New Insights in RBM20 Cardiomyopathy
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Genetic Mutations and Mechanisms in Dilated Cardiomyopathy
Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, … , Jessica R. Golbus, Megan J. Puckelwartz J Clin Invest. 2013;123(1):19-26. https://doi.org/10.1172/JCI62862. Review Series Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of congestive heart failure. In hypertrophic cardiomyopathy (HCM), cardiac output is limited by the thickened myocardium through impaired filling and outflow. Mutations in the genes encoding the thick filament components myosin heavy chain and myosin binding protein C (MYH7 and MYBPC3) together explain 75% of inherited HCMs, leading to the observation that HCM is a disease of the sarcomere. Many mutations are “private” or rare variants, often unique to families. In contrast, dilated cardiomyopathy (DCM) is far more genetically heterogeneous, with mutations in genes encoding cytoskeletal, nucleoskeletal, mitochondrial, and calcium-handling proteins. DCM is characterized by enlarged ventricular dimensions and impaired systolic and diastolic function. Private mutations account for most DCMs, with few hotspots or recurring mutations. More than 50 single genes are linked to inherited DCM, including many genes that also link to HCM. Relatively few clinical clues guide the diagnosis of inherited DCM, but emerging evidence supports the use of genetic testing to identify those patients at risk for faster disease progression, congestive heart failure, and arrhythmia. Find the latest version: https://jci.me/62862/pdf Review series Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, Jessica R. Golbus, and Megan J. Puckelwartz Department of Human Genetics, University of Chicago, Chicago, Illinois, USA. Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of conges- tive heart failure. -
Discovery of the Novel Autophagy Inhibitor Aumitin That Targets Mitochondrial Complex I
Electronic Supplementary Material (ESI) for Chemical Science. This journal is © The Royal Society of Chemistry 2018 Discovery of the novel autophagy inhibitor Aumitin that targets mitochondrial complex I Lucas Robkea,b,c, Yushi Futamurad, Georgios Konstantinidise, Julian Wilkea,b, Harumi Aonod, Zhwan Mahmoudb, Nobumoto Watanabec,f, Yao-Wen Wue, Hiroyuki Osadac,d, Luca Laraiaa,g *, Herbert Waldmanna,b * a: Max-Planck-Institute of Molecular Physiology, department of Chemical Biology, Otto-Hahn-Str. 11, 44227 Dortmund (Germany); b: Faculty of Chemistry and Chemical Biology, TU Dortmund University, Otto-Hahn-Str. 4a, 44227 Dortmund (Germany); c: RIKEN-Max Planck Joint Research Division for Systems Chemical Biology, RIKEN CSRS, 2-1, Hirosawa, Wako, Saitama 351-0198 (Japan); d: Chemical Biology Research Group, RIKEN CSRS, 2-1, Hirosawa, Wako, Saitama 351-0198 (Japan); e: Chemical Genomics Centre of the Max-Planck-Society, Otto- Hahn-Str. 15, 44227 Dortmund (Germany); f: Bio-Active Compounds Discovery Research Unit, RIKEN CSRS, 2-1, Hirosawa, Wako, Saitama 351-0198 (Japan). g: present address: Department of Chemistry, Technical University of Denmark, Kemitorvet Building 207, Room 124, 2800 Kgs. Lyngby, Denmark. * [email protected], [email protected] SI-Table 1: Structure activity relationship of the di-aminopyrimidines. Starvation = starvation induced autophagy assay; Rapamycin = Rapamycin induced autophagy assay; Viability = survival assessed by means of an ADP-glow assay. > 10 = no inhibition at a test concentration of 10 -
Integrative Analyses Identify Potential Key Genes and Pathways in Keshan
