DOCSLIB.ORG

Updates on Myopia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Updates on Myopia A Clinical Perspective Marcus Ang Tien Y. Wong Editors Updates on Myopia Marcus Ang • Tien Y. Wong Editors Updates on Myopia A Clinical Perspective Editors Marcus Ang Tien Y. Wong Singapore National Eye Center Singapore National Eye Center Duke-NUS Medical School Duke-NUS Medical School National University of Singapore National University of Singapore Singapore Singapore This book is an open access publication. ISBN 978-981-13-8490-5 ISBN 978-981-13-8491-2 (eBook) https://doi.org/10.1007/978-981-13-8491-2 © The Editor(s) (if applicable) and The Author(s) 2020, corrected publication 2020 Open Access This book is licensed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license and indicate if changes were made. The images or other third party material in this book are included in the book's Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the book's Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specifc statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affliations. This Springer imprint is published by the registered company Springer Nature Singapore Pte Ltd. The registered company address is: 152 Beach Road, #21-01/04 Gateway East, Singapore 189721, Singapore Preface Myopia is now being recognized as a signifcant global public health problem that will affect billions of people in the next decades, especially in Asia. Currently, pathologic myopia is already a major cause of visual impairment in both Asian and Western populations. As the prevalence of myopia and pathological myopia increases around the world, there is increasing need for active prevention of myopia progression and management of its potential complications. The purpose of this book is to provide updates on current understanding of myo- pia, new methods of evaluation of the myopic eye, and a focus on clinical manage- ment of myopia and its complications. This book will provide a unique perspective from the current world experts on the subject, with a focus on clinical aspects of understanding, evaluation, and management of myopia. Chapter 1 provides a concise summary of all the key points from the book for busy readers who want a quick overview on clinical myopia. The rest of the book is comprehensive and provides updates on almost all aspects with regard to myopia. Chapters 2 and 3 describe epidemiology and economic burden; Chaps. 4 and 5 dis- cuss genetic and pathogenetic mechanisms; Chaps. 6 to 8 describe risk factors and ways to prevent myopia development or progression. Next, Chaps. 9 and 10 discuss pathological myopia and advances (and challenges) in imaging myopic eyes. Finally, Chaps. 11 to 14 provide clinical pearls of managing myopia complications, i.e., glaucoma, retina, and choroidal neovascularization in adults. As new data is constantly emerging, this book was generated with the inputs of all authors within 6 months to ensure that the evidence shared is as current as pos- sible. Thus, it is important to keep updated with online material and literature review. Nonetheless, we hope you will fnd this book as a useful reference for optometry students, ophthalmology residents, and eye care professionals to have a comprehensive update on myopia with a clinical perspective. Singapore, Singapore Marcus Ang Singapore, Singapore Tien Y. Wong v Acknowledgments Singapore National Eye Centre, Singapore Singapore Eye Research Institute, Singapore Duke National University of Singapore (DUKE NUS), Singapore Singapore National Eye Centre Myopia Centre, Singapore PANTONE 300C PANTONE Neutral Black C vii Contents 1 Introduction and Overview on Myopia: A Clinical Perspective ������������ 1 Chee Wai Wong, Noel Brennan, and Marcus Ang 2 Global Epidemiology of Myopia . 27 Saiko Matsumura, Cheng Ching-Yu, and Seang-Mei Saw 3 The Economic and Societal Impact of Myopia and High Myopia . 53 Sharon Yu Lin Chua and Paul J. Foster 4 Understanding Myopia: Pathogenesis and Mechanisms ������������������������ 65 Ranjay Chakraborty, Scott A. Read, and Stephen J. Vincent 5 The Genetics of Myopia . 95 Milly S. Tedja, Annechien E. G. Haarman, Magda A. Meester-Smoor, Virginie J. M. Verhoeven, Caroline C. W. Klaver, and Stuart MacGregor 6 Risk Factors for Myopia: Putting Causal Pathways into a Social Context �������������������������������������� 133 Ian G. Morgan, Amanda N. French, and Kathryn A. Rose 7 Prevention of Myopia Onset ���������������������������������������������������������������������� 171 Mingguang He, Yanxian Chen, and Yin Hu 8 Clinical Management and Control of Myopia in Children �������������������� 187 Audrey Chia and Su Ann Tay 9 Understanding Pathologic Myopia . 201 Kyoko Ohno-Matsui and Jost B. Jonas 10 Imaging in Myopia . 219 Quan V. Hoang, Jacqueline Chua, Marcus Ang, and Leopold Schmetterer 11 Glaucoma in High Myopia ������������������������������������������������������������������������ 241 Jost B. Jonas, Songhomitra Panda-Jonas, and Kyoko Ohno-Matsui ix x Contents 12 Clinical Management of Myopia in Adults: Treatment of Retinal Complications �������������������������������������������������������� 257 Jerry K. H. Lok, Raymond L. M. Wong, Lawrence P. L. Iu, and Ian Y. H. Wong 13 Clinical Management of Myopia in Adults: Treatment of Myopic CNV ������������������������������������������������������������������������ 271 Shaun Sim, Chee Wai Wong, and Gemmy C. M. Cheung 14 Optical Interventions for Myopia Control . 289 Wing Chun Tang, Myra Leung, Angel C. K. Wong, Chi-ho To, and Carly S. Y. Lam Correction to: Optical Interventions for Myopia Control. C1 About the Editors Marcus Ang is consultant ophthalmologist at the Corneal and External Eye Disease Department of the Singapore National Eye Center (SNEC) and Duke-NUS Medical School, National University of Singapore, as well as Clinical Director of the SNEC Myopia Centre. His clinical and research areas of expertise include the treatment, and prevention of visual impairment in adult myopia. He also has special research interests in corneal transplantation, such as Descemet membrane endothe- lial keratoplasty (DMEK) and anterior segment imaging including novel optical coherence tomography systems for the cornea. Dr. Ang has published over 120 peer-reviewed articles journals, coauthored several book chapters on corneal trans- plantation, and received numerous international awards. Tien Y. Wong is Arthur Lim Professor in Ophthalmology and Medical Director at the Singapore National Eye Center (SNEC). He is concurrently Academic Chair of Ophthalmology and Vice-Dean of Duke-NUS Medical School, National University of Singapore. Prior to his current appointments, Prof. Wong was Executive Director of the Singapore Eye Research Institute; Chairman of the Department of Ophthalmology, National University of Singapore; Chairman of the Department of Ophthalmology at the University of Melbourne; and Managing Director of the Centre for Eye Research Australia, Australia. Professor Wong is a retinal specialist, whose clinical practice focuses on major retinal diseases. His research covers epidemiologi- cal, clinical, and translational studies of eye diseases, including epidemiology and risk factors of myopia, imaging in myopic macular degeneration, and clinical trials on treatment of myopic choroidal neovascularization. He has published more than 1000 papers in peer-reviewed journals, including the New England Journal of Medicine and the Lancet. Prof. Wong has received a number of national and interna- tional awards. xi Introduction and Overview on Myopia: A Clinical Perspective 1 Chee Wai Wong, Noel Brennan, and Marcus Ang Key Points • Myopia is a signifcant global public health and socioeconomic problem. • Pathologic myopia has become a major cause of blindness or visual impair- ment in both Asian and Western populations. • Myopia may be a highly heritable trait, with environmental infuences such as outdoor activity playing important roles in its development and progression. • Control of myopia in children is important, and various strategies includ- ing pharmacologic and lens-related interventions have proven effcacy. • Imaging is important to detect complications of pathologic myopia, and both medical and surgical interventions may be useful for their management. C. W. Wong · M. Ang (*) Singapore National Eye Centre, Singapore Eye Research Institute, Singapore, Singapore Duke-NUS Medical School, Singapore, Singapore e-mail: [email protected]
Recommended publications
  • A Case Study of Distinctive Phenotypes Arising from Emanuel Syndrome in Two Karyotypically Identical Patients Mot Yee Yik1, Rabiatul Basria S.M.N

