DOCSLIB.ORG

Cyclin-Dependent Kinases and Their Role in Inflammation, Endothelial Cell Migration

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cyclin-Dependent Kinases and Their Role in Inflammation, Endothelial Cell Migration Cyclin-Dependent Kinases and their role in Inflammation, Endothelial Cell Migration and Autocrine Activity Dissertation Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Shruthi Ratnakar Shetty Graduate Program in Pharmaceutical Sciences The Ohio State University 2020 Dissertation Committee Dale Hoyt, Advisor Liva Rakotondraibe Moray Campbell Keli Hu Copyrighted by Shruthi Ratnakar Shetty 2020 Abstract Inflammation is the body’s response to infection or injury. Endothelial cells are among the different players involved in an inflammatory cascade. In response to an inflammatory stimuli such as bacterial lipopolysaccharide (LPS), endothelial cells get activated which is characterized by the production of important mediators, such as inducible nitric oxide synthase (iNOS) which, catalyzes the production of nitric oxide (NO) and reactive nitrogen species and cyclooxygenase-2 (COX-2) that catalyzes the production of prostaglandins. Though the production of these mediators is required for an inflammatory response, it is important that their levels are regulated. Continued production of iNOS results in increased accumulation of reactive nitrogen species (RNS) that might lead to cytotoxicity, whereas lack of/suppression results in endothelial and vascular dysfunction. On the other hand, severe cardiovascular, intestinal and renal side effects are observed with significant suppression of COX-2. Thus, studying factors that could regulate the levels of iNOS and COX-2 could provide useful insights for developing novel therapeutic targets. Regulation of protein levels involves control of protein induction or turnover. Since protein induction requires transcription, in this dissertation we studied the role of a promoter of transcription “Cyclin- dependent kinase 7 (CDK7)” in iNOS and COX-2 protein induction. We first depleted CDK7 in mouse aortic endothelial cells (MAEC) using siRNA, followed by stimulus with ii lipopolysaccharide/interferon gamma (LPS/IFN) to induce iNOS and COX-2 protein. Interestingly, CDK7 depletion resulted in excessive induction of both iNOS and COX-2 protein levels compared to control. This observation was recapitulated using a covalent inhibitor of CDK7, THZ1. Further investigation showed the protein induction due to lack of CDK7 was not due to increased mRNA levels. CDK7 knockdown however decreased the turnover of iNOS, but not COX-2 protein. We identified a novel mechanism by which CDK7 could regulate the stability of iNOS protein. We demonstrated how in the absence of CDK7, iNOS was resistant to degradation by protease, calpain, due to increased association of iNOS with its binding partner calmodulin. CDK7 depletion was also found to exert a post-transcriptional effect on COX-2, by activating upstream signaling cascades from mTOR and MAPK pathways that might promote translation. Activation of the components of the translation pre- initiation complex was also observed in the absence of CDK7, which contributed to increased COX-2 protein levels. This dissertation thus identifies CDK7 as a repressor of both iNOS and COX-2 proteins in endothelial cells by affecting their turnover and translation, respectively. The research provides novel insights, for the therapeutic manipulation of iNOS and COX-2 expression in endothelial cells via the less explored post-transcriptional effects of CDK7. We also investigated the roles of different transcriptional and atypical CDKs in angiogenesis and autocrine activity in endothelial cells. CDK5 and CDK9 were found to be potential regulators of endothelial cell migration whereas CDK7 and CDK9 were found iii to regulate autocrine activity in endothelial cells. Although these studies are highly preliminary, they pave the way to understand and further explore these CDKs as potential angiogenic or autocrine targets in various therapeutic conditions. iv Dedication This Dissertation is dedicated to my family, my father Ratnakar Shetty, my mother Mamatha Shetty and my sister Reshma Shetty, who have been incredibly supportive and have always encouraged me to do my best. v Acknowledgement I would like to thank my family especially my parents for their incredible support. The last five years of my PhD journey would not have been possible without the training and guidance from my advisor Dr. Dale Hoyt. I would also like to thank my committee members Dr. Liva, Dr. Hu and Dr. Campbell for their useful suggestions and insights on how to improve my research project. Finally, my doctoral training has not only enabled me to be a better scientist but also has helped improve my scientific communication skills for which I am extremely grateful to the