DOCSLIB.ORG

MYLK2, Active MYLK2, Active

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
MYLK2, Active MYLK2, Active Catalogue # Aliquot Size M63-10H-05 5 µg M63-10H-10 10 µg M63-10H-20 20 µg MYLK2, Active Full-length recombinant protein expressed in Sf9 cells Catalog # M63-10H Lot # E1 65-4 Product Description Specific Activity Recombinant full-length human MYLK2 was expressed by baculovirus in Sf9 insect cells using an N-terminal His tag. 84,000 The gene accession number is NM_033118 . 63,000 Gene Aliases 42,000 skMLCK, KMLC, MLCK, MLCK2 21,000 (cpm) Activity Formulation 0 0 10 20 30 40 Protein (ng) Recombinant protein stored in 50mM sodium phosphate, pH 7.0, 300mM NaCl, 150mM imidazole, 0.1mM PMSF, The specific activity of MYLK2 was determined to be 238 0.25mM DTT, 25% glycerol. nmol/min/mg as per activity assay protocol. Storage and Stability Purity Store product at –70 oC. For optimal storage, aliquot target into smaller quantities after centrifugation and store at recommended temperature. For most favorable performance, avoid repeated handling and multiple The purity of MYLK2 was freeze/thaw cycles. determined to be >85% by densitometry. Scientific Background Approx. MW 74kDa . MYLK2 is a member of the myosin light chain kinase family and is a calcium/calmodulin dependent enzyme that is exclusively expressed in adult skeletal muscle (1). MYLK2 has been proposed to participate in signaling pathways (calcium signaling pathway, focal adhesion, regulation of actin cytoskeleton) and cellular processes MYLK2, Active (neuromuscular synaptic transmission, protein/amino acid Full-length recombinant human protein expressed in Sf9 cells phosphorylation). MYLK2 is involved in multiple molecular functions as a result of various subdomains that Catalog Number M63-10H participate in ATP binding, calmodulin binding, Specific Activity 238 nmol/min/mg nucleotide binding, protein serine/threonine kinase Specific Lot Number E165-4 activity and transferase activity) (2). Purity >85% Concentration 0.1 µ g/ µl Stability 1yr at –70 oC from date of shipment References Storage & Shipping Store product at –70 oC. For optimal storage, aliquot target into smaller 1. Soung, Y.H. et al:, Mutational analysis of the kinase domain quantities after centrifugation and of MYLK2 gene in common human cancers.Pathol Res store at recommended temperature. Pract. 2006;202(3):137-40. For most favorable performance, 2. Toth-Zsamboki, E. et al. P2X1-mediated ERK2 activation avoid repeated handling and multiple amplifies the collagen-induced platelet secretion by freeze/thaw cycles. Product shipped enhancing myosin light chain kinase activation.J. Biol Chem. on dry ice. 2003; 21;278(47):46661-7. To place your order, please contact us by phone 1-(604)-232-4600, fax 1-604-232-4601 or by email: [email protected] www.signalchem.com FOR IN VITRO RESEARCH PURPOSES ONLY. NOT INTENDED FOR USE IN HUMAN OR ANIMALS. Activity Assay Protocol Reaction Components Active Kinase (Catalog #: M63-10H) [33P]-ATP Assay Cocktail Active MYLK2 (0.1 µg/ µl) diluted with Kinase Dilution Prepare 250 µM [33P]-ATP Assay Cocktail in a designated Buffer III (Catalog #: K23-09 ) and assayed as outlined in radioactive working area by adding the following sample activity plot. (Note: these are suggested working components: 150 µl of 10mM ATP Stock Solution (Catalog #: dilutions and it is recommended that the researcher A50-09 ), 100 µl [ 33 P]-ATP (1mCi/100 µl), 5.75ml of Kinase Assay perform a serial dilution of Active MLCK for optimal Buffer I (Catalog #: K01-09 ). Store 1ml aliquots at –20 oC. results). Kinase Dilution Buffer III (Catalog #: K23 -09 ) 10mM ATP Stock Solution (Catalog #: A50-09 ) Kinase Assay Buffer I (Catalog #: K01-09 ) diluted at a Prepare ATP stock solution by dissolving 55mg of ATP in 10ml 1:4 ratio (5X dilution) with 50ng/ µl BSA solution. of Kinase Assay Buffer I (Catalog #: K01-09 ). Store 200 µl aliquots at –20 oC. Kinase Assay Buffe r I (Catalog #: K01 -09 ) Substrate (Catalog #: M89 -54G ) Buffer components: 25mM MOPS, pH 7. 