DOCSLIB.ORG

Dilated Cardiomyopathy Caused by Truncating Titin Variants

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Dilated Cardiomyopathy Caused by Truncating Titin Variants BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Med Genet Dilated cardiomyopathy caused by truncating titin variants – Long-term outcomes, arrhythmias, response to treatment and sex differences SUPPLEMENTARY MATERIAL Christoffer Rasmus Vissing1*, MD; Torsten Bloch Rasmussen2, MD, PhD; Anne Mette Dybro2, MD; Morten Salling Olesen3,4, MSc, PhD; Lisbeth Nørum Pedersen5; MSc, PhD; Morten Jensen, MD, PhD2; Henning Bundgaard1, MD, DMSc; Alex Hørby Christensen1,6 MD, PhD 1The Capital Region’s Unit for Inherited Cardiac Diseases, Department of Cardiology, Rigshospitalet, Copenhagen University Hospital, Copenhagen, Denmark 2Department of Cardiology, Aarhus University Hospital, Aarhus, Denmark 3Laboratory for Molecular Cardiology, University of Copenhagen, Copenhagen, Denmark 4Department of Biomedical Sciences, University of Copenhagen, Copenhagen, 2200 N, Denmark 5Department of Molecular Medicine, Aarhus University Hospital, Denmark. 6Department of Cardiology, Herlev-Gentofte Hospital, Copenhagen University Hospital, Copenhagen, Denmark *Corresponding author: Christoffer Rasmus Vissing, MD The Capital Region’s Unit for Inherited Cardiac Diseases, Department of Cardiology, The Heart Center, Rigshospitalet, Copenhagen University Hospital, Blegdamsvej 9, DK-2100 Copenhagen, Denmark, E-mail: [email protected]; Phone +45 3545 5045 1 Vissing CR, et al. J Med Genet 2020;0:1–10. doi: 10.1136/jmedgenet-2020-107178 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Med Genet Supplementary Materials Contents Dilated cardiomyopathy caused by truncating titin variants – Long-term outcomes, arrhythmias, response to treatment and sex differences ...................................................................................................................... 1 SUPPLEMENTARY METHODS ............................................................................................................................. 3 Definitions ..................................................................................................................................................... 3 Genetic Screening ......................................................................................................................................... 3 Statistical analyses ........................................................................................................................................ 4 INFORMATION ON PATIENTS WITH MULTIPLE VARIANTS: ............................................................................... 5 FIGURES ............................................................................................................................................................. 6 Supplementary Figure 1: Forest-plots depicting hazard ratios in Cox proportional hazards models for the three studied cardiac outcomes .................................................................................................................... 6 Supplementary Figure 2: Forest-plots depicting univariable hazard ratios of 6 clinical variables in the three studied cardiac outcomes .................................................................................................................... 7 Supplementary Figure 3: Outcomes according to site of truncation in titin ................................................. 8 Supplementary Figure 4: Outcomes in probands vs relatives ....................................................................... 9 SUPPLEMENTARY TABLES ................................................................................................................................ 10 Supplementary Table 1. Identified truncating TTN variants. All variants are annotated in relation to the titin-metatranscript (NM_001267550.1) ..................................................................................................... 10 Supplementary Table 2: Association of clinical variables with combined end-point (implantation of LVAD, heart transplantation or death) in univariable and multivariable cox regression analysis ......................... 21 Supplementary Table 3: Association of clinical variables with ventricular arrhythmia in univariable and multivariable cox regression analysis. ......................................................................................................... 23 Supplementary Table 4: Association of clinical variables with atrial fibrillation in univariable cox regression analysis. ...................................................................................................................................... 25 2 Vissing CR, et al. J Med Genet 2020;0:1–10. doi: 10.1136/jmedgenet-2020-107178 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Med Genet SUPPLEMENTARY METHODS Definitions Severe systemic hypertension We defined the exclusion criteria severe systemic hypertension as: an untreated systolic blood pressure > 180mmHg, and/or an untreated diastolic blood pressure > 110 mmHg, and/or a systolic blood pressure > 160 mmHg on antihypertensive treatment and/or a diastolic blood pressure > 100 mmHg on antihypertensive treatment. Diabetes mellitus Patients were registered as having diabetes if they had a clinical diagnosis of diabetes mellitus or if they were prescribed antidiabetic medications. Severely dysregulated diabetes mellitus was defined as patients with neuropathy, nephropathy or retinopathy. Metabolic, infectious or inflammatory cardiomyopathies We defined the exclusion criteria for the above terms to encompass myocarditis caused by viral, bacterial, fungal or parasitic infections. Autoimmune diseases including giant cell myocarditis, non-infectious myocarditis, polymyositis/dermatomyositis, Churg-Strauss syndrome, Wegener’s granulomatosis, systemic lupus erythematosus or sarcoidosis. Nutritional deficiencies or hemochromatosis. Uncontrolled hypothyroidism or hyperthyroidism, Cushing’s disease, Addison disease, pheochromocytoma, acromegaly, fatty acid oxidation disorders, carnitine deficiency, glycogen storage diseases, organic acidurias and disorders of oxidative phosphorylation. Genetic Screening Old genetic panel The first genetic panel used for screening cardiomyopathy patients at our institutions included the following 14 genes: ACTC, CRSP3, LAMP2, LMNA, MYL2, MYL3, MYH7, MYBPC3, PRKAG2, (RBM20), SCN5A, TNNI3, TNNT2 and TPM. RBM20 is in brackets since it was not a part of the panel originally, but all patients have been sequenced in RBM20 after the initial screening. This panel was implemented in 2006 and was in 3 Vissing CR, et al. J Med Genet 2020;0:1–10. doi: 10.1136/jmedgenet-2020-107178 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Med Genet clinical use until late 2018, although most cardiomyopathy patients were screened with additional genetic panels. New genetic panel (Copenhagen) The current genetic panel in Copenhagen consists of the following 62 genes: ACTC, ACTN2, ANKRD1, BAG3, CALR3, CASQ2, CAV3, CRYAB, CSRP3, CTF1, CTNNA3, DES, DMD, DNAJC19, DSC2, DSG2, DSP, DTNA, EMD, EYA4, FHL1, FHL2, FLNC, GATAD1, GLA, HCN4, ILK, JPH2, JUP, LAMA4, LAMP2, LDB3, LMNA, MIB1, MYBPC3, MYH6, MYH7, MYL2, MYL3, MYLK2, MYOZ2, MYPN, NEBL, NEXN, OBSCN, PKP2, PLN, PRDM16, PRKAG2, PSEN1, PSEN2, RBM20, SCN5A, SGCB, SGCD, SLC22A5, TAZ, TCAP, TMEM43, TMPO, TNNC1, TNNI3, TNNI3K, TNNT2, TPM1, TTN, TTR, VCL New genetic panel (Aarhus) The current genetic panel in Aarhus consists of the following 102 genes: ABCC9, ACTC1, ACTN2, AKAP9, ANK2, ANKRD1, ANO1, APOB, BAG3, BEST3, CACNA1C, CACNA2D1, CACNB2, CALM1, CALM2, CALM3, CASQ2, CAV3, CDH2, CRYAB, CSRP3, CTNNA3, DES, DMD, DNAJC19, DSC2, DSG2, DSP, DTNA, EMD, EYA4, FHL1, FHL2, FKTN, FLNC, FXN, GATA4, GLA, GPD1L, GAA, HCN4, JPH2, JUP, KCND3, KCNE1M KCNE2M KCNE3, KCNE5, KCNH2, KCNJ5, KCNJ8, KCNQ1, LAMA4, LAMP2, LDB3, LDLR, LMNA, MYBPC3, MYH6, MYH7, MYL2, MYL3, MYOZ2, MYPBC3, MYPN, NEBL, NEXN, PCSK9, PKP2, PLN, PRDM16, PRKAG2, PSEN1, PSEN2, PTPN11, RAF1, RANGRF, RBM20, RYR2, SCN10A, SCN1B, SCN2B, SCN3B, SCN4B, SCN5A, SGCD, SLC4AE, SNTA1, TAZ, TCAP, TMEM43, TMPO, TNNC1, TNNI3, TNNT2, TPM1, TRDN, TRPM4, TTN, TTR, VCL and ZBTB17. Statistical analyses Cox proportional hazards models were used to examine the relationship between baseline variables and the three studied outcomes which included 1) A composite outcome of occurrence of implantation of left ventricular assist device, heart transplantation or death (the combined outcome), 2) The occurrence of sustained ventricular tachycardia, ventricular fibrillation, sudden cardiac death, aborted sudden cardiac death or appropriate shock by implantable cardioverter defibrillator (the ventricular arrhythmia outcome), and 3) The occurrence of atrial fibrillation or fluttering. The timing to outcomes was defined as follow-up time from time of dilated cardiomyopathy diagnosis. Multivariable Cox proportional-hazards regression analyses were created by including pre-defined variables known to be clinically
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Genetic Mutations and Mechanisms in Dilated Cardiomyopathy
    Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, … , Jessica R. Golbus, Megan J. Puckelwartz J Clin Invest. 2013;123(1):19-26. https://doi.org/10.1172/JCI62862. Review Series Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of congestive heart failure. In hypertrophic cardiomyopathy (HCM), cardiac output is limited by the thickened myocardium through impaired filling and outflow. Mutations in the genes encoding the thick filament components myosin heavy chain and myosin binding protein C (MYH7 and MYBPC3) together explain 75% of inherited HCMs, leading to the observation that HCM is a disease of the sarcomere. Many mutations are “private” or rare variants, often unique to families. In contrast, dilated cardiomyopathy (DCM) is far more genetically heterogeneous, with mutations in genes encoding cytoskeletal, nucleoskeletal, mitochondrial, and calcium-handling proteins. DCM is characterized by enlarged ventricular dimensions and impaired systolic and diastolic function. Private mutations account for most DCMs, with few hotspots or recurring mutations. More than 50 single genes are linked to inherited DCM, including many genes that also link to HCM. Relatively few clinical clues guide the diagnosis of inherited DCM, but emerging evidence supports the use of genetic testing to identify those patients at risk for faster disease progression, congestive heart failure, and arrhythmia. Find the latest version: https://jci.me/62862/pdf Review series Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, Jessica R. Golbus, and Megan J. Puckelwartz Department of Human Genetics, University of Chicago, Chicago, Illinois, USA. Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of conges- tive heart failure.
    [Show full text]
  • Integrative Analyses Identify Potential Key Genes and Pathways in Keshan
    medRxiv preprint doi: https://doi.org/10.1101/2021.03.12.21253491; this version posted March 15, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Integrative analyses identify potential key genes and pathways in Keshan disease using whole-exome sequencing Jichang Huang1#, Chenqing Zheng2#, Rong Luo1#, Mingjiang Liu3, Qingquan Gu4, Jinshu Li5, Xiushan Wu6, Zhenglin Yang3, Xia Shen2*, Xiaoping Li3* 1 Institute of Geriatric Cardiovascular Disease, Chengdu Medical College, Chengdu, People’s Republic of China 2 State Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-sen University, Guangzhou, China 3 Department of Cardiology, Hospital of the University of Electronic Science and Technology of China and Sichuan Provincial People’s Hospital, Chengdu, Sichuan, China 4 Shenzhen RealOmics (Biotech) Co., Ltd., Shenzhen, China 5 Institute of Endemic Disease, Center for Disease Control and Prevention of Sichuan Province, Chengdu, Sichuan, China 6 The Center of Heart Development, College of Life Sciences, Hunan Norma University, Changsha, China #, These authors contributed equally to this work. *, Authors for correspondence. NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. medRxiv preprint doi: https://doi.org/10.1101/2021.03.12.21253491; this version posted March 15, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Profiling Data
    Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8
    [Show full text]
  • Supplementary Table 1
    SI Table S1. Broad protein kinase selectivity for PF-2771. Kinase, PF-2771 % Inhibition at 10 μM Service Kinase, PF-2771 % Inhibition at 1 μM Service rat RPS6KA1 (RSK1) 39 Dundee AURKA (AURA) 24 Invitrogen IKBKB (IKKb) 26 Dundee CDK2 /CyclinA 21 Invitrogen mouse LCK 25 Dundee rabbit MAP2K1 (MEK1) 19 Dundee AKT1 (AKT) 21 Dundee IKBKB (IKKb) 16 Dundee CAMK1 (CaMK1a) 19 Dundee PKN2 (PRK2) 14 Dundee RPS6KA5 (MSK1) 18 Dundee MAPKAPK5 14 Dundee PRKD1 (PKD1) 13 Dundee PIM3 12 Dundee MKNK2 (MNK2) 12 Dundee PRKD1 (PKD1) 12 Dundee MARK3 10 Dundee NTRK1 (TRKA) 12 Invitrogen SRPK1 9 Dundee MAPK12 (p38g) 11 Dundee MAPKAPK5 9 Dundee MAPK8 (JNK1a) 11 Dundee MAPK13 (p38d) 8 Dundee rat PRKAA2 (AMPKa2) 11 Dundee AURKB (AURB) 5 Dundee NEK2 11 Invitrogen CSK 5 Dundee CHEK2 (CHK2) 11 Invitrogen EEF2K (EEF-2 kinase) 4 Dundee MAPK9 (JNK2) 9 Dundee PRKCA (PKCa) 4 Dundee rat RPS6KA1 (RSK1) 8 Dundee rat PRKAA2 (AMPKa2) 4 Dundee DYRK2 7 Dundee rat CSNK1D (CKId) 3 Dundee AKT1 (AKT) 7 Dundee LYN 3 BioPrint PIM2 7 Invitrogen CSNK2A1 (CKIIa) 3 Dundee MAPK15 (ERK7) 6 Dundee CAMKK2 (CAMKKB) 1 Dundee mouse LCK 5 Dundee PIM3 1 Dundee PDPK1 (PDK1) (directed 5 Invitrogen rat DYRK1A (MNB) 1 Dundee RPS6KB1 (p70S6K) 5 Dundee PBK 0 Dundee CSNK2A1 (CKIIa) 4 Dundee PIM1 -1 Dundee CAMKK2 (CAMKKB) 4 Dundee DYRK2 -2 Dundee SRC 4 Invitrogen MAPK12 (p38g) -2 Dundee MYLK2 (MLCK_sk) 3 Invitrogen NEK6 -3 Dundee MKNK2 (MNK2) 2 Dundee RPS6KB1 (p70S6K) -3 Dundee SRPK1 2 Dundee AKT2 -3 Dundee MKNK1 (MNK1) 2 Dundee RPS6KA3 (RSK2) -3 Dundee CHEK1 (CHK1) 2 Invitrogen rabbit MAP2K1 (MEK1) -4 Dundee
    [Show full text]
  • Disrupted Mechanobiology Links the Molecular and Cellular Phenotypes
    bioRxiv preprint doi: https://doi.org/10.1101/555391; this version posted February 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Disrupted Mechanobiology Links the Molecular and Cellular 2 Phenotypes in Familial Dilated Cardiomyopathy 3 4 Sarah R. Clippinger1,2, Paige E. Cloonan1,2, Lina Greenberg1, Melanie Ernst1, W. Tom 5 Stump1, Michael J. Greenberg1,* 6 7 1 Department of Biochemistry and Molecular Biophysics, Washington University School 8 of Medicine, St. Louis, MO, 63110, USA 9 10 2 These authors contributed equally to this work 11 12 *Corresponding author: 13 Michael J. Greenberg 14 Department of Biochemistry and Molecular Biophysics 15 Washington University School of Medicine 16 660 S. Euclid Ave., Campus Box 8231 17 St. Louis, MO 63110 18 Phone: (314) 362-8670 19 Email: [email protected] 20 21 22 Running title: A DCM mutation disrupts mechanosensing 23 24 25 Keywords: Mechanosensing, stem cell derived cardiomyocytes, muscle regulation, 26 troponin, myosin, traction force microscopy 1 bioRxiv preprint doi: https://doi.org/10.1101/555391; this version posted February 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 27 Abstract 28 Familial dilated cardiomyopathy (DCM) is a leading cause of sudden cardiac death and a 29 major indicator for heart transplant. The disease is frequently caused by mutations of 30 sarcomeric proteins; however, it is not well understood how these molecular mutations 31 lead to alterations in cellular organization and contractility.