medRxiv preprint doi: https://doi.org/10.1101/2021.03.12.21253491; this version posted March 15, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Integrative analyses identify potential key genes and pathways in Keshan disease using whole-exome sequencing Jichang Huang1#, Chenqing Zheng2#, Rong Luo1#, Mingjiang Liu3, Qingquan Gu4, Jinshu Li5, Xiushan Wu6, Zhenglin Yang3, Xia Shen2*, Xiaoping Li3* 1 Institute of Geriatric Cardiovascular Disease, Chengdu Medical College, Chengdu, People’s Republic of China 2 State Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-sen University, Guangzhou, China 3 Department of Cardiology, Hospital of the University of Electronic Science and Technology of China and Sichuan Provincial People’s Hospital, Chengdu, Sichuan, China 4 Shenzhen RealOmics (Biotech) Co., Ltd., Shenzhen, China 5 Institute of Endemic Disease, Center for Disease Control and Prevention of Sichuan Province, Chengdu, Sichuan, China 6 The Center of Heart Development, College of Life Sciences, Hunan Norma University, Changsha, China #, These authors contributed equally to this work. *, Authors for correspondence. NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. medRxiv preprint doi: https://doi.org/10.1101/2021.03.12.21253491; this version posted March 15, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. -
Profiling Data
Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8 -
The TRAX, DISC1, and GSK3 Complex in Mental Disorders and Therapeutic Interventions Yu-Ting Weng1,2, Ting Chien1, I-I Kuan1 and Yijuang Chern1,2*
Weng et al. Journal of Biomedical Science (2018) 25:71 https://doi.org/10.1186/s12929-018-0473-x REVIEW Open Access The TRAX, DISC1, and GSK3 complex in mental disorders and therapeutic interventions Yu-Ting Weng1,2, Ting Chien1, I-I Kuan1 and Yijuang Chern1,2* Abstract Psychiatric disorders (such as bipolar disorder, depression, and schizophrenia) affect the lives of millions of individuals worldwide. Despite the tremendous efforts devoted to various types of psychiatric studies and rapidly accumulating genetic information, the molecular mechanisms underlying psychiatric disorder development remain elusive. Among the genes that have been implicated in schizophrenia and other mental disorders, disrupted in schizophrenia 1 (DISC1) and glycogen synthase kinase 3 (GSK3) have been intensively investigated. DISC1 binds directly to GSK3 and modulates many cellular functions by negatively inhibiting GSK3 activity. The human DISC1 gene is located on chromosome 1 and is highly associated with schizophrenia and other mental disorders. A recent study demonstrated that a neighboring gene of DISC1, translin-associated factor X (TRAX), binds to the DISC1/GSK3β complex and at least partly mediates the actions of the DISC1/GSK3β complex. Previous studies also demonstrate that TRAX and most of its interacting proteins that have been identified so far are risk genes and/or markers of mental disorders. In the present review, we will focus on the emerging roles of TRAX and its interacting proteins (including DISC1 and GSK3β) in psychiatric disorders and the potential implications for developing therapeutic interventions. Keywords: TRAX, DISC1, GSK3β, Mental disorders, DNA damage, DNA repair, Oxidative stress, A2AR, PKA Background DNA repair) by interacting with various proteins [4–12]. -
Disrupted Mechanobiology Links the Molecular and Cellular Phenotypes
bioRxiv preprint doi: https://doi.org/10.1101/555391; this version posted February 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Disrupted Mechanobiology Links the Molecular and Cellular 2 Phenotypes in Familial Dilated Cardiomyopathy 3 4 Sarah R. Clippinger1,2, Paige E. Cloonan1,2, Lina Greenberg1, Melanie Ernst1, W. Tom 5 Stump1, Michael J. Greenberg1,* 6 7 1 Department of Biochemistry and Molecular Biophysics, Washington University School 8 of Medicine, St. Louis, MO, 63110, USA 9 10 2 These authors contributed equally to this work 11 12 *Corresponding author: 13 Michael J. Greenberg 14 Department of Biochemistry and Molecular Biophysics 15 Washington University School of Medicine 16 660 S. Euclid Ave., Campus Box 8231 17 St. Louis, MO 63110 18 Phone: (314) 362-8670 19 Email: [email protected] 20 21 22 Running title: A DCM mutation disrupts mechanosensing 23 24 25 Keywords: Mechanosensing, stem cell derived cardiomyocytes, muscle regulation, 26 troponin, myosin, traction force microscopy 1 bioRxiv preprint doi: https://doi.org/10.1101/555391; this version posted February 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 27 Abstract 28 Familial dilated cardiomyopathy (DCM) is a leading cause of sudden cardiac death and a 29 major indicator for heart transplant. The disease is frequently caused by mutations of 30 sarcomeric proteins; however, it is not well understood how these molecular mutations 31 lead to alterations in cellular organization and contractility. -
