DOCSLIB.ORG

By Submitted in Partial Satisfaction of the Requirements for Degree of in In

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
By Submitted in Partial Satisfaction of the Requirements for Degree of in In BCL6 maintains thermogenic capacity of brown adipose tissue during dormancy by Vassily Kutyavin DISSERTATION Submitted in partial satisfaction of the requirements for degree of DOCTOR OF PHILOSOPHY in Biomedical Sciences in the GRADUATE DIVISION of the UNIVERSITY OF CALIFORNIA, SAN FRANCISCO Approved: ______________________________________________________________________________Eric Verdin Chair ______________________________________________________________________________Ajay Chawla ______________________________________________________________________________Ethan Weiss ______________________________________________________________________________ ______________________________________________________________________________ Committee Members Copyright 2019 by Vassily Kutyavin ii Dedicated to everyone who has supported me during my scientific education iii Acknowledgements I'm very grateful to my thesis adviser, Ajay Chawla, for his mentorship and support during my dissertation work over the past five years. Throughout my time in his lab, I was always able to rely on his guidance, and his enthusiasm for science was a great source of motivation. Even when he was traveling, he could easily be reached for advice by phone or e- mail. I am particularly grateful for his help with writing the manuscript, which was probably the most challenging aspect of graduate school for me. I am also very grateful to him for helping me find a postdoctoral fellowship position. Ajay's inquisitive and fearless approach to science have been a great inspiration to me. In contrast to the majority of scientists who focus narrowly on a specific topic, Ajay pursued fundamental questions across a broad range of topics and was able to make tremendous contributions. My experience in his lab instilled in me a deep appreciation for thinking about the entire organism from an evolutionary perspective and focusing on the key questions that escape the attention of the larger scientific community. As I move forward in my scientific career, there is no doubt that I will rely on him as a role model. I am very grateful to the other members of Ajay's lab who supported me during my thesis work. I am especially grateful to José Barreto Campello Carvalheira who worked directly with me during my first few months in the lab and helped to make the transition a smooth one. I am also grateful to Yifu Qiu, Min Woo Lee, and Yoshitaka Sogawa for teaching me many of the experimental approaches that proved to be very useful during my thesis work. I am also grateful to Xiaojin Cui for taking care of the lab, ordering all of the reagents that I needed, and helping to assemble the mouse lines that I used during my thesis work. I am grateful to fellow graduate students Yixuan Wu and Nyasha Chagwedera for their camaraderie and support. iv I also would like to thank my thesis committee members, Eric Verdin and Ethan Weiss, for their excellent advice and support. In particular I appreciate Eric's willingness to continue his role on the committee even when he relocated to the Buck Institute halfway through my thesis and consequently had to drive a long distance to attend the committee meetings. I also want to thank De'Broski Herbert, Emin Maltepe, Jayanta Debnath, and Jeffrey Cox for serving on my qualifying exam committee. In addition, I am grateful to Art Weiss and Jason Cyster for granting me the opportunity to work in their labs as a rotation student. They were fantastic mentors and role models during my first year of graduate school. I would also like to thank Judy Shigenega, the manager of the Molecular Core Facility at San Francisco VA Medical Center who provided invaluable assistance with next generation sequencing. In addition, I would like to thank Reena Zalpuri from the UC Berkeley Electron Microscope Lab for her assistance with electron microscopy. Finally, I would like to thank my family for their great support during the past five years. Contributions to the presented work Chapter 2 is adapted from a manuscript (in preparation) with the following citation: Kutyavin, V., Chawla, A. (2019). BCL6 regulates thermogenic capacity and survival of brown adipocytes during dormancy. Proc Natl Acad Sci U S A. Manuscript in preparation. Vassily Kutyavin designed, performed, and analyzed all experiments. Vassily Kutyavin and Ajay Chawla wrote and edited the manuscript. Ajay Chawla supervised the study. Vassily Kutyavin’s contributions to the work in Chapter 2 were equivalent in scope to the corresponding section of a standard doctoral thesis. v BCL6 maintains thermogenic capacity of brown adipose tissue during dormancy by Vassily Kutyavin Abstract During exposure to environmental cold, brown adipocytes protect against hypothermia by generating heat (thermogenesis). In warm environments, brown adipocytes become inactive or dormant, but still maintain their identity and thermogenic capacity, allowing rapid reactivation of thermogenesis upon subsequent cold exposure. Our understanding of the dormant state and its regulation is very limited. Here, we show that the transcription factor B cell leukemia/lymphoma 6 (BCL6) is specifically required for maintenance of thermogenic capacity during dormancy in mouse brown adipocytes. By a combination of both direct and indirect transcriptional mechanisms, BCL6 promotes uncoupled respiration, fatty acid oxidation, and survival in dormant brown adipocytes. In part, BCL6 achieves this by remodeling the epigenome of brown adipocytes to enforce brown and oppose white adipocyte cellular identity. Thus, unlike other transcription factors that regulate cold-induced thermogenesis, BCL6 is specifically required for maintenance of thermogenic fitness during adaptation to environmental warmth. vi TABLE OF CONTENTS Chapter 1: Introduction ............................................................................................................... 1 The importance of temperature for living organisms .................................................................. 2 Diverse strategies of thermoregulation in the animal kingdom .................................................. 2 Ectotherms ............................................................................................................................... 3 Endotherms .............................................................................................................................. 4 The thermoregulatory circuit in mammals .................................................................................. 6 Physiological mechanisms that increase body temperature in response to cold ..................... 6 Behavioral mechanisms that increase body temperature in response to cold .......................... 8 Physiological mechanisms that decrease body temperature in response to heat ..................... 8 Behavioral mechanisms that decrease body temperature in response to heat ......................... 9 Roles of adipocytes in energy homeostasis and thermoregulation ........................................... 10 UCP1-dependent thermogenesis in brown and beige adipocytes .......................................... 10 Alternative, UCP1-independent pathways of thermogenesis in brown and beige adipocytes ............................................................................................................................................... 13 Short- and long-term adaptation of brown and beige adipocytes to environmental temperature ............................................................................................................................ 13 The role of thermogenic adipocytes in diet-induced thermogenesis ..................................... 15 Brown adipose tissue in humans ............................................................................................... 16 Transcriptional regulation of brown adipocyte thermogenesis ................................................. 17 vii Transcriptional mechanisms governing brown adipocyte differentiation ............................. 18 Transcriptional mechanisms controlling acute activation of thermogenesis in response to cold ........................................................................................................................................ 19 Thyroid hormone receptors ................................................................................................... 20 Estrogen-related receptors ..................................................................................................... 21 B cell leukemia/lymphoma 6 (BCL6) ...................................................................................... 21 Molecular mechanisms of transcriptional regulation by BCL6 ............................................. 22 Transcriptional regulation of Bcl6 ......................................................................................... 23 Post-translational regulation of BCL6 ................................................................................... 23 Functions of BCL6 in germinal center B cells ...................................................................... 24 BCL6 as an oncogene ............................................................................................................ 25 Functions of BCL6 in T follicular helper cells ...................................................................... 26 Functions of BCL6 in memory and effector T cells .............................................................. 27 Functions of BCL6 in macrophages .....................................................................................
Load more

Recommended publications
  • Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis.
