DOCSLIB.ORG

Role of Phytochemicals in Colon Cancer Prevention: a Nutrigenomics Approach

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Role of Phytochemicals in Colon Cancer Prevention: a Nutrigenomics Approach Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Marjan J van Erk Promotor: Prof. Dr. P.J. van Bladeren Hoogleraar in de Toxicokinetiek en Biotransformatie Wageningen Universiteit Co-promotoren: Dr. Ir. J.M.M.J.G. Aarts Universitair Docent, Sectie Toxicologie Wageningen Universiteit Dr. Ir. B. van Ommen Senior Research Fellow Nutritional Systems Biology TNO Voeding, Zeist Promotiecommissie: Prof. Dr. P. Dolara University of Florence, Italy Prof. Dr. J.A.M. Leunissen Wageningen Universiteit Prof. Dr. J.C. Mathers University of Newcastle, United Kingdom Prof. Dr. M. Müller Wageningen Universiteit Dit onderzoek is uitgevoerd binnen de onderzoekschool VLAG Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Marjan Jolanda van Erk Proefschrift ter verkrijging van graad van doctor op gezag van de rector magnificus van Wageningen Universiteit, Prof.Dr.Ir. L. Speelman, in het openbaar te verdedigen op vrijdag 1 oktober 2004 des namiddags te vier uur in de Aula Title Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Author Marjan Jolanda van Erk Thesis Wageningen University, Wageningen, the Netherlands (2004) with abstract, with references, with summary in Dutch ISBN 90-8504-085-X ABSTRACT Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Specific food compounds, especially from fruits and vegetables, may protect against development of colon cancer. In this thesis effects and mechanisms of various phytochemicals in relation to colon cancer prevention were studied through application of large-scale gene expression profiling. Expression measurement of thousands of genes can yield a more complete and in-depth insight into the mode of action of the compounds. Effects of quercetin (a flavonoid present in e.g. apples and onions), curcumin (a spice used e.g. in curries) and resveratrol (present e.g. in grapes) were studied in cultured colon cancer cells. These studies confirmed some hypothesized mechanisms of action of these compounds (e.g. effects on cell cycle) and yielded new interesting leads (e.g. effects on proteasome genes, DNA repair genes, tubulin genes). In addition, expression profiles of a panel of 14 human cell lines derived from colonic tissue were compared and related to expression profiles of human colon biopsies from normal and tumor tissue. Changes in expression profiles of a subset of colon cancer-specific genes (as a biomarker set) in cultured colon cancer cells could be useful to translate in vitro results to the in vivo situation. In addition to the in vitro studies, effects of wheat bran, curcumin, rutin and benzyl isothiocyanate on colon carcinogenesis were studied in a rat model. Wheat bran and curcumin showed a protective effect (lower tumor multiplicity after 8 months compared to the control group). Expression profiles of differentially expressed genes in small intestinal tissue at intermediate time points were predictive of colon tumor development at the end of the study, confirming a correlation between effects in small intestine and colon. In summary, the studies in this thesis demonstrate the potential of large-scale expression profiling in nutrition studies. These studies also demonstrated that although the technological advancements in large-scale gene expression analysis allow for the collection of ‘whole genome’ results, the challenge for the coming years will be to further exploit these data. Only when advances in the bioinformatics field lead to easier interpretation of large amounts of data from nutrigenomics studies, the large potential of nutrigenomics can become reality. TABLE OF CONTENTS Chapter 1. General introduction p. 9 Chapter 2. Integrated assessment by multiple gene expression analysis p. 25 of quercetin bioactivity on anticancer-related mechanisms in colon cancer cells in vitro Chapter 3. Time- and dose-dependent effects of curcumin on p. 51 gene expression in human colon cancer cells Chapter 4. Towards an in vitro screening system for potential p. 81 cancer-preventive compounds based on gene expression profiling of cell lines and of human colon biopsies Chapter 5. Screening for potential cancer-preventive effects of p. 115 quercetin, curcumin and resveratrol by gene expression profiling in colon cancer cell lines Chapter 6. Do aberrant crypt foci have predictive value for the occurrence p. 139 of colorectal tumours? Potential of gene expression profiling in tumours Chapter 