DOCSLIB.ORG

Flawed Phospholipid Formation Or Faulty Fatty Acid Oxidation: Determining the Cause of Mitochondrial Dysfunction in Hearts Lacking Acsl1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Flawed Phospholipid Formation Or Faulty Fatty Acid Oxidation: Determining the Cause of Mitochondrial Dysfunction in Hearts Lacking Acsl1 FLAWED PHOSPHOLIPID FORMATION OR FAULTY FATTY ACID OXIDATION: DETERMINING THE CAUSE OF MITOCHONDRIAL DYSFUNCTION IN HEARTS LACKING ACSL1 Trisha J. Grevengoed A dissertation submitted to the faculty at the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Nutrition (Biochemistry) in the School of Public Health. Chapel Hill 2015 Approved by: Rosalind A. Coleman Stephen D. Hursting Liza Makowski Leslie V. Parise Steven H. Zeisel © 2015 Trisha J. Grevengoed ALL RIGHTS RESERVED ii ABSTRACT Trisha J. Grevengoed: Fatty acid activation in cardiac mitochondria: The role of ACSL1 in phospholipid formation and remodeling, substrate switching, and autophagic flux (Under the direction of Rosalind A. Coleman) Cardiovascular disease is the number one cause of death worldwide. In the heart, mitochondria provide up to 95% of energy, with most of this energy coming from metabolism of fatty acids (FA). FA must be converted to acyl-CoAs by acyl-CoA synthetases (ACS) before entry into pathways of β- oxidation or glycerolipid synthesis. ACSL1 contributes more than 90% of total cardiac ACSL activity, and mice with an inducible knockout of ACSL1 (Acsl1T-/-) have impaired cardiac FA oxidation. The effects of loss of ACSL1 on mitochondrial respiratory function, phospholipid formation, or autophagic flux have not yet been studied. Acsl1T-/- hearts contained 3-fold more mitochondria with abnormal structure and displayed lower respiratory function. Because ACSL1 exhibited a strong substrate preference for linoleate (18:2), we investigated the composition of mitochondrial phospholipids. Acsl1T-/- hearts contained 83% less tetralinoleoyl-cardiolipin (CL), the major form present in control hearts. Modulating ACSL1 expression in cell lines confirmed that ACSL1 is necessary for linoleate incorporation into CL. To determine whether increasing content of linoleate in CL would improve mitochondrial respiratory function, control and Acsl1T-/- mice were fed a high linoleate diet, which normalized amount of tetralinoleoyl-CL, but did not improve respiratory function. The metabolic switch from FA use to high glucose use activates mechanistic target of rapamycin complex 1 (mTORC1), which initiates growth by increasing protein and RNA synthesis and FA metabolism while decreasing autophagy. Short-term mTORC1 inhibition normalized mitochondrial structure, number, and maximal respiration rate in Acsl1T-/- hearts but not ADP-stimulated oxygen iii consumption, which was likely caused by lower ATP synthase activity present in both vehicle- and rapamycin-treated Acsl1T-/- hearts. The autophagic rate was 88% lower in Acsl1T-/- hearts. mTORC1 inhibition increased autophagy to a rate that was 3.1-fold higher than in controls, allowing clearance of damaged mitochondria. ACSL1 deficiency in heart activated mTORC1, thereby inhibiting autophagy and increasing the number of damaged mitochondria with impaired respiratory capacity. ACSL1 is required for the normal composition of phospholipid species and maintenance of FA oxidation to prevent low autophagic rate. Loss of ACSL1 causes impaired mitochondrial respiratory function, which can be partially improved by clearing damaged mitochondria but not by normalizing CL. iv ACKNOWLEDGEMENTS I would like to thank Dr. Rosalind Coleman for helping me develop the skills needed to become an independent researcher. She has instilled the value of critical thinking in every aspect of science. Her support and guidance has been invaluable to my development as a scientist. Rosalind has also provided me with a laboratory of people that I can learn from: Jessica Ellis’s support through my first years of graduate school was vital to that time. Daniel Cooper has gone through much of the process with me and has been a useful critic of experiments as well a sympathetic ear when experiments inevitably did not work. Others in the lab, including David Paul, Angela Wendel, Matthew Keogh, and Florencia Pascual have provided guidance and support that I could not have done without. I also want to acknowledge my parents’ support of me through a process which was completely foreign to them. They told me I could be anything I wanted when I grew up, and helped me along every step of the process. Their support has made it possible for me to complete this work. v PREFACE Parts of this dissertation have been or will be published in peer-reviewed journals. The majority of Chapter 1 is taken from a review written in collaboration with Dr. Eric Klett and Dr. Rosalind Coleman that has been published in the Annual Review of Nutrition (1). Chapter 2 is