DOCSLIB.ORG

Antidiabetic E4orf1 Protein Prevents Hepatic Steatosis and Reduces Markers of Aging-­Related Cellular Damage in High Fat Fed Older Mice

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Antidiabetic E4orf1 Protein Prevents Hepatic Steatosis and Reduces Markers of Aging-­Related Cellular Damage in High Fat Fed Older Mice Obesity studies Open access Original research BMJ Open Diab Res Care: first published as 10.1136/bmjdrc-2020-002096 on 3 May 2021. Downloaded from Antidiabetic E4orf1 protein prevents hepatic steatosis and reduces markers of aging- related cellular damage in high fat fed older mice Zahra Mostofinejad,1,2 Md Akheruzzaman ,1 Md Abu Bakkar Siddik ,1 Presheet Patkar,1 Nikhil V Dhurandhar,1 Vijay Hegde 1 To cite: Mostofinejad Z, ABSTRACT Akheruzzaman M, Introduction Older age is associated with greater Significance of this study Abu Bakkar Siddik M, et al. prevalence of hyperinsulinemia, type 2 diabetes, and fatty Antidiabetic E4orf1 protein liver disease. These metabolic conditions and aging are What is already known about this subject? prevents hepatic steatosis bidirectionally linked to mitochondrial dysfunction and ► Metabolic disorders such as hyperinsulinemia, type and reduces markers of 2 diabetes and fatty liver disease and aging are bi- aging- related cellular damage telomere attrition. Although effectively addressing these conditions is important for influencing the health and directionally associated with mitochondrial dysfunc- in high fat fed older mice. tion and telomere attrition. BMJ Open Diab Res Care the lifespan, it is particularly challenging in older age. ► Modifying certain biomarkers like deregulated nutri- 2021;9:e002096. doi:10.1136/ We reported that E4orf1, a protein derived from human bmjdrc-2020-002096 adenovirus Ad36, reduces hyperinsulinemia, improves ent sensing, mitochondrial dysfunction, cellular se- glucose clearance, and protects against hepatic steatosis nescence caused by telomere attrition and genomic in younger mice exposed to high fat diet (HFD). Here, we instability are strategies to improve the health span ZM and MA contributed equally. tested if E4orf1 will improve glycemic control, liver fat of an individual. accumulation, mitochondrial integrity, and reduce telomere ► Despite lifestyle modifications and antidiabetic Components of this study agents showing health benefits, there are limitations have been presented at the attrition in older mice. and better therapeutic interventions are needed for American Society of Nutrition Research design and methods We used 9- month- old annual meeting in 2018 and at mice that inducibly expressed E4orf1 in adipose tissue and delaying aging-rela ted risk factors. non-E4orf1 expressing control mice. Mice were maintained Obesity week 2020. What are the new findings? on a 60% (kcal) HFD for 20 weeks and glycemic control In high fat fed older mice, adenoviral protein E4orf1 Received 24 December 2020 was determined by intraperitoneal glucose tolerance test ► significantly improves glycemic control in an insulin Revised 30 March 2021 at week 20. Following 20 weeks of HF- feeding, mice independent manner. http://drc.bmj.com/ Accepted 10 April 2021 were sacrificed and liver tissues collected to determine E4orf1 expression reduces hepatic steatosis and fi- the expression of aging genes using qRT-PCR based RT2 ► brosis despite high fat diet in these mice. Profiler PCR array. Results Compared with the control mice, E4orf1 ► E4orf1 expression also reduces aging- related hepat- significantly improved glycemic control and reduced ic markers of mitochondrial integrity and telomere hepatic steatosis and fibrosis. Additionally, E4orf1 attrition. maintained markers of mitochondrial integrity and How might these results change the focus of on September 