DOCSLIB.ORG

Apoptotic Cells Inflammasome Activity During the Uptake of Macrophage

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Apoptotic Cells Inflammasome Activity During the Uptake of Macrophage Downloaded from http://www.jimmunol.org/ by guest on October 2, 2021 is online at: average * The Journal of Immunology published online 20 April 2012 from submission to initial decision 4 weeks from acceptance to publication http://www.jimmunol.org/content/early/2012/04/20/jimmun ol.1103760 Complement Protein C1q Directs Macrophage Polarization and Limits Inflammasome Activity during the Uptake of Apoptotic Cells Marie E. Benoit, Elizabeth V. Clarke, Pedro Morgado, Deborah A. Fraser and Andrea J. Tenner J Immunol Submit online. Every submission reviewed by practicing scientists ? is published twice each month by http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://www.jimmunol.org/content/suppl/2012/04/20/jimmunol.110376 0.DC1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of October 2, 2021. Published April 20, 2012, doi:10.4049/jimmunol.1103760 The Journal of Immunology Complement Protein C1q Directs Macrophage Polarization and Limits Inflammasome Activity during the Uptake of Apoptotic Cells Marie E. Benoit, Elizabeth V. Clarke, Pedro Morgado, Deborah A. Fraser, and Andrea J. Tenner Deficiency in C1q, the recognition component of the classical complement cascade and a pattern recognition receptor involved in apoptotic cell clearance, leads to lupus-like autoimmune diseases characterized by auto-antibodies to self proteins and aberrant innate immune cell activation likely due to impaired clearance of apoptotic cells. In this study, we developed an autologous system using primary human lymphocytes and human monocyte-derived macrophages (HMDMs) to characterize the effect of C1q on macrophage gene expression profiles during the uptake of apoptotic cells. C1q bound to autologous apoptotic lymphocytes mod- ulated expression of genes associated with JAK/STAT signaling, chemotaxis, immunoregulation, and NLRP3 inflammasome acti- Downloaded from vation in LPS-stimulated HMDMs. Specifically, C1q sequentially induced type I IFNs, IL-27, and IL-10 in LPS-stimulated HMDMs and IL-27 in HMDMs when incubated with apoptotic lymphocyte conditioned media. Coincubation with C1q tails prevented the induction of type I IFNs and IL-27 in a dose-dependent manner, and neutralization of type I IFNs partially prevented IL-27 induction by C1q. Finally, C1q decreased procaspase-1 cleavage and caspase-1–dependent cleavage of IL-1b suggesting a potent inhibitory effect of C1q on inflammasome activation. These results identify specific molecular pathways induced by C1q to suppress macrophage inflammation and provide potential therapeutic targets to control macrophage polarization and thus http://www.jimmunol.org/ inflammation and autoimmunity. The Journal of Immunology, 2012, 188: 000–000. he complement system, a powerful effector of the innate moral defense system to sense danger by recognizing pathogen- immune system, consists of a group of proteins circulating associated molecular patterns (PAMPs) but is also activated by T as inactive precursors in the blood and in extracellular damage-associated molecular patterns (DAMPs) or altered self fluids. Upon activation through the classical, lectin, or alternative tissues. Dysregulated complement activation has been associated pathway, a cascade of proteolytic cleavages and formation of with the development of various diseases including rheumatoid central enzymatic complexes (C3 and C5 