Characterization of Gene Expression Patterns in the Wild Pacific Salmon
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Ovulation-Selective Genes: the Generation and Characterization of an Ovulatory-Selective Cdna Library
531 Ovulation-selective genes: the generation and characterization of an ovulatory-selective cDNA library A Hourvitz1,2*, E Gershon2*, J D Hennebold1, S Elizur2, E Maman2, C Brendle1, E Y Adashi1 and N Dekel2 1Division of Reproductive Sciences, Department of Obstetrics and Gynecology, University of Utah Health Sciences Center, Salt Lake City, Utah 84132, USA 2Department of Biological Regulation, Weizmann Institute of Science, Rehovot, Israel (Requests for offprints should be addressed to N Dekel; Email: [email protected]) *(A Hourvitz and E Gershon contributed equally to this paper) (J D Hennebold is now at Division of Reproductive Sciences, Oregon National Primate Research Center, Oregon Health and Science University, Beaverton, Oregon 97006, USA) Abstract Ovulation-selective/specific genes, that is, genes prefer- (FAE-1) homolog, found to be localized to the inner entially or exclusively expressed during the ovulatory periantral granulosa and to the cumulus granulosa cells of process, have been the subject of growing interest. We antral follicles. The FAE-1 gene is a -ketoacyl-CoA report herein studies on the use of suppression subtractive synthase belonging to the fatty acid elongase (ELO) hybridization (SSH) to construct a ‘forward’ ovulation- family, which catalyzes the initial step of very long-chain selective/specific cDNA library. In toto, 485 clones were fatty acid synthesis. All in all, the present study accom- sequenced and analyzed for homology to known genes plished systematic identification of those hormonally with the basic local alignment tool (BLAST). Of those, regulated genes that are expressed in the ovary in an 252 were determined to be nonredundant. -
18S Rrna Is a Reliable Normalisation Gene for Real Time PCR Based On
Kuchipudi et al. Virology Journal 2012, 9:230 http://www.virologyj.com/content/9/1/230 METHODOLOGY Open Access 18S rRNA is a reliable normalisation gene for real time PCR based on influenza virus infected cells Suresh V Kuchipudi1*, Meenu Tellabati1, Rahul K Nelli1, Gavin A White2, Belinda Baquero Perez1, Sujith Sebastian1, Marek J Slomka3, Sharon M Brookes3, Ian H Brown3, Stephen P Dunham1 and Kin-Chow Chang1 Abstract Background: One requisite of quantitative reverse transcription PCR (qRT-PCR) is to normalise the data with an internal reference gene that is invariant regardless of treatment, such as virus infection. Several studies have found variability in the expression of commonly used housekeeping genes, such as beta-actin (ACTB) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), under different experimental settings. However, ACTB and GAPDH remain widely used in the studies of host gene response to virus infections, including influenza viruses. To date no detailed study has been described that compares the suitability of commonly used housekeeping genes in influenza virus infections. The present study evaluated several commonly used housekeeping genes [ACTB, GAPDH, 18S ribosomal RNA (18S rRNA), ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide (ATP5B) and ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9) (ATP5G1)] to identify the most stably expressed gene in human, pig, chicken and duck cells infected with a range of influenza A virus subtypes. Results: The relative expression stability of commonly used housekeeping genes were determined in primary human bronchial epithelial cells (HBECs), pig tracheal epithelial cells (PTECs), and chicken and duck primary lung-derived cells infected with five influenza A virus subtypes. -
Systematic Identification of Housekeeping Genes Possibly Used As References in Caenorhabditis Elegans by Large-Scale Data Integration
cells Article Systematic Identification of Housekeeping Genes Possibly Used as References in Caenorhabditis elegans by Large-Scale Data Integration 1, 1, 1 1 1 1 1 Jingxin Tao y, Youjin Hao y, Xudong Li , Huachun Yin , Xiner Nie , Jie Zhang , Boying Xu , Qiao Chen 2 and Bo Li 1,* 1 College of Life Sciences, Chongqing Normal University, Chongqing 401331, China; [email protected] (J.T.); [email protected] (Y.H.); [email protected] (X.L.); [email protected] (H.Y.); [email protected] (X.N.); [email protected] (J.Z.); [email protected] (B.X.) 2 Scientific Research Office, Chongqing Normal University, Chongqing 401331, China; [email protected] * Correspondence: [email protected]; Tel.: +86-23-6591-0315 These authors contributed equally to this work. y Received: 24 January 2020; Accepted: 11 March 2020; Published: 24 March 2020 Abstract: For accurate gene expression quantification, normalization of