Thioesterase-Mediated Control of Cellular Calcium Homeostasis Enables Hepatic ER Stress
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
(12) Patent Application Publication (10) Pub. No.: US 2015/0337275 A1 Pearlman Et Al
US 20150337275A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2015/0337275 A1 Pearlman et al. (43) Pub. Date: Nov. 26, 2015 (54) BOCONVERSION PROCESS FOR Publication Classification PRODUCING NYLON-7, NYLON-7.7 AND POLYESTERS (51) Int. C. CI2N 9/10 (2006.01) (71) Applicant: INVISTATECHNOLOGIES S.a.r.l., CI2P 7/40 (2006.01) St. Gallen (CH) CI2PI3/00 (2006.01) CI2PI3/04 (2006.01) (72) Inventors: Paul S. Pearlman, Thornton, PA (US); CI2P 13/02 (2006.01) Changlin Chen, Cleveland (GB); CI2N 9/16 (2006.01) Adriana L. Botes, Cleveland (GB); Alex CI2N 9/02 (2006.01) Van Eck Conradie, Cleveland (GB); CI2N 9/00 (2006.01) Benjamin D. Herzog, Wichita, KS (US) CI2P 7/44 (2006.01) CI2P I 7/10 (2006.01) (73) Assignee: INVISTATECHNOLOGIES S.a.r.l., (52) U.S. C. St. Gallen (CH) CPC. CI2N 9/13 (2013.01); C12P 7/44 (2013.01); CI2P 7/40 (2013.01); CI2P 13/005 (2013.01); (21) Appl. No.: 14/367,484 CI2P 17/10 (2013.01); CI2P 13/02 (2013.01); CI2N 9/16 (2013.01); CI2N 9/0008 (2013.01); (22) PCT Fled: Dec. 21, 2012 CI2N 9/93 (2013.01); CI2P I3/04 (2013.01); PCT NO.: PCT/US2012/071.472 CI2P 13/001 (2013.01); C12Y 102/0105 (86) (2013.01) S371 (c)(1), (2) Date: Jun. 20, 2014 (57) ABSTRACT Embodiments of the present invention relate to methods for Related U.S. Application Data the biosynthesis of di- or trifunctional C7 alkanes in the (60) Provisional application No. -
4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4). -
Yeast Genome Gazetteer P35-65
gazetteer Metabolism 35 tRNA modification mitochondrial transport amino-acid metabolism other tRNA-transcription activities vesicular transport (Golgi network, etc.) nitrogen and sulphur metabolism mRNA synthesis peroxisomal transport nucleotide metabolism mRNA processing (splicing) vacuolar transport phosphate metabolism mRNA processing (5’-end, 3’-end processing extracellular transport carbohydrate metabolism and mRNA degradation) cellular import lipid, fatty-acid and sterol metabolism other mRNA-transcription activities other intracellular-transport activities biosynthesis of vitamins, cofactors and RNA transport prosthetic groups other transcription activities Cellular organization and biogenesis 54 ionic homeostasis organization and biogenesis of cell wall and Protein synthesis 48 plasma membrane Energy 40 ribosomal proteins organization and biogenesis of glycolysis translation (initiation,elongation and cytoskeleton gluconeogenesis termination) organization and biogenesis of endoplasmic pentose-phosphate pathway translational control reticulum and Golgi tricarboxylic-acid pathway tRNA synthetases organization and biogenesis of chromosome respiration other protein-synthesis activities structure fermentation mitochondrial organization and biogenesis metabolism of energy reserves (glycogen Protein destination 49 peroxisomal organization and biogenesis and trehalose) protein folding and stabilization endosomal organization and biogenesis other energy-generation activities protein targeting, sorting and translocation vacuolar and lysosomal -
Thioesterase Superfamily Member 1 Undergoes Stimulus-Coupled Conformational Reorganization to Regulate Metabolism in Mice