department of Pharmacology, including all faculty and students for their insightful comments during seminars and weekly journal clubs. Lastly, I would like to thank all my friends and those lasting relationships I have built here in Columbus, Ohio. Go Bucks! vi Vita 2008-2012…………………....Bachelor’s in Pharmacy, University of Mumbai, Mumbai, India 2012-2014…………………....Master’s in Pharmacology, Toxicology and Therapeutics, University of Mumbai, India 2014-2015……………………Drug Safety Associate, TATA Consultancy Services, Mumbai, India 2015-2020……………………PhD. Pharmaceutical Sciences, College of Pharmacy, The Ohio State University, Columbus, Ohio 2015-2019……………………Graduate Teaching Associate, College of Pharmacy, The Ohio State University, Columbus, Ohio 2018-2020…………………....Delegate, Council of Graduate Students, The Ohio State University, Columbus, Ohio 2019-2020…………………....Graduate Minor Applied Clinical and Preclinical Research, The Ohio State University, Columbus, Ohio vii 2019-2020……………………Graduate Fellow, College of Pharmacy, The Ohio State University, Columbus, Ohio 2019-2020……………………Graduate Representative, University Conduct Board, The Ohio State University, Columbus, Ohio Publications 1. Shetty S, Spaulding AM, Baker C, Baine SH, Hoyt DG. Translational Regulation of Cyclooxygenase-2 (COX2) by Cyclin-Dependent Kinase 7 (CDK7) in Endothelial Cells. The FASEB Journal. 2020;34(S1):1-1. doi:10.1096/fasebj.2020.34.s1.04431 2. Shetty S, Spaulding AM, Baker C, Baine SH, Hoyt DG. Regulation of Inducible Nitric Oxide Synthase (iNOS) by Cyclin-Dependent Kinase 7 (CDK7) in Endothelial Cells. The FASEB Journal. 2020;34(S1):1-1. doi:10.1096/fasebj.2020.34.s1.04533 3. Karmahapatra, S., Kientz, C., Shetty, S., Yalowich, J. C., & Rakotondraibe, L. H. (2018). Capsicodendrin from Cinnamosma fragrans Exhibits Antiproliferative and Cytotoxic Activity in Human Leukemia Cells: Modulation by Glutathione. Journal of Natural Products, 81(3), 625–629. https://doi.org/10.1021/acs.jnatprod.7b00887 4. Shetty, S., et al. (2015). Neuroprotective potential of escitalopram against behavioral, mitochondrial and oxidative dysfunction induced by 3-nitropropionic acid. Annals of Neurosciences, 22(1), 11–18. https://doi.org/10.5214/ans.0972.7531.220104 viii 5. Hariharan, A., Shetty, S., Shirole, T., & Jagtap, A. G. (2014). Potential of protease inhibitor in 3-nitropropionic acid induced Huntington’s disease like symptoms: Mitochondrial dysfunction and neurodegeneration. Neurotoxicology, 45, 139–148. https://doi.org/10.1016/j.neuro.2014.10.004 Fields of Study Major Field: Pharmaceutical Sciences Minor Field: Applied Clinical and Preclinical Research ix Table of Contents Abstract ...................................................................................................................... ii Dedication ...................................................................................................................v Acknowledgement ..................................................................................................... vi Vita ........................................................................................................................... vii Publications ............................................................................................................. viii Table of Contents ........................................................................................................x List of Tables............................................................................................................xvi List of Figures ........................................................................................................ xvii List of Symbols and Abbreviations .......................................................................... xx Chapter 1. Introduction and Literature Review .......................................................1 1.1 Inflammation: ....................................................................................................1 1.1.1 Activation of Inflammation: What prompts inflammatory cells to produce Cytokines? ................................................................................................................1 1.1.2 Cells and Cytokines Involved in Inflammatory Response: .................................2 1.2 Endothelial cells in Inflammation: ....................................................................8 x 1.3 Inducible nitric oxide synthase: ....................................................................... 11 1.3.1 Introduction: .................................................................................................. 11 1.3.2 Structure: ....................................................................................................... 11 1.3.3 Production of NO: ........................................................................................