7. Gene expression profiling of effects of plant compounds p. 159 in relation to colon carcinogenesis Chapter 8. Summary & future perspectives p. 183 Nederlandse samenvatting p. 193 Bedankt! p. 200 Curriculum vitae, list of publications and training and supervision plan p. 203 GENERAL INTRODUCTION General Introduction Based on: Nutrigenomics and gastrointestinal health promotion Marjan J van Erk and Ben van Ommen In: ‘Nutrigenomics and Proteomics in Health Promotion and Disease Prevention’ (to be published in 2005) 9 CHAPTER 1 Background and aim of this thesis Development of colon cancer, a common form of cancer in Western countries, is related to diet and dietary compounds. Specifically, epidemiological studies indicate a protective effect of fruit and vegetable consumption. Although many bioactive phytochemicals (compounds from plants) have been identified, little is known about the mechanisms of cancer prevention of these compounds. At the same time that the human genome sequence was being unraveled, techniques were developed to measure expression of thousands of genes or proteins simultaneously. This advance from studying single genes or proteins to studying thousands of genes or proteins in one experiment promises to yield extensive and more comprehensive information in many areas of research, including nutrition-related research (figure 1.1). The aim of this thesis is to obtain more complete and in-depth insight in the mode of action of certain phytochemicals in relation to colon cancer prevention through application of large- scale gene expression measurement techniques. This approach has the potential to generate a wealth of information on effects of these compounds, which will help to elucidate the mechanisms of action. The studies described in this thesis are focused on quercetin, rutin, curcumin, resveratrol, wheat bran and benzyl isothiocyanate: plant compounds that are known to be able to protect against colon cancer development. Techniques for large scale measurement DNA gene methylation, SNPs sequencing, histone interaction genotyping RNA transcription transcriptomics processing, stability and (“genomics”) transport of mRNA receptor interaction protein signal transduction, proteomics Food enzyme regulation, Effect compound inhibition, modification transport regulation channel or pump interaction metabolite metabolomics multitude of functions Figure 1.1. Food compounds can have an effect on different levels in the cells (DNA, RNA, protein, metabolite). Large-scale measurement is possible at each of these levels. 10 GENERAL INTRODUCTION Colon cancer Introduction Colon cancer is one of the most prevalent forms of cancer in the Western countries. In the Netherlands for example it is the most common form of cancer in males after prostate and lung cancer and in females it is the most common form of cancer after breast cancer [1]. In the USA the incidence of colon cancer was 62.5 cases per 100.000 for males and 45.9 cases per 100.000 for females in the year 2000 (Surveillance, Epidemiology, and End Results (SEER) Program; www.seer.cancer.gov). In the Netherlands, the colon cancer incidence was reported to be 32.8 per 100.000 person-years for males and 26 per 100.000 person-years for females in 1998 [2]. The process of cancer development can be divided into different steps. It starts with DNA damage and mutations in the initiation phase, followed by growth of transformed cells in the promotion stage, leading to malignant growth and invasion in the progression stage. During development of colon cancer normal colonic epithelium transfers into hyperproliferative epithelium and then further on into adenoma, carcinoma and eventually metastasis, through accumulation of genetic alterations, according to the model of Fearon and Vogelstein [3]. Crucial genes involved in this process include APC, K-ras, DCC, p53, c-myc, cox-2, mismatch repair genes, cell adhesion genes [4-6]. Accumulation of alterations during carcinogenesis leads to impairment of normal growth inhibition by increased cell growth and by inhibition of apoptosis, resulting in clonal expansion of tumor cells [7]. Normally, the balance between cell proliferation and apoptosis in colonic mucosa is tightly regulated in order to maintain a constant cell number [8]. The disturbance of the balance results in an escape from the normal homeostasis of cell number and favors the survival of the mutated and undifferentiated cells [9, 10]. Inhibition of proliferation and increase in apoptosis of these aberrant cells are important mechanisms of prevention of colon cancer. Also, promotion of differentiation e.g. by butyrate is an important preventive mechanism, since differentiation makes an escape from the tight control on cell growth less likely. Several forms of hereditary colon cancer are known. In Familial Adenomatous Polyposis (FAP) patients inherit a germ-line mutation in APC and develop many colon tumors. Hereditary Non-Polyposis Colorectal Cancer (HNPCC) is related to microsatellite instability and a defect in DNA repair [4-6]. Role of nutrition in colon carcinogenesis