ARTICLE https://doi.org/10.1038/s41467-021-23595-x OPEN Thioesterase superfamily member 1 undergoes stimulus-coupled conformational reorganization to regulate metabolism in mice Yue Li 1,2, Norihiro Imai3, Hayley T. Nicholls 3, Blaine R. Roberts 4, Samaksh Goyal 1,2, Tibor I. Krisko 3, Lay-Hong Ang 1,2, Matthew C. Tillman4, Anne M. Roberts4, Mahnoor Baqai 1,2, Eric A. Ortlund 4, ✉ ✉ David E. Cohen 3 & Susan J. Hagen 1,2 1234567890():,; In brown adipose tissue, thermogenesis is suppressed by thioesterase superfamily member 1 (Them1), a long chain fatty acyl-CoA thioesterase. Them1 is highly upregulated by cold ambient temperature, where it reduces fatty acid availability and limits thermogenesis. Here, we show that Them1 regulates metabolism by undergoing conformational changes in response to β-adrenergic stimulation that alter Them1 intracellular distribution. Them1 forms metabolically active puncta near lipid droplets and mitochondria. Upon stimulation, Them1 is phosphorylated at the N-terminus, inhibiting puncta formation and activity and resulting in a diffuse intracellular localization. We show by correlative light and electron microscopy that Them1 puncta are biomolecular condensates that are inhibited by phosphorylation. Thus, Them1 forms intracellular biomolecular condensates that limit fatty acid oxidation and sup- press thermogenesis. During a period of energy demand, the condensates are disrupted by phosphorylation to allow for maximal thermogenesis. The stimulus-coupled reorganization of Them1 provides fine-tuning of thermogenesis and energy expenditure. 1 Division of General Surgery, Department of Surgery, Beth Israel Deaconess Medical Center, Boston, MA, USA. 2 Department of Surgery, Harvard Medical School, Boston, MA, USA. 3 Division of Gastroenterology and Hepatology, Department of Medicine, Weill Cornell Medical College, New York, NY, USA. -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
Acot13 (NM 025790) Mouse Untagged Clone – MC203714 | Origene
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MC203714 Acot13 (NM_025790) Mouse Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Acot13 (NM_025790) Mouse Untagged Clone Tag: Tag Free Symbol: Acot13 Synonyms: 0610006O17Rik; Them2 Vector: PCMV6-Kan/Neo E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >BC018165 TGATCATCTAGGACCAGGGCGACCGGGGCGCGCGATCCTTTCTCCCGAGCACGACGCGACACCGCCCGGG CTTGCAGACTTGACCTTCCACACCCTTGTCCTCTCACAAACGTCTCTTCCAGAGTTCACTCTCGCAGAGC CCAGACTCTTGCTTTGCGTCCACGATGAGCAGCATGACCCAGAACCTACGAGAAGTAATGAAGGTTATGT TCAAAGTTCCCGGTTTTGATAGAGTTTTGGAAAAGGTGACGCTTGTCTCGGCTGCTCCTGAGAAACTAAT CTGTGAGATGAAGGTGGAGGAGCAGCATACTAATAAGCTGGGTACGCTCCATGGAGGCTTGACAGCAACC TTAGTGGACAGCATCTCGACCATGGCTCTAATGTGCACAGAAAGAGGAGCACCCGGAGTCAGTGTGGACA TGAACATAACGTACATGTCACCTGCTAAGATAGGAGAAGAAATAGTGATCACAGCACACATTCTGAAGCA AGGAAAGACACTTGCATTTGCCTCAGTGGATCTGACCAACAAGACCACAGGAAAATTAATAGCACAAGGC AGACACACAAAACACCTGGGGAACTGAGAACAGCGGGAAGACCCGAAGAAGCCCAACAATGCCAAGTATG GTTTGTGAACAACTTTCTGAAATAAATTATCAAAACCAGAAAAAAAAAAAAAAAAAAAA Restriction Sites: RsrII-NotI ACCN: NM_025790 Insert Size: 423 bp OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., -
Genome-Wide Transcriptional Sequencing Identifies Novel Mutations in Metabolic Genes in Human Hepatocellular Carcinoma DAOUD M