2, 12.5mM β- LC20 protein substrate, 1mg/ml concentration. glycerol-phosphate, 25mM MgC1 2, 5mM EGTA, 2mM EDTA. Add 0.25mM DTT to Kinase Assay Buffer prior to use. Assay Protocol Step 1. Thaw [33P]-ATP Assay Cocktail in shielded container in a designated radioactive working area. Step 2. Thaw the Active MYLK2, Kinase Assay Buffer, Substrate and Kinase Dilution Buffer on ice. Step 3. In a pre-cooled microfuge tube, add the following reaction components bringing the initial reaction volume up to 20 µl: Component 1. 10 µl of diluted Active MYLK2 (Catalog #M63-10H) Component 2. 5µl of 1mg/ml stock solution of substrate (Catalog #M89-54G) Component 3. 2.5 µl of Ca 2+ / Calmodulin Solution II, 10x (Catalog #C02-39B) Component 4. 2.5 µl of distilled H 2O Step 4. Set up the blank control as outlined in step 3, excluding the addition of the substrate. Replace the substrate with an equal volume of distilled H 2O. Step 5. Initiate the reaction by the addition of 5 µl [ 33P]-ATP Assay Cocktail bringing the final volume up to 25 µl and incubate the mixture in a water bath at 30 oC for 15 minutes. Step 6. After the 15 minute incubation period, terminate the reaction by spotting 20 µl of the reaction mixture onto individual pre-cut strips of phosphocellulose P81 paper. Step 7. Air dry the pre-cut P81 strip and sequentially wash in a 1% phosphoric acid solution (dilute 10ml of phosphoric acid and make a 1L solution with distilled H2O) with constant gentle stirring. It is recommended that the strips be washed a total of 3 intervals for approximately 10 minutes each. Step 8. Count the radioactivity on the P81 paper in the presence of scintillation fluid in a scintillation counter. Step 9. Determine the corrected cpm by removing the blank control value (see Step 4) for each sample and calculate the kinase specific activity as outlined below. Calculation of [P 33]-ATP Specific Activity (SA) (cpm/pmol) Specific activity (SA) = cpm for 5 µl [33P] -ATP / pmoles of ATP (in 5 µl of a 250 µM ATP stock solution, i.e., 1250 pmoles) Kinase Specific Activity (SA) (pmol/min/ µµµg or nmol/min/mg) Corrected cpm from reaction / [(SA of 33P-ATP in cpm/pmol)*(Reaction time in min)*(Enzyme amount in µg or mg)]*[(Reaction Volume) / (Spot Volume)] To place your order, please contact us by phone 1-(604)-232-4600, fax 1-604-232-4601 or by email: [email protected] www.signalchem.com FOR IN VITRO RESEARCH PURPOSES ONLY. NOT INTENDED FOR USE IN HUMAN OR ANIMALS. .
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Genetic Mutations and Mechanisms in Dilated Cardiomyopathy
    Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, … , Jessica R. Golbus, Megan J. Puckelwartz J Clin Invest. 2013;123(1):19-26. https://doi.org/10.1172/JCI62862. Review Series Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of congestive heart failure. In hypertrophic cardiomyopathy (HCM), cardiac output is limited by the thickened myocardium through impaired filling and outflow. Mutations in the genes encoding the thick filament components myosin heavy chain and myosin binding protein C (MYH7 and MYBPC3) together explain 75% of inherited HCMs, leading to the observation that HCM is a disease of the sarcomere. Many mutations are “private” or rare variants, often unique to families. In contrast, dilated cardiomyopathy (DCM) is far more genetically heterogeneous, with mutations in genes encoding cytoskeletal, nucleoskeletal, mitochondrial, and calcium-handling proteins. DCM is characterized by enlarged ventricular dimensions and impaired systolic and diastolic function. Private mutations account for most DCMs, with few hotspots or recurring mutations. More than 50 single genes are linked to inherited DCM, including many genes that also link to HCM. Relatively few clinical clues guide the diagnosis of inherited DCM, but emerging evidence supports the use of genetic testing to identify those patients at risk for faster disease progression, congestive heart failure, and arrhythmia. Find the latest version: https://jci.me/62862/pdf Review series Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, Jessica R. Golbus, and Megan J. Puckelwartz Department of Human Genetics, University of Chicago, Chicago, Illinois, USA. Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of conges- tive heart failure.