    A Case Study of Distinctive Phenotypes Arising from Emanuel Syndrome in Two Karyotypically Identical Patients Mot Yee Yik1, Rabiatul Basria S.M.N

    Malaysian Journal of Medicine and Health Sciences (eISSN 2636-9346) CASE REPORT A Case Study of Distinctive Phenotypes Arising From Emanuel Syndrome in Two Karyotypically Identical Patients Mot Yee Yik1, Rabiatul Basria S.M.N. Mydin2, Emmanuel Jairaj Moses1, Shahrul Hafiz Mohd Zaini2,3, Abdul Rahman Azhari4, Narazah Mohd Yusoff1 1 Regenerative Medicine Sciences Cluster, Advanced Medical and Dental Institute, Universiti Sains Malaysia, 13200 Bertam, Kepala Batas, Pulau Pinang Malaysia 2 Oncological and Radiological Sciences Cluster, Advanced Medical and Dental Institute, Universiti Sains Malaysia, 13200 Bertam, Kepala Batas, Pulau Pinang Malaysia, 3 Institute of Biological Sciences, Faculty of Science, University of Malaya, 50603 Kuala Lumpur. 4 Human Genetics Unit, Advanced Diagnostic Laboratory, Advanced Medical and Dental Institute, Universiti Sains Malaysia ABSTRACT Emanuel syndrome, also referred to as supernumerary der(22) or t(11;22) syndrome, is a rare genomic syndrome. Patients are normally presented with multiple congenital anomalies and severe developmental disabilities. Affected newborns usually carry a derivative chromosome 22 inherited from either parent, which stems from a balanced translocation between chromosomes 11 and 22. Unfortunately, identification of Emanuel syndrome carriers is diffi- cult as balanced translocations do not typically present symptoms. We identified two patients diagnosed as Emanuel syndrome with identical chromosomal aberration: 47,XX,+der(22)t(11;22)(q24;q12.1)mat karyotype but presenting variable phenotypic features. Emanuel syndrome patients present variable phenotypes and karyotypes have also been inconsistent albeit the existence of a derivative chromosome 22. Our data suggests that there may exist ac- companying genetic aberrations which influence the outcome of Emanuel syndrome phenotypes but it should be cautioned that more patient observations, diagnostic data and research is required before conclusions can be drawn on definitive karyotypic-phenotypic correlations.
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • Vision Screening Training

    Vision Screening Training

    Vision Screening Training Child Health and Disability Prevention (CHDP) Program State of California CMS/CHDP Department of Health Care Services Revised 7/8/2013 Acknowledgements Vision Screening Training Workgroup – comprising Health Educators, Public Health Nurses, and CHDP Medical Consultants Dr. Selim Koseoglu, Pediatric Ophthalmologist Local CHDP Staff 2 Objectives By the end of the training, participants will be able to: Understand the basic anatomy of the eye and the pathway of vision Understand the importance of vision screening Recognize common vision disorders in children Identify the steps of vision screening Describe and implement the CHDP guidelines for referral and follow-up Properly document on the PM 160 vision screening results, referrals and follow-up 3 IMPORTANCE OF VISION SCREENING 4 Why Screen for Vision? Early diagnosis of: ◦ Refractive Errors (Nearsightedness, Farsightedness) ◦ Amblyopia (“lazy eye”) ◦ Strabismus (“crossed eyes”) Early intervention is the key to successful treatment 5 Why Screen for Vision? Vision problems often go undetected because: Young children may not realize they cannot see properly Many eye problems do not cause pain, therefore a child may not complain of discomfort Many eye problems may not be obvious, especially among young children The screening procedure may have been improperly performed 6 Screening vs. Diagnosis Screening Diagnosis 1. Identifies children at 1. Identifies the child’s risk for certain eye eye condition conditions or in need 2. Allows the eye of a professional
  • Blue Cone Monochromacy: Visual Function and Efficacy Outcome Measures for Clinical Trials

    Blue Cone Monochromacy: Visual Function and Efficacy Outcome Measures for Clinical Trials

    RESEARCH ARTICLE Blue Cone Monochromacy: Visual Function and Efficacy Outcome Measures for Clinical Trials Xunda Luo1☯‡, Artur V. Cideciyan1☯‡*, Alessandro Iannaccone2, Alejandro J. Roman1, Lauren C. Ditta2, Barbara J. Jennings2, Svetlana A. Yatsenko3, Rebecca Sheplock1, Alexander Sumaroka1, Malgorzata Swider1, Sharon B. Schwartz1, Bernd Wissinger4, Susanne Kohl4, Samuel G. Jacobson1* 1 Scheie Eye Institute, Department of Ophthalmology, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, United States of America, 2 Hamilton Eye Institute, Department of Ophthalmology, University of Tennessee Health Science Center, Memphis, Tennessee, United States of America, 3 Pittsburgh Cytogenetics Laboratory, Center for Medical Genetics and Genomics, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania, United States of America, 4 Molecular Genetics Laboratory, Institute for Ophthalmic Research, Centre for Ophthalmology, University of Tuebingen, Tuebingen, Germany ☯ These authors contributed equally to this work. ‡ OPEN ACCESS These authors are joint first authors on this work. * [email protected] (SGJ); [email protected] (AVC) Citation: Luo X, Cideciyan AV, Iannaccone A, Roman AJ, Ditta LC, Jennings BJ, et al. (2015) Blue Cone Monochromacy: Visual Function and Efficacy Abstract Outcome Measures for Clinical Trials. PLoS ONE 10(4): e0125700. doi:10.1371/journal.pone.0125700 Academic Editor: Dror Sharon, Hadassah-Hebrew University Medical Center, ISRAEL Background Blue Cone Monochromacy (BCM) is an X-linked retinopathy caused by mutations in the Received: December 29, 2014 OPN1LW / OPN1MW gene cluster, encoding long (L)- and middle (M)-wavelength sensitive Accepted: March 21, 2015 cone opsins. Recent evidence shows sufficient structural integrity of cone photoreceptors in Published: April 24, 2015 BCM to warrant consideration of a gene therapy approach to the disease.
  • Pattern of Vitreo-Retinal Diseases at the National Referral Hospital in Bhutan: a Retrospective, Hospital-Based Study Bhim B