26, 2021 by guest. Protected copyright. telomere attrition. research or clinical practice? Conclusion E4orf1 has the potential to improve glycemic ► Given the challenges among the elderly in improv- control in older mice, and the improvement persists ing aging associated comorbidities, use of E4orf1 as even after longer term exposure. E4orf1 expression also © Author(s) (or their a therapeutic target in improving glycemic control, employer(s)) 2021. Re- use maintains mitochondrial integrity and telomere attrition, protecting against hepatic fat accumulation and permitted under CC BY-NC. No thus delaying age- associated diseases. This provides reducing aging- associated cellular damage despite commercial re- use. See rights strong evidence for therapeutic utility of E4orf1 in chronic high fat diet will be clinically desirable. and permissions. Published improving age- associated metabolic and cellular changes by BMJ. that occur with aging in humans. 1Department of Nutritional Sciences, Texas Tech University, Lubbock, Texas, USA shares many chronic metabolic disorders with 2Department of Nutrition and INTRODUCTION obesity and type 2 diabetes (T2D), such as Environmental Toxicology, Aging is a very intricate process that leads to insulin resistance, poor glycemic control, and University of California, Davis, the structural and functional decline of organs chronic low- grade inflammation.2 Advanced California, USA and tissues, marked by chronic systemic age is also associated with ectopic lipid accu- Correspondence to inflammation, oxidative stress, DNA damage, mulation in the liver and can increase the Dr Vijay Hegde; impaired mitochondrial function, cellular prevalence of nonalcoholic fatty liver disease vijay. hegde@ ttu. edu senescence, and tissue dysfunction.1 Aging (NAFLD).3 While the contribution of obesity, BMJ Open Diab Res Care 2021;9:e002096. doi:10.1136/bmjdrc-2020-002096 1 Obesity studies BMJ Open Diab Res Care: first published as 10.1136/bmjdrc-2020-002096 on 3 May 2021. Downloaded from T2D, NAFLD, and nonalcoholic steatohepatitis (NASH) showed that humans who are naturally exposed to Ad36 in the etiology of aging is somewhat ambiguous, given have better glycemic control and, importantly, lower the complexity, the onset of these diseases through meta- hepatic steatosis or NAFLD prevalence.22 23 All these bolic alterations and acceleration of aging could be a features of E4orf1 protein appear to be attractive for vicious cycle.4 the alleviation of several risk factors of aging, which One of the key factors related with cellular aging is telo- may include improved glycemic control and protection mere attrition and damage.5 Several studies have shown against NAFLD but needs further investigation, particu- that patients with T2D have shorter telomeres in white larly in an older mouse model. blood cell and in pancreatic β-cells than non‐T2D indi- In the current study, we determined if E4orf1 can viduals.6 7 Additionally, decline in mitochondrial function improve glycemic control in an insulin independent or an increase in reactive oxygen species (ROS) has also manner in HFD-fed older mice. More specifically, we been implicated in aging.8 Further, it has been shown wanted to test if E4orf1 mediated protection against that telomere dysfunction is associated with a decline in hepatic steatosis can potentially prevent its progression to mitochondrial function.9 Alternatively, hyperglycemia fibrosis and delay aging- associated molecular dynamics. has been shown to induce mitochondrial dysfunction,10 suggesting a bidirectional relationship between T2D and aging associated telomere attrition and mitochondrial RESEARCH DESIGN AND METHODS dysfunction. Animal model and experimental design In view of the complex nature of the aging process, Transgenic