    [Show full text]
  • Profiling Data
    Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8
    [Show full text]
  • Supplementary Table 1
    SI Table S1. Broad protein kinase selectivity for PF-2771. Kinase, PF-2771 % Inhibition at 10 μM Service Kinase, PF-2771 % Inhibition at 1 μM Service rat RPS6KA1 (RSK1) 39 Dundee AURKA (AURA) 24 Invitrogen IKBKB (IKKb) 26 Dundee CDK2 /CyclinA 21 Invitrogen mouse LCK 25 Dundee rabbit MAP2K1 (MEK1) 19 Dundee AKT1 (AKT) 21 Dundee IKBKB (IKKb) 16 Dundee CAMK1 (CaMK1a) 19 Dundee PKN2 (PRK2) 14 Dundee RPS6KA5 (MSK1) 18 Dundee MAPKAPK5 14 Dundee PRKD1 (PKD1) 13 Dundee PIM3 12 Dundee MKNK2 (MNK2) 12 Dundee PRKD1 (PKD1) 12 Dundee MARK3 10 Dundee NTRK1 (TRKA) 12 Invitrogen SRPK1 9 Dundee MAPK12 (p38g) 11 Dundee MAPKAPK5 9 Dundee MAPK8 (JNK1a) 11 Dundee MAPK13 (p38d) 8 Dundee rat PRKAA2 (AMPKa2) 11 Dundee AURKB (AURB) 5 Dundee NEK2 11 Invitrogen CSK 5 Dundee CHEK2 (CHK2) 11 Invitrogen EEF2K (EEF-2 kinase) 4 Dundee MAPK9 (JNK2) 9 Dundee PRKCA (PKCa) 4 Dundee rat RPS6KA1 (RSK1) 8 Dundee rat PRKAA2 (AMPKa2) 4 Dundee DYRK2 7 Dundee rat CSNK1D (CKId) 3 Dundee AKT1 (AKT) 7 Dundee LYN 3 BioPrint PIM2 7 Invitrogen CSNK2A1 (CKIIa) 3 Dundee MAPK15 (ERK7) 6 Dundee CAMKK2 (CAMKKB) 1 Dundee mouse LCK 5 Dundee PIM3 1 Dundee PDPK1 (PDK1) (directed 5 Invitrogen rat DYRK1A (MNB) 1 Dundee RPS6KB1 (p70S6K) 5 Dundee PBK 0 Dundee CSNK2A1 (CKIIa) 4 Dundee PIM1 -1 Dundee CAMKK2 (CAMKKB) 4 Dundee DYRK2 -2 Dundee SRC 4 Invitrogen MAPK12 (p38g) -2 Dundee MYLK2 (MLCK_sk) 3 Invitrogen NEK6 -3 Dundee MKNK2 (MNK2) 2 Dundee RPS6KB1 (p70S6K) -3 Dundee SRPK1 2 Dundee AKT2 -3 Dundee MKNK1 (MNK1) 2 Dundee RPS6KA3 (RSK2) -3 Dundee CHEK1 (CHK1) 2 Invitrogen rabbit MAP2K1 (MEK1) -4 Dundee
    [Show full text]
  • Dilated Cardiomyopathy Caused by Truncating Titin Variants
    BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Med Genet Dilated cardiomyopathy caused by truncating titin variants – Long-term outcomes, arrhythmias, response to treatment and sex differences SUPPLEMENTARY MATERIAL Christoffer Rasmus Vissing1*, MD; Torsten Bloch Rasmussen2, MD, PhD; Anne Mette Dybro2, MD; Morten Salling Olesen3,4, MSc, PhD; Lisbeth Nørum Pedersen5; MSc, PhD; Morten Jensen, MD, PhD2; Henning Bundgaard1, MD, DMSc; Alex Hørby Christensen1,6 MD, PhD 1The Capital Region’s Unit for Inherited Cardiac Diseases, Department of Cardiology, Rigshospitalet, Copenhagen University Hospital, Copenhagen, Denmark 2Department of Cardiology, Aarhus University Hospital, Aarhus, Denmark 3Laboratory for Molecular Cardiology, University of Copenhagen, Copenhagen, Denmark 4Department of Biomedical Sciences, University of Copenhagen, Copenhagen, 2200 N, Denmark 5Department of Molecular Medicine, Aarhus University Hospital, Denmark. 6Department of Cardiology, Herlev-Gentofte Hospital, Copenhagen University Hospital, Copenhagen, Denmark *Corresponding author: Christoffer Rasmus Vissing, MD The Capital Region’s Unit for Inherited Cardiac Diseases, Department of Cardiology, The Heart Center, Rigshospitalet, Copenhagen University Hospital, Blegdamsvej 9, DK-2100 Copenhagen, Denmark, E-mail: [email protected]; Phone +45 3545 5045 1 Vissing CR, et al. J Med Genet 2020;0:1–10.