CANCER GENOMICS & PROTEOMICS 11 : 1-12 (2014) Genome-wide Transcriptional Sequencing Identifies Novel Mutations in Metabolic Genes in Human Hepatocellular Carcinoma DAOUD M. MEERZAMAN 1,2 , CHUNHUA YAN 1, QING-RONG CHEN 1, MICHAEL N. EDMONSON 1, CARL F. SCHAEFER 1, ROBERT J. CLIFFORD 2, BARBARA K. DUNN 3, LI DONG 2, RICHARD P. FINNEY 1, CONSTANCE M. CULTRARO 2, YING HU1, ZHIHUI YANG 2, CU V. NGUYEN 1, JENNY M. KELLEY 2, SHUANG CAI 2, HONGEN ZHANG 2, JINGHUI ZHANG 1,4 , REBECCA WILSON 2, LAUREN MESSMER 2, YOUNG-HWA CHUNG 5, JEONG A. KIM 5, NEUNG HWA PARK 6, MYUNG-SOO LYU 6, IL HAN SONG 7, GEORGE KOMATSOULIS 1 and KENNETH H. BUETOW 1,2 1Center for Bioinformatics and Information Technology, National Cancer Institute, Rockville, MD, U.S.A.; 2Laboratory of Population Genetics, National Cancer Institute, National Cancer Institute, Bethesda, MD, U.S.A.; 3Basic Prevention Science Research Group, Division of Cancer Prevention, National Cancer Institute, Bethesda, MD, U.S.A; 4Department of Biotechnology/Computational Biology, St. Jude Children’s Research Hospital, Memphis, TN, U.S.A.; 5Department of Internal Medicine, University of Ulsan College of Medicine, Asan Medical Center, Seoul, Korea; 6Department of Internal Medicine, University of Ulsan College of Medicine, Ulsan University Hospital, Ulsan, Korea; 7Department of Internal Medicine, College of Medicine, Dankook University, Cheon-An, Korea Abstract . We report on next-generation transcriptome Worldwide, liver cancer is the fifth most common cancer and sequencing results of three human hepatocellular carcinoma the third most common cause of cancer-related mortality (1). tumor/tumor-adjacent pairs. -
By Submitted in Partial Satisfaction of the Requirements for Degree of in In
BCL6 maintains thermogenic capacity of brown adipose tissue during dormancy by Vassily Kutyavin DISSERTATION Submitted in partial satisfaction of the requirements for degree of DOCTOR OF PHILOSOPHY in Biomedical Sciences in the GRADUATE DIVISION of the UNIVERSITY OF CALIFORNIA, SAN FRANCISCO Approved: ______________________________________________________________________________Eric Verdin Chair ______________________________________________________________________________Ajay Chawla ______________________________________________________________________________Ethan Weiss ______________________________________________________________________________ ______________________________________________________________________________ Committee Members Copyright 2019 by Vassily Kutyavin ii Dedicated to everyone who has supported me during my scientific education iii Acknowledgements I'm very grateful to my thesis adviser, Ajay Chawla, for his mentorship and support during my dissertation work over the past five years. Throughout my time in his lab, I was always able to rely on his guidance, and his enthusiasm for science was a great source of motivation. Even when he was traveling, he could easily be reached for advice by phone or e- mail. I am particularly grateful for his help with writing the manuscript, which was probably the most challenging aspect of graduate school for me. I am also very grateful to him for helping me find a postdoctoral fellowship position. Ajay's inquisitive and fearless approach to science have been a great inspiration to me. In contrast to the majority of scientists who focus narrowly on a specific topic, Ajay pursued fundamental questions across a broad range of topics and was able to make tremendous contributions. My experience in his lab instilled in me a deep appreciation for thinking about the entire organism from an evolutionary perspective and focusing on the key questions that escape the attention of the larger scientific community. As I move forward in my scientific career, there is no doubt that I will rely on him as a role model. -
Inflammatory Stimuli Induce Acyl-Coa Thioesterase 7 and Remodeling of Phospholipids Containing Unsaturated Long (C20)-Acyl Chains in Macrophages
Supplemental Material can be found at: http://www.jlr.org/content/suppl/2017/04/17/jlr.M076489.DC1 .html Inflammatory stimuli induce acyl-CoA thioesterase 7 and remodeling of phospholipids containing unsaturated long (C20)-acyl chains in macrophages Valerie Z. Wall,*,† Shelley Barnhart,* Farah Kramer,* Jenny E. Kanter,* Anuradha Vivekanandan-Giri,§ Subramaniam Pennathur,§ Chiara Bolego,** Jessica M. Ellis,§§,*** Miguel A. Gijón,††† Michael J. Wolfgang,*** and Karin E. Bornfeldt1,*,† Department of Medicine,* Division of Metabolism, Endocrinology and Nutrition, and Department of Pathology,† UW Medicine Diabetes Institute, University of Washington, Seattle, WA; Department of Internal Medicine,§ University of Michigan, Ann Arbor, MI; Department of Pharmaceutical and Pharmacological Sciences,** University of Padova, Padova, Italy; Department of Nutrition Science,§§ Purdue University, West Lafayette, IN; Department of Biological Chemistry,*** Johns Hopkins University School of Medicine, Baltimore, MD; and Department of Pharmacology,††† University of Downloaded from Colorado Denver, Aurora, CO Abstract Acyl-CoA thioesterase 7 (ACOT7) is an intracel- containing unsaturated long (C20)-acyl chains in macro- lular enzyme that converts acyl-CoAs to FFAs. ACOT7 is in- phages, and, although ACOT7 has preferential thioesterase duced by lipopolysaccharide (LPS); thus, we investigated activity toward these lipid species, loss of ACOT7 has no ma- www.jlr.org downstream effects of LPS-induced induction of ACOT7 jor detrimental effect on macrophage inflammatory pheno- and its role in inflammatory settings in myeloid cells. Enzy- types.—Wall, V. Z., S. Barnhart, F. Kramer, J. E. Kanter, matic thioesterase activity assays in WT and ACOT7-deficient A. Vivekanandan-Giri, S. Pennathur, C. Bolego, J. M. Ellis, macrophage lysates indicated that endogenous ACOT7 con- M. -
The Metabolic Serine Hydrolases and Their Functions in Mammalian Physiology and Disease Jonathan Z
REVIEW pubs.acs.org/CR The Metabolic Serine Hydrolases and Their Functions in Mammalian Physiology and Disease Jonathan Z. Long* and Benjamin F. Cravatt* The Skaggs Institute for Chemical Biology and Department of Chemical Physiology, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, California 92037, United States CONTENTS 2.4. Other Phospholipases 6034 1. Introduction 6023 2.4.1. LIPG (Endothelial Lipase) 6034 2. Small-Molecule Hydrolases 6023 2.4.2. PLA1A (Phosphatidylserine-Specific 2.1. Intracellular Neutral Lipases 6023 PLA1) 6035 2.1.1. LIPE (Hormone-Sensitive Lipase) 6024 2.4.3. LIPH and LIPI (Phosphatidic Acid-Specific 2.1.2. PNPLA2 (Adipose Triglyceride Lipase) 6024 PLA1R and β) 6035 2.1.3. MGLL (Monoacylglycerol Lipase) 6025 2.4.4. PLB1 (Phospholipase B) 6035 2.1.4. DAGLA and DAGLB (Diacylglycerol Lipase 2.4.5. DDHD1 and DDHD2 (DDHD Domain R and β) 6026 Containing 1 and 2) 6035 2.1.5. CES3 (Carboxylesterase 3) 6026 2.4.6. ABHD4 (Alpha/Beta Hydrolase Domain 2.1.6. AADACL1 (Arylacetamide Deacetylase-like 1) 6026 Containing 4) 6036 2.1.7. ABHD6 (Alpha/Beta Hydrolase Domain 2.5. Small-Molecule Amidases 6036 Containing 6) 6027 2.5.1. FAAH and FAAH2 (Fatty Acid Amide 2.1.8. ABHD12 (Alpha/Beta Hydrolase Domain Hydrolase and FAAH2) 6036 Containing 12) 6027 2.5.2. AFMID (Arylformamidase) 6037 2.2. Extracellular Neutral Lipases 6027 2.6. Acyl-CoA Hydrolases 6037 2.2.1. PNLIP (Pancreatic Lipase) 6028 2.6.1. FASN (Fatty Acid Synthase) 6037 2.2.2. PNLIPRP1 and PNLIPR2 (Pancreatic 2.6.2. -
Antidiabetic E4orf1 Protein Prevents Hepatic Steatosis and Reduces Markers of Aging-Related Cellular Damage in High Fat Fed Older Mice
