DOCSLIB.ORG

(12) Patent Application Publication (10) Pub. No.: US 2015/0337275 A1 Pearlman Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) Patent Application Publication (10) Pub. No.: US 2015/0337275 A1 Pearlman Et Al US 20150337275A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2015/0337275 A1 Pearlman et al. (43) Pub. Date: Nov. 26, 2015 (54) BOCONVERSION PROCESS FOR Publication Classification PRODUCING NYLON-7, NYLON-7.7 AND POLYESTERS (51) Int. C. CI2N 9/10 (2006.01) (71) Applicant: INVISTATECHNOLOGIES S.a.r.l., CI2P 7/40 (2006.01) St. Gallen (CH) CI2PI3/00 (2006.01) CI2PI3/04 (2006.01) (72) Inventors: Paul S. Pearlman, Thornton, PA (US); CI2P 13/02 (2006.01) Changlin Chen, Cleveland (GB); CI2N 9/16 (2006.01) Adriana L. Botes, Cleveland (GB); Alex CI2N 9/02 (2006.01) Van Eck Conradie, Cleveland (GB); CI2N 9/00 (2006.01) Benjamin D. Herzog, Wichita, KS (US) CI2P 7/44 (2006.01) CI2P I 7/10 (2006.01) (73) Assignee: INVISTATECHNOLOGIES S.a.r.l., (52) U.S. C. St. Gallen (CH) CPC. CI2N 9/13 (2013.01); C12P 7/44 (2013.01); CI2P 7/40 (2013.01); CI2P 13/005 (2013.01); (21) Appl. No.: 14/367,484 CI2P 17/10 (2013.01); CI2P 13/02 (2013.01); CI2N 9/16 (2013.01); CI2N 9/0008 (2013.01); (22) PCT Fled: Dec. 21, 2012 CI2N 9/93 (2013.01); CI2P I3/04 (2013.01); PCT NO.: PCT/US2012/071.472 CI2P 13/001 (2013.01); C12Y 102/0105 (86) (2013.01) S371 (c)(1), (2) Date: Jun. 20, 2014 (57) ABSTRACT Embodiments of the present invention relate to methods for Related U.S. Application Data the biosynthesis of di- or trifunctional C7 alkanes in the (60) Provisional application No. 61/578.265, filed on Dec. presence of isolated enzymes or in the presence of a recom 21, 2011, provisional application No. 61/578,272, binant host cell expressing those enzymes. The di- or trifunc filed on Dec. 21, 2011, provisional application No. tional C7 alkanes are useful as intermediates in the produc 61/578,289, filed on Dec. 21, 2011. tion of nylon-7, nylon-7.X. nylon-X.7, and polyesters. Patent Application Publication Nov. 26, 2015 Sheet 1 of 42 US 2015/0337275 A1 F.G. Ho-oh HON-N-N-N-OH Pinelic acid G 1,7-heptanedio carboxylic acid reductase Sphingomonas 4. aidehyde DH falcohol DH (CAR) EC 1.2.99.- macrogofitabida EC ...- alcoho H EC 1.1.1 - --- Ho-ohO Pimelic acid semialdehyde 7-hydroxyheptanoate (7-oxoheptanoate) co-transaminase EC 2.6.1- Amidohydrolase EC 3.52 Hos--~~ -e O C. 7-aminoheptanoic acid eantholactam Aldehyde DH EC 111 acchio H ~-NH. O 7-aminoheptanal 7-aminoheptanol ()-transaminase EC 261 heptamethylenediamine (1,7-diaminoheptane) Patent Application Publication Nov. 26, 2015 Sheet 2 of 42 US 2015/0337275 A1 FG, 2. Biotin biosynthesis pathway Benzoate degradation pathway Cyclohexane carboxylate pathway Biotin biosynthesis pathway Condensation of 3 X malonyl-CoA - (reaction not assigned to pathway) - Hos---sco Hor-lap O O O O fatA fat ThioesterPimeloy-CoA hydrolase tigase (EC(EC 3.1.2.