C57BL/6J mice expressing Ad36E4orf1 quantitative biomarkers like epigenetic alterations, protein (n=7, M=4, F=3) or non-transgenic littermates deregulated nutrient sensing, mitochondrial dysfunc- (C57BL/6 mice, n=8, M=4, F=4) from our breeding tion, cellular senescence caused by telomere attrition and colony were included in this study. Animals were handled genomic instability predict health span of an individual11 following Texas Tech University Institutional Animal and potentially can be modified. Dietary restriction Care and Use Committee guidelines. All mice were and exercise have been the most studied interventions group- housed, on a 12 hours light/12 hours dark cycle at in improving aging associated risk factors.12 13 However, 25°C, with ad libitum access to chow diet (protein 24%, poor compliance associated with these lifestyle modifica- carbohydrate 60%, and fat 16%) and water. Weekly body tions makes them challenging, especially for the elderly. weight was recorded. After taking baseline measurements Well maintained glycemic control could prevent or delay at 9 months of age, animals were switched to a high fat- the development of multiple age- related disorders and doxycycline diet (HF- dox; 60% kcal from fat, dox 600 might slow the aging process.14 Currently, several antidi- ppm/kg) until their sacrifice (at week 20). Following 20 abetic agents are used for maintaining glycemic control. weeks of HF- dox feeding, blood glucose was measured Common among them is insulin sensitizer metformin, after 4 hours fasting and 15 min after a glucose challenge which also improves health span in mice15 and shows as described previously.17 Serum insulin was also assessed reduced mortality in patients with diabetes compared by ELISA (EMD Millipore, Cat. EZRMI-13K). Mice were http://drc.bmj.com/ 16 with patients with diabetes not receiving metformin. then sacrificed using CO2 asphyxiation and cervical dislo- One of the limitations with efficacy of many antidiabetic cation and cardiac puncture blood was collected. Liver drugs is the requirement of a functional insulin signaling and other peripheral tissues were harvested, frozen pathway, which is often impaired during T2D. Therefore, immediately in liquid nitrogen, and preserved at −80°C therapeutic interventions for delaying aging
Load more

Recommended publications
  • (12) Patent Application Publication (10) Pub. No.: US 2015/0337275 A1 Pearlman Et Al
    US 20150337275A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2015/0337275 A1 Pearlman et al. (43) Pub. Date: Nov. 26, 2015 (54) BOCONVERSION PROCESS FOR Publication Classification PRODUCING NYLON-7, NYLON-7.7 AND POLYESTERS (51) Int. C. CI2N 9/10 (2006.01) (71) Applicant: INVISTATECHNOLOGIES S.a.r.l., CI2P 7/40 (2006.01) St. Gallen (CH) CI2PI3/00 (2006.01) CI2PI3/04 (2006.01) (72) Inventors: Paul S. Pearlman, Thornton, PA (US); CI2P 13/02 (2006.01) Changlin Chen, Cleveland (GB); CI2N 9/16 (2006.01) Adriana L. Botes, Cleveland (GB); Alex CI2N 9/02 (2006.01) Van Eck Conradie, Cleveland (GB); CI2N 9/00 (2006.01) Benjamin D. Herzog, Wichita, KS (US) CI2P 7/44 (2006.01) CI2P I 7/10 (2006.01) (73) Assignee: INVISTATECHNOLOGIES S.a.r.l., (52) U.S. C. St. Gallen (CH) CPC. CI2N 9/13 (2013.01); C12P 7/44 (2013.01); CI2P 7/40 (2013.01); CI2P 13/005 (2013.01); (21) Appl. No.: 14/367,484 CI2P 17/10 (2013.01); CI2P 13/02 (2013.01); CI2N 9/16 (2013.01); CI2N 9/0008 (2013.01); (22) PCT Fled: Dec. 21, 2012 CI2N 9/93 (2013.01); CI2P I3/04 (2013.01); PCT NO.: PCT/US2012/071.472 CI2P 13/001 (2013.01); C12Y 102/0105 (86) (2013.01) S371 (c)(1), (2) Date: Jun. 20, 2014 (57) ABSTRACT Embodiments of the present invention relate to methods for Related U.S. Application Data the biosynthesis of di- or trifunctional C7 alkanes in the (60) Provisional application No.
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Acot13 (NM 025790) Mouse Untagged Clone – MC203714 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MC203714 Acot13 (NM_025790) Mouse Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Acot13 (NM_025790) Mouse Untagged Clone Tag: Tag Free Symbol: Acot13 Synonyms: 0610006O17Rik; Them2 Vector: PCMV6-Kan/Neo E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >BC018165 TGATCATCTAGGACCAGGGCGACCGGGGCGCGCGATCCTTTCTCCCGAGCACGACGCGACACCGCCCGGG CTTGCAGACTTGACCTTCCACACCCTTGTCCTCTCACAAACGTCTCTTCCAGAGTTCACTCTCGCAGAGC CCAGACTCTTGCTTTGCGTCCACGATGAGCAGCATGACCCAGAACCTACGAGAAGTAATGAAGGTTATGT TCAAAGTTCCCGGTTTTGATAGAGTTTTGGAAAAGGTGACGCTTGTCTCGGCTGCTCCTGAGAAACTAAT CTGTGAGATGAAGGTGGAGGAGCAGCATACTAATAAGCTGGGTACGCTCCATGGAGGCTTGACAGCAACC TTAGTGGACAGCATCTCGACCATGGCTCTAATGTGCACAGAAAGAGGAGCACCCGGAGTCAGTGTGGACA TGAACATAACGTACATGTCACCTGCTAAGATAGGAGAAGAAATAGTGATCACAGCACACATTCTGAAGCA AGGAAAGACACTTGCATTTGCCTCAGTGGATCTGACCAACAAGACCACAGGAAAATTAATAGCACAAGGC AGACACACAAAACACCTGGGGAACTGAGAACAGCGGGAAGACCCGAAGAAGCCCAACAATGCCAAGTATG GTTTGTGAACAACTTTCTGAAATAAATTATCAAAACCAGAAAAAAAAAAAAAAAAAAAA Restriction Sites: RsrII-NotI ACCN: NM_025790 Insert Size: 423 bp OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g.,
    [Show full text]
  • By Submitted in Partial Satisfaction of the Requirements for Degree of in In
    BCL6 maintains thermogenic capacity of brown adipose tissue during dormancy by Vassily Kutyavin DISSERTATION Submitted in partial satisfaction of the requirements for degree of DOCTOR OF PHILOSOPHY in Biomedical Sciences in the GRADUATE DIVISION of the UNIVERSITY OF CALIFORNIA, SAN FRANCISCO Approved: ______________________________________________________________________________Eric Verdin Chair ______________________________________________________________________________Ajay Chawla ______________________________________________________________________________Ethan Weiss ______________________________________________________________________________ ______________________________________________________________________________ Committee Members Copyright 2019 by Vassily Kutyavin ii Dedicated to everyone who has supported me during my scientific education iii Acknowledgements I'm very grateful to my thesis adviser, Ajay Chawla, for his mentorship and support during my dissertation work over the past five years. Throughout my time in his lab, I was always able to rely on his guidance, and his enthusiasm for science was a great source of motivation. Even when he was traveling, he could easily be reached for advice by phone or e- mail. I am particularly grateful for his help with writing the manuscript, which was probably the most challenging aspect of graduate school for me. I am also very grateful to him for helping me find a postdoctoral fellowship position. Ajay's inquisitive and fearless approach to science have been a great inspiration to me. In contrast to the majority of scientists who focus narrowly on a specific topic, Ajay pursued fundamental questions across a broad range of topics and was able to make tremendous contributions. My experience in his lab instilled in me a deep appreciation for thinking about the entire organism from an evolutionary perspective and focusing on the key questions that escape the attention of the larger scientific community. As I move forward in my scientific career, there is no doubt that I will rely on him as a role model.