    [Show full text]
  • New Insights in RBM20 Cardiomyopathy
    Current Heart Failure Reports (2020) 17:234–246 https://doi.org/10.1007/s11897-020-00475-x TRANSLATIONAL RESEARCH IN HEART FAILURE (J BACKS & M VAN DEN HOOGENHOF, SECTION EDITORS) New Insights in RBM20 Cardiomyopathy D. Lennermann1,2 & J. Backs1,2 & M. M. G. van den Hoogenhof1,2 Published online: 13 August 2020 # The Author(s) 2020 Abstract Purpose of Review This review aims to give an update on recent findings related to the cardiac splicing factor RNA-binding motif protein 20 (RBM20) and RBM20 cardiomyopathy, a form of dilated cardiomyopathy caused by mutations in RBM20. Recent Findings While most research on RBM20 splicing targets has focused on titin (TTN), multiple studies over the last years have shown that other splicing targets of RBM20 including Ca2+/calmodulin-dependent kinase IIδ (CAMK2D) might be critically involved in the development of RBM20 cardiomyopathy. In this regard, loss of RBM20 causes an abnormal intracellular calcium handling, which may relate to the arrhythmogenic presentation of RBM20 cardiomyopathy. In addition, RBM20 presents clinically in a highly gender-specific manner, with male patients suffering from an earlier disease onset and a more severe disease progression. Summary Further research on RBM20, and treatment of RBM20 cardiomyopathy, will need to consider both the multitude and relative contribution of the different splicing targets and related pathways, as well as gender differences. Keywords RBM20 . Dilated cardiomyopathy . CaMKIIδ . Calcium handling . Gender differences . Titin Introduction (ARVC), where a small number of genes account for most of the genetic causes, DCM-causing mutations have been ob- Dilated cardiomyopathy (DCM), as defined by left ventricular served in a variety of genes of diverse ontology [2].