gene expression data against reliable reference genes is required. It is known that the expression levels of commonly used reference genes vary considerably under different experimental conditions, and therefore, their use for data normalization is limited. In this study, an unbiased identification of reference genes in Caenorhabditis elegans was performed based on 145 microarray datasets (2296 gene array samples) covering different developmental stages, different tissues, drug treatments, lifestyle, and various stresses. As a result, thirteen housekeeping genes (rps-23, rps-26, rps-27, rps-16, rps-2, rps-4, rps-17, rpl-24.1, rpl-27, rpl-33, rpl-36, rpl-35, and rpl-15) with enhanced stability were comprehensively identified by using six popular normalization algorithms and RankAggreg method. -
Mediator of DNA Damage Checkpoint 1 (MDC1) Is a Novel Estrogen Receptor Co-Regulator in Invasive 6 Lobular Carcinoma of the Breast 7 8 Evelyn K
bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423142; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 1 Running Title: MDC1 co-regulates ER in ILC 2 3 Research article 4 5 Mediator of DNA damage checkpoint 1 (MDC1) is a novel estrogen receptor co-regulator in invasive 6 lobular carcinoma of the breast 7 8 Evelyn K. Bordeaux1+, Joseph L. Sottnik1+, Sanjana Mehrotra1, Sarah E. Ferrara2, Andrew E. Goodspeed2,3, James 9 C. Costello2,3, Matthew J. Sikora1 10 11 +EKB and JLS contributed equally to this project. 12 13 Affiliations 14 1Dept. of Pathology, University of Colorado Anschutz Medical Campus 15 2Biostatistics and Bioinformatics Shared Resource, University of Colorado Comprehensive Cancer Center 16 3Dept. of Pharmacology, University of Colorado Anschutz Medical Campus 17 18 Corresponding author 19 Matthew J. Sikora, PhD.; Mail Stop 8104, Research Complex 1 South, Room 5117, 12801 E. 17th Ave.; Aurora, 20 CO 80045. Tel: (303)724-4301; Fax: (303)724-3712; email: [email protected]. Twitter: 21 @mjsikora 22 23 Authors' contributions 24 MJS conceived of the project. MJS, EKB, and JLS designed and performed experiments. JLS developed models 25 for the project. EKB, JLS, SM, and AEG contributed to data analysis and interpretation. SEF, AEG, and JCC 26 developed and performed informatics analyses. MJS wrote the draft manuscript; all authors read and revised the 27 manuscript and have read and approved of this version of the manuscript. -
Contig Protein Description Symbol Anterior Posterior Ratio
Table S2. List of proteins detected in anterior and posterior intestine pooled samples. Data on protein expression are mean ± SEM of 4 pools fed the experimental diets. The number of the contig in the Sea Bream Database (http://nutrigroup-iats.org/seabreamdb) is indicated. Contig Protein Description Symbol Anterior Posterior Ratio Ant/Pos C2_6629 1,4-alpha-glucan-branching enzyme GBE1 0.88±0.1 0.91±0.03 0.98 C2_4764 116 kDa U5 small nuclear ribonucleoprotein component EFTUD2 0.74±0.09 0.71±0.05 1.03 C2_299 14-3-3 protein beta/alpha-1 YWHAB 1.45±0.23 2.18±0.09 0.67 C2_268 14-3-3 protein epsilon YWHAE 1.28±0.2 2.01±0.13 0.63 C2_2474 14-3-3 protein gamma-1 YWHAG 1.8±0.41 2.72±0.09 0.66 C2_1017 14-3-3 protein zeta YWHAZ 1.33±0.14 4.41±0.38 0.30 C2_34474 14-3-3-like protein 2 YWHAQ 1.3±0.11 1.85±0.13 0.70 C2_4902 17-beta-hydroxysteroid dehydrogenase 14 HSD17B14 0.93±0.05 2.33±0.09 0.40 C2_3100 1-acylglycerol-3-phosphate O-acyltransferase ABHD5 ABHD5 0.85±0.07 0.78±0.13 1.10 C2_15440 1-phosphatidylinositol phosphodiesterase PLCD1 0.65±0.12 0.4±0.06 1.65 C2_12986 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase delta-1 PLCD1 0.76±0.08 1.15±0.16 0.66 C2_4412 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase gamma-2 PLCG2 1.13±0.08 2.08±0.27 0.54 C2_3170 2,4-dienoyl-CoA reductase, mitochondrial DECR1 1.16±0.1 0.83±0.03 1.39 C2_1520 26S protease regulatory subunit 10B PSMC6 1.37±0.21 1.43±0.04 0.96 C2_4264 26S protease regulatory subunit 4 PSMC1 1.2±0.2 1.78±0.08 0.68 C2_1666 26S protease regulatory subunit 6A PSMC3 1.44±0.24 1.61±0.08 -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Proteasome System of Protein Degradation and Processing