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • The TRAX, DISC1, and GSK3 Complex in Mental Disorders and Therapeutic Interventions Yu-Ting Weng1,2, Ting Chien1, I-I Kuan1 and Yijuang Chern1,2*
    Weng et al. Journal of Biomedical Science (2018) 25:71 https://doi.org/10.1186/s12929-018-0473-x REVIEW Open Access The TRAX, DISC1, and GSK3 complex in mental disorders and therapeutic interventions Yu-Ting Weng1,2, Ting Chien1, I-I Kuan1 and Yijuang Chern1,2* Abstract Psychiatric disorders (such as bipolar disorder, depression, and schizophrenia) affect the lives of millions of individuals worldwide. Despite the tremendous efforts devoted to various types of psychiatric studies and rapidly accumulating genetic information, the molecular mechanisms underlying psychiatric disorder development remain elusive. Among the genes that have been implicated in schizophrenia and other mental disorders, disrupted in schizophrenia 1 (DISC1) and glycogen synthase kinase 3 (GSK3) have been intensively investigated. DISC1 binds directly to GSK3 and modulates many cellular functions by negatively inhibiting GSK3 activity. The human DISC1 gene is located on chromosome 1 and is highly associated with schizophrenia and other mental disorders. A recent study demonstrated that a neighboring gene of DISC1, translin-associated factor X (TRAX), binds to the DISC1/GSK3β complex and at least partly mediates the actions of the DISC1/GSK3β complex. Previous studies also demonstrate that TRAX and most of its interacting proteins that have been identified so far are risk genes and/or markers of mental disorders. In the present review, we will focus on the emerging roles of TRAX and its interacting proteins (including DISC1 and GSK3β) in psychiatric disorders and the potential implications for developing therapeutic interventions. Keywords: TRAX, DISC1, GSK3β, Mental disorders, DNA damage, DNA repair, Oxidative stress, A2AR, PKA Background DNA repair) by interacting with various proteins [4–12].
    [Show full text]
  • New Insights in RBM20 Cardiomyopathy
    Current Heart Failure Reports (2020) 17:234–246 https://doi.org/10.1007/s11897-020-00475-x TRANSLATIONAL RESEARCH IN HEART FAILURE (J BACKS & M VAN DEN HOOGENHOF, SECTION EDITORS) New Insights in RBM20 Cardiomyopathy D. Lennermann1,2 & J. Backs1,2 & M. M. G. van den Hoogenhof1,2 Published online: 13 August 2020 # The Author(s) 2020 Abstract Purpose of Review This review aims to give an update on recent findings related to the cardiac splicing factor RNA-binding motif protein 20 (RBM20) and RBM20 cardiomyopathy, a form of dilated cardiomyopathy caused by mutations in RBM20. Recent Findings While most research on RBM20 splicing targets has focused on titin (TTN), multiple studies over the last years have shown that other splicing targets of RBM20 including Ca2+/calmodulin-dependent kinase IIδ (CAMK2D) might be critically involved in the development of RBM20 cardiomyopathy. In this regard, loss of RBM20 causes an abnormal intracellular calcium handling, which may relate to the arrhythmogenic presentation of RBM20 cardiomyopathy. In addition, RBM20 presents clinically in a highly gender-specific manner, with male patients suffering from an earlier disease onset and a more severe disease progression. Summary Further research on RBM20, and treatment of RBM20 cardiomyopathy, will need to consider both the multitude and relative contribution of the different splicing targets and related pathways, as well as gender differences. Keywords RBM20 . Dilated cardiomyopathy . CaMKIIδ . Calcium handling . Gender differences . Titin Introduction (ARVC), where a small number of genes account for most of the genetic causes, DCM-causing mutations have been ob- Dilated cardiomyopathy (DCM), as defined by left ventricular served in a variety of genes of diverse ontology [2].
    [Show full text]
  • TITLE PAGE Oxidative Stress and Response to Thymidylate Synthase
    Downloaded from molpharm.aspetjournals.org at ASPET Journals on October 2, 2021 -Targeted -Targeted 1 , University of of , University SC K.W.B., South Columbia, (U.O., Carolina, This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted.
    [Show full text]
  • Targeting Cyclin-Dependent Kinase 9 and Myeloid Cell Leukaemia 1 in MYC-Driven B-Cell Lymphoma
    Targeting cyclin-dependent kinase 9 and myeloid cell leukaemia 1 in MYC-driven B-cell lymphoma Gareth Peter Gregory ORCID ID: 0000-0002-4170-0682 Thesis for Doctor of Philosophy September 2016 Sir Peter MacCallum Department of Oncology The University of Melbourne Doctor of Philosophy Submitted in total fulfilment of the degree of Abstract Aggressive B-cell lymphomas include diffuse large B-cell lymphoma, Burkitt lymphoma and intermediate forms. Despite high response rates to conventional immuno-chemotherapeutic approaches, an unmet need for novel therapeutic by resistance to chemotherapy and radiotherapy. The proto-oncogene MYC is strategies is required in the setting of relapsed and refractory disease, typified frequently dysregulated in the aggressive B-cell lymphomas, however, it has proven an elusive direct therapeutic target. MYC-dysregulated disease maintains a ‘transcriptionally-addicted’ state, whereby perturbation of A significant body of evidence is accumulating to suggest that RNA polymerase II activity may indirectly antagonise MYC activity. Furthermore, very recent studies implicate anti-apoptotic myeloid cell leukaemia 1 (MCL-1) as a critical survival determinant of MYC-driven lymphoma. This thesis utilises pharmacologic and genetic techniques in MYC-driven models of aggressive B-cell lymphoma to demonstrate that cyclin-dependent kinase 9 (CDK9) and MCL-1 are oncogenic dependencies of this subset of disease. The cyclin-dependent kinase inhibitor, dinaciclib, and more selective CDK9 inhibitors downregulation of MCL1 are used
    [Show full text]
  • Newfound Coding Potential of Transcripts Unveils Missing Members Of
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.02.406710; this version posted December 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Newfound coding potential of transcripts unveils missing members of 2 human protein communities 3 4 Sebastien Leblanc1,2, Marie A Brunet1,2, Jean-François Jacques1,2, Amina M Lekehal1,2, Andréa 5 Duclos1, Alexia Tremblay1, Alexis Bruggeman-Gascon1, Sondos Samandi1,2, Mylène Brunelle1,2, 6 Alan A Cohen3, Michelle S Scott1, Xavier Roucou1,2,* 7 1Department of Biochemistry and Functional Genomics, Université de Sherbrooke, Sherbrooke, 8 Quebec, Canada. 9 2 PROTEO, Quebec Network for Research on Protein Function, Structure, and Engineering. 10 3Department of Family Medicine, Université de Sherbrooke, Sherbrooke, Quebec, Canada. 11 12 *Corresponding author: Tel. (819) 821-8000x72240; E-Mail: [email protected] 13 14 15 Running title: Alternative proteins in communities 16 17 Keywords: alternative proteins, protein network, protein-protein interactions, pseudogenes, 18 affinity purification-mass spectrometry 19 20 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.02.406710; this version posted December 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 21 Abstract 22 23 Recent proteogenomic approaches have led to the discovery that regions of the transcriptome 24 previously annotated as non-coding regions (i.e.
    [Show full text]
  • The Genetic Complexity of Prostate Cancer
    G C A T T A C G G C A T genes Review The Genetic Complexity of Prostate Cancer Eva Compérat 1,2,3,*, Gabriel Wasinger 3 , André Oszwald 3 , Renate Kain 3 , Geraldine Cancel-Tassin 1 and Olivier Cussenot 1,4 1 CeRePP/GRC5 Predictive Onco-Urology, Sorbonne University, 75020 Paris, France; [email protected] (G.C.-T.); [email protected] (O.C.) 2 Department of Pathology, Hôpital Tenon, Sorbonne University, 75020 Paris, France 3 Department of Pathology, Medical University of Vienna, 1090 Vienna, Austria; [email protected] (G.W.); [email protected] (A.O.); [email protected] (R.K.) 4 Department of Urology, Hôpital Tenon, Sorbonne University, 75020 Paris, France * Correspondence: [email protected]; Tel.: +33-658246024 Received: 28 September 2020; Accepted: 23 November 2020; Published: 25 November 2020 Abstract: Prostate cancer (PCa) is a major concern in public health, with many genetically distinct subsets. Genomic alterations in PCa are extraordinarily complex, and both germline and somatic mutations are of great importance in the development of this tumor. The aim of this review is to provide an overview of genetic changes that can occur in the development of PCa and their role in potential therapeutic approaches. Various pathways and mechanisms proposed to play major roles in PCa are described in detail to provide an overview of current knowledge. Keywords: prostate cancer; germline mutations; somatic mutations; PTEN; TMPRSS2; ERG; androgen receptors 1. Introduction Prostate cancer (PCa) is a major concern in public health, with more than 1.1 million cases worldwide detected every year [1].
    [Show full text]
  • A Critical Role for Kalirin in NGF Signaling Through Trka
    MOLECULAR AND CELLULAR BIOLOGY, June 2005, p. 5106–5118 Vol. 25, No. 12 0270-7306/05/$08.00ϩ0 doi:10.1128/MCB.25.12.5106–5118.2005 Copyright © 2005, American Society for Microbiology. All Rights Reserved. Critical Role for Kalirin in Nerve Growth Factor Signaling through TrkA Kausik Chakrabarti,1 Rong Lin,1 Noraisha I. Schiller,1 Yanping Wang,1 David Koubi,2 Ying-Xin Fan,3 Brian B. Rudkin,2 Gibbes R. Johnson,3 and Martin R. Schiller1* University of Connecticut Health Center, Department of Neuroscience, 263 Farmington Ave., Farmington, Connecticut 06030-43011; Laboratoire de Biologie Moleculaire de la Cellule, UMR 5161 CNRS, INRA U1237, Ecole Normale Supe´rieure de Lyon, IFR 128 “BioSciences Lyon-Gerland,” 69364 Lyon cedex 07, France2; and Division of Therapeutic Proteins, Center for Drug Evaluation and Research, Food and Drug Administration, Bethesda, Maryland 208923 Received 30 June 2004/Returned for modification 16 September 2004/Accepted 10 March 2005 Kalirin is a multidomain guanine nucleotide exchange factor (GEF) that activates Rho proteins, inducing cytoskeletal rearrangement in neurons. Although much is known about the effects of Kalirin on Rho GTPases and neuronal morphology, little is known about the association of Kalirin with the receptor/signaling systems that affect neuronal morphology. Our experiments demonstrate that Kalirin binds to and colocalizes with the TrkA neurotrophin receptor in neurons. In PC12 cells, inhibition of Kalirin expression using antisense RNA decreased nerve growth factor (NGF)-induced TrkA autophosphorylation and process extension. Kalirin overexpression potentiated neurotrophin-stimulated TrkA autophosphorylation and neurite outgrowth in PC12 cells at a low concentration of NGF.
    [Show full text]
  • Cyclin-Dependent Kinases and CDK Inhibitors in Virus-Associated Cancers Shaian Tavakolian, Hossein Goudarzi and Ebrahim Faghihloo*
    Tavakolian et al. Infectious Agents and Cancer (2020) 15:27 https://doi.org/10.1186/s13027-020-00295-7 REVIEW Open Access Cyclin-dependent kinases and CDK inhibitors in virus-associated cancers Shaian Tavakolian, Hossein Goudarzi and Ebrahim Faghihloo* Abstract The role of several risk factors, such as pollution, consumption of alcohol, age, sex and obesity in cancer progression is undeniable. Human malignancies are mainly characterized by deregulation of cyclin-dependent kinases (CDK) and cyclin inhibitor kinases (CIK) activities. Viruses express some onco-proteins which could interfere with CDK and CIKs function, and induce some signals to replicate their genome into host’scells.By reviewing some studies about the function of CDK and CIKs in cells infected with oncoviruses, such as HPV, HTLV, HERV, EBV, KSHV, HBV and HCV, we reviewed the mechanisms of different onco-proteins which could deregulate the cell cycle proteins. Keywords: CDK, CIKs, Cancer, Virus Introduction the key role of the phosphorylation in the entrance of Cell division is controlled by various elements [1–10], the cells to the S phase of the cell cycle [19]. especially serine/ threonine protein kinase complexes, CDK genes are classified in mammalian cells into differ- called cyclin-dependent kinases (CDKs), and cyclins, ent classes of CDKs, especially some important regulatory whose expression is prominently regulated by the bind- ones (The regulatory CDKs play important roles in medi- ing to CDK inhibitors [11, 12]. In all eukaryotic species, ating cell cycle). Each of these CDKs could interact with a these genes are classified into different families. It is specific cyclin and thereby regulating the expression of well-established that the complexes of cyclin and CDK different genes [20, 21].
    [Show full text]
  • Title Mtorc1 Upregulation Via ERK-Dependent Gene Expression Change Confers Intrinsic Resistance to MEK Inhibitors in Oncogenic Kras-Mutant Cancer Cells
    mTORC1 upregulation via ERK-dependent gene expression Title change confers intrinsic resistance to MEK inhibitors in oncogenic KRas-mutant cancer cells. Komatsu, Naoki; Fujita, Yoshihisa; Matsuda, Michiyuki; Aoki, Author(s) Kazuhiro Citation Oncogene (2015), 34(45): 5607-5616 Issue Date 2015-11-05 URL http://hdl.handle.net/2433/207613 This is the accepted manuscrip of the article is available at http://dx.doi.org/10.1038/onc.2015.16.; The full-text file will be made open to the public on 5 May 2016 in accordance with Right publisher's 'Terms and Conditions for Self-Archiving'.; この論 文は出版社版でありません。引用の際には出版社版をご 確認ご利用ください。; This is not the published version. Please cite only the published version. Type Journal Article Textversion author Kyoto University 1 Title mTORC1 upregulation via ERK-dependent gene expression change confers intrinsic resistance to MEK inhibitors in oncogenic KRas-mutant cancer cells. Authors Naoki Komatsu1, Yoshihisa Fujita2, Michiyuki Matsuda1,2, and Kazuhiro Aoki3 Affiliations 1. Laboratory of Bioimaging and Cell Signaling, Graduate School of Biostudies, Kyoto University, Japan 2. Department of Pathology and Biology of Diseases, Graduate School of Medicine, Kyoto University, Japan 3. Imaging Platform for Spatio-Temporal Information, Graduate School of Medicine, Kyoto University, Japan To whom correspondence should be addressed Kazuhiro Aoki, Imaging Platform for Spatio-Temporal Information, Graduate School of Medicine, Kyoto University, Sakyo-ku, Kyoto 606-8501, Japan; Tel.: 81-75-753-9450; Fax: 81-75-753-4698; E-mail: [email protected] Running title (less than 50 letters and spaces): Transcriptional control of mTORC1 activity by ERK 2 Abstract Cancer cells harboring oncogenic BRaf mutants, but not oncogenic KRas mutants, are sensitive to MEK inhibitors (MEKi).