Dilated Cardiomyopathy Caused by Truncating Titin Variants
BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Med Genet Dilated cardiomyopathy caused by truncating titin variants – Long-term outcomes, arrhythmias, response to treatment and sex differences SUPPLEMENTARY MATERIAL Christoffer Rasmus Vissing1*, MD; Torsten Bloch Rasmussen2, MD, PhD; Anne Mette Dybro2, MD; Morten Salling Olesen3,4, MSc, PhD; Lisbeth Nørum Pedersen5; MSc, PhD; Morten Jensen, MD, PhD2; Henning Bundgaard1, MD, DMSc; Alex Hørby Christensen1,6 MD, PhD 1The Capital Region’s Unit for Inherited Cardiac Diseases, Department of Cardiology, Rigshospitalet, Copenhagen University Hospital, Copenhagen, Denmark 2Department of Cardiology, Aarhus University Hospital, Aarhus, Denmark 3Laboratory for Molecular Cardiology, University of Copenhagen, Copenhagen, Denmark 4Department of Biomedical Sciences, University of Copenhagen, Copenhagen, 2200 N, Denmark 5Department of Molecular Medicine, Aarhus University Hospital, Denmark. 6Department of Cardiology, Herlev-Gentofte Hospital, Copenhagen University Hospital, Copenhagen, Denmark *Corresponding author: Christoffer Rasmus Vissing, MD The Capital Region’s Unit for Inherited Cardiac Diseases, Department of Cardiology, The Heart Center, Rigshospitalet, Copenhagen University Hospital, Blegdamsvej 9, DK-2100 Copenhagen, Denmark, E-mail: [email protected]; Phone +45 3545 5045 1 Vissing CR, et al. J Med Genet 2020;0:1–10. -
Cyclin-Dependent Kinases and Their Role in Inflammation, Endothelial Cell Migration
Cyclin-Dependent Kinases and their role in Inflammation, Endothelial Cell Migration and Autocrine Activity Dissertation Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Shruthi Ratnakar Shetty Graduate Program in Pharmaceutical Sciences The Ohio State University 2020 Dissertation Committee Dale Hoyt, Advisor Liva Rakotondraibe Moray Campbell Keli Hu Copyrighted by Shruthi Ratnakar Shetty 2020 Abstract Inflammation is the body’s response to infection or injury. Endothelial cells are among the different players involved in an inflammatory cascade. In response to an inflammatory stimuli such as bacterial lipopolysaccharide (LPS), endothelial cells get activated which is characterized by the production of important mediators, such as inducible nitric oxide synthase (iNOS) which, catalyzes the production of nitric oxide (NO) and reactive nitrogen species and cyclooxygenase-2 (COX-2) that catalyzes the production of prostaglandins. Though the production of these mediators is required for an inflammatory response, it is important that their levels are regulated. Continued production of iNOS results in increased accumulation of reactive nitrogen species (RNS) that might lead to cytotoxicity, whereas lack of/suppression results in endothelial and vascular dysfunction. On the other hand, severe cardiovascular, intestinal and renal side effects are observed with significant suppression of COX-2. Thus, studying factors that could regulate the levels of iNOS and COX-2 could provide useful insights for developing novel therapeutic targets. Regulation of protein levels involves control of protein induction or turnover. Since protein induction requires transcription, in this dissertation we studied the role of a promoter of transcription “Cyclin- dependent kinase 7 (CDK7)” in iNOS and COX-2 protein induction. -
Gene Expression Profiling of Micrornas Associated with UCA1 in Bladder Cancer Cells