    [Show full text]
  • Inflammatory Stimuli Induce Acyl-Coa Thioesterase 7 and Remodeling of Phospholipids Containing Unsaturated Long (C20)-Acyl Chains in Macrophages
    Supplemental Material can be found at: http://www.jlr.org/content/suppl/2017/04/17/jlr.M076489.DC1 .html Inflammatory stimuli induce acyl-CoA thioesterase 7 and remodeling of phospholipids containing unsaturated long (C20)-acyl chains in macrophages Valerie Z. Wall,*,† Shelley Barnhart,* Farah Kramer,* Jenny E. Kanter,* Anuradha Vivekanandan-Giri,§ Subramaniam Pennathur,§ Chiara Bolego,** Jessica M. Ellis,§§,*** Miguel A. Gijón,††† Michael J. Wolfgang,*** and Karin E. Bornfeldt1,*,† Department of Medicine,* Division of Metabolism, Endocrinology and Nutrition, and Department of Pathology,† UW Medicine Diabetes Institute, University of Washington, Seattle, WA; Department of Internal Medicine,§ University of Michigan, Ann Arbor, MI; Department of Pharmaceutical and Pharmacological Sciences,** University of Padova, Padova, Italy; Department of Nutrition Science,§§ Purdue University, West Lafayette, IN; Department of Biological Chemistry,*** Johns Hopkins University School of Medicine, Baltimore, MD; and Department of Pharmacology,††† University of Downloaded from Colorado Denver, Aurora, CO Abstract Acyl-CoA thioesterase 7 (ACOT7) is an intracel- containing unsaturated long (C20)-acyl chains in macro- lular enzyme that converts acyl-CoAs to FFAs. ACOT7 is in- phages, and, although ACOT7 has preferential thioesterase duced by lipopolysaccharide (LPS); thus, we investigated activity toward these lipid species, loss of ACOT7 has no ma- www.jlr.org downstream effects of LPS-induced induction of ACOT7 jor detrimental effect on macrophage inflammatory pheno- and its role in inflammatory settings in myeloid cells. Enzy- types.—Wall, V. Z., S. Barnhart, F. Kramer, J. E. Kanter, matic thioesterase activity assays in WT and ACOT7-deficient A. Vivekanandan-Giri, S. Pennathur, C. Bolego, J. M. Ellis, macrophage lysates indicated that endogenous ACOT7 con- M.
    [Show full text]
  • Flawed Phospholipid Formation Or Faulty Fatty Acid Oxidation: Determining the Cause of Mitochondrial Dysfunction in Hearts Lacking Acsl1
    FLAWED PHOSPHOLIPID FORMATION OR FAULTY FATTY ACID OXIDATION: DETERMINING THE CAUSE OF MITOCHONDRIAL DYSFUNCTION IN HEARTS LACKING ACSL1 Trisha J. Grevengoed A dissertation submitted to the faculty at the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Nutrition (Biochemistry) in the School of Public Health. Chapel Hill 2015 Approved by: Rosalind A. Coleman Stephen D. Hursting Liza Makowski Leslie V. Parise Steven H. Zeisel © 2015 Trisha J. Grevengoed ALL RIGHTS RESERVED ii ABSTRACT Trisha J. Grevengoed: Fatty acid activation in cardiac mitochondria: The role of ACSL1 in phospholipid formation and remodeling, substrate switching, and autophagic flux (Under the direction of Rosalind A. Coleman) Cardiovascular disease is the number one cause of death worldwide. In the heart, mitochondria provide up to 95% of energy, with most of this energy coming from metabolism of fatty acids (FA). FA must be converted to acyl-CoAs by acyl-CoA synthetases (ACS) before entry into pathways of β- oxidation or glycerolipid synthesis. ACSL1 contributes more than 90% of total cardiac ACSL activity, and mice with an inducible knockout of ACSL1 (Acsl1T-/-) have impaired cardiac FA oxidation. The effects of loss of ACSL1 on mitochondrial respiratory function, phospholipid formation, or autophagic flux have not yet been studied. Acsl1T-/- hearts contained 3-fold more mitochondria with abnormal structure and displayed lower respiratory function. Because ACSL1 exhibited a strong substrate preference for linoleate (18:2), we investigated the composition of mitochondrial phospholipids. Acsl1T-/- hearts contained 83% less tetralinoleoyl-cardiolipin (CL), the major form present in control hearts.