-)6.2.1.-) %t. CoA transferase (ECW2.83.-) H or-no O O Acyl-(acyl carrier protein) Acyl-CoA reductase Pima lic acid reduct eductase EC 2.50 afooxylic acid reductase VE: 1299.- EC 2.18O G Horn-inO O Pimelic acid semiaidehyde Tetratin degradation pathway CO2 Ec: 4.1.1 - o-keto acid decarboxylase O H* O OH HO (.-Ketosuberate4. O Coenzyme B pathway (Methanogenic archae) Patent Application Publication Nov. 26, 2015 Sheet 3 of 42 US 2015/0337275 A1 FG, 3 Ho-roO O O-ketoguterateO Acetyl-CoA, H2O EC 2.3.3.14 (akSA) EC 4.2.1.114 (aksDiaksE) or EC 4.2.1.36 CoA EC 4.2.1.114 (aksDiaksE) CO2 EC 1.1.1.87 (aksF) O O to-oh -X // > Lysine O-ketoadipate O Acetyl-CoA, H2O EC 2.3.3.14 (akSA) EC 4.2.1.114 (aksDfaksE) or EC 4.2.1.36 CoA EC 4.2.1.114 (aks faksE) CO2 EC 1.1.1.87 (aksF) Ho-n-rotO O O O-ketopimelate Acetyl-CoA, H2O EC 2.3.3.14 (akSA) Coenzyme B EC 4.2.1.114 (aksDfaksE) or EC 4.2.1.36 COA EC 4.2.1.114 (aksOfaksE) CO2 EC 1.1.1.87 (aksF) O O OH O -- CO HO O O-ketoSuberate O H 2 pimetic acid semialdehyde (7-oxoheptanoate) Change: 4.1.3- to 2.3.3.14 (homocitrate synthase) AksD/AksE can be 4.2.1.114 (R)-homocitrate yase only or 4.2.1.114 + 4.2.1.36 (homoisocitrate hydro-iyase AksF hono-isocitrate dehydrogenase 1.1.1.87 Patent Application Publication Nov. 26, 2015 Sheet 4 of 42 US 2015/0337275 A1 FG. 4 O O condensation O O O o'-'s-coa os---is-ca Malonyl-CoA O O 3-oxoglutaryl-CoA 1sul CO2 oxo group elimination O S-CoA CoA Malonyl-CoA O O Condensation & ----- OXO group elimination O O HO S-CoA o'-'s-coa Pimeloyl-CoA Glutaryl-CoA CO2 CoA Malonyl-CoA Patent Application Publication Nov. 26, 2015 Sheet 5 of 42 US 2015/0337275 A1 F.G. S PA5OBO HO J--- S-acp (CYP107H1)s R S-acp Pimeloy-acp (CH2)CH3 long-chain faty acid-acp O y O Ho-oh Pineic acid ATP, CoA BioW EC 62.4 AMP, PP, L-Aia CO2 O O H CoA HO --~ul S-COA “HN O O Pimeoyl-CoA BioF OH EC 2.34f BioC 7-keto-8-aminopelagonate BioH BioGiEOKFBOY 2 Biotin Patent Application Publication Nov. 26, 2015 Sheet 6 of 42 US 2015/0337275 A1 F.G. 6 EC 2.1.19 EC 2.3.18O O O BioC O O FabH O. O. O. -e -> HO S-COA so-sco O acp Madon yW-COA Maory-CoAy newestery 3-OXO-Gutaw-acol9 y- plgety methwester is, EC 1.3.1.10 EC 4.2.1.59 Fag Fabi FaZ Yo is acp Yo usicS. acp - Yo if acp glutary-acp methyl ester enoylglutary-acp methyl ester 3-hydroxy-glutaryl-acp methyl ester EC 2.3141 FabB EC 1.1.1.100 EC 4.289 O O O FacG O CH C. Faby O O YO acp) YO ---sus aCp Yo ---s-s acp 3-oxopimelyl-acp methyester 3-hydroxypimely-acp) methyl ester enoylpinely-acp methyl ester EC 3.110 EC 2.3.47 EC 3.185 Fabi O O BigF O O BioH O O a "HN OH XHO 1s-s-s-s acp Sas-s-s-sO acp 7-keto-8-aminopelargonate pinely-acp pimelyl-acp methyl ester EC 3.12.4 aaaS Fata, FatB Lipase or Biotin O O esterase O O HO ----- OH N O --~us OH pimelic acid pimelate monomethyl ester EC 2.180 O Acyl-acp reductase -----> HO SO Pimelic acid semialdehyde Patent Application Publication Nov. 26, 2015 Sheet 7 of 42 US 2015/0337275 A1 F.G. 7 coO Benzoate EC 6.2.1 2. C’soO O OH Benzoyl-CoA COA-S Cyclohexane carboxylate O O 2-ketocyclohexane-1-carboxyl-CoA H D. 2-ketocyclohexanecarboxyCoA hydrolase (Rp-bad) O O g O Ho-r-r-sca -X-> Ho-sca Pimeloyl-CoA B-Oxidation Glutary-CoA Patent Application Publication Nov. 26, 2015 Sheet 8 of 42 US 2015/0337275 A1 FG, 8 -/- CO -t, - O OH OH OH Naphtalene Tetrain O (benzocyclohexane) 2,4-dihydrodec-2-ene-1,10-dioic acid O OH h X-K O HC3 O HO --~sSO Puruvate Pimelic acid semialdehyde ThG | Ho-n-n-oh Pinetic acid Patent Application Publication Nov. 26, 2015 Sheet 9 of 42 US 2015/0337275 A1 FEG, 9 O O O O O sy- os---sca O SCoA O OH O O O n’ 2H) O ---sul SCOA Crotorate -s-so O ls-s-sS-1 scoA N-H2O APCOA r -CO2 O O O O crotonyl-CoA -> "sca -s-s SCCA 2H ho Enoyl-CoA O r O 3-hydroxy- OH O hydrataseEC 4.2.1.17 to- O ----- SCOA butyryl-CoA -lul OH. O. Pimeoyl-CoA SCOA --scoA. /y 2H 3-hydroxybutyryl- 2H EC 1157 t aceto- O O O O acetyl-CoA Y CoA--sca O --sca O OO O - sco O-. acetyl-CoAy 1 sco 1sca EC 239COA 'year w- carboxylate N- COASH ATP O Patent Application Publication Nov. 26, 2015 Sheet 10 of 42 US 2015/0337275 A1 F.G. 10A Diaminopimelate NH2 NH2 decarboxylase Ho-oh 6 Lysine O O meso-2,6-diaminopimelate Ammonia iyase NH Ho-s-s-to O O - - - - - - - - - - - - - - - - 6-amino-2-heptenedioic acid Enoate Reductase y - - - - - - - - - - - - - - - NH , Annonia Ho-oh - - - - - - - - A ------- lyase O O O K s t O 3 di p 3.t e 2-amino-heptanedioic acid - - - ---------------- Amino goes O as O HO OH ~~~ HO OH AkSA HO -oh O O -o- HO s 2-heptenedioic acid Oo-ketopimel ate? O CoA transferase - - - Hydro-lyase Carbonyl reductase HO YO acid-thiol ligase OH trihomocitrate Hos---is-CoAs, Ho-oh O t AKSD/AKSE O O O d O 2-heptenedioic acid-CoA c-hydroxypimelate HO 2 Enoate Enoate , OH Reductase Reductase, HO. O. Enoyl-CoA , Cis-(homo)3-aconitate dehydrogenas w t Aks), AkSE HO S-CoA HO OH -e- O O O O O Pimeloyl-CoA hioesterase Pineic acid HO OH HO YO Fatty-acyl-CoA Carboxylic acid (-)-threo-iso(homo)scitrate reductase reductase AkSF Decarboxylase O HO 2O -- HO O O O Pimelic acid semialdehyde O-ketosuberate Amino transferase Anino tances O Decarboxylase HO Hos----NH. se- r-r-no O O NH2 7-aminoheptanoic acid C-aminOSuberate Patent Application Publication Nov. 26, 2015 Sheet 11 of 42 US 2015/0337275 A1 FG, 10B CoA transferase OH acid-thiol gase CH Ho-oh - - Ho----> S-CoA O O O O CoA-SH O-hydroxypimelate C O-hydroxypimeoyl-CoA Hydro-lyase Hydro-lyase CoA transferase Ho-oh acid-thioi Eigase Hos---sca O O 7 O O 2-heptenedioic acid COA-SH 2-heptenedioic acid-CoA Enoate Enoate Reductase Reductase COA transferase Enoyl-CoA dehydrogenase acid-thiol ligase or Ho-oh hioesterase Hos---is-CoA O O O O Pinneic acid CoA-SH Pimeoyl-CoA Fig.