Load more

Recommended publications
  • PSMA4 Antibody (Monoclonal) (M01) Mouse Monoclonal Antibody Raised Against a Full Length Recombinant PSMA4
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 PSMA4 Antibody (monoclonal) (M01) Mouse monoclonal antibody raised against a full length recombinant PSMA4. Catalog # AT3454a Specification PSMA4 Antibody (monoclonal) (M01) - Product Information Application IF, WB, E Primary Accession P25789 Other Accession BC005361 Reactivity Human Host mouse Clonality Monoclonal Isotype IgG2b kappa Calculated MW 29484 PSMA4 Antibody (monoclonal) (M01) - Additional Information Immunofluorescence of monoclonal antibody to PSMA4 on HeLa cell. [antibody concentration 10 ug/ml] Gene ID 5685 Other Names Proteasome subunit alpha type-4, Macropain subunit C9, Multicatalytic endopeptidase complex subunit C9, Proteasome component C9, Proteasome subunit L, PSMA4, HC9, PSC9 Target/Specificity PSMA4 (AAH05361, 1 a.a. ~ 261 a.a) full-length recombinant protein with GST tag. MW of the GST tag alone is 26 KDa. Dilution WB~~1:500~1000 Antibody Reactive Against Recombinant Protein.Western Blot detection against Format Immunogen (54.45 KDa) . Clear, colorless solution in phosphate buffered saline, pH 7.2 . Storage Store at -20°C or lower. Aliquot to avoid repeated freezing and thawing. Precautions PSMA4 Antibody (monoclonal) (M01) is for research use only and not for use in diagnostic or therapeutic procedures. Page 1/3 10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 PSMA4 Antibody (monoclonal) (M01) - Protocols Provided below are standard protocols that you may find useful for product applications. • Western Blot • Blocking Peptides • Dot Blot • Immunohistochemistry • Immunofluorescence • Immunoprecipitation • Flow Cytomety • Cell Culture PSMA4 monoclonal antibody (M01), clone 2A10-E4 Western Blot analysis of PSMA4 expression in Hela ( (Cat # AT3454a ) Detection limit for recombinant GST tagged PSMA4 is approximately 3ng/ml as a capture antibody.
    [Show full text]
  • The Effect of Temperature Adaptation on the Ubiquitin–Proteasome Pathway in Notothenioid Fishes Anne E
    © 2017. Published by The Company of Biologists Ltd | Journal of Experimental Biology (2017) 220, 369-378 doi:10.1242/jeb.145946 RESEARCH ARTICLE The effect of temperature adaptation on the ubiquitin–proteasome pathway in notothenioid fishes Anne E. Todgham1,*, Timothy A. Crombie2 and Gretchen E. Hofmann3 ABSTRACT proliferation to compensate for the effects of low temperature on ’ There is an accumulating body of evidence suggesting that the sub- aerobic metabolism (Johnston, 1989; O Brien et al., 2003; zero Antarctic marine environment places physiological constraints Guderley, 2004). Recently, there has been an accumulating body – on protein homeostasis. Levels of ubiquitin (Ub)-conjugated proteins, of literature to suggest that protein homeostasis the maintenance of – 20S proteasome activity and mRNA expression of many proteins a functional protein pool has been highly impacted by evolution involved in both the Ub tagging of damaged proteins as well as the under these cold and stable conditions. different complexes of the 26S proteasome were measured to Maintaining protein homeostasis is a fundamental physiological examine whether there is thermal compensation of the Ub– process, reflecting a dynamic balance in synthetic and degradation proteasome pathway in Antarctic fishes to better understand the processes. There are numerous lines of evidence to suggest efficiency of the protein degradation machinery in polar species. Both temperature compensation of protein synthesis in Antarctic Antarctic (Trematomus bernacchii, Pagothenia borchgrevinki)and invertebrates (Whiteley et al., 1996; Marsh et al., 2001; Robertson non-Antarctic (Notothenia angustata, Bovichtus variegatus) et al., 2001; Fraser et al., 2002) and fish (Storch et al., 2005). In notothenioids were included in this study to investigate the zoarcid fishes, it has been demonstrated that Antarctic eelpouts mechanisms of cold adaptation of this pathway in polar species.