    Pattern of Vitreo-Retinal Diseases at the National Referral Hospital in Bhutan: a Retrospective, Hospital-Based Study Bhim B

    Rai et al. BMC Ophthalmology (2020) 20:51 https://doi.org/10.1186/s12886-020-01335-x RESEARCH ARTICLE Open Access Pattern of vitreo-retinal diseases at the national referral hospital in Bhutan: a retrospective, hospital-based study Bhim B. Rai1,2* , Michael G. Morley3, Paul S. Bernstein4 and Ted Maddess1 Abstract Background: Knowing the pattern and presentation of the diseases is critical for management strategies. To inform eye-care policy we quantified the pattern of vitreo-retinal (VR) diseases presenting at the national referral hospital in Bhutan. Methods: We reviewed all new patients over three years from the retinal clinic of the Jigme Dorji Wangchuck National Referral Hospital. Demographic data, presenting complaints and duration, treatment history, associated systemic diseases, diagnostic procedures performed, and final diagnoses were quantified. Comparisons of the expected and observed frequency of gender used Chi-squared tests. We applied a sampling with replacement based bootstrap analysis (10,000 cycles) to estimate the population means and the standard errors of the means and standard error of the 10th, 25th, 50th, 75th and 90th percentiles of the ages of the males and females within 20-year cohorts. We then applied t-tests employing the estimated means and standard errors. The 2913 subjects insured that the bootstrap estimates were statistically conservative. Results: The 2913 new cases were aged 47.2 ± 21.8 years. 1544 (53.0%) were males. Housewives (953, 32.7%) and farmers (648, 22.2%) were the commonest occupations. Poor vision (41.9%), screening for diabetic and hypertensive retinopathy (13.1%), referral (9.7%), sudden vision loss (9.3%), and trauma (8.0%) were the commonest presenting symptoms.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Diabetic Retinopathy

    Diabetic Retinopathy

    Postgrad MedJ7 1998;74:129-1 33 C The Fellowship of Postgraduate Medicine, 1998 Classic diseases revisited Postgrad Med J: first published as 10.1136/pgmj.74.869.129 on 1 March 1998. Downloaded from Diabetic retinopathy David A Infeld, John G O'Shea Summary Diabetes mellitus is the most common cause of blindness amongst the 25-65 Diabetic retinopathy is the com- year age group. The ocular complications of diabetes include diabetic monest cause ofblindness amongst retinopathy, iris neovascularisation, glaucoma, cataract, and microvascular individuals of working age. The abnormalities of the optic nerve. The most frequent complication is diabetic onset of retinopathy is variable. retinopathy.`' The risk of becoming blind increases with the duration of Regular ophthalmic screening is diabetes. The cumulative risk is higher in insulin-dependent diabetes mellitus essential in order to detect treat- (IDDM) than in noninsulin dependent diabetes mellitus (NIDDM).4 able lesions early. Retinal laser World-wide, it is estimated that over 2.5 million people are blind due to diabetes, therapy is highly effective in slow- which is thus the fourth leading cause ofblindness and an increasing problem in ing the progression of retinopathy developing nations.6 and in preventing blindness. As the Blindness commonly occurs from either macular oedema or ischaemia, vitre- sufferers of diabetes mellitus, the ous haemorrhage, or tractional retinal detachment.''5 Macular oedema is now commonest endocrine disorder, the leading cause of loss of vision amongst Western patients. It develops earlier now constitute approximately and is more severe in NIDDM than in IDDM.7 The treatment of macular 1-2% of Western populations, con- oedema has therefore been the subject of leading international studies.
  • 18 (2), 2015 77-82 a Case with Emanuel Syndrome