Load more

Recommended publications
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • Adipose Tissue NAPE-PLD Controls Fat Mass Development by Altering the Browning Process and Gut Microbiota
    ARTICLE Received 11 Jul 2014 | Accepted 4 Feb 2015 | Published 11 Mar 2015 DOI: 10.1038/ncomms7495 OPEN Adipose tissue NAPE-PLD controls fat mass development by altering the browning process and gut microbiota Lucie Geurts1, Amandine Everard1,*, Matthias Van Hul1,*, Ahmed Essaghir2, Thibaut Duparc1, Se´bastien Matamoros1, Hubert Plovier1, Julien Castel3, Raphael G.P. Denis3, Marie Bergiers1, Ce´line Druart1, Mireille Alhouayek4, Nathalie M. Delzenne1, Giulio G. Muccioli4, Jean-Baptiste Demoulin2, Serge Luquet3 & Patrice D. Cani1 Obesity is a pandemic disease associated with many metabolic alterations and involves several organs and systems. The endocannabinoid system (ECS) appears to be a key regulator of energy homeostasis and metabolism. Here we show that specific deletion of the ECS synthesizing enzyme, NAPE-PLD, in adipocytes induces obesity, glucose intolerance, adipose tissue inflammation and altered lipid metabolism. We report that Napepld-deleted mice present an altered browning programme and are less responsive to cold-induced browning, highlighting the essential role of NAPE-PLD in regulating energy homeostasis and metabolism in the physiological state. Our results indicate that these alterations are mediated by a shift in gut microbiota composition that can partially transfer the phenotype to germ-free mice. Together, our findings uncover a role of adipose tissue NAPE-PLD on whole-body metabolism and provide support for targeting NAPE-PLD-derived bioactive lipids to treat obesity and related metabolic disorders. 1 Metabolism and Nutrition Research Group, WELBIO-Walloon Excellence in Life Sciences and BIOtechnology, Louvain Drug Research Institute, Universite´ catholique de Louvain, Avenue E. Mounier, 73 B1.73.11, 1200 Brussels, Belgium. 2 de Duve Institute, Universite´ catholique de Louvain, Avenue Hippocrate, 74 B1.74.05, 1200 Brussels, Belgium.
    [Show full text]
  • Amt-10-1373-2017-Supplement.Pdf
    Supplement of Atmos. Meas. Tech., 10, 1373–1386, 2017 http://www.atmos-meas-tech.net/10/1373/2017/ doi:10.5194/amt-10-1373-2017-supplement © Author(s) 2017. CC Attribution 3.0 License. Supplement of New insights into atmospherically relevant reaction systems using direct analysis in real-time mass spectrometry (DART-MS) Yue Zhao et al. Correspondence to: Barbara J. Finlayson-Pitts (bjfi[email protected]) The copyright of individual parts of the supplement might differ from the CC-BY 3.0 licence. 31 1. Particle size distributions for amine-reacted diacids and -cedrene secondary organic 32 aerosol (SOA) particles. 33 1.1 Amine-reacted diacid particles. 34 At the exit of the flow reactor, size distributions of the amine-reacted diacid particles were 35 collected using a scanning mobility particle sizer (SMPS, TSI) consisting of an electrostatic 36 classifier (model 3080), a long differential mobility analyzer (DMA, model 3081) and a 37 condensation particle counter (model 3025A or 3776). Typical surface weighted size 38 distributions for (a) malonic acid (C3), (b) glutaric acid (C5), and (c) pimelic acid (C7) reacted 39 particles are presented in Fig. S1, with size distribution statistics given in Table S1. To reflect 40 the ~10% loss of amine-diacid particles in the denuder, a correction factor, Cf, of 1.1 was applied 41 when calculating the fraction of amine in the particles, fp. 3 (a) Malonic acid particles 1.6 (b) Glutaric acid particles ) ) w/o denuder -3 w/o denuder -3 w/ denuder w/ denuder cm cm 1.2 2 2 2 cm cm -4 -4 0.8 (10 (10 p p 1 0.4 dS/dlogD dS/dlogD 0 0.0 100 1000 100 1000 D (nm) D (nm) 42 p p 3 (c) Pimelic acid particles w/o denuder ) -3 w/ denuder Figure S1.