INTERNATIONAL JOURNAL OF ONCOLOGY 48: 1617-1627, 2016 Gene expression profiling of microRNAs associated with UCA1 in bladder cancer cells XIAOJUAN XIE1,2, JINGJING PAN1, LIQIANG WEI2, SHOUZHEN WU3, HUILIAN HOU4, XU LI3 and WEI CHEN1 1Department of Clinical Laboratory, The First Affiliated Hospital of Xi'an Jiaotong University, Xi'an, Shaanxi 710061; 2Shaanxi Center for Clinical Laboratory, Shaanxi Provincial People's Hospital, Xi'an, Shaanxi 710068; 3Center for Translational Medicine, 4Department of Pathology, The First Affiliated Hospital of Xi'an Jiaotong University, Xi'an, Shaanxi 710061, P.R. China Received November 11, 2015; Accepted December 27, 2015 DOI: 10.3892/ijo.2016.3357 Abstract. Emerging evidence indicates that non-coding and positively correlated with miR-196a, whereas UCA1 and RNAs, such as lncRNAs and microRNAs, play important miR-196a were negatively correlated with p27kip1, which was roles in diverse diseases, such as cancer, immune diseases downregulated in bladder cancer patients. Thus, our findings and cardiovascular diseases. Interestingly, lncRNAs could provided valuable information on miRNAs associated with directly or indirectly regulate the expression of miRNAs. UCA1 in bladder cancer, which could be helpful to further However, the expression profiling of miRNAs associated with explore the related genes and molecular networks fundamental UCA1 in bladder cancer remains unknown. Here, we used in bladder cancer progression. Illumina deep sequencing to sequence miRNA libraries from both the UCA1 knockdown and normal high-expression 5637 Introduction cells. We identified 225 and 235 miRNAs expressed in 5637 cells of normal high-expression and knockdown of UCA1, Recently, emerging studies have demonstrated that 70-90% of respectively. -
A Missense Mutation in the RSRSP Stretch of Rbm20 Causes Dilated
www.nature.com/scientificreports OPEN A missense mutation in the RSRSP stretch of Rbm20 causes dilated cardiomyopathy and atrial fbrillation in mice Kensuke Ihara1,2*, Tetsuo Sasano2, Yuichi Hiraoka3, Marina Togo‑Ohno4, Yurie Soejima5, Motoji Sawabe5, Megumi Tsuchiya6, Hidesato Ogawa6, Tetsushi Furukawa1 & Hidehito Kuroyanagi4* Dilated cardiomyopathy (DCM) is a fatal heart disease characterized by left ventricular dilatation and cardiac dysfunction. Recent genetic studies on DCM have identifed causative mutations in over 60 genes, including RBM20, which encodes a regulator of heart‑specifc splicing. DCM patients with RBM20 mutations have been reported to present with more severe cardiac phenotypes, including impaired cardiac function, atrial fbrillation (AF), and ventricular arrhythmias leading to sudden cardiac death, compared to those with mutations in the other genes. An RSRSP stretch of RBM20, a hotspot of missense mutations found in patients with idiopathic DCM, functions as a crucial part of its nuclear localization signals. However, the relationship between mutations in the RSRSP stretch and cardiac phenotypes has never been assessed in an animal model. Here, we show that Rbm20 mutant mice harboring a missense mutation S637A in the RSRSP stretch, mimicking that in a DCM patient, demonstrated severe cardiac dysfunction and spontaneous AF and ventricular arrhythmias mimicking the clinical state in patients. In contrast, Rbm20 mutant mice with frame‑shifting deletion demonstrated less severe phenotypes, although loss of RBM20‑dependent alternative splicing was indistinguishable. RBM20S637A protein cannot be localized to the nuclear speckles, but accumulated in cytoplasmic, perinuclear granule‑like structures in cardiomyocytes, which might contribute to the more severe cardiac phenotypes. Dilated cardiomyopathy (DCM) is a fatal cardiac disease characterized by enlargement of the cardiac chambers and impaired systolic function1. -
TITLE PAGE Oxidative Stress and Response to Thymidylate Synthase
Downloaded from molpharm.aspetjournals.org at ASPET Journals on October 2, 2021 -Targeted -Targeted 1 , University of of , University SC K.W.B., South Columbia, (U.O., Carolina, This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted.