DOCSLIB.ORG

TITLE PAGE Oxidative Stress and Response to Thymidylate Synthase

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
TITLE PAGE Oxidative Stress and Response to Thymidylate Synthase Downloaded from molpharm.aspetjournals.org at ASPET Journals on October 2, 2021 -Targeted -Targeted 1 , University of of , University SC K.W.B., South Columbia, (U.O., Carolina, This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this versi , Karen W. , Karen Barbour, Sarah Clinton,A. Berger Franklin G. and Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward. Published on October 6, 2015 as DOI: 10.1124/mol.115.099614 Molecular Pharmacology Fast Forward.
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Determining the Role of P53 Mutation in Human Breast
    Determining the Role of p53 Mutation in Human Breast Cancer Progression Using Recombinant Mutant/Wild-Type p53 Heterozygous Human Mammary Epithelial Cell Culture Models Item Type text; Electronic Dissertation Authors Junk, Damian Jerome Publisher The University of Arizona. Rights Copyright © is held by the author. Digital access to this material is made possible by the University Libraries, University of Arizona. Further transmission, reproduction or presentation (such as public display or performance) of protected items is prohibited except with permission of the author. Download date 28/09/2021 18:36:12 Link to Item http://hdl.handle.net/10150/193600 DETERMINING THE ROLE OF P53 MUTATION IN HUMAN BREAST CANCER PROGRESSION USING RECOMBINANT MUTANT/WILD-TYPE P53 HETEROZYGOUS HUMAN MAMMARY EPITHELIAL CELL CULTURE MODELS by Damian Jerome Junk _________________________ A Dissertation Submitted to the Faculty of the GRADUATE INTERDISCIPLINARY PROGRAM IN CANCER BIOLOGY In Partial Fulfillment of the Requirements For the Degree of DOCTOR OF PHILOSOPHY In the Graduate College THE UNIVERSITY OF ARIZONA 2008 2 THE UNIVERSITY OF ARIZONA GRADUATE COLLEGE As members of the Dissertation Committee, we certify that we have read the dissertation prepared by Damian Jerome Junk entitled Determining the Role of p53 Mutation in Human Breast Cancer Progression Using Recombinant Mutant/Wild-Type p53 Heterozygous Human Mammary Epithelial Cell Culture Models and recommend that it be accepted as fulfilling the dissertation requirement for the Degree of Doctor of Philosophy _______________________________________________________________________ Date: 4/18/08 Bernard W. Futscher, Ph.D. _______________________________________________________________________ Date: 4/18/08 Anne E. Cress, Ph.D. _______________________________________________________________________ Date: 4/18/08 Jesse D.
    [Show full text]
  • Genotyping for Response to Physical Training
    Wright State University CORE Scholar Browse all Theses and Dissertations Theses and Dissertations 2019 Genotyping for Response to Physical Training Stacy Simmons Wright State University Follow this and additional works at: https://corescholar.libraries.wright.edu/etd_all Part of the Molecular Biology Commons Repository Citation Simmons, Stacy, "Genotyping for Response to Physical Training" (2019). Browse all Theses and Dissertations. 2109. https://corescholar.libraries.wright.edu/etd_all/2109 This Thesis is brought to you for free and open access by the Theses and Dissertations at CORE Scholar. It has been accepted for inclusion in Browse all Theses and Dissertations by an authorized administrator of CORE Scholar. For more information, please contact [email protected]. GENOTYPING FOR RESPONSE TO PHYSICAL TRAINING A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science By STACY SIMMONS B.S., Wright State University, 2014 _________________________________________________________ 2019 Wright State University WRIGHT STATE UNIVERSITY GRADUATE SCHOOL July 29, 2019 I HEREBY RECOMMEND THAT THE THESIS PREPARED UNDER MY SUPERVISION BY Stacy Simmons ENTITLED Genotyping for Response to Physical Training BE ACCEPTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF Master of Science. ___________________________________ Michael Markey, Ph.D. Thesis Director ____________________________________ Madhavi P. Kadakia, Ph.D. Committee on Chair, Department of Biochemistry Final Examination and
    [Show full text]
  • Katalog 2015 Cover Paul Lin *Hinweis Förderung.Indd
    Product List 2015 WE LIVE SERVICE Certificates quartett owns two productions sites that are certified according to EN ISO 9001:2008 Quality management systems - Requirements EN ISO 13485:2012 + AC:2012 Medical devices - Quality management systems - Requirements for regulatory purposes GMP Conformity Our quality management guarantees products of highest quality! 2 Foreword to the quartett product list 2015 quartett Immunodiagnostika, Biotechnologie + Kosmetik Vertriebs GmbH welcomes you as one of our new business partners as well as all of our previous loyal clients. You are now member of quartett´s worldwide customers. First of all we would like to introduce ourselves to you. Founded as a family-run company in 1986, quartett ensures for more than a quarter of a century consistent quality of products. Service and support of our valued customers are our daily businesses. And we will continue! In the end 80´s quartett offered radioimmunoassay and enzyme immunoassay kits from different manufacturers in the USA. In the beginning 90´s the company changed its strategy from offering products for routine diagnostic to the increasing field of research and development. Setting up a production plant in 1997 and a second one in 2011 supported this decision. The company specialized its product profile in the field of manufacturing synthetic peptides for antibody production, peptides such as protease inhibitors, biochemical reagents and products for histology, cytology and immunohistology. All products are exclusively manufactured in Germany without outsourcing any production step. Nowadays, we expand into all other diagnostic and research fields and supply our customers in universities, government institutes, pharmaceutical and biotechnological companies, hospitals, and private doctor offices.
    [Show full text]
  • Structure of the Human Frataxin-Bound Iron-Sulfur Cluster Assembly Complex Provides Insight Into Its Activation Mechanism
    bioRxiv preprint doi: https://doi.org/10.1101/561795; this version posted February 28, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Structure of the human frataxin-bound iron-sulfur cluster assembly complex provides insight into its activation mechanism Nicholas G. Fox1,4, Xiaodi Yu2,4, Xidong Feng2, Henry J. Bailey1, Alain Martelli3, Joseph F. Nabhan3, Claire Strain-Damerell1, Christine Bulawa3, Wyatt W. Yue1,*, Seungil Han2,* 1Structural Genomics Consortium, Nuffield Department of Clinical Medicine, University of Oxford, UK OX3 7DQ 2Discovery Sciences, Worldwide Research and Development, Pfizer Inc., Eastern Point Road, Groton, CT, 06340, United States 3Rare Disease Research Unit, Worldwide Research and Development, Pfizer Inc., 610 Main Street, Cambridge, MA, 02139, United States 4These authors contributed equally. *Correspondence should be addressed to Wyatt W. Yue, [email protected] Seungil Han, [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/561795; this version posted February 28, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract Iron-sulfur clusters (ISC) are essential in all life forms and carry out many crucial cellular functions. The core machinery for de novo ISC biosynthesis, located in the mitochondria matrix, is a five- protein complex containing the cysteine desulfurase NFS1 that is activated by frataxin (FXN), scaffold protein ISCU, accessory protein ISD11, and acyl-carrier protein ACP.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
    [Show full text]
  • ) (51) International Patent Classification: Columbia V5G 1G3
    ) ( (51) International Patent Classification: Columbia V5G 1G3 (CA). PANDEY, Nihar R.; 10209 A 61K 31/4525 (2006.01) C07C 39/23 (2006.01) 128A St, Surrey, British Columbia V3T 3E7 (CA). A61K 31/05 (2006.01) C07D 405/06 (2006.01) (74) Agent: ZIESCHE, Sonia et al.; Gowling WLG (Canada) A61P25/22 (2006.01) LLP, 2300 - 550 Burrard Street, Vancouver, British Colum¬ (21) International Application Number: bia V6C 2B5 (CA). PCT/CA2020/050165 (81) Designated States (unless otherwise indicated, for every (22) International Filing Date: kind of national protection av ailable) . AE, AG, AL, AM, 07 February 2020 (07.02.2020) AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, (25) Filing Language: English DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, (26) Publication Language: English HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (30) Priority Data: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, 16/270,389 07 February 2019 (07.02.2019) US OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (63) Related by continuation (CON) or continuation-in-part SC, SD, SE, SG, SK, SL, ST, SV, SY, TH, TJ, TM, TN, TR, (CIP) to earlier application: TT, TZ, UA, UG, US, UZ, VC, VN, WS, ZA, ZM, ZW. US 16/270,389 (CON) (84) Designated States (unless otherwise indicated, for every Filed on 07 Februaiy 2019 (07.02.2019) kind of regional protection available) .
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • Poorna Roy Phd Dissertation
    ANALYZING AND CLASSIFYING BIMOLECULAR INTERACTIONS: I. EFFECTS OF METAL BINDING ON AN IRON-SULFUR CLUSTER SCAFFOLD PROTEIN II. AUTOMATIC ANNOTATION OF RNA-PROTEIN INTERACTIONS FOR NDB Poorna Roy A Dissertation Submitted to the Graduate College of Bowling Green State University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY August 2017 Committee: Neocles Leontis, Committee Co-Chair Andrew Torelli, Committee Co-Chair Vipaporn Phuntumart, Graduate Faculty Representative H. Peter Lu © 2017 Poorna Roy All Rights Reserved iii ABSTRACT Neocles B. Leontis and Andrew T. Torelli, Committee co-chairs This dissertation comprises two distinct parts; however the different research agendas are thematically linked by their complementary approaches to investigate the nature of important intermolecular interactions. The first part is the study of interactions between an iron-sulfur cluster scaffold protein, IscU, and different transition metal ions. Interactions between IscU and specific metal ions are investigated and compared with those of SufU, a homologous Fe-S cluster biosynthesis protein from Gram-positive bacteria whose metal-dependent conformational behavior remains unclear. These studies were extended with additional metal ions selected to determine whether coordination geometry at the active sites of IscU and its homolog influence metal ion selectivity. Comparing the conformational behavior and affinity for different transition metal ions revealed that metal-dependent conformational transitions exhibited by IscU may be a recurring strategy exhibited by U-type proteins involved in Fe-S cluster biosynthesis. The second part of the thesis focuses on automated detection and annotation of specific interactions between nucleotides and amino acid residues in RNA-protein complexes.