    [Show full text]
  • Early During Myelomagenesis Alterations in DNA Methylation That
    Myeloma Is Characterized by Stage-Specific Alterations in DNA Methylation That Occur Early during Myelomagenesis This information is current as Christoph J. Heuck, Jayesh Mehta, Tushar Bhagat, Krishna of September 23, 2021. Gundabolu, Yiting Yu, Shahper Khan, Grigoris Chrysofakis, Carolina Schinke, Joseph Tariman, Eric Vickrey, Natalie Pulliam, Sangeeta Nischal, Li Zhou, Sanchari Bhattacharyya, Richard Meagher, Caroline Hu, Shahina Maqbool, Masako Suzuki, Samir Parekh, Frederic Reu, Ulrich Steidl, John Greally, Amit Verma and Seema B. Downloaded from Singhal J Immunol 2013; 190:2966-2975; Prepublished online 13 February 2013; doi: 10.4049/jimmunol.1202493 http://www.jimmunol.org/content/190/6/2966 http://www.jimmunol.org/ Supplementary http://www.jimmunol.org/content/suppl/2013/02/13/jimmunol.120249 Material 3.DC1 References This article cites 38 articles, 15 of which you can access for free at: http://www.jimmunol.org/content/190/6/2966.full#ref-list-1 by guest on September 23, 2021 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc.
    [Show full text]
  • Geneseq®: Cardio
    LabCorp GeneSeq®: Cardio Helping you provide better patient care Testing for more than 100 genetic causes of familial cardiac disease. Treatment That May Help Clinical Utility Familial cardiac diseases are associated with up to 80% • Establish/confirm a diagnosis of familial cardiac disease. of cases of sudden cardiac death in young patients.1 • Identify the need for regular cardiac screening, lifestyle Identification of individuals with pathogenic mutations in changes, or pharmacological or surgical intervention to genes associated with cardiac disease may allow timely prevent the progression of cardiac disease and secondary initiation of screening and treatment that may help prevent complications. myocardial infarction, stroke, and sudden cardiac death. • Identify first-degree relatives of the proband who have inherited a disease-causing genetic variant and may be GeneSeq: Cardio at risk for myocardial infarction, stroke, or sudden cardiac death. can be a useful prognostic tool in the presence of a positive • Facilitate appropriate genetic counseling for probands family history and symptoms of cardiomyopathy, arrhythmia, and their first-degree relatives. aortopathy, Noonan syndrome, RASopathies, congenital heart disease, early-onset coronary artery disease, or familial hypercholesterolemia. Sample Requirements • 10 mL whole blood or 30 mL if ordering multiple tests. Six indications for testing, available separately or in combination Test No. Test Name Genes Included In the Profile 451422 GeneSeq®: Cardio - Familial Cardiomyopathy Profile
    [Show full text]
  • The Role of Genetics in Cardiomyopaties: a Review Luis Vernengo and Haluk Topaloglu
    Chapter The Role of Genetics in Cardiomyopaties: A Review Luis Vernengo and Haluk Topaloglu Abstract Cardiomyopathies are defined as disorders of the myocardium which are always associated with cardiac dysfunction and are aggravated by arrhythmias, heart failure and sudden death. There are different ways of classifying them. The American Heart Association has classified them in either primary or secondary cardiomyopathies depending on whether the heart is the only organ involved or whether they are due to a systemic disorder. On the other hand, the European Society of Cardiology has classified them according to the different morphological and functional phenotypes associated with their pathophysiology. In 2013 the MOGE(S) classification started to be published and clinicians have started to adopt it. The purpose of this review is to update it. Keywords: cardiomyopathy, primary and secondary cardiomyopathies, sarcomeric genes 1. Introduction Cardiomyopathies can be defined as disorders of the myocardium associated with cardiac dysfunction and which are aggravated by arrhythmias, heart failure and sudden death [1]. The aim of this chapter is focused on updating and reviewing cardiomyopathies. In 1957, Bridgen coined