    18 (2), 2015 77-82 a Case with Emanuel Syndrome

    18 (2), 2015 l 77-82 DOI: 10.1515/bjmg-2015-0089 CASE REPORT A CASE WITH EMANUEL SYNDROME: EXTRA DERIVATIVE 22 CHROMOSOME INHERITED FROM THE MOTHER İkbal Atli E*, Gürkan H, Vatansever Ü, Ulusal S, Tozkir H *Corresponding Author: Emine İkbal Atli, Ph.D., Department of Medical Genetics, Faculty of Medicine, Trakya University, Campus Of Balkan, D100 Street, Edirne 22030, Turkey. Tel: +90-554-253-4030. Fax: +90- 284-223-4201. E-mail: [email protected] ABSTRACT INTRODUCTION Emanuel syndrome (ES) is a rare chromosomal Emanuel syndrome (ES) is an unbalanced disorder that is characterized by multiple congenital translocation syndrome, usually arising through a anomalies and developmental disabilities. Affected 3:1 meiosis I malsegregation during gametogenesis children are usually identified in the newborn period in a phenotypically balanced translocation normal as the offspring of balanced (11;22) translocation carrier. While the true mortality rate in Emanuel syn- carriers. Carriers of this balanced translocation usu- drome is unknown, long-term survival is possible [1]. ally have no clinical symptoms and are often identi- Emanuel syndrome is also referred to as derivative fied after the birth of offspring with an unbalanced 22 syndrome, derivative 11;22 syndrome, partial tri- form of the translocation, the supernumerary der(22) somy 11;22, or supernumerary der(22)t(11;22) syn- t(11;22) syndrome. We report a 3-year-old boy with drome [2]. In this partial duplication, 11(q23-qter) the t(11;22)(q23;q11) chromosome, transmitted in and 22(pter-q11) complex, congenital diaphragmatic an unbalanced fashion from his mother.
  • Myopia Dystopia Are Future Generations Doomed to an Ever-Worsening Spiral of Refractive Error?

    Myopia Dystopia Are Future Generations Doomed to an Ever-Worsening Spiral of Refractive Error?

    NOVEMBER / DECEMBER 2013 # 03 Upfront In Practice NextGen Profession Blindingly Obvious Progress Predicting Outcomes of Stem Cells in Ophthalmology: How To Do Your Own With Glaucoma Anti-VEGF Therapy Are We Nearly There Yet? Market Research 10 26 – 28 35 – 37 40 – 41 Myopia Dystopia Are future generations doomed to an ever-worsening spiral of refractive error? 16 – 20 RETINAL DISEASE IS OUR FOCUS At Alimera Sciences, we are dedicated to developing innovative, vision-improving treatments for chronic retinal diseases. Our commitment to retina-treating ophthalmologists and their patients is manifest in a product portfolio designed to treat early- and late-stage diseases such as DMO, wet and dry AMD, and RVO.* Moving the back of the eye to the forefront of research and development. © 2013 Alimera Sciences Limited Date of preparation: March 2013 ILV-00182 * DMO-diabetic macular oedema; AMD-age-related macular degeneration; RVO-retinal vein occlusion. Online this Month Is Print Dead? Clearly not. You’re reading this... But that’s not to say there isn’t room for some exciting digital publishing, as proved by The Ophthalmologist iPad app. Here, we take you on a whistle-stop tour of the navigation features. Swipe left/right to the previous/next article Swipe up/down to read an article Formatted for landscape & portrait Go back to last read article Access the issues archive Quick access to all articles in issue Add an article to your favorites Full issue easy preview Interactive Icons: More information available More content available Or visit us on the web at www.theophthalmologist.com Contents 14 Feature 16 Myopia Dystopia Five questions that must be answered on the causes and consequences of near-sightedness, By Richard Gallagher 24 In Practice 03 Online This Month Upfront 24 Loss of Traction Mark Hillen asks if orcriplasmin 10 Blindingly Obvious Progress can..
  • Research Institute Annual Report 2005