    [Show full text]
  • The TRAX, DISC1, and GSK3 Complex in Mental Disorders and Therapeutic Interventions Yu-Ting Weng1,2, Ting Chien1, I-I Kuan1 and Yijuang Chern1,2*
    Weng et al. Journal of Biomedical Science (2018) 25:71 https://doi.org/10.1186/s12929-018-0473-x REVIEW Open Access The TRAX, DISC1, and GSK3 complex in mental disorders and therapeutic interventions Yu-Ting Weng1,2, Ting Chien1, I-I Kuan1 and Yijuang Chern1,2* Abstract Psychiatric disorders (such as bipolar disorder, depression, and schizophrenia) affect the lives of millions of individuals worldwide. Despite the tremendous efforts devoted to various types of psychiatric studies and rapidly accumulating genetic information, the molecular mechanisms underlying psychiatric disorder development remain elusive. Among the genes that have been implicated in schizophrenia and other mental disorders, disrupted in schizophrenia 1 (DISC1) and glycogen synthase kinase 3 (GSK3) have been intensively investigated. DISC1 binds directly to GSK3 and modulates many cellular functions by negatively inhibiting GSK3 activity. The human DISC1 gene is located on chromosome 1 and is highly associated with schizophrenia and other mental disorders. A recent study demonstrated that a neighboring gene of DISC1, translin-associated factor X (TRAX), binds to the DISC1/GSK3β complex and at least partly mediates the actions of the DISC1/GSK3β complex. Previous studies also demonstrate that TRAX and most of its interacting proteins that have been identified so far are risk genes and/or markers of mental disorders. In the present review, we will focus on the emerging roles of TRAX and its interacting proteins (including DISC1 and GSK3β) in psychiatric disorders and the potential implications for developing therapeutic interventions. Keywords: TRAX, DISC1, GSK3β, Mental disorders, DNA damage, DNA repair, Oxidative stress, A2AR, PKA Background DNA repair) by interacting with various proteins [4–12].
    [Show full text]
  • ALG12 Gene Pair Kentaro Oh-Hashi1*, Hisashi Koga2, Shun Ikeda2, Kiyo Shimada2, Yoko Hirata1, Kazutoshi Kiuchi1
    Oh-hashi et al. BMC Genomics 2010, 11:664 http://www.biomedcentral.com/1471-2164/11/664 RESEARCH ARTICLE Open Access Role of an ER stress response element in regulating the bidirectional promoter of the mouse CRELD2 - ALG12 gene pair Kentaro Oh-hashi1*, Hisashi Koga2, Shun Ikeda2, Kiyo Shimada2, Yoko Hirata1, Kazutoshi Kiuchi1 Abstract Background: Recently, we identified cysteine-rich with EGF-like domains 2 (CRELD2) as a novel endoplasmic reticulum (ER) stress-inducible gene and characterized its transcriptional regulation by ATF6 under ER stress conditions. Interestingly, the CRELD2 and asparagine-linked glycosylation 12 homolog (ALG12) genes are arranged as a bidirectional (head-to-head) gene pair and are separated by less than 400 bp. In this study, we characterized the transcriptional regulation of the mouse CRELD2 and ALG12 genes that is mediated by a common bidirectional promoter. Results: This short intergenic region contains an ER stress response element (ERSE) sequence and is well conserved among the human, rat and mouse genomes. Microarray analysis revealed that CRELD2 and ALG12 mRNAs were induced in Neuro2a cells by treatment with thapsigargin (Tg), an ER stress inducer, in a time- dependent manner. Other ER stress inducers, tunicamycin and brefeldin A, also increased the expression of these two mRNAs in Neuro2a cells. We then tested for the possible involvement of the ERSE motif and other regulatory sites of the intergenic region in the transcriptional regulation of the mouse CRELD2 and ALG12 genes by using variants of the bidirectional reporter construct. With regards to the promoter activities of the CRELD2-ALG12 gene pair, the entire intergenic region hardly responded to Tg, whereas the CRELD2 promoter constructs of the proximal region containing the ERSE motif showed a marked responsiveness to Tg.
    [Show full text]