work that has been submitted to the Journal of Lipid Research in which I designed and performed the majority of experiments under the supervision of Dr. Coleman and collaborated with Sarah Martin and Dr. Robert Murphy for measurement of lipid species and with Lalage Katunga and Dr. Ethan Anderson for measurement of mitochondrial function in muscle fibers. Chapter 3 is work that has been submitted to the FASEB Journal and is under review. I performed the majority of this work with technical assistance from Daniel Cooper and Jessica Ellis under the supervision of Dr. Coleman. vi TABLE OF CONTENTS LIST OF TABLES ....................................................................................................................................... ix LIST OF FIGURES ...................................................................................................................................... x LIST OF ABBREVIATIONS ...................................................................................................................... xi CHAPTER 1: BACKGROUND ................................................................................................................... 1 Partitioning of fatty acids and the formation of fatty acyl-CoAs .............................................................. 1 Fatty acid use by acyl-CoA synthetases .................................................................................................... 2 Acyl-CoA binding protein and fatty acid binding proteins ....................................................................... 3 Complex lipid synthesis and degradation ................................................................................................. 5 Acyl-CoA synthetases and fatty acid transport proteins ......................................................................... 10 Regulation of long-chain ACS isoforms ................................................................................................. 12 Channeling. ............................................................................................................................................. 14 Knockout and knockdown of ACSL1 ..................................................................................................... 15 Overexpression of ACSL1 ...................................................................................................................... 17 Role of acyl-CoAs in disease .................................................................................................................. 18 Background Figures ................................................................................................................................ 26 Specific Aims .......................................................................................................................................... 34 CHAPTER 2: ACYL-COA SYNTHETASE 1 DEFICIENCY ALTERS CARDIOLIPIN SPECIES AND IMPAIRS MITOCHONDRIAL FUNCTION ....................................................... 36 Introduction ............................................................................................................................................. 37 Methods .................................................................................................................................................. 38 Results: .................................................................................................................................................... 44 Discussion ............................................................................................................................................... 51 Figures .................................................................................................................................................... 54 CHAPTER 3: LOSS OF ACSL1 IMPAIRS CARDIAC AUTOPHAGY AND MITOCHONDRIAL STRUCTURE THROUGH MTORC1 ACTIVATION ................................ 67 Introduction ............................................................................................................................................. 68 Materials and Methods ............................................................................................................................ 69 Results ..................................................................................................................................................... 72 Discussion ............................................................................................................................................... 77 Figures .................................................................................................................................................... 81 vii CHAPTER 4: SYNTHESIS .......................................................................................................................
Load more

Recommended publications
  • (12) Patent Application Publication (10) Pub. No.: US 2015/0337275 A1 Pearlman Et Al
    US 20150337275A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2015/0337275 A1 Pearlman et al. (43) Pub. Date: Nov. 26, 2015 (54) BOCONVERSION PROCESS FOR Publication Classification PRODUCING NYLON-7, NYLON-7.7 AND POLYESTERS (51) Int. C. CI2N 9/10 (2006.01) (71) Applicant: INVISTATECHNOLOGIES S.a.r.l., CI2P 7/40 (2006.01) St. Gallen (CH) CI2PI3/00 (2006.01) CI2PI3/04 (2006.01) (72) Inventors: Paul S. Pearlman, Thornton, PA (US); CI2P 13/02 (2006.01) Changlin Chen, Cleveland (GB); CI2N 9/16 (2006.01) Adriana L. Botes, Cleveland (GB); Alex CI2N 9/02 (2006.01) Van Eck Conradie, Cleveland (GB); CI2N 9/00 (2006.01) Benjamin D. Herzog, Wichita, KS (US) CI2P 7/44 (2006.01) CI2P I 7/10 (2006.01) (73) Assignee: INVISTATECHNOLOGIES S.a.r.l., (52) U.S. C. St. Gallen (CH) CPC. CI2N 9/13 (2013.01); C12P 7/44 (2013.01); CI2P 7/40 (2013.01); CI2P 13/005 (2013.01); (21) Appl. No.: 14/367,484 CI2P 17/10 (2013.01); CI2P 13/02 (2013.01); CI2N 9/16 (2013.01); CI2N 9/0008 (2013.01); (22) PCT Fled: Dec. 21, 2012 CI2N 9/93 (2013.01); CI2P I3/04 (2013.01); PCT NO.: PCT/US2012/071.472 CI2P 13/001 (2013.01); C12Y 102/0105 (86) (2013.01) S371 (c)(1), (2) Date: Jun. 20, 2014 (57) ABSTRACT Embodiments of the present invention relate to methods for Related U.S. Application Data the biosynthesis of di- or trifunctional C7 alkanes in the (60) Provisional application No.
    [Show full text]
  • Understanding the Potential Role of Sirtuin 2 on Aging: Consequences of SIRT2.3 Overexpression in Senescence
    International Journal of Molecular Sciences Article Understanding the Potential Role of Sirtuin 2 on Aging: Consequences of SIRT2.3 Overexpression in Senescence Noemi Sola-Sevilla 1, Ana Ricobaraza 2, Ruben Hernandez-Alcoceba 2 , Maria S. Aymerich 3,4, Rosa M. Tordera 1 and Elena Puerta 1,* 1 Pharmacology and Toxicology Department, Faculty of Pharmacy, University of Navarra, Navarra Institute for Health Research (IdiSNA), 31008 Pamplona, Spain; [email protected] (N.S.-S.); [email protected] (R.M.T.) 2 Gene Therapy Program CIMA, University of Navarra, Navarra Institute for Health Research (IdiSNA), 31008 Pamplona, Spain; [email protected] (A.R.); [email protected] (R.H.-A.) 3 Departamento de Bioquímica y Genética, Facultad de Ciencias, Universidad de Navarra, 31008 Pamplona, Spain; [email protected] 4 Neuroscience Program CIMA, University of Navarra, Navarra Institute for Health Research (IdiSNA), 31008 Pamplona, Spain * Correspondence: [email protected] Abstract: Sirtuin 2 (SIRT2) has been associated to aging and age-related pathologies. Specifically, an age-dependent accumulation of isoform 3 of SIRT2 in the CNS has been demonstrated; however, no study has addressed the behavioral or molecular consequences that this could have on aging. In the present study, we have designed an adeno-associated virus vector (AAV-CAG-Sirt2.3-eGFP) for the overexpression of SIRT2.3 in the hippocampus of 2 month-old SAMR1 and SAMP8 mice. Our Citation: Sola-Sevilla, N.; results show that the specific overexpression of this isoform does not induce significant behavioral or Ricobaraza, A.; Hernandez-Alcoceba, molecular effects at short or long term in the control strain. Only a tendency towards a worsening in R.; Aymerich, M.S.; Tordera, R.M.; the performance in acquisition phase of the Morris Water Maze was found in SAMP8 mice, together Puerta, E.
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • DYSREGULATION of LONG-CHAIN ACYL-Coa SYNTHETASES in CANCER and THEIR TARGETING STRATEGIES in ANTICANCER THERAPY Md Amir Hossain1, Jun Ma2, Yong Yang1 1
    Hossain et al RJLBPCS 2020 www.rjlbpcs.com Life Science Informatics Publications Original Review Article DOI: 10.26479/2020.0603.06 DYSREGULATION OF LONG-CHAIN ACYL-CoA SYNTHETASES IN CANCER AND THEIR TARGETING STRATEGIES IN ANTICANCER THERAPY Md Amir Hossain1, Jun Ma2, Yong Yang1 1. Academic Institute of Pharmaceutical Science, China Pharmaceutical University, Nanjing, China. 2. Ningxia Baoshihua Hospital, Ningxia, China. ABSTRACT: Cancer is a leading cause of death worldwide, and the number of cases globally continues to increase. Cancer is caused by certain changes in genes that are involved in controlling cell functions and cell division. Notably, metabolic dysregulation is one the hallmarks of cancer, and increases in fatty acid metabolism have been demonstrated to promote the growth and survival of a variety of cancers. In human, fatty acids either can be breakdown into acetyl-CoA through catabolic metabolism and aid in ATP generation or in the anabolic metabolism they can incorporate into triacylglycerol and phospholipid. Importantly, both of these pathways need activation of fatty acids, and the key players in this activation of fatty acids are the long-chain acyl-CoA synthetases (ACSLs) that are commonly dysregulated in cancer and associated with oncogenesis and survival. Therefore, it provides a rationale to target ACSLs in cancer. This review summarizes the current understanding of long-chain acyl-CoA synthetases in cancer and their targeting opportunities. KEYWORDS: Acyl-CoA synthetases, cancer, fatty acid, lipid metabolism. Article History: Received: April 15, 2020; Revised: May 10, 2020; Accepted: May 30, 2020. Corresponding Author: Prof. Yong Yang* Academic Institute of Pharmaceutical Science, China Pharmaceutical University, Nanjing, China.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Acot13 (NM 025790) Mouse Untagged Clone – MC203714 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MC203714 Acot13 (NM_025790) Mouse Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Acot13 (NM_025790) Mouse Untagged Clone Tag: Tag Free Symbol: Acot13 Synonyms: 0610006O17Rik; Them2 Vector: PCMV6-Kan/Neo E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >BC018165 TGATCATCTAGGACCAGGGCGACCGGGGCGCGCGATCCTTTCTCCCGAGCACGACGCGACACCGCCCGGG CTTGCAGACTTGACCTTCCACACCCTTGTCCTCTCACAAACGTCTCTTCCAGAGTTCACTCTCGCAGAGC CCAGACTCTTGCTTTGCGTCCACGATGAGCAGCATGACCCAGAACCTACGAGAAGTAATGAAGGTTATGT TCAAAGTTCCCGGTTTTGATAGAGTTTTGGAAAAGGTGACGCTTGTCTCGGCTGCTCCTGAGAAACTAAT CTGTGAGATGAAGGTGGAGGAGCAGCATACTAATAAGCTGGGTACGCTCCATGGAGGCTTGACAGCAACC TTAGTGGACAGCATCTCGACCATGGCTCTAATGTGCACAGAAAGAGGAGCACCCGGAGTCAGTGTGGACA TGAACATAACGTACATGTCACCTGCTAAGATAGGAGAAGAAATAGTGATCACAGCACACATTCTGAAGCA AGGAAAGACACTTGCATTTGCCTCAGTGGATCTGACCAACAAGACCACAGGAAAATTAATAGCACAAGGC AGACACACAAAACACCTGGGGAACTGAGAACAGCGGGAAGACCCGAAGAAGCCCAACAATGCCAAGTATG GTTTGTGAACAACTTTCTGAAATAAATTATCAAAACCAGAAAAAAAAAAAAAAAAAAAA Restriction Sites: RsrII-NotI ACCN: NM_025790 Insert Size: 423 bp OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g.,
    [Show full text]
  • By Submitted in Partial Satisfaction of the Requirements for Degree of in In