convertases) leads to arthritis and Alzheimer’s disease (2, 3). A causal link between by guest on October 2, 2021 the generation of active fragments resulting in the opsonization complement deficiency and systemic lupus erythematosus (SLE) of invading pathogens (C1q, C3b, and iC3b), release of proin- involves in part the role of complement in physiological waste flammatory chemotactic factors (C3a and C5a), which recruit disposal mechanisms, in particular clearance of dying cells (4). leukocytes to the site of infection or injury, and finally formation Although activation by all three complement pathways can con- of the membrane attack complex (C5b-9) and subsequent lysis tribute to enhanced uptake of apoptotic cells by phagocytic cells of the pathogen (1, 2). Complement functions as an important hu- (5–8), homozygous deficiency of any of the early complement components of the classical pathway (C1q, C1r, C1s, C4, and C2) . Department of Molecular Biology and Biochemistry, Institute for Immunology, Uni- predisposes to the development of SLE with 90% of individuals versity of California, Irvine, Irvine, CA 92697 with genetic deficiency of C1q developing severe SLE (9). Received for publication December 22, 2011. Accepted for publication March 20, C1q is known to play a prominent nonredundant tissue-specific 2012. role in the clearance of apoptotic cells in vitro and in vivo (10– This work was supported by Grant UL1 RR031985 from the National Center for 14). C1q binds to apoptotic cells and cellular debris through its Research Resources (a component of the National Institutes of Health and the Na- globular heads (10, 15) and to phagocytic receptors through its tional Institutes of Health Roadmap for Medical Research), National Institutes of Health Grants AI 41090 and AG 00538, and the Cypress College Science, Technol- collagen tails (1, 16). Although at first thought to be primarily of ogy, Engineering, and Math Summer Bridge Program. liver origin, C1q is predominantly synthesized in vivo by peripheral The gene expression data presented in this article have been submitted to the Gene tissue macrophages and dendritic cells (17, 18) and by myeloid cells Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo/) under accession number in vitro (8, 19–21). Although C1q is most often bound to C1r and GSE30177. C1s in the circulation (22), this local synthesis of C1q is hypothe- Address correspondence and reprint requests to Dr. Andrea J. Tenner, Department of Molecular Biology and Biochemistry, 3205 McGaugh Hall, University of California, sized to be the major source of C1q for the rapid opsonization of Irvine, Irvine, CA 92697. E-mail address: [email protected] dying cells in tissue before recruitment of plasma-derived compo- The online version of this article contains supplemental material. nents such as C1r and C1s and subsequent activation of the com- Abbreviations used in this article: AL, apoptotic lymphocyte; ASC, apoptosis-asso- plement cascade. In addition, induced synthesis of C1q has been ciated speck-like protein containing a CARD domain; DAMP, damage-associated mo- detected in several injury models in vivo and in vitro[(23, 24); lecular pattern; EAL, early apoptotic lymphocyte; GO, gene ontology; HMDM, human monocyte-derived macrophage; HMGB1, high mobility group box 1; HSP, heat shock reviewed in Ref. 3], suggesting that the induction of C1q synthesis protein; LAL, late apoptotic lymphocyte; PAMP, pathogen-associated molecular pat- in tissue may be a response to injury that promotes rapid clearance tern; pDC, plasmacytoid