    [Show full text]
  • The Rise and Fall of the Bovine Corpus Luteum
    University of Nebraska Medical Center DigitalCommons@UNMC Theses & Dissertations Graduate Studies Spring 5-6-2017 The Rise and Fall of the Bovine Corpus Luteum Heather Talbott University of Nebraska Medical Center Follow this and additional works at: https://digitalcommons.unmc.edu/etd Part of the Biochemistry Commons, Molecular Biology Commons, and the Obstetrics and Gynecology Commons Recommended Citation Talbott, Heather, "The Rise and Fall of the Bovine Corpus Luteum" (2017). Theses & Dissertations. 207. https://digitalcommons.unmc.edu/etd/207 This Dissertation is brought to you for free and open access by the Graduate Studies at DigitalCommons@UNMC. It has been accepted for inclusion in Theses & Dissertations by an authorized administrator of DigitalCommons@UNMC. For more information, please contact [email protected]. THE RISE AND FALL OF THE BOVINE CORPUS LUTEUM by Heather Talbott A DISSERTATION Presented to the Faculty of the University of Nebraska Graduate College in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Biochemistry and Molecular Biology Graduate Program Under the Supervision of Professor John S. Davis University of Nebraska Medical Center Omaha, Nebraska May, 2017 Supervisory Committee: Carol A. Casey, Ph.D. Andrea S. Cupp, Ph.D. Parmender P. Mehta, Ph.D. Justin L. Mott, Ph.D. i ACKNOWLEDGEMENTS This dissertation was supported by the Agriculture and Food Research Initiative from the USDA National Institute of Food and Agriculture (NIFA) Pre-doctoral award; University of Nebraska Medical Center Graduate Student Assistantship; University of Nebraska Medical Center Exceptional Incoming Graduate Student Award; the VA Nebraska-Western Iowa Health Care System Department of Veterans Affairs; and The Olson Center for Women’s Health, Department of Obstetrics and Gynecology, Nebraska Medical Center.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2015/0337275 A1 Pearlman Et Al
    US 20150337275A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2015/0337275 A1 Pearlman et al. (43) Pub. Date: Nov. 26, 2015 (54) BOCONVERSION PROCESS FOR Publication Classification PRODUCING NYLON-7, NYLON-7.7 AND POLYESTERS (51) Int. C. CI2N 9/10 (2006.01) (71) Applicant: INVISTATECHNOLOGIES S.a.r.l., CI2P 7/40 (2006.01) St. Gallen (CH) CI2PI3/00 (2006.01) CI2PI3/04 (2006.01) (72) Inventors: Paul S. Pearlman, Thornton, PA (US); CI2P 13/02 (2006.01) Changlin Chen, Cleveland (GB); CI2N 9/16 (2006.01) Adriana L. Botes, Cleveland (GB); Alex CI2N 9/02 (2006.01) Van Eck Conradie, Cleveland (GB); CI2N 9/00 (2006.01) Benjamin D. Herzog, Wichita, KS (US) CI2P 7/44 (2006.01) CI2P I 7/10 (2006.01) (73) Assignee: INVISTATECHNOLOGIES S.a.r.l., (52) U.S. C. St. Gallen (CH) CPC. CI2N 9/13 (2013.01); C12P 7/44 (2013.01); CI2P 7/40 (2013.01); CI2P 13/005 (2013.01); (21) Appl. No.: 14/367,484 CI2P 17/10 (2013.01); CI2P 13/02 (2013.01); CI2N 9/16 (2013.01); CI2N 9/0008 (2013.01); (22) PCT Fled: Dec. 21, 2012 CI2N 9/93 (2013.01); CI2P I3/04 (2013.01); PCT NO.: PCT/US2012/071.472 CI2P 13/001 (2013.01); C12Y 102/0105 (86) (2013.01) S371 (c)(1), (2) Date: Jun. 20, 2014 (57) ABSTRACT Embodiments of the present invention relate to methods for Related U.S. Application Data the biosynthesis of di- or trifunctional C7 alkanes in the (60) Provisional application No.
    [Show full text]
  • A Genome-Wide Study of Blood Pressure in African Americans Accounting for Gene-Smoking Interaction Jacquelyn Y
    A Genome-wide study of blood pressure in African Americans accounting for gene-smoking interaction Jacquelyn Y. Taylor, Yale University Karen Schwander, Washington University in St. Louis Sharon L. R. Kardia, University of Michigan Donna Arnett, University of Alabama, Birmingham Jingjing Liang, Case Western Reserve University Steven C. Hunt, University of Utah D.C. Rao, Washington University in St. Louis Yan Sun, Emory University Journal Title: Scientific Reports Volume: Volume 6 Publisher: Nature Publishing Group | 2016-01-11, Pages 18812-18812 Type of Work: Article | Final Publisher PDF Publisher DOI: 10.1038/srep18812 Permanent URL: https://pid.emory.edu/ark:/25593/rhb37 Final published version: http://dx.doi.org/10.1038/srep18812 Copyright information: © 2016, Macmillan Publishers Limited This is an Open Access work distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/). Accessed September 29, 2021 11:39 AM EDT www.nature.com/scientificreports OPEN A Genome-wide study of blood pressure in African Americans accounting for gene-smoking Received: 15 January 2015 Accepted: 09 November 2015 interaction Published: 11 January 2016 Jacquelyn Y. Taylor1, Karen Schwander2, Sharon L. R. Kardia3 & Donna Arnett4, Jingjing Liang5 Steven C. Hunt6, D.C. Rao2 & Yan V. Sun7,8 Cigarette smoking has been shown to be a health hazard. In addition to being considered a negative lifestyle behavior, studies have shown that cigarette smoking has been linked to genetic underpinnings of hypertension. Because African Americans have the highest incidence and prevalence of hypertension, we examined the joint effect of genetics and cigarette smoking on health among this understudied population.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name mitochondrial translational initiation factor 2 Gene Symbol MTIF2 Organism Human Gene Summary During the initiation of protein biosynthesis initiation factor-2 (IF-2) promotes the binding of the initiator tRNA to the small subunit of the ribosome in a GTP-dependent manner. Prokaryotic IF-2 is a single polypeptide while eukaryotic cytoplasmic IF-2 (eIF-2) is a trimeric protein. Bovine liver mitochondria contain IF-2(mt) an 85-kD monomeric protein that is equivalent to prokaryotic IF-2. The predicted 727-amino acid human protein contains a 29-amino acid presequence. Human IF-2(mt) shares 32 to 38% amino acid sequence identity with yeast IF-2(mt) and several prokaryotic IF-2s with the greatest degree of conservation in the G domains of the proteins. Two transcript variants encoding the same protein have been found for this gene. Gene Aliases Not Available RefSeq Accession No. NC_000002.11, NG_017017.1, NT_022184.15 UniGene ID Hs.149894 Ensembl Gene ID ENSG00000085760 Entrez Gene ID 4528 Assay Information Unique Assay ID qHsaCEP0058136 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000263629, ENST00000366137, ENST00000441307, ENST00000420637, ENST00000417363, ENST00000412530, ENST00000394600 Amplicon Context Sequence CCAAGCTCCTCATTTTACAGAAAAGGAAACGGAAATCCAGAAGGGTCAAAAAAG CTTCTCCAATGTCATACCGCTAGTTAATGGCAGTCAAGACTAGAACCCAGACG Amplicon Length (bp) 77 Chromosome Location 2:55495715-55495821 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 95 R2 0.9995 cDNA Cq 21.05 Page 1/5 PrimePCR™Assay Validation Report cDNA Tm (Celsius) 79 gDNA Cq 24.56 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report.
    [Show full text]
  • Assessment of NR4A Ligands That Directly Bind and Modulate the Orphan Nuclear Receptor Nurr1
    bioRxiv preprint doi: https://doi.org/10.1101/2020.05.22.109017; this version posted May 25, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Assessment of NR4A Ligands that Directly Bind and Modulate the Orphan Nuclear Receptor Nurr1 Paola Munoz-Tello 1, Hua Lin 2,3, Pasha Khan 2, Ian Mitchelle S. de Vera 1,4, Theodore M. Kamenecka 2, and Douglas J. Kojetin 1,2,* 1 Department of Integrative Structural and Computational Biology, The Scripps Research Institute, Jupiter, FL, 33458, USA 2 Department of Molecular Medicine, The Scripps Research Institute, Jupiter, Florida 33458, USA 3 Current address: Biomedical Research Center of South China, College of Life Sciences, Fujian Normal University, Fuzhou 350117, China 4 Current address: Department of Pharmacology and Physiology, Saint Louis University School of Medicine, St. Louis, MO 63104, USA * Correspondence: [email protected] as ligands that increase Nurr1 transcription in human neuroblastoma SK- ABSTRACT N-BE(2)-C cells (11). Amodiaquine improves behavioral alterations in a Nurr1/NR4A2 is an orphan nuclear receptor transcription factor im- Parkinson’s disease animal model (11) and improves neuropathology and plicated as a potential drug target for neurological disorders including memory impairment in an Alzheimer’s disease animal model (12). Alzheimer’s and Parkinson’s diseases. Previous studies identified small molecule modulators of NR4A nuclear receptors including Nurr1 and Amodiaquine is the most potent and efficacious Nurr1 agonist of the Nur77/NR4A1; it remains unclear whether these ligands affect Nurr1 4-amino-7-chloroquinoline compounds, but these compounds are not through direct binding or indirect non-binding mechanisms.