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Acot13 (NM 025790) Mouse Untagged Clone – MC203714 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MC203714 Acot13 (NM_025790) Mouse Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Acot13 (NM_025790) Mouse Untagged Clone Tag: Tag Free Symbol: Acot13 Synonyms: 0610006O17Rik; Them2 Vector: PCMV6-Kan/Neo E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >BC018165 TGATCATCTAGGACCAGGGCGACCGGGGCGCGCGATCCTTTCTCCCGAGCACGACGCGACACCGCCCGGG CTTGCAGACTTGACCTTCCACACCCTTGTCCTCTCACAAACGTCTCTTCCAGAGTTCACTCTCGCAGAGC CCAGACTCTTGCTTTGCGTCCACGATGAGCAGCATGACCCAGAACCTACGAGAAGTAATGAAGGTTATGT TCAAAGTTCCCGGTTTTGATAGAGTTTTGGAAAAGGTGACGCTTGTCTCGGCTGCTCCTGAGAAACTAAT CTGTGAGATGAAGGTGGAGGAGCAGCATACTAATAAGCTGGGTACGCTCCATGGAGGCTTGACAGCAACC TTAGTGGACAGCATCTCGACCATGGCTCTAATGTGCACAGAAAGAGGAGCACCCGGAGTCAGTGTGGACA TGAACATAACGTACATGTCACCTGCTAAGATAGGAGAAGAAATAGTGATCACAGCACACATTCTGAAGCA AGGAAAGACACTTGCATTTGCCTCAGTGGATCTGACCAACAAGACCACAGGAAAATTAATAGCACAAGGC AGACACACAAAACACCTGGGGAACTGAGAACAGCGGGAAGACCCGAAGAAGCCCAACAATGCCAAGTATG GTTTGTGAACAACTTTCTGAAATAAATTATCAAAACCAGAAAAAAAAAAAAAAAAAAAA Restriction Sites: RsrII-NotI ACCN: NM_025790 Insert Size: 423 bp OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g.,
    [Show full text]
  • By Submitted in Partial Satisfaction of the Requirements for Degree of in In
    BCL6 maintains thermogenic capacity of brown adipose tissue during dormancy by Vassily Kutyavin DISSERTATION Submitted in partial satisfaction of the requirements for degree of DOCTOR OF PHILOSOPHY in Biomedical Sciences in the GRADUATE DIVISION of the UNIVERSITY OF CALIFORNIA, SAN FRANCISCO Approved: ______________________________________________________________________________Eric Verdin Chair ______________________________________________________________________________Ajay Chawla ______________________________________________________________________________Ethan Weiss ______________________________________________________________________________ ______________________________________________________________________________ Committee Members Copyright 2019 by Vassily Kutyavin ii Dedicated to everyone who has supported me during my scientific education iii Acknowledgements I'm very grateful to my thesis adviser, Ajay Chawla, for his mentorship and support during my dissertation work over the past five years. Throughout my time in his lab, I was always able to rely on his guidance, and his enthusiasm for science was a great source of motivation. Even when he was traveling, he could easily be reached for advice by phone or e- mail. I am particularly grateful for his help with writing the manuscript, which was probably the most challenging aspect of graduate school for me. I am also very grateful to him for helping me find a postdoctoral fellowship position. Ajay's inquisitive and fearless approach to science have been a great inspiration to me. In contrast to the majority of scientists who focus narrowly on a specific topic, Ajay pursued fundamental questions across a broad range of topics and was able to make tremendous contributions. My experience in his lab instilled in me a deep appreciation for thinking about the entire organism from an evolutionary perspective and focusing on the key questions that escape the attention of the larger scientific community. As I move forward in my scientific career, there is no doubt that I will rely on him as a role model.