    [Show full text]
  • Downloaded from (2007)
    ARTICLE https://doi.org/10.1038/s41467-020-14796-x OPEN Alterations in promoter interaction landscape and transcriptional network underlying metabolic adaptation to diet ✉ Yufeng Qin1, Sara A. Grimm2, John D. Roberts1, Kaliopi Chrysovergis1 & Paul A. Wade 1 Metabolic adaptation to nutritional state requires alterations in gene expression in key tis- sues. Here, we investigated chromatin interaction dynamics, as well as alterations in cis- 1234567890():,; regulatory loci and transcriptional network in a mouse model system. Chronic consumption of a diet high in saturated fat, when compared to a diet high in carbohydrate, led to dramatic reprogramming of the liver transcriptional network. Long-range interaction of promoters with distal regulatory loci, monitored by promoter capture Hi-C, was regulated by metabolic status in distinct fashion depending on diet. Adaptation to a lipid-rich diet, mediated largely by nuclear receptors including Hnf4α, relied on activation of preformed enhancer/promoter loops. Adaptation to carbohydrate-rich diet led to activation of preformed loops and to de novo formation of new promoter/enhancer interactions. These results suggest that adapta- tion to nutritional changes and metabolic stress occurs through both de novo and pre-existing chromatin interactions which respond differently to metabolic signals. 1 Eukaryotic Transcriptional Regulation Group, Epigenetics and Stem Cell Biology Laboratory, National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709, USA. 2 Integrative Bioinformatics
    [Show full text]
  • Suppression of Fatty Acid Oxidation by Thioesterase Superfamily Member
    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.21.440732; this version posted April 21, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Suppression of Fatty Acid Oxidation by Thioesterase Superfamily Member 2 in Skeletal Muscle Promotes Hepatic Steatosis and Insulin Resistance Norihiro Imai1, Hayley T. Nicholls1, Michele Alves-Bezerra1, Yingxia Li1, Anna A. Ivanova2, Eric A. Ortlund2, and David E. Cohen1 1Division of Gastroenterology and Hepatology, Joan & Sanford I. Weill Department of Medicine, Weill Cornell Medical College, NY 10021 USA 2Department of Biochemistry, Emory University, Atlanta, GA 30322 USA Current addresses: Norihiro Imai - Department of Gastroenterology and Hepatology, Nagoya University School of Medicine, Aichi 4668560 Japan Michele Alves-Bezerra - Department of Molecular Physiology and Biophysics, Baylor College of Medicine, Houston, TX 77030 USA bioRxiv preprint doi: https://doi.org/10.1101/2021.04.21.440732; this version posted April 21, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Figure number: 8 Supplemental figure number: 10 Supplemental table number: 2 References: 48 Keywords: Hepatic steatosis, obesity, acyl-CoA thioesterase, fatty acid oxidation, insulin resistance Conflict of interest: The authors have declared that no conflict of interest exists. Author contributions: N.I.: designed research studies, conducted experiments, acquired data, analyzed data and wrote manuscript. H.T.N.: conducted experiments and analyzed data, M.A.B.: designed research studies and conducted experiments, Y.L.: acquired data, A.A.I.: conducted experiments and analyzed data, E.A.O.: analyzed data, D.E.C.: designed research studies, analyzed data and wrote manuscript.
    [Show full text]
  • Molecular Signatures Differentiate Immune States in Type 1 Diabetes Families
    Page 1 of 65 Diabetes Molecular signatures differentiate immune states in Type 1 diabetes families Yi-Guang Chen1, Susanne M. Cabrera1, Shuang Jia1, Mary L. Kaldunski1, Joanna Kramer1, Sami Cheong2, Rhonda Geoffrey1, Mark F. Roethle1, Jeffrey E. Woodliff3, Carla J. Greenbaum4, Xujing Wang5, and Martin J. Hessner1 1The Max McGee National Research Center for Juvenile Diabetes, Children's Research Institute of Children's Hospital of Wisconsin, and Department of Pediatrics at the Medical College of Wisconsin Milwaukee, WI 53226, USA. 2The Department of Mathematical Sciences, University of Wisconsin-Milwaukee, Milwaukee, WI 53211, USA. 3Flow Cytometry & Cell Separation Facility, Bindley Bioscience Center, Purdue University, West Lafayette, IN 47907, USA. 4Diabetes Research Program, Benaroya Research Institute, Seattle, WA, 98101, USA. 5Systems Biology Center, the National Heart, Lung, and Blood Institute, the National Institutes of Health, Bethesda, MD 20824, USA. Corresponding author: Martin J. Hessner, Ph.D., The Department of Pediatrics, The Medical College of Wisconsin, Milwaukee, WI 53226, USA Tel: 011-1-414-955-4496; Fax: 011-1-414-955-6663; E-mail: [email protected]. Running title: Innate Inflammation in T1D Families Word count: 3999 Number of Tables: 1 Number of Figures: 7 1 For Peer Review Only Diabetes Publish Ahead of Print, published online April 23, 2014 Diabetes Page 2 of 65 ABSTRACT Mechanisms associated with Type 1 diabetes (T1D) development remain incompletely defined. Employing a sensitive array-based bioassay where patient plasma is used to induce transcriptional responses in healthy leukocytes, we previously reported disease-specific, partially IL-1 dependent, signatures associated with pre and recent onset (RO) T1D relative to unrelated healthy controls (uHC).