    [Show full text]
  • Individual Protomers of a G Protein-Coupled Receptor Dimer Integrate Distinct Functional Modules
    OPEN Citation: Cell Discovery (2015) 1, 15011; doi:10.1038/celldisc.2015.11 © 2015 SIBS, CAS All rights reserved 2056-5968/15 ARTICLE www.nature.com/celldisc Individual protomers of a G protein-coupled receptor dimer integrate distinct functional modules Nathan D Camp1, Kyung-Soon Lee2, Jennifer L Wacker-Mhyre2, Timothy S Kountz2, Ji-Min Park2, Dorathy-Ann Harris2, Marianne Estrada2, Aaron Stewart2, Alejandro Wolf-Yadlin1, Chris Hague2 1Department of Genome Sciences, University of Washington School of Medicine, Seattle, WA, USA; 2Department of Pharmacology, University of Washington School of Medicine, Seattle, WA, USA Recent advances in proteomic technology reveal G-protein-coupled receptors (GPCRs) are organized as large, macromolecular protein complexes in cell membranes, adding a new layer of intricacy to GPCR signaling. We previously reported the α1D-adrenergic receptor (ADRA1D)—a key regulator of cardiovascular, urinary and CNS function—binds the syntrophin family of PDZ domain proteins (SNTA, SNTB1, and SNTB2) through a C-terminal PDZ ligand inter- action, ensuring receptor plasma membrane localization and G-protein coupling. To assess the uniqueness of this novel GPCR complex, 23 human GPCRs containing Type I PDZ ligands were subjected to TAP/MS proteomic analysis. Syntrophins did not interact with any other GPCRs. Unexpectedly, a second PDZ domain protein, scribble (SCRIB), was detected in ADRA1D complexes. Biochemical, proteomic, and dynamic mass redistribution analyses indicate syntrophins and SCRIB compete for the PDZ ligand, simultaneously exist within an ADRA1D multimer, and impart divergent pharmacological properties to the complex. Our results reveal an unprecedented modular dimeric architecture for the ADRA1D in the cell membrane, providing unexpected opportunities for fine-tuning receptor function through novel protein interactions in vivo, and for intervening in signal transduction with small molecules that can stabilize or disrupt unique GPCR:PDZ protein interfaces.
    [Show full text]
  • Distinct Fiber Type Signature in Mouse Muscles Expressing a Mutant Lamin a Responsible for Congenital Muscular Dystrophy in a Patient
    cells Article Distinct Fiber Type Signature in Mouse Muscles Expressing a Mutant Lamin A Responsible for Congenital Muscular Dystrophy in a Patient Alice Barateau 1,*, Nathalie Vadrot 1, Onnik Agbulut 2, Patrick Vicart 1, Sabrina Batonnet-Pichon 1 and Brigitte Buendia 1 1 Unité de Biologie Fonctionnelle et Adaptative (BFA), CNRS UMR 8251, Université Paris Diderot, Sorbonne Paris Cité, 75013 Paris, France; [email protected] (N.V.); [email protected] (P.V.); [email protected] (S.B.-P.); [email protected] (B.B.) 2 Biological Adaptation and Ageing, UMR CNRS 8256, Institut de Biologie Paris-Seine (IBPS), UPMC Univ Paris 06, Sorbonne Universités, 75005 Paris, France; [email protected] * Correspondence: [email protected]; Tel.: +33-157-277-958 Academic Editor: Thomas Dechat Received: 9 January 2017; Accepted: 20 April 2017; Published: 24 April 2017 Abstract: Specific mutations in LMNA, which encodes nuclear intermediate filament proteins lamins A/C, affect skeletal muscle tissues. Early-onset LMNA myopathies reveal different alterations of muscle fibers, including fiber type disproportion or prominent dystrophic and/or inflammatory changes. Recently, we identified the p.R388P LMNA mutation as responsible for congenital muscular dystrophy (L-CMD) and lipodystrophy. Here, we asked whether viral-mediated expression of mutant lamin A in murine skeletal muscles would be a pertinent model to reveal specific muscle alterations. We found that the total amount and size of muscle fibers as well as the extent of either inflammation or muscle regeneration were similar to wildtype or mutant lamin A.