the word “cardiomyopathy” for the first time and in 1958, the British pathologist Teare reported nine cases of septum hypertrophy [2]. Genetics has played a key role in the understanding of these disorders. In general, the overall prevalence of cardiomyopathies in the world population is 3%. The genetic forms of cardiomyopathies are characterized by both locus and allelic heterogeneity. The mutations of the genes which encode for a variety of proteins of the sarcomere, cytoskeleton, nuclear envelope, sarcolemma, ion channels and intercellular junctions alter many pathways and cellular structures affecting in a negative form the mechanism of muscle contraction and its function, and the sensi- tivity of ion channels to electrolytes, calcium homeostasis and how mechanic force in the myocardium is generated and transmitted [3, 4].
    [Show full text]
  • Comprehensive Cardiovascular
    ComprehensiveComprehensive Cardiovascular Cardiovascular CardiovascularCardiovascular Diseases Diseases CardiovascularCardiovascular diseases diseases are are a groupa group of of disorders disorders that that may may affect affect the the heart heart and and blood blood vessels. vessels. WhileWhile the the causes causes of of cardiovascularcardiovascular disease disease are are diverse, diverse, proportions proportions are are genetic genetic in inorigin. origin. These These disorders disorders may may occur occur as aspart part of ofa clinicala clinical spectrumspectrum associated associated with with a particulara particular genetic genetic condition condition or or as as an anisolated isolated finding. finding. The The mode mode of of inheritance inheritance is isalso also diverse diverse withwith differing differing clinical clinical variability variability and and expressivity. expressivity. EmoryEmory Genetics Genetics Laboratory Laboratory offers offers the the Comprehensive Comprehensive Cardiovascular Cardiovascular Panel Panel to toaid aid in inthe the diagnosis diagnosis of ofa avariety variety of of cardiovascularcardiovascular conditions. conditions. This This panel panel is isideal ideal if theif the causative causative gene gene is isunknown unknown and and therefore therefore single-gene single-gene analysis analysis will will notnot be be cost-effective. cost-effective. Some Some genes genes on on this this panel panel are are associated associated with with addit additionalional phenotypes. phenotypes. GenesGenes Included
    [Show full text]
  • MYLK2 Kinase
    MYLK2 Kinase Store at -80°C n3 5 µg Orders n 877-616-CELL (2355) [email protected] Support n 877-678-TECH (8324) [email protected] Web n www.cellsignal.com New 11/06 #7498 This product is for in vitro research use only and is not intended for use in humans or animals. Description: Purified recombinant full length human Source/Purification: The GST-Kinase fusion protein was Storage: Enzyme is supplied in 50 mM Tris-HCl, pH 7.5; MYLK2 (Met1-Val596) kinase, supplied as a GST fusion produced using a baculovirus expression system with a 150 mM NaCl, 0.25 mM DTT, 0.1 mM EGTA, 0.1 mM EDTA, protein. construct expressing full length human MYLK2 (Met1- 0.1 mM PMSF, 25% glycerol, 7 mM glutathione. Val596) (GenBank Accession No. NM_033118.2) with an Store at –80°C. Background: Myosin light chain kinases (MYLKs) are amino-terminal GST tag. The protein was purified by one- Ca2+/calmodulin-dependent protein kinases that regulate Keep on ice during use. step affinity chromatography using GSH-agarose. myosin motor activities through phosphorylation of myosin Avoid repeated freeze-thaw cycles. regulatory light chain (RLC). This phosphorylation increases Quality Control: The theoretical molecular weight of the the actin-activated myosin ATPase activity and is thought GST-MYLK2 fusion protein is 95 kDa. The purified kinase Companion Products: to play major roles in a number of biological processes, was quality controlled for purity using SDS-PAGE followed Serine/Threonine Kinase Substrate Screening Kit #7400 including cell spreading and migration, transepithelial by Coomassie stain [Fig.1].