ISSN 0006-2979, Biochemistry (Moscow), 2009, Vol. 74, No. 13, pp. 1411-1442. © Pleiades Publishing, Ltd., 2009. Original Russian Text © A. V. Sorokin, E. R. Kim, L. P. Ovchinnikov, 2009, published in Uspekhi Biologicheskoi Khimii, 2009, Vol. 49, pp. 3-76. REVIEW Proteasome System of Protein Degradation and Processing A. V. Sorokin*, E. R. Kim, and L. P. Ovchinnikov Institute of Protein Research, Russian Academy of Sciences, 142290 Pushchino, Moscow Region, Russia; E-mail: [email protected]; [email protected] Received February 5, 2009 Abstract—In eukaryotic cells, degradation of most intracellular proteins is realized by proteasomes. The substrates for pro- teolysis are selected by the fact that the gate to the proteolytic chamber of the proteasome is usually closed, and only pro- teins carrying a special “label” can get into it. A polyubiquitin chain plays the role of the “label”: degradation affects pro- teins conjugated with a ubiquitin (Ub) chain that consists at minimum of four molecules. Upon entering the proteasome channel, the polypeptide chain of the protein unfolds and stretches along it, being hydrolyzed to short peptides. Ubiquitin per se does not get into the proteasome, but, after destruction of the “labeled” molecule, it is released and labels another molecule. This process has been named “Ub-dependent protein degradation”. In this review we systematize current data on the Ub–proteasome system, describe in detail proteasome structure, the ubiquitination system, and the classical ATP/Ub- dependent mechanism of protein degradation, as well as try to focus readers’ attention on the existence of alternative mech- anisms of proteasomal degradation and processing of proteins. -
Role of Phytochemicals in Colon Cancer Prevention: a Nutrigenomics Approach
Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Marjan J van Erk Promotor: Prof. Dr. P.J. van Bladeren Hoogleraar in de Toxicokinetiek en Biotransformatie Wageningen Universiteit Co-promotoren: Dr. Ir. J.M.M.J.G. Aarts Universitair Docent, Sectie Toxicologie Wageningen Universiteit Dr. Ir. B. van Ommen Senior Research Fellow Nutritional Systems Biology TNO Voeding, Zeist Promotiecommissie: Prof. Dr. P. Dolara University of Florence, Italy Prof. Dr. J.A.M. Leunissen Wageningen Universiteit Prof. Dr. J.C. Mathers University of Newcastle, United Kingdom Prof. Dr. M. Müller Wageningen Universiteit Dit onderzoek is uitgevoerd binnen de onderzoekschool VLAG Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Marjan Jolanda van Erk Proefschrift ter verkrijging van graad van doctor op gezag van de rector magnificus van Wageningen Universiteit, Prof.Dr.Ir. L. Speelman, in het openbaar te verdedigen op vrijdag 1 oktober 2004 des namiddags te vier uur in de Aula Title Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Author Marjan Jolanda van Erk Thesis Wageningen University, Wageningen, the Netherlands (2004) with abstract, with references, with summary in Dutch ISBN 90-8504-085-X ABSTRACT Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Specific food compounds, especially from fruits and vegetables, may protect against development of colon cancer. In this thesis effects and mechanisms of various phytochemicals in relation to colon cancer prevention were studied through application of large-scale gene expression profiling. Expression measurement of thousands of genes can yield a more complete and in-depth insight into the mode of action of the compounds. -
Role of Active Contraction and Tropomodulins in Regulating Actin Filament Length and Sarcomere Structure in Developing Zebrafish Skeletal Muscle
ORIGINAL RESEARCH published: 31 March 2016 doi: 10.3389/fphys.2016.00091 Role of Active Contraction and Tropomodulins in Regulating Actin Filament Length and Sarcomere Structure in Developing Zebrafish Skeletal Muscle Lise Mazelet 1, Matthew O. Parker 2, Mei Li 3, Anders Arner 3 and Rachel Ashworth 4* 1 School of Biological and Chemical Sciences, Queen Mary, University of London, London, UK, 2 School of Health Sciences and Social Work, University of Portsmouth, Portsmouth, UK, 3 Department of Physiology and Pharmacology, Karolinska Institutet, Stockholm, Sweden, 4 The Blizard Institute/Institute of Health Sciences Education, Barts and The London School of Medicine and Dentistry, London, UK Whilst it is recognized that contraction plays an important part in maintaining the structure and function of mature skeletal muscle, its role during development remains undefined. In this study the role of movement in skeletal muscle maturation was investigated in intact zebrafish embryos using a combination of genetic and pharmacological approaches. An immotile mutant line (cacnb1ts25) which lacks functional voltage-gated calcium channels (dihydropyridine receptors) in the muscle and pharmacological immobilization of embryos Edited by: with a reversible anesthetic (Tricaine), allowed the study of paralysis (in mutants and Catherine Coirault, anesthetized fish) and recovery of movement (reversal of anesthetic treatment). The Institut National de la Santé et de la Recherche Médicale, France effect of paralysis in early embryos (aged between 17 and 24 hours post-fertilization, hpf) Reviewed by: on skeletal muscle structure at both myofibrillar and myofilament level was determined Corrado Poggesi, using both immunostaining with confocal microscopy and small angle X-ray diffraction. -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.