    BCL6 maintains thermogenic capacity of brown adipose tissue during dormancy by Vassily Kutyavin DISSERTATION Submitted in partial satisfaction of the requirements for degree of DOCTOR OF PHILOSOPHY in Biomedical Sciences in the GRADUATE DIVISION of the UNIVERSITY OF CALIFORNIA, SAN FRANCISCO Approved: ______________________________________________________________________________Eric Verdin Chair ______________________________________________________________________________Ajay Chawla ______________________________________________________________________________Ethan Weiss ______________________________________________________________________________ ______________________________________________________________________________ Committee Members Copyright 2019 by Vassily Kutyavin ii Dedicated to everyone who has supported me during my scientific education iii Acknowledgements I'm very grateful to my thesis adviser, Ajay Chawla, for his mentorship and support during my dissertation work over the past five years. Throughout my time in his lab, I was always able to rely on his guidance, and his enthusiasm for science was a great source of motivation. Even when he was traveling, he could easily be reached for advice by phone or e- mail. I am particularly grateful for his help with writing the manuscript, which was probably the most challenging aspect of graduate school for me. I am also very grateful to him for helping me find a postdoctoral fellowship position. Ajay's inquisitive and fearless approach to science have been a great inspiration to me. In contrast to the majority of scientists who focus narrowly on a specific topic, Ajay pursued fundamental questions across a broad range of topics and was able to make tremendous contributions. My experience in his lab instilled in me a deep appreciation for thinking about the entire organism from an evolutionary perspective and focusing on the key questions that escape the attention of the larger scientific community. As I move forward in my scientific career, there is no doubt that I will rely on him as a role model.
    [Show full text]
  • Inflammatory Stimuli Induce Acyl-Coa Thioesterase 7 and Remodeling of Phospholipids Containing Unsaturated Long (C20)-Acyl Chains in Macrophages
    Supplemental Material can be found at: http://www.jlr.org/content/suppl/2017/04/17/jlr.M076489.DC1 .html Inflammatory stimuli induce acyl-CoA thioesterase 7 and remodeling of phospholipids containing unsaturated long (C20)-acyl chains in macrophages Valerie Z. Wall,*,† Shelley Barnhart,* Farah Kramer,* Jenny E. Kanter,* Anuradha Vivekanandan-Giri,§ Subramaniam Pennathur,§ Chiara Bolego,** Jessica M. Ellis,§§,*** Miguel A. Gijón,††† Michael J. Wolfgang,*** and Karin E. Bornfeldt1,*,† Department of Medicine,* Division of Metabolism, Endocrinology and Nutrition, and Department of Pathology,† UW Medicine Diabetes Institute, University of Washington, Seattle, WA; Department of Internal Medicine,§ University of Michigan, Ann Arbor, MI; Department of Pharmaceutical and Pharmacological Sciences,** University of Padova, Padova, Italy; Department of Nutrition Science,§§ Purdue University, West Lafayette, IN; Department of Biological Chemistry,*** Johns Hopkins University School of Medicine, Baltimore, MD; and Department of Pharmacology,††† University of Downloaded from Colorado Denver, Aurora, CO Abstract Acyl-CoA thioesterase 7 (ACOT7) is an intracel- containing unsaturated long (C20)-acyl chains in macro- lular enzyme that converts acyl-CoAs to FFAs. ACOT7 is in- phages, and, although ACOT7 has preferential thioesterase duced by lipopolysaccharide (LPS); thus, we investigated activity toward these lipid species, loss of ACOT7 has no ma- www.jlr.org downstream effects of LPS-induced induction of ACOT7 jor detrimental effect on macrophage inflammatory pheno- and its role in inflammatory settings in myeloid cells. Enzy- types.—Wall, V. Z., S. Barnhart, F. Kramer, J. E. Kanter, matic thioesterase activity assays in WT and ACOT7-deficient A. Vivekanandan-Giri, S. Pennathur, C. Bolego, J. M. Ellis, macrophage lysates indicated that endogenous ACOT7 con- M.
    [Show full text]
  • The Metabolic Serine Hydrolases and Their Functions in Mammalian Physiology and Disease Jonathan Z
    REVIEW pubs.acs.org/CR The Metabolic Serine Hydrolases and Their Functions in Mammalian Physiology and Disease Jonathan Z. Long* and Benjamin F. Cravatt* The Skaggs Institute for Chemical Biology and Department of Chemical Physiology, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, California 92037, United States CONTENTS 2.4. Other Phospholipases 6034 1. Introduction 6023 2.4.1. LIPG (Endothelial Lipase) 6034 2. Small-Molecule Hydrolases 6023 2.4.2. PLA1A (Phosphatidylserine-Specific 2.1. Intracellular Neutral Lipases 6023 PLA1) 6035 2.1.1. LIPE (Hormone-Sensitive Lipase) 6024 2.4.3. LIPH and LIPI (Phosphatidic Acid-Specific 2.1.2. PNPLA2 (Adipose Triglyceride Lipase) 6024 PLA1R and β) 6035 2.1.3. MGLL (Monoacylglycerol Lipase) 6025 2.4.4. PLB1 (Phospholipase B) 6035 2.1.4. DAGLA and DAGLB (Diacylglycerol Lipase 2.4.5. DDHD1 and DDHD2 (DDHD Domain R and β) 6026 Containing 1 and 2) 6035 2.1.5. CES3 (Carboxylesterase 3) 6026 2.4.6. ABHD4 (Alpha/Beta Hydrolase Domain 2.1.6. AADACL1 (Arylacetamide Deacetylase-like 1) 6026 Containing 4) 6036 2.1.7. ABHD6 (Alpha/Beta Hydrolase Domain 2.5. Small-Molecule Amidases 6036 Containing 6) 6027 2.5.1. FAAH and FAAH2 (Fatty Acid Amide 2.1.8. ABHD12 (Alpha/Beta Hydrolase Domain Hydrolase and FAAH2) 6036 Containing 12) 6027 2.5.2. AFMID (Arylformamidase) 6037 2.2. Extracellular Neutral Lipases 6027 2.6. Acyl-CoA Hydrolases 6037 2.2.1. PNLIP (Pancreatic Lipase) 6028 2.6.1. FASN (Fatty Acid Synthase) 6037 2.2.2. PNLIPRP1 and PNLIPR2 (Pancreatic 2.6.2.
    [Show full text]
  • Pan-Histone Deacetylase Inhibitors Regulate Signaling Pathways
    Majumdar et al. BMC Genomics 2012, 13:709 http://www.biomedcentral.com/1471-2164/13/709 RESEARCH ARTICLE Open Access Pan-histone deacetylase inhibitors regulate signaling pathways involved in proliferative and pro-inflammatory mechanisms in H9c2 cells Gipsy Majumdar1, Piyatilake Adris1, Neha Bhargava1, Hao Chen2 and Rajendra Raghow1,2* Abstract Background: We have shown previously that pan-HDAC inhibitors (HDACIs) m-carboxycinnamic acid bis-hydroxamide (CBHA) and trichostatin A (TSA) attenuated cardiac hypertrophy in BALB/c mice by inducing hyper-acetylation of cardiac chromatin that was accompanied by suppression of pro-inflammatory gene networks. However, it was not feasible to determine the precise contribution of the myocytes- and non-myocytes to HDACI-induced gene expression in the intact heart. Therefore, the current study was undertaken with a primary goal of elucidating temporal changes in the transcriptomes of cardiac myocytes exposed to CBHA and TSA. Results: We incubated H9c2 cardiac myocytes in growth medium containing either of the two HDACIs for 6h and 24h and analyzed changes in gene expression using Illumina microarrays. H9c2 cells exposed to TSA for 6h and 24h led to differential expression of 468 and 231 genes, respectively. In contrast, cardiac myocytes incubated with CBHA for 6h and 24h elicited differential expression of 768 and 999 genes, respectively. We analyzed CBHA- and TSA-induced differentially expressed genes by Ingenuity Pathway (IPA), Kyoto Encyclopedia of Genes and Genomes (KEGG) and Core_TF programs and discovered that CBHA and TSA impinged on several common gene networks. Thus, both HDACIs induced a repertoire of signaling kinases (PTEN-PI3K-AKT and MAPK) and transcription factors (Myc, p53, NFkB and HNF4A) representing canonical TGFβ, TNF-α, IFNγ and IL-6 specific networks.