    [Show full text]
  • Skeletal Muscle Gene Expression in Long-Term Endurance and Resistance Trained Elderly
    International Journal of Molecular Sciences Article Skeletal Muscle Gene Expression in Long-Term Endurance and Resistance Trained Elderly 1,2, 3, 1,2, Alessandra Bolotta y, Giuseppe Filardo y, Provvidenza Maria Abruzzo *, Annalisa Astolfi 4,5 , Paola De Sanctis 1, Alessandro Di Martino 6, Christian Hofer 7, Valentina Indio 4 , Helmut Kern 7, Stefan Löfler 7 , Maurilio Marcacci 8, Sandra Zampieri 9,10, 1,2, 1, Marina Marini z and Cinzia Zucchini z 1 Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna School of Medicine, 40138 Bologna, Italy; [email protected] (A.B.); [email protected] (P.D.S.); [email protected] (M.M.); [email protected] (C.Z.) 2 IRCCS Fondazione Don Carlo Gnocchi, 20148 Milan, Italy 3 Applied and Translational Research Center, IRCCS Istituto Ortopedico Rizzoli, 40136 Bologna, Italy; g.fi[email protected] 4 Giorgio Prodi Interdepartimental Center for Cancer Research, S.Orsola-Malpighi Hospital, 40138 Bologna, Italy; annalisa.astolfi@unibo.it (A.A.); [email protected] (V.I.) 5 Department of Morphology, Surgery and Experimental Medicine, University of Ferrara, 44121 Ferrara, Italy 6 Second Orthopaedic and Traumatologic Clinic, IRCCS Istituto Ortopedico Rizzoli, 40136 Bologna, Italy; [email protected] 7 Ludwig Boltzmann Institute for Rehabilitation Research, 1160 Wien, Austria; [email protected] (C.H.); [email protected] (H.K.); stefan.loefl[email protected] (S.L.) 8 Department of Biomedical Sciences, Knee Joint Reconstruction Center, 3rd Orthopaedic Division, Humanitas Clinical Institute, Humanitas University, 20089 Milan, Italy; [email protected] 9 Department of Surgery, Oncology and Gastroenterology, University of Padua, 35122 Padua, Italy; [email protected] 10 Department of Biomedical Sciences, University of Padua, 35131 Padua, Italy * Correspondence: [email protected]; Tel.: +39-051-2094122 These authors contributed equally to this work.
    [Show full text]
  • Cardiovascular Diseases Genetic Testing Program Information
    Cardiovascular Diseases Genetic Testing Program Description: Congenital Heart Disease Panels We offer comprehensive gene panels designed to • Congenital Heart Disease Panel (187 genes) diagnose the most common genetic causes of hereditary • Heterotaxy Panel (114 genes) cardiovascular diseases. Testing is available for congenital • RASopathy/Noonan Spectrum Disorders Panel heart malformation, cardiomyopathy, arrythmia, thoracic (31 genes) aortic aneurysm, pulmonary arterial hypertension, Marfan Other Panels syndrome, and RASopathy/Noonan spectrum disorders. • Pulmonary Arterial Hypertension (PAH) Panel Hereditary cardiovascular disease is caused by variants in (20 genes) many different genes, and may be inherited in an autosomal dominant, autosomal recessive, or X-linked manner. Other Indications: than condition-specific panels, we also offer single gene Panels: sequencing for any gene on the panels, targeted variant • Confirmation of genetic diagnosis in a patient with analysis, and targeted deletion/duplication analysis. a clinical diagnosis of cardiovascular disease Tests Offered: • Carrier or pre-symptomatic diagnosis identification Arrythmia Panels in individuals with a family history of cardiovascular • Comprehensive Arrhythmia Panel (81 genes) disease of unknown genetic basis • Atrial Fibrillation (A Fib) Panel (28 genes) Gene Specific Sequencing: • Atrioventricular Block (AV Block) Panel (7 genes) • Confirmation of genetic diagnosis in a patient with • Brugada Syndrome Panel (21 genes) cardiovascular disease and in whom a specific
    [Show full text]