    [Show full text]
  • Synergy of WEE1 and Mtor Inhibition in Mutant KRAS-Driven
    Published OnlineFirst August 18, 2017; DOI: 10.1158/1078-0432.CCR-17-1098 Cancer Therapy: Preclinical Clinical Cancer Research Synergy of WEE1 and mTOR Inhibition in Mutant KRAS-Driven Lung Cancers Josephine Hai1,2, Shengwu Liu1,2, Lauren Bufe1, Khanh Do1,2, Ting Chen1,3, Xiaoen Wang1, Christine Ng4, Shuai Li1,2, Ming-Sound Tsao4, Geoffrey I. Shapiro1,2, and Kwok-Kin Wong1,2,3 Abstract Purpose: KRAS-activating mutations are the most common Results: We demonstrate that combined inhibition of oncogenic driver in non–small cell lung cancer (NSCLC), but mTOR and WEE1 induced potent synergistic cytotoxic efforts to directly target mutant KRAS have proved a formidable effects selectively in KRAS-mutant NSCLC cell lines, delayed challenge. Therefore, multitargeted therapy may offer a plau- human tumor xenograft growth and caused tumor regres- sible strategy to effectively treat KRAS-driven NSCLCs. Here, we sion in a murine lung adenocarcinoma model. Mechanis- evaluate the efficacy and mechanistic rationale for combining tically, we show that inhibition of mTOR potentiates mTOR and WEE1 inhibition as a potential therapy for lung WEE1 inhibition by abrogating compensatory activation of cancers harboring KRAS mutations. DNA repair, exacerbating DNA damage in KRAS-mutant Experimental Design: We investigated the synergistic effect of NSCLC, and that this effect is due in part to reduction in combining mTOR and WEE1 inhibitors on cell viability, apo- cyclin D1. ptosis, and DNA damage repair response using a panel of Conclusions: These findings demonstrate that compro- human KRAS-mutantandwildtypeNSCLCcelllinesand mised DNA repair underlies the observed potent synergy of patient-derived xenograft cell lines.
    [Show full text]
  • The Guanine Nucleotide Exchange Factor Kalirin-7 Is a Novel Synphilin-1 Interacting Protein and Modifies Synphilin-1 Aggregate Transport and Formation
    The Guanine Nucleotide Exchange Factor Kalirin-7 Is a Novel Synphilin-1 Interacting Protein and Modifies Synphilin-1 Aggregate Transport and Formation Yu-Chun Tsai, Olaf Riess, Anne S. Soehn., Huu Phuc Nguyen*. Department of Medical Genetics, University of Tuebingen, Tuebingen, Germany Abstract Synphilin-1 has been identified as an interaction partner of a-synuclein, a key protein in the pathogenesis of Parkinson disease (PD). To further explore novel binding partners of synphilin-1, a yeast two hybrid screening was performed and kalirin-7 was identified as a novel interactor. We then investigated the effect of kalirin-7 on synphilin-1 aggregate formation. Coexpression of kalirin-7 and synphilin-1 caused a dramatic relocation of synphilin-1 cytoplasmic small inclusions to a single prominent, perinuclear inclusion. These perinuclear inclusions were characterized as being aggresomes according to their colocalization with microtubule organization center markers, and their formation was microtubule-dependent. Furthermore, kalirin-7 increased the susceptibility of synphilin-1 inclusions to be degraded as demonstrated by live cell imaging and quantification of aggregates. However, the kalirin-7-mediated synphilin-1 aggresome response was not dependent on the GEF activity of kalirin-7 since various dominant negative small GTPases could not inhibit the formation of aggresomes. Interestingly, the aggresome response was blocked by HDAC6 catalytic mutants and the HDAC inhibitor trichostatin A (TSA). Moreover, kalirin-7 decreased the level of acetylated a-tubulin in response to TSA, which suggests an effect of kalirin-7 on HDAC6-mediated protein transportation and aggresome formation. In summary, this is the first report demonstrating that kalirin-7 leads to the recruitment of synphilin-1 into aggresomes in a HDAC6-dependent manner and also links kalirin-7 to microtubule dynamics.
    [Show full text]