dendritic cell; PI, propidium iodide; qRT-PCR, quantitative of apoptotic cells and concomitant suppression of inflammation. For real-time PCR; SLE, systemic lupus erythematosus. example, interaction of C1q with human monocytes or dendritic Copyright Ó 2012 by The American Association of Immunologists, Inc. 0022-1767/12/$16.00 cells results in the downregulation of proinflammatory cytokines www.jimmunol.org/cgi/doi/10.4049/jimmunol.1103760 2 C1q LIMITS MACROPHAGE AND INFLAMMASOME ACTIVATION upon TLR4 stimulation by LPS (25, 26). Recently, we showed that C1q binding assay C1q enhances uptake of apoptotic Jurkat T cells by human mono- EALs and LALs were incubated with 150 mg/ml purified human C1q for cytes but has no effect on the basal clearance level of these apoptotic 1 h in PBS/1% human serum albumin at 37˚C. Binding of C1q was as- cells by human monocyte-derived macrophages (HMDMs) and sessed for every experiment by flow cytometry using an mAb against C1q dendritic cells (8). In addition, although C1q influences the induc- (Quidel) and FITC–anti-mouse IgG (Jackson ImmunoResearch Laborato- . tion of cytokines in all myeloid cell types tested in this study, both ries). For each experiment, C1q binding was 50% for EALs or LALs. the degree and direction of modulation depend on the state of dif- Uptake assay ferentiation of the phagocytic cell (8). However, because several C1q receptors have been identified and none has been shown spe- PKH26-labeled or unlabeled EALs and LALs, precoated or not with C1q, were incubated with HMDMs at a 5:1 ratio for 1 h (optimal ratio and time cifically to mediate C1q-enhancement of phagocytosis of apoptotic determined in preliminary experiments, see Supplemental Fig. 2B) in cells (1, 12, 27), the intracellular signaling pathways engaged upon phagocytosis buffer (RPMI 1640, 25 mM HEPES, and 5 mM MgCl2). For interaction of C1q with phagocytic cells remain to be fully eluci- uptake quantification, cells were washed, harvested with trypsin/EDTA, dated. In addition, because characterization of macrophage acti- and stained
Load more

Recommended publications
  • (12) Patent Application Publication (10) Pub. No.: US 2015/0337275 A1 Pearlman Et Al
    US 20150337275A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2015/0337275 A1 Pearlman et al. (43) Pub. Date: Nov. 26, 2015 (54) BOCONVERSION PROCESS FOR Publication Classification PRODUCING NYLON-7, NYLON-7.7 AND POLYESTERS (51) Int. C. CI2N 9/10 (2006.01) (71) Applicant: INVISTATECHNOLOGIES S.a.r.l., CI2P 7/40 (2006.01) St. Gallen (CH) CI2PI3/00 (2006.01) CI2PI3/04 (2006.01) (72) Inventors: Paul S. Pearlman, Thornton, PA (US); CI2P 13/02 (2006.01) Changlin Chen, Cleveland (GB); CI2N 9/16 (2006.01) Adriana L. Botes, Cleveland (GB); Alex CI2N 9/02 (2006.01) Van Eck Conradie, Cleveland (GB); CI2N 9/00 (2006.01) Benjamin D. Herzog, Wichita, KS (US) CI2P 7/44 (2006.01) CI2P I 7/10 (2006.01) (73) Assignee: INVISTATECHNOLOGIES S.a.r.l., (52) U.S. C. St. Gallen (CH) CPC. CI2N 9/13 (2013.01); C12P 7/44 (2013.01); CI2P 7/40 (2013.01); CI2P 13/005 (2013.01); (21) Appl. No.: 14/367,484 CI2P 17/10 (2013.01); CI2P 13/02 (2013.01); CI2N 9/16 (2013.01); CI2N 9/0008 (2013.01); (22) PCT Fled: Dec. 21, 2012 CI2N 9/93 (2013.01); CI2P I3/04 (2013.01); PCT NO.: PCT/US2012/071.472 CI2P 13/001 (2013.01); C12Y 102/0105 (86) (2013.01) S371 (c)(1), (2) Date: Jun. 20, 2014 (57) ABSTRACT Embodiments of the present invention relate to methods for Related U.S. Application Data the biosynthesis of di- or trifunctional C7 alkanes in the (60) Provisional application No.