Obesity studies Open access Original research BMJ Open Diab Res Care: first published as 10.1136/bmjdrc-2020-002096 on 3 May 2021. Downloaded from Antidiabetic E4orf1 protein prevents hepatic steatosis and reduces markers of aging- related cellular damage in high fat fed older mice Zahra Mostofinejad,1,2 Md Akheruzzaman ,1 Md Abu Bakkar Siddik ,1 Presheet Patkar,1 Nikhil V Dhurandhar,1 Vijay Hegde 1 To cite: Mostofinejad Z, ABSTRACT Akheruzzaman M, Introduction Older age is associated with greater Significance of this study Abu Bakkar Siddik M, et al. prevalence of hyperinsulinemia, type 2 diabetes, and fatty Antidiabetic E4orf1 protein liver disease. These metabolic conditions and aging are What is already known about this subject? prevents hepatic steatosis bidirectionally linked to mitochondrial dysfunction and ► Metabolic disorders such as hyperinsulinemia, type and reduces markers of 2 diabetes and fatty liver disease and aging are bi- aging- related cellular damage telomere attrition. Although effectively addressing these conditions is important for influencing the health and directionally associated with mitochondrial dysfunc- in high fat fed older mice. tion and telomere attrition. BMJ Open Diab Res Care the lifespan, it is particularly challenging in older age. ► Modifying certain biomarkers like deregulated nutri- 2021;9:e002096. doi:10.1136/ We reported that E4orf1, a protein derived from human bmjdrc-2020-002096 adenovirus Ad36, reduces hyperinsulinemia, improves ent sensing, mitochondrial dysfunction, cellular se- glucose clearance, and protects against hepatic steatosis nescence caused by telomere attrition and genomic in younger mice exposed to high fat diet (HFD). Here, we instability are strategies to improve the health span ZM and MA contributed equally. -
Flawed Phospholipid Formation Or Faulty Fatty Acid Oxidation: Determining the Cause of Mitochondrial Dysfunction in Hearts Lacking Acsl1
FLAWED PHOSPHOLIPID FORMATION OR FAULTY FATTY ACID OXIDATION: DETERMINING THE CAUSE OF MITOCHONDRIAL DYSFUNCTION IN HEARTS LACKING ACSL1 Trisha J. Grevengoed A dissertation submitted to the faculty at the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Nutrition (Biochemistry) in the School of Public Health. Chapel Hill 2015 Approved by: Rosalind A. Coleman Stephen D. Hursting Liza Makowski Leslie V. Parise Steven H. Zeisel © 2015 Trisha J. Grevengoed ALL RIGHTS RESERVED ii ABSTRACT Trisha J. Grevengoed: Fatty acid activation in cardiac mitochondria: The role of ACSL1 in phospholipid formation and remodeling, substrate switching, and autophagic flux (Under the direction of Rosalind A. Coleman) Cardiovascular disease is the number one cause of death worldwide. In the heart, mitochondria provide up to 95% of energy, with most of this energy coming from metabolism of fatty acids (FA). FA must be converted to acyl-CoAs by acyl-CoA synthetases (ACS) before entry into pathways of β- oxidation or glycerolipid synthesis. ACSL1 contributes more than 90% of total cardiac ACSL activity, and mice with an inducible knockout of ACSL1 (Acsl1T-/-) have impaired cardiac FA oxidation. The effects of loss of ACSL1 on mitochondrial respiratory function, phospholipid formation, or autophagic flux have not yet been studied. Acsl1T-/- hearts contained 3-fold more mitochondria with abnormal structure and displayed lower respiratory function. Because ACSL1 exhibited a strong substrate preference for linoleate (18:2), we investigated the composition of mitochondrial phospholipids. Acsl1T-/- hearts contained 83% less tetralinoleoyl-cardiolipin (CL), the major form present in control hearts.