    [Show full text]
  • Genetic Variations in the PSMA6 and PSMC6 Proteasome Genes Are Associated with Multiple Sclerosis and Response to Interferon‑Β Therapy in Latvians
    EXPERIMENTAL AND THERAPEUTIC MEDICINE 21: 478, 2021 Genetic variations in the PSMA6 and PSMC6 proteasome genes are associated with multiple sclerosis and response to interferon‑β therapy in Latvians NATALIA PARAMONOVA1, JOLANTA KALNINA1, KRISTINE DOKANE1, KRISTINE DISLERE1, ILVA TRAPINA1, TATJANA SJAKSTE1 and NIKOLAJS SJAKSTE1,2 1Genomics and Bioinformatics, Institute of Biology of The University of Latvia; 2Department of Medical Biochemistry of The University of Latvia, LV‑1004 Riga, Latvia Received July 8, 2020; Accepted December 8, 2020 DOI: 10.3892/etm.2021.9909 Abstract. Several polymorphisms in genes related to the Introduction ubiquitin‑proteasome system exhibit an association with pathogenesis and prognosis of various human autoimmune Multiple sclerosis (MS) is a lifelong demyelinating disease of diseases. Our previous study reported the association the central nervous system. The clinical onset of MS tends to between multiple sclerosis (MS) and the PSMA3‑rs2348071 be between the second and fourth decade of life. Similarly to polymorphism in the Latvian population. The current study other autoimmune diseases, women are affected 3‑4 times more aimed to evaluate the PSMA6 and PSMC6 genetic variations, frequently than men (1). About 10% of MS patients experience their interaction between each other and with the rs2348071, a primary progressive MS form characterized by the progres‑ on the susceptibility to MS risk and response to therapy in sion of neurological disability from the onset. In about 90% the Latvian population. PSMA6‑rs2277460, ‑rs1048990 and of MS patients, the disease undergoes the relapse‑remitting PSMC6‑rs2295826, ‑rs2295827 were genotyped in the MS MS course (RRMS); in most of these patients, the condition case/control study and analysed in terms of genotype‑protein acquires secondary progressive course (SPMS) (2).
    [Show full text]
  • View of HER2: Human Epidermal Growth Factor Receptor 2; TNBC: Triple-Negative Breast Resistance to Systemic Therapy in Patients with Breast Cancer
    Wen et al. Cancer Cell Int (2018) 18:128 https://doi.org/10.1186/s12935-018-0625-9 Cancer Cell International PRIMARY RESEARCH Open Access Sulbactam‑enhanced cytotoxicity of doxorubicin in breast cancer cells Shao‑hsuan Wen1†, Shey‑chiang Su2†, Bo‑huang Liou3, Cheng‑hao Lin1 and Kuan‑rong Lee1* Abstract Background: Multidrug resistance (MDR) is a major obstacle in breast cancer treatment. The predominant mecha‑ nism underlying MDR is an increase in the activity of adenosine triphosphate (ATP)-dependent drug efux trans‑ porters. Sulbactam, a β-lactamase inhibitor, is generally combined with β-lactam antibiotics for treating bacterial infections. However, sulbactam alone can be used to treat Acinetobacter baumannii infections because it inhibits the expression of ATP-binding cassette (ABC) transporter proteins. This is the frst study to report the efects of sulbactam on mammalian cells. Methods: We used the breast cancer cell lines as a model system to determine whether sulbactam afects cancer cells. The cell viabilities in the present of doxorubicin with or without sulbactam were measured by MTT assay. Protein identities and the changes in protein expression levels in the cells after sulbactam and doxorubicin treatment were determined using LC–MS/MS. Real-time reverse transcription polymerase chain reaction (real-time RT-PCR) was used to analyze the change in mRNA expression levels of ABC transporters after treatment of doxorubicin with or without sulbactam. The efux of doxorubicin was measures by the doxorubicin efux assay. Results: MTT assay revealed that sulbactam enhanced the cytotoxicity of doxorubicin in breast cancer cells. The results of proteomics showed that ABC transporter proteins and proteins associated with the process of transcription and initiation of translation were reduced.