    Research Institute Annual Report 2005

    Research Annual Report 2005 The Joseph Stokes Jr. Research Institute of The Children’s Hospital of Philadelphia Embarking on a New Era ely to children is founded b xclusiv y Dr. F ted e ranc dica is W de . Le ital wi sp s, w ho it st h fir H ’s ew n so tio n na B ac he h T e an — d 5 5 R 8 .A 1 .F . P e n r o s e “... very large numbers of specialties moved towards the solution of each individual patient’s problem through highly diversified laboratory and clinical research.” - Joseph Stokes Jr., M.D., 1967 CONTENTS PURSUING RESEARCH PREEMINENCE 2 PROGRESS NOTES 30 SUPPORTING RESEARCH - STOKES CORE FACILITIES 40 INNOVATION FUELING PROGRESS 46 BUILDING THE INTELLECTUAL COMMUNITY 52 ADMINISTRATIVE ENHANCEMENTS 80 FINANCIAL/AWARD INFORMATION 84 WHO'S WHO AT STOKES 87 It is with great enthusiasm that we introduce the premier annual report for the Joseph Stokes Jr. Research Institute of The Children’s Hospital of Philadelphia. Stokes Institute has a rich and distinguished “bench to bedside” research history. The Institute serves as the home for more than 250 world-class investigators conducting innovative research in the laboratories and clinics across our campus. And, as you will see within the pages of this report, our investigators continue to advance the basic understanding of pediatric diseases and to develop new therapies that will benefit our patients and their families for generations to come. We’ve witnessed substantial growth in the Hospital’s research program over the last decade.
  • Colour Vision Deficiency

    Colour Vision Deficiency

    Eye (2010) 24, 747–755 & 2010 Macmillan Publishers Limited All rights reserved 0950-222X/10 $32.00 www.nature.com/eye Colour vision MP Simunovic REVIEW deficiency Abstract effective "treatment" of colour vision deficiency: whilst it has been suggested that tinted lenses Colour vision deficiency is one of the could offer a means of enabling those with commonest disorders of vision and can be colour vision deficiency to make spectral divided into congenital and acquired forms. discriminations that would normally elude Congenital colour vision deficiency affects as them, clinical trials of such lenses have been many as 8% of males and 0.5% of femalesFthe largely disappointing. Recent developments in difference in prevalence reflects the fact that molecular genetics have enabled us to not only the commonest forms of congenital colour understand more completely the genetic basis of vision deficiency are inherited in an X-linked colour vision deficiency, they have opened the recessive manner. Until relatively recently, our possibility of gene therapy. The application of understanding of the pathophysiological basis gene therapy to animal models of colour vision of colour vision deficiency largely rested on deficiency has shown dramatic results; behavioural data; however, modern molecular furthermore, it has provided interesting insights genetic techniques have helped to elucidate its into the plasticity of the visual system with mechanisms. respect to extracting information about the The current management of congenital spectral composition of the visual scene. colour vision deficiency lies chiefly in appropriate counselling (including career counselling). Although visual aids may Materials and methods be of benefit to those with colour vision deficiency when performing certain tasks, the This article was prepared by performing a evidence suggests that they do not enable primary search of Pubmed for articles on wearers to obtain normal colour ‘colo(u)r vision deficiency’ and ‘colo(u)r discrimination.
  • Care of the Patient with Accommodative and Vergence Dysfunction

    Care of the Patient with Accommodative and Vergence Dysfunction

    OPTOMETRIC CLINICAL PRACTICE GUIDELINE Care of the Patient with Accommodative and Vergence Dysfunction OPTOMETRY: THE PRIMARY EYE CARE PROFESSION Doctors of optometry are independent primary health care providers who examine, diagnose, treat, and manage diseases and disorders of the visual system, the eye, and associated structures as well as diagnose related systemic conditions. Optometrists provide more than two-thirds of the primary eye care services in the United States. They are more widely distributed geographically than other eye care providers and are readily accessible for the delivery of eye and vision care services. There are approximately 36,000 full-time-equivalent doctors of optometry currently in practice in the United States. Optometrists practice in more than 6,500 communities across the United States, serving as the sole primary eye care providers in more than 3,500 communities. The mission of the profession of optometry is to fulfill the vision and eye care needs of the public through clinical care, research, and education, all of which enhance the quality of life. OPTOMETRIC CLINICAL PRACTICE GUIDELINE CARE OF THE PATIENT WITH ACCOMMODATIVE AND VERGENCE DYSFUNCTION Reference Guide for Clinicians Prepared by the American Optometric Association Consensus Panel on Care of the Patient with Accommodative and Vergence Dysfunction: Jeffrey S. Cooper, M.S., O.D., Principal Author Carole R. Burns, O.D. Susan A. Cotter, O.D. Kent M. Daum, O.D., Ph.D. John R. Griffin, M.S., O.D. Mitchell M. Scheiman, O.D. Revised by: Jeffrey S. Cooper, M.S., O.D. December 2010 Reviewed by the AOA Clinical Guidelines Coordinating Committee: David A.