Individual Protomers of a G Protein-Coupled Receptor Dimer Integrate Distinct Functional Modules
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Genetic Mutations and Mechanisms in Dilated Cardiomyopathy
Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, … , Jessica R. Golbus, Megan J. Puckelwartz J Clin Invest. 2013;123(1):19-26. https://doi.org/10.1172/JCI62862. Review Series Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of congestive heart failure. In hypertrophic cardiomyopathy (HCM), cardiac output is limited by the thickened myocardium through impaired filling and outflow. Mutations in the genes encoding the thick filament components myosin heavy chain and myosin binding protein C (MYH7 and MYBPC3) together explain 75% of inherited HCMs, leading to the observation that HCM is a disease of the sarcomere. Many mutations are “private” or rare variants, often unique to families. In contrast, dilated cardiomyopathy (DCM) is far more genetically heterogeneous, with mutations in genes encoding cytoskeletal, nucleoskeletal, mitochondrial, and calcium-handling proteins. DCM is characterized by enlarged ventricular dimensions and impaired systolic and diastolic function. Private mutations account for most DCMs, with few hotspots or recurring mutations. More than 50 single genes are linked to inherited DCM, including many genes that also link to HCM. Relatively few clinical clues guide the diagnosis of inherited DCM, but emerging evidence supports the use of genetic testing to identify those patients at risk for faster disease progression, congestive heart failure, and arrhythmia. Find the latest version: https://jci.me/62862/pdf Review series Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, Jessica R. Golbus, and Megan J. Puckelwartz Department of Human Genetics, University of Chicago, Chicago, Illinois, USA. Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of conges- tive heart failure. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
The Biomarkers of Key Mirnas and Target Genes Associated with Acute Myocardial Infarction
The biomarkers of key miRNAs and target genes associated with acute myocardial infarction Qi Wang1, Bingyan Liu2,3, Yuanyong Wang4, Baochen Bai1, Tao Yu3 and Xian–ming Chu1,5 1 Department of Cardiology, The Affiliated hospital of Qingdao University, Qingdao, China 2 School of Basic Medicine, Qingdao University, Qingdao, China 3 Institute for Translational Medicine, Qingdao University, Qingdao, China 4 Department of Thoracic Surgery, Affiliated Hospital of Qingdao University, Qingdao, China 5 Department of Cardiology, The Affiliated Cardiovascular Hospital of Qingdao University, Qingdao, China ABSTRACT Background. Acute myocardial infarction (AMI) is considered one of the most prominent causes of death from cardiovascular disease worldwide. Knowledge of the molecular mechanisms underlying AMI remains limited. Accurate biomarkers are needed to predict the risk of AMI and would be beneficial for managing the incidence rate. The gold standard for the diagnosis of AMI, the cardiac troponin T (cTnT) assay, requires serial testing, and the timing of measurement with respect to symptoms affects the results. As attractive candidate diagnostic biomarkers in AMI, circulating microRNAs (miRNAs) are easily detectable, generally stable and tissue specific. Methods. The Gene Expression Omnibus (GEO) database was used to compare miRNA expression between AMI and control samples, and the interactions between miRNAs and mRNAs were analysed for expression and function. Furthermore, a protein-protein interaction (PPI) network was constructed. The miRNAs identified in the bioinformatic analysis were verified by RT-qPCR in an H9C2 cell line. The miRNAs in plasma samples from patients with AMI (n D 11) and healthy controls (n D 11) were used to construct Submitted 23 December 2019 receiver operating characteristic (ROC) curves to evaluate the clinical prognostic value Accepted 14 April 2020 of the identified miRNAs. -
Cdc42 and Rac1 Activity Is Reduced in Human Pheochromocytoma and Correlates with FARP1 and ARHGEF1 Expression
234 P Croisé et al. Rho-GTPase activity in human 23:4 281–293 Research pheochromocytoma Cdc42 and Rac1 activity is reduced in human pheochromocytoma and correlates with FARP1 and ARHGEF1 expression Pauline Croisé1, Sébastien Houy1, Mathieu Gand1, Joël Lanoix2, Valérie Calco1, Petra Tóth1, Laurent Brunaud3, Sandra Lomazzi4, Eustache Paramithiotis2, Daniel Chelsky2, Stéphane Ory1,* and Stéphane Gasman1,* Correspondence 1Institut des Neurosciences Cellulaires et Intégratives (INCI), CNRS UPR 3212, Strasbourg, France should be addressed 2Caprion Proteome, Inc., Montréal, Québec, Canada to S Ory or S Gasman 3Service de Chirurgie Digestive, Hépato-bilaire et Endocrinienne, CHRU Nancy, Hôpitaux de Brabois, Email Vandoeuvre les Nancy, France [email protected] or 4Centre de Ressources Biologiques (CRB), CHRU Nancy, Hôpitaux de Brabois, Vandoeuvres les Nancy, France [email protected] *(S Ory and S Gasman contributed equally to this work) Abstract Among small GTPases from the Rho family, Cdc42, Rac, and Rho are well known to mediate Key Words a large variety of cellular processes linked with cancer biology through their ability to cycle f Rho-GTPases between an inactive (GDP-bound) and an active (GTP-bound) state. Guanine nucleotide f pheochromocytoma exchange factors (GEFs) stimulate the exchange of GDP for GTP to generate the activated f mass spectrometry form, whereas the GTPase-activating proteins (GAPs) catalyze GTP hydrolysis, leading to f Rho-GEF Endocrine-Related Cancer Endocrine-Related the inactivated form. Modulation of Rho GTPase activity following altered expression of Rho-GEFs and/or Rho-GAPs has already been reported in various human tumors. However, nothing is known about the Rho GTPase activity or the expression of their regulators in human pheochromocytomas, a neuroendocrine tumor (NET) arising from chromaffin cells of the adrenal medulla. -
Integrative Analyses Identify Potential Key Genes and Pathways in Keshan
medRxiv preprint doi: https://doi.org/10.1101/2021.03.12.21253491; this version posted March 15, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Integrative analyses identify potential key genes and pathways in Keshan disease using whole-exome sequencing Jichang Huang1#, Chenqing Zheng2#, Rong Luo1#, Mingjiang Liu3, Qingquan Gu4, Jinshu Li5, Xiushan Wu6, Zhenglin Yang3, Xia Shen2*, Xiaoping Li3* 1 Institute of Geriatric Cardiovascular Disease, Chengdu Medical College, Chengdu, People’s Republic of China 2 State Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-sen University, Guangzhou, China 3 Department of Cardiology, Hospital of the University of Electronic Science and Technology of China and Sichuan Provincial People’s Hospital, Chengdu, Sichuan, China 4 Shenzhen RealOmics (Biotech) Co., Ltd., Shenzhen, China 5 Institute of Endemic Disease, Center for Disease Control and Prevention of Sichuan Province, Chengdu, Sichuan, China 6 The Center of Heart Development, College of Life Sciences, Hunan Norma University, Changsha, China #, These authors contributed equally to this work. *, Authors for correspondence. NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. medRxiv preprint doi: https://doi.org/10.1101/2021.03.12.21253491; this version posted March 15, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. -
In Amyotrophic Lateral Sclerosis
ORIGINAL RESEARCH published: 25 March 2021 doi: 10.3389/fncel.2021.600872 Dual Role of Lysophosphatidic Acid Receptor 2 (LPA2) in Amyotrophic Lateral Sclerosis Maria Puigdomenech-Poch 1,2, Anna Martínez-Muriana 1, Pol Andrés-Benito 2,3, Isidre Ferrer 2,3, Jerold Chun 4 and Rubèn López-Vales 1,2* 1Departament de Biologia Cellular, Fisiologia i Immunologia, Institut de Neurociències, Centro de Investigación Biomédica en Red sobre Enfermedades Neurodegenerativas (CIBERNED), Universitat Autònoma de Barcelona, Bellaterra, Spain, 2Centro de Investigación Biomédica en Red de Enfermedades Neurodegenerativas (CIBERNED), Madrid, Spain, 3Departament de Patologia i Terapèutica Experimental, Hospital Universitari de Bellvitge, IDIBELL, L’Hospitalet de Llobregat, Universitat de Barcelona, Barcelona, Spain, 4Sanford Burnham Prebys Medical Discovery Institute, La Jolla, CA, United States Lysophosphatidic acid (LPA) is a pleiotropic extracellular lipid mediator with many Edited by: Ertugrul Kilic, physiological functions that signal through six known G protein-coupled receptors Istanbul Medipol University, Turkey (LPA1–6). In the central nervous system (CNS), LPA mediates a wide range of effects Reviewed by: including neural progenitor cell physiology, neuronal cell death, axonal retraction, and Savina Apolloni, inflammation. Since inflammation is a hallmark of most neurological conditions, we University of Rome Tor Vergata, Italy Mustafa Caglar Beker, hypothesized that LPA could be involved in the physiopathology of amyotrophic lateral Istanbul Medipol University, Turkey sclerosis (ALS). We found that LPA2 RNA was upregulated in post-mortem spinal cord *Correspondence: samples of ALS patients and in the sciatic nerve and skeletal muscle of SOD1G93A Rubèn López-Vales [email protected] mouse, the most widely used ALS mouse model. -
Focus on Cdc42 in Breast Cancer: New Insights, Target Therapy Development and Non-Coding Rnas
Review Focus on Cdc42 in Breast Cancer: New Insights, Target Therapy Development and Non-Coding RNAs Yu Zhang †, Jun Li †, Xing-Ning Lai, Xue-Qiao Jiao, Jun-Ping Xiong and Li-Xia Xiong * Department of Pathophysiology, Jiangxi Province Key Laboratory of Tumor Pathogenesis and Molecular Pathology, Medical College, Nanchang University, 461 Bayi Road, Nanchang 330006, China; [email protected] (Y.Z.); [email protected] (J.L.); [email protected] (X.-N.L.); [email protected] (X.-Q.J.); [email protected] (J.-P.X.) * Correspondence: [email protected]; Tel.: +86-791-8636-0556 † These authors contributed equally to this work. Received: 30 December 2018; Accepted: 8 February 2019; Published: 11 February 2019 Abstract: Breast cancer is the most common malignant tumors in females. Although the conventional treatment has demonstrated a certain effect, some limitations still exist. The Rho guanosine triphosphatase (GTPase) Cdc42 (Cell division control protein 42 homolog) is often upregulated by some cell surface receptors and oncogenes in breast cancer. Cdc42 switches from inactive guanosine diphosphate (GDP)-bound to active GTP-bound though guanine-nucleotide- exchange factors (GEFs), results in activation of signaling cascades that regulate various cellular processes such as cytoskeletal changes, proliferation and polarity establishment. Targeting Cdc42 also provides a strategy for precise breast cancer therapy. In addition, Cdc42 is a potential target for several types of non-coding RNAs including microRNAs and lncRNAs. These non-coding RNAs is extensively involved in Cdc42-induced tumor processes, while many of them are aberrantly expressed. Here, we focus on the role of Cdc42 in cell morphogenesis, proliferation, motility, angiogenesis and survival, introduce the Cdc42-targeted non-coding RNAs, as well as present current development of effective Cdc42-targeted inhibitors in breast cancer. -
Targeting Lysophosphatidic Acid in Cancer: the Issues in Moving from Bench to Bedside
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by IUPUIScholarWorks cancers Review Targeting Lysophosphatidic Acid in Cancer: The Issues in Moving from Bench to Bedside Yan Xu Department of Obstetrics and Gynecology, Indiana University School of Medicine, 950 W. Walnut Street R2-E380, Indianapolis, IN 46202, USA; [email protected]; Tel.: +1-317-274-3972 Received: 28 August 2019; Accepted: 8 October 2019; Published: 10 October 2019 Abstract: Since the clear demonstration of lysophosphatidic acid (LPA)’s pathological roles in cancer in the mid-1990s, more than 1000 papers relating LPA to various types of cancer were published. Through these studies, LPA was established as a target for cancer. Although LPA-related inhibitors entered clinical trials for fibrosis, the concept of targeting LPA is yet to be moved to clinical cancer treatment. The major challenges that we are facing in moving LPA application from bench to bedside include the intrinsic and complicated metabolic, functional, and signaling properties of LPA, as well as technical issues, which are discussed in this review. Potential strategies and perspectives to improve the translational progress are suggested. Despite these challenges, we are optimistic that LPA blockage, particularly in combination with other agents, is on the horizon to be incorporated into clinical applications. Keywords: Autotaxin (ATX); ovarian cancer (OC); cancer stem cell (CSC); electrospray ionization tandem mass spectrometry (ESI-MS/MS); G-protein coupled receptor (GPCR); lipid phosphate phosphatase enzymes (LPPs); lysophosphatidic acid (LPA); phospholipase A2 enzymes (PLA2s); nuclear receptor peroxisome proliferator-activated receptor (PPAR); sphingosine-1 phosphate (S1P) 1. -
1 Supporting Information for a Microrna Network Regulates
Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia. -
Updates on Myopia
Updates on Myopia A Clinical Perspective Marcus Ang Tien Y. Wong Editors Updates on Myopia Marcus Ang • Tien Y. Wong Editors Updates on Myopia A Clinical Perspective Editors Marcus Ang Tien Y. Wong Singapore National Eye Center Singapore National Eye Center Duke-NUS Medical School Duke-NUS Medical School National University of Singapore National University of Singapore Singapore Singapore This book is an open access publication. ISBN 978-981-13-8490-5 ISBN 978-981-13-8491-2 (eBook) https://doi.org/10.1007/978-981-13-8491-2 © The Editor(s) (if applicable) and The Author(s) 2020, corrected publication 2020 Open Access This book is licensed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license and indicate if changes were made. The images or other third party material in this book are included in the book's Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the book's Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specifc statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. -
Disrupted Mechanobiology Links the Molecular and Cellular Phenotypes
bioRxiv preprint doi: https://doi.org/10.1101/555391; this version posted February 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Disrupted Mechanobiology Links the Molecular and Cellular 2 Phenotypes in Familial Dilated Cardiomyopathy 3 4 Sarah R. Clippinger1,2, Paige E. Cloonan1,2, Lina Greenberg1, Melanie Ernst1, W. Tom 5 Stump1, Michael J. Greenberg1,* 6 7 1 Department of Biochemistry and Molecular Biophysics, Washington University School 8 of Medicine, St. Louis, MO, 63110, USA 9 10 2 These authors contributed equally to this work 11 12 *Corresponding author: 13 Michael J. Greenberg 14 Department of Biochemistry and Molecular Biophysics 15 Washington University School of Medicine 16 660 S. Euclid Ave., Campus Box 8231 17 St. Louis, MO 63110 18 Phone: (314) 362-8670 19 Email: [email protected] 20 21 22 Running title: A DCM mutation disrupts mechanosensing 23 24 25 Keywords: Mechanosensing, stem cell derived cardiomyocytes, muscle regulation, 26 troponin, myosin, traction force microscopy 1 bioRxiv preprint doi: https://doi.org/10.1101/555391; this version posted February 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 27 Abstract 28 Familial dilated cardiomyopathy (DCM) is a leading cause of sudden cardiac death and a 29 major indicator for heart transplant. The disease is frequently caused by mutations of 30 sarcomeric proteins; however, it is not well understood how these molecular mutations 31 lead to alterations in cellular organization and contractility.