    [Show full text]
  • 20S Proteasome Α3 (Phospho Ser250) Polyclonal Antibody Catalog # AP67328
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 20S Proteasome α3 (phospho Ser250) Polyclonal Antibody Catalog # AP67328 Specification 20S Proteasome α3 (phospho Ser250) Polyclonal Antibody - Product Information Application WB Primary Accession P25788 Reactivity Human, Mouse, Rat Host Rabbit Clonality Polyclonal 20S Proteasome α3 (phospho Ser250) Polyclonal Antibody - Additional Information Gene ID 5684 Other Names PSMA3; HC8; PSC8; Proteasome subunit alpha type-3; Macropain subunit C8; Multicatalytic endopeptidase complex subunit C8; Proteasome component C8 Dilution WB~~Western Blot: 1/500 - 1/2000. Immunohistochemistry: 1/100 - 1/300. ELISA: 1/10000. Not yet tested in other applications. Format Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. Storage Conditions -20℃ 20S Proteasome α3 (phospho Ser250) Polyclonal Antibody - Protein Information Name PSMA3 Synonyms HC8, PSC8 Function Component of the 20S core proteasome complex involved in the proteolytic degradation of most intracellular proteins. This complex plays numerous essential roles within the cell by associating with Page 1/2 10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 different regulatory particles. Associated with two 19S regulatory particles, forms the 26S proteasome and thus participates in the ATP- dependent degradation of ubiquitinated proteins. The 26S proteasome plays a key role in the maintenance of protein homeostasis by removing misfolded or damaged proteins that could impair cellular functions, and by removing proteins whose functions are no longer required. Associated with the PA200 or PA28, the 20S proteasome mediates ubiquitin- independent protein degradation. This type of proteolysis is required in several 20S Proteasome α3 (phospho Ser250) pathways including spermatogenesis Polyclonal Antibody - Background (20S-PA200 complex) or generation of a subset of MHC class I-presented antigenic Component of the 20S core proteasome peptides (20S-PA28 complex).
    [Show full text]
  • Metallothionein Monoclonal Antibody, Clone N11-G
    Metallothionein monoclonal antibody, clone N11-G Catalog # : MAB9787 規格 : [ 50 uL ] List All Specification Application Image Product Rabbit monoclonal antibody raised against synthetic peptide of MT1A, Western Blot (Recombinant protein) Description: MT1B, MT1E, MT1F, MT1G, MT1H, MT1IP, MT1L, MT1M, MT2A. Immunogen: A synthetic peptide corresponding to N-terminus of human MT1A, MT1B, MT1E, MT1F, MT1G, MT1H, MT1IP, MT1L, MT1M, MT2A. Host: Rabbit enlarge Reactivity: Human, Mouse Immunoprecipitation Form: Liquid Enzyme-linked Immunoabsorbent Assay Recommend Western Blot (1:1000) Usage: ELISA (1:5000-1:10000) The optimal working dilution should be determined by the end user. Storage Buffer: In 20 mM Tris-HCl, pH 8.0 (10 mg/mL BSA, 0.05% sodium azide) Storage Store at -20°C. Instruction: Note: This product contains sodium azide: a POISONOUS AND HAZARDOUS SUBSTANCE which should be handled by trained staff only. Datasheet: Download Applications Western Blot (Recombinant protein) Western blot analysis of recombinant Metallothionein protein with Metallothionein monoclonal antibody, clone N11-G (Cat # MAB9787). Lane 1: 1 ug. Lane 2: 3 ug. Lane 3: 5 ug. Immunoprecipitation Enzyme-linked Immunoabsorbent Assay ASSP5 MT1A MT1B MT1E MT1F MT1G MT1H MT1M MT1L MT1IP Page 1 of 5 2021/6/2 Gene Information Entrez GeneID: 4489 Protein P04731 (Gene ID : 4489);P07438 (Gene ID : 4490);P04732 (Gene ID : Accession#: 4493);P04733 (Gene ID : 4494);P13640 (Gene ID : 4495);P80294 (Gene ID : 4496);P80295 (Gene ID : 4496);Q8N339 (Gene ID : 4499);Q86YX0 (Gene ID : 4490);Q86YX5
