoryl Form of Pyruvate, Phosphate Dikinase from Propionibacteria* (Phosphoenolpyruvate/ATP/Enzyme) YORAM MILNER and HARLAND G
    Proc. Nat. Acad. Sci. USA Vol. 69, No. 9, pp. 2463-2468, September 1972 Isolation of a Pyrophosphoryl Form of Pyruvate, Phosphate Dikinase from Propionibacteria* (phosphoenolpyruvate/ATP/enzyme) YORAM MILNER AND HARLAND G. WOOD Department of Biochemistry, Case Western Reserve University School of Medicine, Cleveland, Ohio 44106 Contributed by Harland G. Wood, June 15, 1972 ABSTRACT Pyruvate, phosphate dikinase from Pro- Enzyme-P + pyruvate ;. enzyme + P-enolpyruvate [ic] pionibacterium shermanii catalyzes the formation of P- enolpyruvate, AMP, and inorganic pyrophosphate from P-enolpyruvate synthase of Escherichia coli, which catalyzes pyruvate, ATP, and orthophosphate; the mechanism reaction 2, likewise uses a mechanism that does not involve a involves three partial reactions and three forms of the enzyme: pyrophosphoryl-enzyme, phosphoryl-enzyme, stable, free diphosphoryl-enzyme (3). and free enzyme. The phosphoryl-enzyme was prepared by -- AMP Pi incubation with P-enolpyruvate and isolated by gel- ATP + pyruvate P-enolpyruvate + + [2] chromatography. The phosphoryl-enzyme was converted These observations led us to reinvestigate the validity of the to 32P31P-enzyme and [32P]Pi by incubation with [32P]PPi; 1 mol of pyrophosphoryl-enzyme was formed per mol of Evans-Wood mechanism. Steady-state and exchange kinetics enzyme of molecular weight 150,000. The labeled enzyme have shown clearly that the pyruvate, phosphate dikinase of released its radioactivity upon incubation with Pi or propionibacteria proceeds via a tri(uni,uni) ping-pong se- AMP to produce the expected [33PJPPi or [y-y3P]ATP, re- quence, as expected from the Evans-Wood mechanism (4). We spectively. Hydrolysis of the pyrophosphoryl-enzyme with here the isolation of the form of the dilute acid yielded PPi.
    [Show full text]
  • Hexokinase Isozyme Patterns of Experimental Hepatomas of Rats1
    [CANCER RESEARCH 29, 1437-1446, July 1969] Hexokinase Isozyme Patterns of Experimental Hepatomas of Rats1 ••'<-*,V*:te¿-v*:.'J'. Shigeaki Sato, Taijiro Matsushima, and Takashi Sugimura Biochemistry Division, National Cancer Center Research Institute, Tsukiji, Chuo-ku, Tokyo, Japan SUMMARY tive factor for the rate of glycolysis in various tumor strains (29). Meanwhile Gonzalez et al. (6) in 1964 separated rat liver Hexokinase isozymes in rat tissues were electrophoretically hexokinase into four types with diethylaminoethyl cellulose separated on cellulose acetate membrane. The method was column chromatography. Katzen and Schimke (12) in 1965 very quick and gave reproducible results. By using this succeeded in separating four types of hexokinase in rat tissues method, hexokinase isozyme patterns were studied on normal with starch gel electrophoresis and mentioned the presence of rat liver and experimental hepatomas with differing growth the specific isozyme pattern in the specific tissue. Following rates and degrees of differentiation. these pioneering works, the hexokinase isozyme patterns of In normal rat liver, the hexokinase pattern obtained on cellu many tissues, including human materials, have been elucidated, lose acetate membrane was identical with that obtained on and the enzymatic properties of each type of isozyme have starch gel by previous workers. There were four types of hexo- been studied (3, 7, 10, 23). While many papers on isozyme kinases, which corresponded to Types I, II, III, and IV hexo- patterns of hexokinase in the normal tissues have been pub kinases according to Katzen and Schimke, in order of increas lished, there have been only recent reports by Gumaa and ing mobility from the origin to the anode.