    [Show full text]
  • Inflammatory Stimuli Induce Acyl-Coa Thioesterase 7 and Remodeling of Phospholipids Containing Unsaturated Long (C20)-Acyl Chains in Macrophages
    Supplemental Material can be found at: http://www.jlr.org/content/suppl/2017/04/17/jlr.M076489.DC1 .html Inflammatory stimuli induce acyl-CoA thioesterase 7 and remodeling of phospholipids containing unsaturated long (C20)-acyl chains in macrophages Valerie Z. Wall,*,† Shelley Barnhart,* Farah Kramer,* Jenny E. Kanter,* Anuradha Vivekanandan-Giri,§ Subramaniam Pennathur,§ Chiara Bolego,** Jessica M. Ellis,§§,*** Miguel A. Gijón,††† Michael J. Wolfgang,*** and Karin E. Bornfeldt1,*,† Department of Medicine,* Division of Metabolism, Endocrinology and Nutrition, and Department of Pathology,† UW Medicine Diabetes Institute, University of Washington, Seattle, WA; Department of Internal Medicine,§ University of Michigan, Ann Arbor, MI; Department of Pharmaceutical and Pharmacological Sciences,** University of Padova, Padova, Italy; Department of Nutrition Science,§§ Purdue University, West Lafayette, IN; Department of Biological Chemistry,*** Johns Hopkins University School of Medicine, Baltimore, MD; and Department of Pharmacology,††† University of Downloaded from Colorado Denver, Aurora, CO Abstract Acyl-CoA thioesterase 7 (ACOT7) is an intracel- containing unsaturated long (C20)-acyl chains in macro- lular enzyme that converts acyl-CoAs to FFAs. ACOT7 is in- phages, and, although ACOT7 has preferential thioesterase duced by lipopolysaccharide (LPS); thus, we investigated activity toward these lipid species, loss of ACOT7 has no ma- www.jlr.org downstream effects of LPS-induced induction of ACOT7 jor detrimental effect on macrophage inflammatory pheno- and its role in inflammatory settings in myeloid cells. Enzy- types.—Wall, V. Z., S. Barnhart, F. Kramer, J. E. Kanter, matic thioesterase activity assays in WT and ACOT7-deficient A. Vivekanandan-Giri, S. Pennathur, C. Bolego, J. M. Ellis, macrophage lysates indicated that endogenous ACOT7 con- M.
    [Show full text]
  • The Metabolic Serine Hydrolases and Their Functions in Mammalian Physiology and Disease Jonathan Z
    REVIEW pubs.acs.org/CR The Metabolic Serine Hydrolases and Their Functions in Mammalian Physiology and Disease Jonathan Z. Long* and Benjamin F. Cravatt* The Skaggs Institute for Chemical Biology and Department of Chemical Physiology, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, California 92037, United States CONTENTS 2.4. Other Phospholipases 6034 1. Introduction 6023 2.4.1. LIPG (Endothelial Lipase) 6034 2. Small-Molecule Hydrolases 6023 2.4.2. PLA1A (Phosphatidylserine-Specific 2.1. Intracellular Neutral Lipases 6023 PLA1) 6035 2.1.1. LIPE (Hormone-Sensitive Lipase) 6024 2.4.3. LIPH and LIPI (Phosphatidic Acid-Specific 2.1.2. PNPLA2 (Adipose Triglyceride Lipase) 6024 PLA1R and β) 6035 2.1.3. MGLL (Monoacylglycerol Lipase) 6025 2.4.4. PLB1 (Phospholipase B) 6035 2.1.4. DAGLA and DAGLB (Diacylglycerol Lipase 2.4.5. DDHD1 and DDHD2 (DDHD Domain R and β) 6026 Containing 1 and 2) 6035 2.1.5. CES3 (Carboxylesterase 3) 6026 2.4.6. ABHD4 (Alpha/Beta Hydrolase Domain 2.1.6. AADACL1 (Arylacetamide Deacetylase-like 1) 6026 Containing 4) 6036 2.1.7. ABHD6 (Alpha/Beta Hydrolase Domain 2.5. Small-Molecule Amidases 6036 Containing 6) 6027 2.5.1. FAAH and FAAH2 (Fatty Acid Amide 2.1.8. ABHD12 (Alpha/Beta Hydrolase Domain Hydrolase and FAAH2) 6036 Containing 12) 6027 2.5.2. AFMID (Arylformamidase) 6037 2.2. Extracellular Neutral Lipases 6027 2.6. Acyl-CoA Hydrolases 6037 2.2.1. PNLIP (Pancreatic Lipase) 6028 2.6.1. FASN (Fatty Acid Synthase) 6037 2.2.2. PNLIPRP1 and PNLIPR2 (Pancreatic 2.6.2.