    [Show full text]
  • Sirt3) Regulates Skeletal Muscle Metabolism and Insulin Signaling Via Altered Mitochondrial Oxidation and Reactive Oxygen Species Production
    Sirtuin-3 (Sirt3) regulates skeletal muscle metabolism and insulin signaling via altered mitochondrial oxidation and reactive oxygen species production Enxuan Jinga, Brice Emanuellia, Matthew D. Hirscheyb,c, Jeremie Bouchera, Kevin Y. Leea, David Lombardd,1, Eric M. Verdinb,c, and C. Ronald Kahna,2 aJoslin Diabetes Center, Harvard Medical School, Boston, MA 02215; bGladstone Institute of Virology and Immunology, San Francisco, CA 94158; cUniversity of California, San Francisco, CA 94143; and dDepartment of Genetics, Harvard Medical School, Boston, MA Contributed by C. Ronald Kahn, July 20, 2011 (sent for review April 14, 2011) Sirt3 is a member of the sirtuin family of protein deacetylases that early, or even primary, contributor to development of skeletal is localized in mitochondria and regulates mitochondrial function. muscle insulin resistance and type 2 diabetes. Sirt3 expression in skeletal muscle is decreased in models of type 1 In recent years, the sirtuin family of NAD+-dependent and type 2 diabetes and regulated by feeding, fasting, and caloric deacetylases has emerged as important regulators of metabolism. restriction. Sirt3 knockout mice exhibit decreased oxygen con- Among seven members of the sirtuin family, Sirt3 is of particular sumption and develop oxidative stress in skeletal muscle, leading interest with regard to mitochondrial function because it is lo- to JNK activation and impaired insulin signaling. This effect is mim- calized primarily in mitochondria (16). Sirt3 has been shown to Sirt3 icked by knockdown of in cultured myoblasts, which exhibit deacetylate and thereby regulate several mitochondrial targets, reduced mitochondrial oxidation, increased reactive oxygen spe- including acetyl-CoA synthase 2 and glutamate dehydrogenase cies, activation of JNK, increased serine and decreased tyrosine (17, 18).
    [Show full text]
  • Elucidating Biological Roles of Novel Murine Genes in Hearing Impairment in Africa
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 19 September 2019 doi:10.20944/preprints201909.0222.v1 Review Elucidating Biological Roles of Novel Murine Genes in Hearing Impairment in Africa Oluwafemi Gabriel Oluwole,1* Abdoulaye Yal 1,2, Edmond Wonkam1, Noluthando Manyisa1, Jack Morrice1, Gaston K. Mazanda1 and Ambroise Wonkam1* 1Division of Human Genetics, Department of Pathology, Faculty of Health Sciences, University of Cape Town, Observatory, Cape Town, South Africa. 2Department of Neurology, Point G Teaching Hospital, University of Sciences, Techniques and Technology, Bamako, Mali. *Correspondence to: [email protected]; [email protected] Abstract: The prevalence of congenital hearing impairment (HI) is highest in Africa. Estimates evaluated genetic causes to account for 31% of HI cases in Africa, but the identification of associated causative genes mutations have been challenging. In this study, we reviewed the potential roles, in humans, of 38 novel genes identified in a murine study. We gathered information from various genomic annotation databases and performed functional enrichment analysis using online resources i.e. genemania and g.proflier. Results revealed that 27/38 genes are express mostly in the brain, suggesting additional cognitive roles. Indeed, HERC1- R3250X had been associated with intellectual disability in a Moroccan family. A homozygous 216-bp deletion in KLC2 was found in two siblings of Egyptian descent with spastic paraplegia. Up to 27/38 murine genes have link to at least a disease, and the commonest mode of inheritance is autosomal recessive (n=8). Network analysis indicates that 20 other genes have intermediate and biological links to the novel genes, suggesting their possible roles in HI.
    [Show full text]