    [Show full text]
  • The Role of the Mtor Pathway in Developmental Reprogramming Of
    THE ROLE OF THE MTOR PATHWAY IN DEVELOPMENTAL REPROGRAMMING OF HEPATIC LIPID METABOLISM AND THE HEPATIC TRANSCRIPTOME AFTER EXPOSURE TO 2,2',4,4'- TETRABROMODIPHENYL ETHER (BDE-47) An Honors Thesis Presented By JOSEPH PAUL MCGAUNN Approved as to style and content by: ________________________________________________________** Alexander Suvorov 05/18/20 10:40 ** Chair ________________________________________________________** Laura V Danai 05/18/20 10:51 ** Committee Member ________________________________________________________** Scott C Garman 05/18/20 10:57 ** Honors Program Director ABSTRACT An emerging hypothesis links the epidemic of metabolic diseases, such as non-alcoholic fatty liver disease (NAFLD) and diabetes with chemical exposures during development. Evidence from our lab and others suggests that developmental exposure to environmentally prevalent flame-retardant BDE47 may permanently reprogram hepatic lipid metabolism, resulting in an NAFLD-like phenotype. Additionally, we have demonstrated that BDE-47 alters the activity of both mTOR complexes (mTORC1 and 2) in hepatocytes. The mTOR pathway integrates environmental information from different signaling pathways, and regulates key cellular functions such as lipid metabolism, innate immunity, and ribosome biogenesis. Thus, we hypothesized that the developmental effects of BDE-47 on liver lipid metabolism are mTOR-dependent. To assess this, we generated mice with liver-specific deletions of mTORC1 or mTORC2 and exposed these mice and their respective controls perinatally to
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • Iron–Sulfur Clusters: from Metals Through Mitochondria Biogenesis to Disease
    JBIC Journal of Biological Inorganic Chemistry https://doi.org/10.1007/s00775-018-1548-6 MINIREVIEW Iron–sulfur clusters: from metals through mitochondria biogenesis to disease Mauricio Cardenas‑Rodriguez1 · Afroditi Chatzi1 · Kostas Tokatlidis1 Received: 13 November 2017 / Accepted: 22 February 2018 © The Author(s) 2018. This article is an open access publication Abstract Iron–sulfur clusters are ubiquitous inorganic co-factors that contribute to a wide range of cell pathways including the main- tenance of DNA integrity, regulation of gene expression and protein translation, energy production, and antiviral response. Specifcally, the iron–sulfur cluster biogenesis pathways include several proteins dedicated to the maturation of apoproteins in diferent cell compartments. Given the complexity of the biogenesis process itself, the iron–sulfur research area consti- tutes a very challenging and interesting feld with still many unaddressed questions. Mutations or malfunctions afecting the iron–sulfur biogenesis machinery have been linked with an increasing amount of disorders such as Friedreich’s ataxia and various cardiomyopathies. This review aims to recap the recent discoveries both in the yeast and human iron–sulfur cluster arena, covering recent discoveries from chemistry to disease. Keywords Metal · Cysteine · Iron–sulfur · Mitochondrial disease · Iron regulation Abbreviations Rad3 TFIIH/NER complex ATP-dependent Aft Activator of ferrous transport 5′–3′ DNA helicase subunit RAD3 Atm1 ATP-binding cassette (ABC) transporter Ssq1 Stress-seventy sub-family Q 1 Cfd1 Complement factor D SUF Sulfur mobilization system CIA Cytosolic iron–sulfur cluster assembly XPD Xeroderma pigmentosum group D Erv1 Essential for respiration and vegetative helicase growth 1 Yap5 Yeast AP-5 GFER Growth factor, augmenter of liver regeneration Grx/GLRX Glutaredoxin Introduction GSH Reduced glutathione GSSG Oxidised glutathione Iron–sulfur clusters are metal prosthetic groups, synthesized HSP9 Heat shock protein 9 and utilised in diferent cell compartments.