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name mitochondrial translational initiation factor 2 Gene Symbol MTIF2 Organism Human Gene Summary During the initiation of protein biosynthesis initiation factor-2 (IF-2) promotes the binding of the initiator tRNA to the small subunit of the ribosome in a GTP-dependent manner. Prokaryotic IF-2 is a single polypeptide while eukaryotic cytoplasmic IF-2 (eIF-2) is a trimeric protein. Bovine liver mitochondria contain IF-2(mt) an 85-kD monomeric protein that is equivalent to prokaryotic IF-2. The predicted 727-amino acid human protein contains a 29-amino acid presequence. Human IF-2(mt) shares 32 to 38% amino acid sequence identity with yeast IF-2(mt) and several prokaryotic IF-2s with the greatest degree of conservation in the G domains of the proteins. Two transcript variants encoding the same protein have been found for this gene. Gene Aliases Not Available RefSeq Accession No. NC_000002.11, NG_017017.1, NT_022184.15 UniGene ID Hs.149894 Ensembl Gene ID ENSG00000085760 Entrez Gene ID 4528 Assay Information Unique Assay ID qHsaCEP0058136 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000263629, ENST00000366137, ENST00000441307, ENST00000420637, ENST00000417363, ENST00000412530, ENST00000394600 Amplicon Context Sequence CCAAGCTCCTCATTTTACAGAAAAGGAAACGGAAATCCAGAAGGGTCAAAAAAG CTTCTCCAATGTCATACCGCTAGTTAATGGCAGTCAAGACTAGAACCCAGACG Amplicon Length (bp) 77 Chromosome Location 2:55495715-55495821 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 95 R2 0.9995 cDNA Cq 21.05 Page 1/5 PrimePCR™Assay Validation Report cDNA Tm (Celsius) 79 gDNA Cq 24.56 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report.
    [Show full text]
  • Hematopoietic Differentiation
    Hematopoietic Differentiation A number of lineages of mature cells are derived by a series of steps from a common stem cell precursor. Myeloid cells including neutrophils and monocytes are important for early defense against infection and because of the occurrence of myeloid leukemias. Myeloid differentiation and activation offers a favorable system for experimental investigation. Some Models of Gene Expression in Myeloid Cells 1. Compare resting neutrophils with neutrophils exposed for two hours to either. – A. Non-pathogenic E. coli. – B. Yersinia pestis D27 (plague bacillus). – C. Non-pathogenic Yersinia D28. 2. Induced differentiation of MPRO promyelocytic cells. NeutrophilsNeutrophils Major frontline defense cells against invading pathogens. – Constitute 70% of the total blood leukocytes. – Terminally differentiated professional phagocytic cells with an antibacterial arsenal. – Use both oxygen dependent and oxygen independent killing mechanisms. Play a central role in 2000X mag inflammation. Distribution of IL-8 transcripts on neutrophils (in situ hybridization) A combination of two Cy3 (red)- A labeled oligonucleotides complementary to IL-8 transcripts were used for in situ hybridization with neutrophils incubated in the absence (A) or presence (B) of ten E. coli K12 organisms per neutrophil. BB Methods of Analysis 1. mRNA analysis. – A. 3’ end restriction fragment gel display. – B. Affymetrix 60k or 42k oligonucleotide arrays. 2. Protein analysis. 2D gel electrophoresis using a variety of ph ranges for isoelectric focusing. MALDI-TOF identification of proteins. Representative Segments of Display Gels of cDNA Fragments: (Left) Neutrophils and Monocytes Exposed to E. coli for 2 H; (Right) Neutrophils Exposed to Various Bacteria for 2 H Ec: E. coli K12; Yp (KIM5): Y.