    [Show full text]
  • Antidiabetic E4orf1 Protein Prevents Hepatic Steatosis and Reduces Markers of Aging-­Related Cellular Damage in High Fat Fed Older Mice
    Obesity studies Open access Original research BMJ Open Diab Res Care: first published as 10.1136/bmjdrc-2020-002096 on 3 May 2021. Downloaded from Antidiabetic E4orf1 protein prevents hepatic steatosis and reduces markers of aging- related cellular damage in high fat fed older mice Zahra Mostofinejad,1,2 Md Akheruzzaman ,1 Md Abu Bakkar Siddik ,1 Presheet Patkar,1 Nikhil V Dhurandhar,1 Vijay Hegde 1 To cite: Mostofinejad Z, ABSTRACT Akheruzzaman M, Introduction Older age is associated with greater Significance of this study Abu Bakkar Siddik M, et al. prevalence of hyperinsulinemia, type 2 diabetes, and fatty Antidiabetic E4orf1 protein liver disease. These metabolic conditions and aging are What is already known about this subject? prevents hepatic steatosis bidirectionally linked to mitochondrial dysfunction and ► Metabolic disorders such as hyperinsulinemia, type and reduces markers of 2 diabetes and fatty liver disease and aging are bi- aging- related cellular damage telomere attrition. Although effectively addressing these conditions is important for influencing the health and directionally associated with mitochondrial dysfunc- in high fat fed older mice. tion and telomere attrition. BMJ Open Diab Res Care the lifespan, it is particularly challenging in older age. ► Modifying certain biomarkers like deregulated nutri- 2021;9:e002096. doi:10.1136/ We reported that E4orf1, a protein derived from human bmjdrc-2020-002096 adenovirus Ad36, reduces hyperinsulinemia, improves ent sensing, mitochondrial dysfunction, cellular se- glucose clearance, and protects against hepatic steatosis nescence caused by telomere attrition and genomic in younger mice exposed to high fat diet (HFD). Here, we instability are strategies to improve the health span ZM and MA contributed equally.