    [Show full text]
  • Identification of Genomic Targets of Krüppel-Like Factor 9 in Mouse Hippocampal
    Identification of Genomic Targets of Krüppel-like Factor 9 in Mouse Hippocampal Neurons: Evidence for a role in modulating peripheral circadian clocks by Joseph R. Knoedler A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Neuroscience) in the University of Michigan 2016 Doctoral Committee: Professor Robert J. Denver, Chair Professor Daniel Goldman Professor Diane Robins Professor Audrey Seasholtz Associate Professor Bing Ye ©Joseph R. Knoedler All Rights Reserved 2016 To my parents, who never once questioned my decision to become the other kind of doctor, And to Lucy, who has pushed me to be a better person from day one. ii Acknowledgements I have a huge number of people to thank for having made it to this point, so in no particular order: -I would like to thank my adviser, Dr. Robert J. Denver, for his guidance, encouragement, and patience over the last seven years; his mentorship has been indispensable for my growth as a scientist -I would also like to thank my committee members, Drs. Audrey Seasholtz, Dan Goldman, Diane Robins and Bing Ye, for their constructive feedback and their willingness to meet in a frequently cold, windowless room across campus from where they work -I am hugely indebted to Pia Bagamasbad and Yasuhiro Kyono for teaching me almost everything I know about molecular biology and bioinformatics, and to Arasakumar Subramani for his tireless work during the home stretch to my dissertation -I am grateful for the Neuroscience Program leadership and staff, in particular
    [Show full text]
  • Thioesterase-Mediated Control of Cellular Calcium Homeostasis Enables Hepatic ER Stress
    Thioesterase-mediated control of cellular calcium homeostasis enables hepatic ER stress Baran A. Ersoy, … , Ipek Alpertunga, David E. Cohen J Clin Invest. 2018;128(1):141-156. https://doi.org/10.1172/JCI93123. Research Article Cell biology Metabolism The incorporation of excess saturated free fatty acids (SFAs) into membrane phospholipids within the ER promotes ER stress, insulin resistance, and hepatic gluconeogenesis. Thioesterase superfamily member 2 (Them2) is a mitochondria- associated long-chain fatty acyl-CoA thioesterase that is activated upon binding phosphatidylcholine transfer protein (PC- TP). Under fasting conditions, the Them2/PC-TP complex directs saturated fatty acyl-CoA toward β-oxidation. Here, we showed that during either chronic overnutrition or acute induction of ER stress, Them2 and PC-TP play critical roles in trafficking SFAs into the glycerolipid biosynthetic pathway to form saturated phospholipids, which ultimately reduce ER membrane fluidity. The Them2/PC-TP complex activated ER stress pathways by enhancing translocon-mediated efflux of ER calcium. The increased cytosolic calcium, in turn, led to the phosphorylation of calcium/calmodulin-dependent protein kinase II, which promoted both hepatic insulin resistance and gluconeogenesis. These findings delineate a mechanistic link between obesity and insulin resistance and establish the Them2/PC-TP complex as an attractive target for the management of hepatic steatosis and insulin resistance. Find the latest version: https://jci.me/93123/pdf The Journal of Clinical Investigation RESEARCH ARTICLE Thioesterase-mediated control of cellular calcium homeostasis enables hepatic ER stress Baran A. Ersoy, Kristal M. Maner-Smith, Yingxia Li, Ipek Alpertunga, and David E. Cohen Department of Medicine, Division of Gastroenterology and Hepatology, Weill Cornell Medical College, New York, New York, USA.
    [Show full text]