    [Show full text]
  • Degradation and Beyond: Control of Androgen Receptor Activity by the Proteasome System
    CELLULAR & MOLECULAR BIOLOGY LETTERS Volume 11, (2006) pp 109 – 131 http://www.cmbl.org.pl DOI: 10.2478/s11658-006-0011-9 Received: 06 December 2005 Revised form accepted: 31 January 2006 © 2006 by the University of Wrocław, Poland DEGRADATION AND BEYOND: CONTROL OF ANDROGEN RECEPTOR ACTIVITY BY THE PROTEASOME SYSTEM TOMASZ JAWORSKI Department of Cellular Biochemistry, Nencki Institute of Experimental Biology, Polish Academy of Sciences, Pasteura 3, 02-093 Warsaw, Poland Abstract: The androgen receptor (AR) is a transcription factor belonging to the family of nuclear receptors which mediates the action of androgens in the development of urogenital structures. AR expression is regulated post- * Corresponding author: e-mail: [email protected] Abbreviations used: AATF – apoptosis antagonizing factor; APIS complex – AAA proteins independent of 20S; ARA54 – AR-associated protein 54; ARA70 – AR-associated protein 70; ARE – androgen responsive element; ARNIP – AR N-terminal interacting protein; bFGF – basic fibroblast growth factor; CARM1 – coactivator-associated arginine methyltransferase 1; CHIP – C-terminus Hsp70 interacting protein; DBD – DNA binding domain; E6-AP – E6-associated protein; GRIP-1 – glucocorticoid receptor interacting protein 1; GSK3β – glycogen synthase kinase 3β; HDAC1 – histone deacetylase 1; HECT – homologous to the E6-AP C-terminus; HEK293 – human embryonal kidney cell line; HepG2 – human hepatoma cell line; Hsp90 – heat shock protein 90; IGF-1 – insulin-like growth factor 1; IL-6 – interleukin 6; KLK2 –
    [Show full text]
  • CD56+ T-Cells in Relation to Cytomegalovirus in Healthy Subjects and Kidney Transplant Patients
    CD56+ T-cells in Relation to Cytomegalovirus in Healthy Subjects and Kidney Transplant Patients Institute of Infection and Global Health Department of Clinical Infection, Microbiology and Immunology Thesis submitted in accordance with the requirements of the University of Liverpool for the degree of Doctor in Philosophy by Mazen Mohammed Almehmadi December 2014 - 1 - Abstract Human T cells expressing CD56 are capable of tumour cell lysis following activation with interleukin-2 but their role in viral immunity has been less well studied. The work described in this thesis aimed to investigate CD56+ T-cells in relation to cytomegalovirus infection in healthy subjects and kidney transplant patients (KTPs). Proportions of CD56+ T cells were found to be highly significantly increased in healthy cytomegalovirus-seropositive (CMV+) compared to cytomegalovirus-seronegative (CMV-) subjects (8.38% ± 0.33 versus 3.29%± 0.33; P < 0.0001). In donor CMV-/recipient CMV- (D-/R-)- KTPs levels of CD56+ T cells were 1.9% ±0.35 versus 5.42% ±1.01 in D+/R- patients and 5.11% ±0.69 in R+ patients (P 0.0247 and < 0.0001 respectively). CD56+ T cells in both healthy CMV+ subjects and KTPs expressed markers of effector memory- RA T-cells (TEMRA) while in healthy CMV- subjects and D-/R- KTPs the phenotype was predominantly that of naïve T-cells. Other surface markers, CD8, CD4, CD58, CD57, CD94 and NKG2C were expressed by a significantly higher proportion of CD56+ T-cells in healthy CMV+ than CMV- subjects. Functional studies showed levels of pro-inflammatory cytokines IFN-γ and TNF-α, as well as granzyme B and CD107a were significantly higher in CD56+ T-cells from CMV+ than CMV- subjects following stimulation with CMV antigens.