    [Show full text]
  • Flawed Phospholipid Formation Or Faulty Fatty Acid Oxidation: Determining the Cause of Mitochondrial Dysfunction in Hearts Lacking Acsl1
    FLAWED PHOSPHOLIPID FORMATION OR FAULTY FATTY ACID OXIDATION: DETERMINING THE CAUSE OF MITOCHONDRIAL DYSFUNCTION IN HEARTS LACKING ACSL1 Trisha J. Grevengoed A dissertation submitted to the faculty at the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Nutrition (Biochemistry) in the School of Public Health. Chapel Hill 2015 Approved by: Rosalind A. Coleman Stephen D. Hursting Liza Makowski Leslie V. Parise Steven H. Zeisel © 2015 Trisha J. Grevengoed ALL RIGHTS RESERVED ii ABSTRACT Trisha J. Grevengoed: Fatty acid activation in cardiac mitochondria: The role of ACSL1 in phospholipid formation and remodeling, substrate switching, and autophagic flux (Under the direction of Rosalind A. Coleman) Cardiovascular disease is the number one cause of death worldwide. In the heart, mitochondria provide up to 95% of energy, with most of this energy coming from metabolism of fatty acids (FA). FA must be converted to acyl-CoAs by acyl-CoA synthetases (ACS) before entry into pathways of β- oxidation or glycerolipid synthesis. ACSL1 contributes more than 90% of total cardiac ACSL activity, and mice with an inducible knockout of ACSL1 (Acsl1T-/-) have impaired cardiac FA oxidation. The effects of loss of ACSL1 on mitochondrial respiratory function, phospholipid formation, or autophagic flux have not yet been studied. Acsl1T-/- hearts contained 3-fold more mitochondria with abnormal structure and displayed lower respiratory function. Because ACSL1 exhibited a strong substrate preference for linoleate (18:2), we investigated the composition of mitochondrial phospholipids. Acsl1T-/- hearts contained 83% less tetralinoleoyl-cardiolipin (CL), the major form present in control hearts.
    [Show full text]
  • Downloaded from (2007)
    ARTICLE https://doi.org/10.1038/s41467-020-14796-x OPEN Alterations in promoter interaction landscape and transcriptional network underlying metabolic adaptation to diet ✉ Yufeng Qin1, Sara A. Grimm2, John D. Roberts1, Kaliopi Chrysovergis1 & Paul A. Wade 1 Metabolic adaptation to nutritional state requires alterations in gene expression in key tis- sues. Here, we investigated chromatin interaction dynamics, as well as alterations in cis- 1234567890():,; regulatory loci and transcriptional network in a mouse model system. Chronic consumption of a diet high in saturated fat, when compared to a diet high in carbohydrate, led to dramatic reprogramming of the liver transcriptional network. Long-range interaction of promoters with distal regulatory loci, monitored by promoter capture Hi-C, was regulated by metabolic status in distinct fashion depending on diet. Adaptation to a lipid-rich diet, mediated largely by nuclear receptors including Hnf4α, relied on activation of preformed enhancer/promoter loops. Adaptation to carbohydrate-rich diet led to activation of preformed loops and to de novo formation of new promoter/enhancer interactions. These results suggest that adapta- tion to nutritional changes and metabolic stress occurs through both de novo and pre-existing chromatin interactions which respond differently to metabolic signals. 1 Eukaryotic Transcriptional Regulation Group, Epigenetics and Stem Cell Biology Laboratory, National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709, USA. 2 Integrative Bioinformatics
    [Show full text]
  • Production of Malonic Acid Through the Fermentation of Glucose
    University of Pennsylvania ScholarlyCommons Department of Chemical & Biomolecular Senior Design Reports (CBE) Engineering 4-20-2018 Production of Malonic Acid through the Fermentation of Glucose Emily P. Peters University of Pennsylvania, [email protected] Gabrielle J. Schlakman University of Pennsylvania, [email protected] Elise N. Yang University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/cbe_sdr Part of the Biochemical and Biomolecular Engineering Commons Peters, Emily P.; Schlakman, Gabrielle J.; and Yang, Elise N., "Production of Malonic Acid through the Fermentation of Glucose" (2018). Senior Design Reports (CBE). 107. https://repository.upenn.edu/cbe_sdr/107 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/cbe_sdr/107 For more information, please contact [email protected]. Production of Malonic Acid through the Fermentation of Glucose Abstract The overall process to produce malonic acid has not drastically changed in the past 50 years. The current process is damaging to the environment and costly, requiring high market prices. Lygos, Inc., a lab in Berkeley, California, has published a patent describing a way to produce malonic acid through the biological fermentation of genetically modified easty cells. This proposed technology is appealing as it is both better for the environment and economically friendly. For the process discussed in this report, genetically modified Pichia Kudriavzevii yeast cells will be purchased from the Lygos lab along with the negotiation of exclusive licensing rights to the technology. The cells will be grown in fermentation vessels, while being constantly fed oxygen, glucose and fermentation media. The cells will excrete malonic acid in the 101 hour fermentation process.
    [Show full text]