    [Show full text]
  • The Oleaginous Astaxanthin-Producing Alga
    Zhang et al. Biotechnol Biofuels (2021) 14:119 https://doi.org/10.1186/s13068-021-01969-z Biotechnology for Biofuels REVIEW Open Access The oleaginous astaxanthin-producing alga Chromochloris zofngiensis: potential from production to an emerging model for studying lipid metabolism and carotenogenesis Yu Zhang, Ying Ye, Fan Bai and Jin Liu* Abstract The algal lipids-based biodiesel, albeit having advantages over plant oils, still remains high in the production cost. Co-production of value-added products with lipids has the potential to add benefts and is thus believed to be a promising strategy to improve the production economics of algal biodiesel. Chromochloris zofngiensis, a unicellular green alga, has been considered as a promising feedstock for biodiesel production because of its robust growth and ability of accumulating high levels of triacylglycerol under multiple trophic conditions. This alga is also able to synthesize high-value keto-carotenoids and has been cited as a candidate producer of astaxanthin, the strongest antioxidant found in nature. The concurrent accumulation of triacylglycerol and astaxanthin enables C. zofngiensis an ideal cell factory for integrated production of the two compounds and has potential to improve algae-based production economics. Furthermore, with the advent of chromosome-level whole genome sequence and genetic tools, C. zofngiensis becomes an emerging model for studying lipid metabolism and carotenogenesis. In this review, we summarize recent progress on the production of triacylglycerol and astaxanthin by C. zofngiensis. We also update our understanding in the distinctive molecular mechanisms underlying lipid metabolism and carotenogenesis, with an emphasis on triacylglycerol and astaxanthin biosynthesis and crosstalk between the two pathways.
    [Show full text]
  • Name: Chem 465 Biochemistry II Test 1 Spring 2019 Multiple Choice (4 Points Apiece): 1. in an Anaerobic Muscle Preparation, Lact
    Name: Chem 465 Biochemistry II Test 1 Spring 2019 Multiple choice (4 points apiece): 1. In an anaerobic muscle preparation, lactate formed from glucose labeled in C-3 and C-4 would be labeled in: A) all three carbon atoms. B) only the carbon atom carrying the OH. C) only the carboxyl carbon atom. D) only the methyl carbon atom. E) the methyl and carboxyl carbon atoms. 2. In an anaerobic muscle preparation, lactate formed from glucose labeled in C-2 would be labeled in: A) all three carbon atoms. B) only the carbon atom carrying the OH. C) only the carboxyl carbon atom. D) only the methyl carbon atom. E) the methyl and carboxyl carbon atoms. 3. All of the following enzymes involved in the flow of carbon from glucose to lactate (glycolysis) are also involved in the reversal of this flow (gluconeogenesis) except: A) 3-phosphoglycerate kinase. B) aldolase. C) enolase. D) phosphofructokinase-1. E) phosphoglucoisomerase. 4. Cellular isozymes of pyruvate kinase are allosterically inhibited by: A) high concentrations of AMP. B) high concentrations of ATP. C) high concentrations of citrate. D) low concentrations of acetyl-CoA. E) low concentrations of ATP. 5. Which of the following is not true of the reaction catalyzed by the pyruvate dehydrogenase complex? A) Biotin participates in the decarboxylation. B) Both NAD+ and a flavin nucleotide act as electron carriers. C) The reaction occurs in the mitochondrial matrix. D) The substrate is held by the lipoyl-lysine "swinging arm." E) Two different cofactors containing -SH groups participate. 6. (20 points) This page is blank because I want you to fill it in with the glycolytic pathway from glucose to pyruvate showing the structure of all intermediates.
    [Show full text]
  • Inorganic Polyphosphates Regulate Hexokinase Activity and Reactive Oxygen Species Generation in Mito- Chondria of Rhipicephalus
    Int. J. Biol. Sci. 2013, Vol. 9 842 Ivyspring International Publisher International Journal of Biological Sciences 2013; 9(8):842-852. doi: 10.7150/ijbs.6628 Research Paper Inorganic Polyphosphates Regulate Hexokinase Activity and Reactive Oxygen Species Generation in Mito- chondria of Rhipicephalus (Boophilus) microplus Embryo Amanda Fraga1, Jorge Moraes1,2, José Roberto da Silva1,2, Evenilton P. Costa3, Jackson Menezes1,2, Itabajara da Silva Vaz Jr2,4, Carlos Logullo2,3, Rodrigo Nunes da Fonseca 1,2 and Eldo Campos1,2 1. Laboratório Integrado de Bioquímica—Hatisaburo Masuda, UFRJ, Polo Barreto, Av. São José do Barreto nº 764, São Jose do Barreto, CEP 27971-550, Macaé, RJ, Brazil; 2. Instituto Nacional de Ciência e Tecnologia—Entomologia Molecular, Rio de Janeiro, RJ, CEP 21941–590, Brazil; 3. Laboratório de Química e Função de Proteínas e Peptídeos and Unidade de Experimentação Animal–CBB–UENF, Avenida Alberto Lamego, 2000, Horto, Campos dos Goytacazes, RJ, CEP 28015–620, Brazil; 4. Centro de Biotecnologia e Faculdade de Veterinária, UFRGS, Avenida Bento Gonçalves, 9090, Porto Alegre, RS, C.P. 15005, CEP 91501–970, Brazil. Corresponding author: Tel.: +55-22-33993967. E-Mail address: [email protected] (E. Campos). © Ivyspring International Publisher. This is an open-access article distributed under the terms of the Creative Commons License (http://creativecommons.org/ licenses/by-nc-nd/3.0/). Reproduction is permitted for personal, noncommercial use, provided that the article is in whole, unmodified, and properly cited. Received: 2013.05.06; Accepted: 2013.08.08; Published: 2013.08.27 Abstract The physiological roles of polyphosphates (poly P) recently found in arthropod mitochondria remain obscure.