    [Show full text]
  • Investigation of Structural Properties of Methylated Human Promoter Regions in Terms of Dna Helical Rise
    INVESTIGATION OF STRUCTURAL PROPERTIES OF METHYLATED HUMAN PROMOTER REGIONS IN TERMS OF DNA HELICAL RISE A THESIS SUBMITTED TO THE GRADUATE SCHOOL OF INFORMATICS OF MIDDLE EAST TECHNICAL UNIVERSITY BY BURCU YALDIZ IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE IN BIOINFORMATICS AUGUST 2014 INVESTIGATION OF STRUCTURAL PROPERTIES OF METHYLATED HUMAN PROMOTER REGIONS IN TERMS OF DNA HELICAL RISE submitted by Burcu YALDIZ in partial fulfillment of the requirements for the degree of Master of Science, Bioinformatics Program, Middle East Technical University by, Prof. Dr. Nazife Baykal _____________________ Director, Informatics Institute Assist. Prof. Dr. Yeşim Aydın Son _____________________ Head of Department, Health Informatics, METU Assist. Prof. Dr. Yeşim Aydın Son Supervisor, Health Informatics, METU _____________________ Examining Committee Members: Assoc. Prof. Dr. Tolga Can _____________________ METU, CENG Assist. Prof. Dr. Yeşim Aydın Son _____________________ METU, Health Informatics Assist. Prof. Dr. Aybar Can Acar _____________________ METU, Health Informatics Assist. Prof. Dr. Özlen Konu _____________________ Bilkent University, Molecular Biology and Genetics Assoc. Prof. Dr. Çağdaş D. Son _____________________ METU, Biology Date: 27.08.2014 I hereby declare that all information in this document has been obtained and presented in accordance with academic rules and ethical conduct. I also declare that, as required by these rules and conduct, I have fully cited and referenced all material and results that are not original to this work. Name, Last name : Burcu Yaldız Signature : iii ABSTRACT INVESTIGATION OF STRUCTURAL PROPERTIES OF METHYLATED HUMAN PROMOTER REGIONS IN TERMS OF DNA HELICAL RISE Yaldız, Burcu M.Sc. Bioinformatics Program Advisor: Assist. Prof. Dr. Yeşim Aydın Son August 2014, 60 pages The infamous double helix structure of DNA was assumed to be a rigid, uniformly observed structure throughout the genomic DNA.
    [Show full text]
  • Deubiquitinase UCHL1 Maintains Protein Homeostasis Through PSMA7-APEH- Proteasome Axis in High-Grade Serous Ovarian Carcinoma
    bioRxiv preprint doi: https://doi.org/10.1101/2020.09.28.316810; this version posted October 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Deubiquitinase UCHL1 Maintains Protein Homeostasis through PSMA7-APEH- Proteasome Axis in High-Grade Serous Ovarian Carcinoma Apoorva Tangri1*, Kinzie Lighty1*, Jagadish Loganathan1, Fahmi Mesmar2, Ram Podicheti3, Chi Zhang1, Marcin Iwanicki4, Harikrishna Nakshatri1,5, Sumegha Mitra1,5,# 1 Indiana University School of Medicine, Indianapolis, IN, USA 2 Indiana University, Bloomington, IN, USA 3Center for Genomics and Bioinformatics, Indiana University, Bloomington, IN, USA 4Stevens Institute of Technology, Hoboken, NJ, USA 5Indiana University Melvin & Bren Simon Cancer Center, Indianapolis, USA *Equal contribution # corresponding author; to whom correspondence may be addressed. E-mail: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.28.316810; this version posted October 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract High-grade serous ovarian cancer (HGSOC) is characterized by chromosomal instability, DNA damage, oxidative stress, and high metabolic demand, which exacerbate misfolded, unfolded and damaged protein burden resulting in increased proteotoxicity. However, the underlying mechanisms that maintain protein homeostasis to promote HGSOC growth remain poorly understood. In this study, we report that the neuronal deubiquitinating enzyme, ubiquitin carboxyl-terminal hydrolase L1 (UCHL1) is overexpressed in HGSOC and maintains protein homeostasis. UCHL1 expression was markedly increased in HGSOC patient tumors and serous tubal intraepithelial carcinoma (HGSOC precursor lesions).
    [Show full text]