    [Show full text]
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
    [Show full text]
  • The Human Y Chromosome's Azoospermia Factor B (Azfb) Region
    18 ORIGINAL ARTICLE J Med Genet: first published as 10.1136/jmg.40.1.18 on 1 January 2003. Downloaded from The human Y chromosome’s azoospermia factor b (AZFb) region: sequence, structure, and deletion analysis in infertile men A Ferlin, E Moro, A Rossi, B Dallapiccola, C Foresta ............................................................................................................................. J Med Genet 2003;40:18–24 See end of article for authors’ affiliations Microdeletions of the Y chromosome long arm are the most common mutations in infertile males, where ....................... they involve one or more “azoospermia factors” (AZFa, b, and c). Understanding of the AZF structure and gene content and mapping of the deletion breakpoints in infertile men are still incomplete. We Correspondence to: Professor C Foresta, have assembled a complete 4.3 Mb map of AZFb and surrounding regions by means of 38 BAC University of Padova, clones. The proximal part of AZFb consists of large repeated sequences organised in palindromes, but Department of Medical and most of it is single copy sequence. A number of known and novel genes and gene families map in this Surgical Sciences, Clinica interval, and most of them are testis specific or have testis specific transcripts. STS mapping allowed us Medica 3, Via Ospedale to identify four severely infertile subjects with a deletion in AZFb with similar breakpoints, therefore 105, 35128 Padova, Italy; [email protected] suggesting a common deletion mechanism. This deletion includes at least five single copy genes and two duplicated genes, but does not remove the historical AZFb candidate gene RBMY1. These data Revised version received suggest that other genes in AZFb may have important roles in spermatogenesis.
    [Show full text]
  • Gene Expression Studies: from Case-Control to Multiple-Population-Based Studies
    From the Institute of Human Genetics, Helmholtz Zentrum Munchen,¨ Deutsches Forschungszentrum fur¨ Gesundheit und Umwelt (GmbH) Head: Prof. Dr. Thomas Meitinger Gene expression studies: From case-control to multiple-population-based studies Thesis Submitted for a Doctoral Degree in Natural Sciences at the Faculty of Medicine, Ludwig-Maximilians-Universitat¨ Munchen¨ Katharina Schramm Dachau, Germany 2016 With approval of the Faculty of Medicine Ludwig-Maximilians-Universit¨atM ¨unchen Supervisor/Examiner: Prof. Dr. Thomas Illig Co-Examiners: Prof. Dr. Roland Kappler Dean: Prof. Dr. med. dent. Reinhard Hickel Date of oral examination: 22.12.2016 II Dedicated to my family. III Abstract Recent technological developments allow genome-wide scans of gene expression levels. The reduction of costs and increasing parallelization of processing enable the quantification of 47,000 transcripts in up to twelve samples on a single microarray. Thereby the data collec- tion of large population-based studies was improved. During my PhD, I first developed a workflow for the statistical analyses of case-control stu- dies of up to 50 samples. With large population-based data sets generated I established a pipeline for quality control, data preprocessing and correction for confounders, which re- sulted in substantially improved data. In total, I processed more than 3,000 genome-wide expression profiles using the generated pipeline. With 993 whole blood samples from the population-based KORA (Cooperative Health Research in the Region of Augsburg) study we established one of the largest population-based resource. Using this data set we contributed to a number of transcriptome-wide association studies within national (MetaXpress) and international (CHARGE) consortia.
    [Show full text]
  • Molecular Markers of Serine Protease Evolution
    The EMBO Journal Vol. 20 No. 12 pp. 3036±3045, 2001 Molecular markers of serine protease evolution Maxwell M.Krem and Enrico Di Cera1 ment and specialization of the catalytic architecture should correspond to signi®cant evolutionary transitions in the Department of Biochemistry and Molecular Biophysics, Washington University School of Medicine, Box 8231, St Louis, history of protease clans. Evolutionary markers encoun- MO 63110-1093, USA tered in the sequences contributing to the catalytic apparatus would thus give an account of the history of 1Corresponding author e-mail: [email protected] an enzyme family or clan and provide for comparative analysis with other families and clans. Therefore, the use The evolutionary history of serine proteases can be of sequence markers associated with active site structure accounted for by highly conserved amino acids that generates a model for protease evolution with broad form crucial structural and chemical elements of applicability and potential for extension to other classes of the catalytic apparatus. These residues display non- enzymes. random dichotomies in either amino acid choice or The ®rst report of a sequence marker associated with serine codon usage and serve as discrete markers for active site chemistry was the observation that both AGY tracking changes in the active site environment and and TCN codons were used to encode active site serines in supporting structures. These markers categorize a variety of enzyme families (Brenner, 1988). Since serine proteases of the chymotrypsin-like, subtilisin- AGY®TCN interconversion is an uncommon event, it like and a/b-hydrolase fold clans according to phylo- was reasoned that enzymes within the same family genetic lineages, and indicate the relative ages and utilizing different active site codons belonged to different order of appearance of those lineages.