    [Show full text]
  • Investigation of Candidate Genes and Mechanisms Underlying Obesity
    Prashanth et al. BMC Endocrine Disorders (2021) 21:80 https://doi.org/10.1186/s12902-021-00718-5 RESEARCH ARTICLE Open Access Investigation of candidate genes and mechanisms underlying obesity associated type 2 diabetes mellitus using bioinformatics analysis and screening of small drug molecules G. Prashanth1 , Basavaraj Vastrad2 , Anandkumar Tengli3 , Chanabasayya Vastrad4* and Iranna Kotturshetti5 Abstract Background: Obesity associated type 2 diabetes mellitus is a metabolic disorder ; however, the etiology of obesity associated type 2 diabetes mellitus remains largely unknown. There is an urgent need to further broaden the understanding of the molecular mechanism associated in obesity associated type 2 diabetes mellitus. Methods: To screen the differentially expressed genes (DEGs) that might play essential roles in obesity associated type 2 diabetes mellitus, the publicly available expression profiling by high throughput sequencing data (GSE143319) was downloaded and screened for DEGs. Then, Gene Ontology (GO) and REACTOME pathway enrichment analysis were performed. The protein - protein interaction network, miRNA - target genes regulatory network and TF-target gene regulatory network were constructed and analyzed for identification of hub and target genes. The hub genes were validated by receiver operating characteristic (ROC) curve analysis and RT- PCR analysis. Finally, a molecular docking study was performed on over expressed proteins to predict the target small drug molecules. Results: A total of 820 DEGs were identified between
    [Show full text]
  • Identification and Characterization of Tissue-Resident Memory T Cells in Humans Brahma Vencel Kumar
    Identification and characterization of tissue-resident memory T cells in humans Brahma Vencel Kumar Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2018 ©2017 Brahma Vencel Kumar All rights reserved ABSTRACT Identification and characterization of tissue-resident memory T cells in humans Brahma Vencel Kumar Memory T cells are critical for maintaining lifelong immunity by protecting against reinfection with previously encountered pathogens. In recent years, a subset of memory T cells termed tissue-resident memory T cells (TRM) has emerged as the primary mediator of protection at many tissue sites. Numerous studies in mice have demonstrated that TRM accelerate pathogen clearance compared with other subsets of memory T cells. The defining characteristic of TRM is that they are retained within tissues and do not circulate in the blood. The lack of TRM in blood has proved to be a barrier for investigating the role of TRM in healthy humans. As a result, there are many outstanding questions about TRM biology in humans, including which phenotypic markers identify TRM, if TRM represent a unique memory subset, as well as defining transcriptional and functional characteristics of this subset. Through a unique collaboration with the local organ procurement agency, we obtained samples from >15 tissue sites from healthy organ donors of all ages. We found that the surface marker CD69 was expressed by memory CD4 + and CD8 + T cells in multiple tissues including spleen and other lymphoid tissues, lung, and intestines, but not in blood, suggesting that this marker may identify TRM in human tissues.
    [Show full text]
  • Role of Phytochemicals in Colon Cancer Prevention: a Nutrigenomics Approach
    Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Marjan J van Erk Promotor: Prof. Dr. P.J. van Bladeren Hoogleraar in de Toxicokinetiek en Biotransformatie Wageningen Universiteit Co-promotoren: Dr. Ir. J.M.M.J.G. Aarts Universitair Docent, Sectie Toxicologie Wageningen Universiteit Dr. Ir. B. van Ommen Senior Research Fellow Nutritional Systems Biology TNO Voeding, Zeist Promotiecommissie: Prof. Dr. P. Dolara University of Florence, Italy Prof. Dr. J.A.M. Leunissen Wageningen Universiteit Prof. Dr. J.C. Mathers University of Newcastle, United Kingdom Prof. Dr. M. Müller Wageningen Universiteit Dit onderzoek is uitgevoerd binnen de onderzoekschool VLAG Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Marjan Jolanda van Erk Proefschrift ter verkrijging van graad van doctor op gezag van de rector magnificus van Wageningen Universiteit, Prof.Dr.Ir. L. Speelman, in het openbaar te verdedigen op vrijdag 1 oktober 2004 des namiddags te vier uur in de Aula Title Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Author Marjan Jolanda van Erk Thesis Wageningen University, Wageningen, the Netherlands (2004) with abstract, with references, with summary in Dutch ISBN 90-8504-085-X ABSTRACT Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Specific food compounds, especially from fruits and vegetables, may protect against development of colon cancer. In this thesis effects and mechanisms of various phytochemicals in relation to colon cancer prevention were studied through application of large-scale gene expression profiling. Expression measurement of thousands of genes can yield a more complete and in-depth insight into the mode of action of the compounds.
    [Show full text]