    [Show full text]
  • Substrate Specificity and Mechanism from the Structure of Pyrococcus
    doi:10.1016/j.jmb.2004.01.043 J. Mol. Biol. (2004) 337, 387–398 Substrate Specificity and Mechanism from the Structure of Pyrococcus furiosus Galactokinase Andrew Hartley1, Steven E. Glynn1, Vladimir Barynin1 Patrick J. Baker1, Svetlana E. Sedelnikova1, Corne´ Verhees2 Daniel de Geus2, John van der Oost2, David J. Timson3 Richard J. Reece4 and David W. Rice1* 1Krebs Institute, Department Galactokinase (GalK) catalyses the first step of the Leloir pathway of of Molecular Biology and galactose metabolism, the ATP-dependent phosphorylation of galactose Biotechnology, University to galactose-1-phosphate. In man, defects in galactose metabolism can of Sheffield, Sheffield S10 2TN result in disorders with severe clinical consequences, and deficiencies in UK galactokinase have been linked with the development of cataracts within the first few months of life. The crystal structure of GalK from Pyrococcus 2Laboratory of Microbiology furiosus in complex with MgADP and galactose has been determined to Wageningen University 2.9 A˚ resolution to provide insights into the substrate specificity and cata- Hesselink van Suchtelenweg 4 lytic mechanism of the enzyme. The structure consists of two domains NL-6703 CT Wageningen, The with the active site in a cleft at the domain interface. Inspection of the sub- Netherlands strate binding pocket identifies the amino acid residues involved in galac- 3Medical Biology Centre tose and nucleotide binding and points to both structural and mechanistic School of Biology and similarities with other enzymes of the GHMP kinase superfamily to which Biotechnology, Queen’s GalK belongs. Comparison of the sequence of the Gal3p inducer protein, University Belfast, 97 Lisburn which is related to GalK and which forms part of the transcriptional Road, Belfast BT9 7BL, UK activation of the GAL gene cluster in the yeast Saccharomyces cerevisiae, 4 has led to an understanding of the molecular basis of galactose and School of Biological Sciences nucleotide recognition.
    [Show full text]
  • Carbohydrate Kinases: a Conserved Mechanism Across Differing Folds
    catalysts Review Carbohydrate Kinases: A Conserved Mechanism Across Differing Folds Sumita Roy 1, Mirella Vivoli Vega 2 and Nicholas J. Harmer 1,* 1 Living Systems Institute, University of Exeter, Stocker Road, Exeter EX4 4QD, UK; [email protected] 2 Department of Biomedical Experimental and Clinical Sciences, University of Florence, Viale Morgagni 50, 50134 Florence, Italy; mirella.vivoli@unifi.it * Correspondence: [email protected]; Tel.: +44-1392-725179 Received: 2 November 2018; Accepted: 21 December 2018; Published: 2 January 2019 Abstract: Carbohydrate kinases activate a wide variety of monosaccharides by adding a phosphate group, usually from ATP. This modification is fundamental to saccharide utilization, and it is likely a very ancient reaction. Modern organisms contain carbohydrate kinases from at least five main protein families. These range from the highly specialized inositol kinases, to the ribokinases and galactokinases, which belong to families that phosphorylate a wide range of substrates. The carbohydrate kinases utilize a common strategy to drive the reaction between the sugar hydroxyl and the donor phosphate. Each sugar is held in position by a network of hydrogen bonds to the non-reactive hydroxyls (and other functional groups). The reactive hydroxyl is deprotonated, usually by an aspartic acid side chain acting as a catalytic base. The deprotonated hydroxyl then attacks the donor phosphate. The resulting pentacoordinate transition state is stabilized by an adjacent divalent cation, and sometimes by a positively charged protein side chain or the presence of an anion hole. Many carbohydrate kinases are allosterically regulated using a wide variety of strategies, due to their roles at critical control points in carbohydrate metabolism.
    [Show full text]