    [Show full text]
  • Analysis of the Dystrophin Interactome
    Analysis of the dystrophin interactome Dissertation In fulfillment of the requirements for the degree “Doctor rerum naturalium (Dr. rer. nat.)” integrated in the International Graduate School for Myology MyoGrad in the Department for Biology, Chemistry and Pharmacy at the Freie Universität Berlin in Cotutelle Agreement with the Ecole Doctorale 515 “Complexité du Vivant” at the Université Pierre et Marie Curie Paris Submitted by Matthew Thorley born in Scunthorpe, United Kingdom Berlin, 2016 Supervisor: Simone Spuler Second examiner: Sigmar Stricker Date of defense: 7th December 2016 Dedicated to My mother, Joy Thorley My father, David Thorley My sister, Alexandra Thorley My fiancée, Vera Sakhno-Cortesi Acknowledgements First and foremost, I would like to thank my supervisors William Duddy and Stephanie Duguez who gave me this research opportunity. Through their combined knowledge of computational and practical expertise within the field and constant availability for any and all assistance I required, have made the research possible. Their overarching support, approachability and upbeat nature throughout, while granting me freedom have made this year project very enjoyable. The additional guidance and supported offered by Matthias Selbach and his team whenever required along with a constant welcoming invitation within their lab has been greatly appreciated. I thank MyoGrad for the collaboration established between UPMC and Freie University, creating the collaboration within this research project possible, and offering research experience in both the Institute of Myology in Paris and the Max Delbruck Centre in Berlin. Vital to this process have been Gisele Bonne, Heike Pascal, Lidia Dolle and Susanne Wissler who have aided in the often complex processes that I am still not sure I fully understand.
    [Show full text]
  • Early During Myelomagenesis Alterations in DNA Methylation That
    Myeloma Is Characterized by Stage-Specific Alterations in DNA Methylation That Occur Early during Myelomagenesis This information is current as Christoph J. Heuck, Jayesh Mehta, Tushar Bhagat, Krishna of September 23, 2021. Gundabolu, Yiting Yu, Shahper Khan, Grigoris Chrysofakis, Carolina Schinke, Joseph Tariman, Eric Vickrey, Natalie Pulliam, Sangeeta Nischal, Li Zhou, Sanchari Bhattacharyya, Richard Meagher, Caroline Hu, Shahina Maqbool, Masako Suzuki, Samir Parekh, Frederic Reu, Ulrich Steidl, John Greally, Amit Verma and Seema B. Downloaded from Singhal J Immunol 2013; 190:2966-2975; Prepublished online 13 February 2013; doi: 10.4049/jimmunol.1202493 http://www.jimmunol.org/content/190/6/2966 http://www.jimmunol.org/ Supplementary http://www.jimmunol.org/content/suppl/2013/02/13/jimmunol.120249 Material 3.DC1 References This article cites 38 articles, 15 of which you can access for free at: http://www.jimmunol.org/content/190/6/2966.full#ref-list-1 by guest on September 23, 2021 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc.
    [Show full text]
  • Geneseq®: Cardio
    LabCorp GeneSeq®: Cardio Helping you provide better patient care Testing for more than 100 genetic causes of familial cardiac disease. Treatment That May Help Clinical Utility Familial cardiac diseases are associated with up to 80% • Establish/confirm a diagnosis of familial cardiac disease. of cases of sudden cardiac death in young patients.1 • Identify the need for regular cardiac screening, lifestyle Identification of individuals with pathogenic mutations in changes, or pharmacological or surgical intervention to genes associated with cardiac disease may allow timely prevent the progression of cardiac disease and secondary initiation of screening and treatment that may help prevent complications. myocardial infarction, stroke, and sudden cardiac death. • Identify first-degree relatives of the proband who have inherited a disease-causing genetic variant and may be GeneSeq: Cardio at risk for myocardial infarction, stroke, or sudden cardiac death. can be a useful prognostic tool in the presence of a positive • Facilitate appropriate genetic counseling for probands family history and symptoms of cardiomyopathy, arrhythmia, and their first-degree relatives. aortopathy, Noonan syndrome, RASopathies, congenital heart disease, early-onset coronary artery disease, or familial hypercholesterolemia. Sample Requirements • 10 mL whole blood or 30 mL if ordering multiple tests. Six indications for testing, available separately or in combination Test No. Test Name Genes Included In the Profile 451422 GeneSeq®: Cardio - Familial Cardiomyopathy Profile
    [Show full text]