    [Show full text]
  • Searching for Novel Peptide Hormones in the Human Genome Olivier Mirabeau
    Searching for novel peptide hormones in the human genome Olivier Mirabeau To cite this version: Olivier Mirabeau. Searching for novel peptide hormones in the human genome. Life Sciences [q-bio]. Université Montpellier II - Sciences et Techniques du Languedoc, 2008. English. tel-00340710 HAL Id: tel-00340710 https://tel.archives-ouvertes.fr/tel-00340710 Submitted on 21 Nov 2008 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. UNIVERSITE MONTPELLIER II SCIENCES ET TECHNIQUES DU LANGUEDOC THESE pour obtenir le grade de DOCTEUR DE L'UNIVERSITE MONTPELLIER II Discipline : Biologie Informatique Ecole Doctorale : Sciences chimiques et biologiques pour la santé Formation doctorale : Biologie-Santé Recherche de nouvelles hormones peptidiques codées par le génome humain par Olivier Mirabeau présentée et soutenue publiquement le 30 janvier 2008 JURY M. Hubert Vaudry Rapporteur M. Jean-Philippe Vert Rapporteur Mme Nadia Rosenthal Examinatrice M. Jean Martinez Président M. Olivier Gascuel Directeur M. Cornelius Gross Examinateur Résumé Résumé Cette thèse porte sur la découverte de gènes humains non caractérisés codant pour des précurseurs à hormones peptidiques. Les hormones peptidiques (PH) ont un rôle important dans la plupart des processus physiologiques du corps humain.
    [Show full text]
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • Mouse CELA3B ORF Mammalian Expression Plasmid, C-His Tag
    Mouse CELA3B ORF mammalian expression plasmid, C-His tag Catalog Number: MG53134-CH General Information Plasmid Resuspension protocol Gene : chymotrypsin-like elastase family, 1. Centrifuge at 5,000×g for 5 min. member 3B 2. Carefully open the tube and add 100 l of sterile water to Official Symbol : CELA3B dissolve the DNA. Synonym : Ela3; Ela3b; AI504000; 0910001F22Rik; 2310074F01Rik 3. Close the tube and incubate for 10 minutes at room Source : Mouse temperature. cDNA Size: 810bp 4. Briefly vortex the tube and then do a quick spin to RefSeq : NM_026419.2 concentrate the liquid at the bottom. Speed is less than Description 5000×g. Lot : Please refer to the label on the tube 5. Store the plasmid at -20 ℃. Vector : pCMV3-C-His Shipping carrier : The plasmid is ready for: Each tube contains approximately 10 μg of lyophilized plasmid. • Restriction enzyme digestion Storage : • PCR amplification The lyophilized plasmid can be stored at ambient temperature for three months. • E. coli transformation Quality control : • DNA sequencing The plasmid is confirmed by full-length sequencing with primers in the sequencing primer list. E.coli strains for transformation (recommended Sequencing primer list : but not limited) pCMV3-F： 5’ CAGGTGTCCACTCCCAGGTCCAAG 3’ Most commercially available competent cells are appropriate for pcDNA3-R ： 5’ GGCAACTAGAAGGCACAGTCGAGG 3’ the plasmid, e.g. TOP10, DH5α and TOP10F´. Or Forward T7 ： 5’ TAATACGACTCACTATAGGG 3’ ReverseBGH ： 5’ TAGAAGGCACAGTCGAGG 3’ pCMV3-F and pcDNA3-R are designed by Sino Biological Inc. Customers can order the primer pair from any oligonucleotide supplier. Manufactured By Sino Biological Inc., FOR RESEARCH USE ONLY. NOT FOR USE IN HUMANS.
    [Show full text]
  • Serine Proteases with Altered Sensitivity to Activity-Modulating
    (19) & (11) EP 2 045 321 A2 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 08.04.2009 Bulletin 2009/15 C12N 9/00 (2006.01) C12N 15/00 (2006.01) C12Q 1/37 (2006.01) (21) Application number: 09150549.5 (22) Date of filing: 26.05.2006 (84) Designated Contracting States: • Haupts, Ulrich AT BE BG CH CY CZ DE DK EE ES FI FR GB GR 51519 Odenthal (DE) HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI • Coco, Wayne SK TR 50737 Köln (DE) •Tebbe, Jan (30) Priority: 27.05.2005 EP 05104543 50733 Köln (DE) • Votsmeier, Christian (62) Document number(s) of the earlier application(s) in 50259 Pulheim (DE) accordance with Art. 76 EPC: • Scheidig, Andreas 06763303.2 / 1 883 696 50823 Köln (DE) (71) Applicant: Direvo Biotech AG (74) Representative: von Kreisler Selting Werner 50829 Köln (DE) Patentanwälte P.O. Box 10 22 41 (72) Inventors: 50462 Köln (DE) • Koltermann, André 82057 Icking (DE) Remarks: • Kettling, Ulrich This application was filed on 14-01-2009 as a 81477 München (DE) divisional application to the application mentioned under INID code 62. (54) Serine proteases with altered sensitivity to activity-modulating substances (57) The present invention provides variants of ser- screening of the library in the presence of one or several ine proteases of the S1 class with altered sensitivity to activity-modulating substances, selection of variants with one or more activity-modulating substances. A method altered sensitivity to one or several activity-modulating for the generation of such proteases is disclosed, com- substances and isolation of those polynucleotide se- prising the provision of a protease library encoding poly- quences that encode for the selected variants.
    [Show full text]
  • The Role of Y Chromosome Deletions in Male Infertility
    European Journal of Endocrinology (2000) 142 418–430 ISSN 0804-4643 INVITED REVIEW The role of Y chromosome deletions in male infertility Kun Ma, Con Mallidis and Shalender Bhasin Division of Endocrinology, Metabolism and Molecular Medicine, Department of Internal Medicine, Charles R Drew University of Medicine and Science, 1731 East 120th Street, Los Angeles, California 90050, USA (Correspondence should be addressed to K Ma; Email: [email protected]) Abstract Male infertility affects approximately 2–7% of couples around the world. Over one in ten men who seek help at infertility clinics are diagnosed as severely oligospermic or azoospermic. Recent extensive molecular studies have revealed that deletions in the azoospermia factor region of the long arm of the Y chromosome are associated with severe spermatogenic impairment (absent or severely reduced germ cell development). Genetic research into male infertility, in the last 7 years, has resulted in the isolation of a great number of genes or gene families on the Y chromosome, some of which are believed to influence spermatogenesis. European Journal of Endocrinology 142 418–430 Introduction of Infertility, with the objective of creating a standard protocol for the investigation of infertile couples. Normal Defective spermatogenesis is the result of a multitude of semen was classified as containing a sperm concentra- causes, such as diseases, malnutrition, endocrinological 6 tion of at least 20 × 10 /ml, of which more than 40% disorders, genetic defects or environmental hazards (1). are progressively motile, more than 60% are alive, and Genetic defects, such as mutations and chromosomal over 50% show normal morphology. In addition, the abnormalities, have been estimated to account for at 6 semen should contain no more than 1 × 10 /ml of white least 30% of male infertility (2).
    [Show full text]
  • TITLE PAGE Oxidative Stress and Response to Thymidylate Synthase
    Downloaded from molpharm.aspetjournals.org at ASPET Journals on October 2, 2021 -Targeted -Targeted 1 , University of of , University SC K.W.B., South Columbia, (U.O., Carolina, This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted.
    [Show full text]