DOCSLIB.ORG

Cytoskeletal Protein Kinases: Titin and Its Relations in Mechanosensing

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cytoskeletal Protein Kinases: Titin and Its Relations in Mechanosensing View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by PubMed Central Pflugers Arch - Eur J Physiol (2011) 462:119–134 DOI 10.1007/s00424-011-0946-1 INVITED REVIEW Cytoskeletal protein kinases: titin and its relations in mechanosensing Mathias Gautel Received: 4 February 2011 /Revised: 15 February 2011 /Accepted: 18 February 2011 /Published online: 18 March 2011 # The Author(s) 2011. This article is published with open access at Springerlink.com Abstract Titin, the giant elastic ruler protein of striated Keywords Sarcomere . Mechanical strain sensor . muscle sarcomeres, contains a catalytic kinase domain Mechanobiology. Titin . Connectin . Twitchin . Myosin related to a family of intrasterically regulated protein light-chain kinase . Autophagy . Obscurin . Myomesin . kinases. The most extensively studied member of this Nbr1 . p62/SQSTM1 . MURF. Telethonin/TCAP branch of the human kinome is the Ca2+–calmodulin (CaM)-regulated myosin light-chain kinases (MLCK). However, not all kinases of the MLCK branch are Introduction functional MLCKs, and about half lack a CaM binding site in their C-terminal autoinhibitory tail (AI). A unifying Many cellular processes, from cell differentiation and feature is their association with the cytoskeleton, mostly via migration during development to functional organ adapta- actin and myosin filaments. Titin kinase, similar to its tion postnatally, involve the sensing and processing of invertebrate analogue twitchin kinase and likely other mechanical stress to trigger cellular responses. Many tissues “MLCKs”, is not Ca2+–calmodulin-activated. Recently, change their physiological properties rapidly in response to local protein unfolding of the C-terminal AI has emerged altered mechanical load, including skin, bone, connective as a common mechanism in the activation of CaM kinases. tissue, vessels, and smooth and striated muscles. These Single-molecule data suggested that opening of the TK responses include cell proliferation (e.g. skin callus forma- active site could also be achieved by mechanical unfolding tion), apoptosis and resorption, or functional remodelling of of the AI. Mechanical modulation of catalytic activity pre-existent cells by hypertrophy or atrophy. In striated might thus allow cytoskeletal signalling proteins to act as muscle, remodelling on the cellular level plays a major role mechanosensors, creating feedback mechanisms between in the adaptation to changes in workload (reviewed in [35, cytoskeletal tension and tension generation or cellular 108]) especially in the heart, where cell proliferation plays a remodelling. Similar to other MLCK-like kinases like negligible role in short-term adaptation [11]. Of clinical DRAK2 and DAPK1, TK is linked to protein turnover interest is the short-term adaptation of heart muscle to regulation via the autophagy/lysosomal system, suggesting increased preload by the Frank Starling mechanism that the MLCK-like kinases have common functions beyond modulates cardiac performance on a beat-to-beat basis, but contraction regulation. cardiac growth and remodelling are also directly and indirectly mechanically controlled [24]. For such control mechanisms to act, the muscle cell must contain sensors This is an invited review for the DeTombe/Granzier Special Issue on responding to changes in mechanical load. While mecha- “The cytoskeleton and the cellular transduction of mechanical strain”. nosensors have been identified at the cell membrane, e.g. M. Gautel (*) the integrin receptor signalling pathway [22, 29], increasing King’s College London BHF Centre of Research Excellence, evidence points to a pivotal role of sensing mechanisms in Cardiovascular Division and Randall Division for Cell the contractile machinery itself. and Molecular Biophysics, London SE1 1UL, UK Striated muscle contractility depends on ordered arrays e-mail: [email protected] of myosin and actin filaments in repetitive units, the 120 Pflugers Arch - Eur J Physiol (2011) 462:119–134 sarcomeres (reviewed in [30]). Sarcomeres have emerged not only to generate force and motion, but also to integrate a host of signalling functions in muscle mechanotransduc- tion. Both the transverse anchoring planes of actin and myosin filaments—the Z-disk and M-band, respectively— have been implicated in active signalling processes relaying information on mechanical strain to cellular systems that control gene expression, protein synthesis, and protein degradation (reviewed in [35, 36, 50, 60, 69]). Recently, combinations of structural biology, biochemical and cell biological analysis, molecular dynamics simulations [38, 68], and single-molecule force spectroscopy [12, 96, 125] have led to fundamental mechanistic insights into the Fig. 1 The MLCK branch of the human kinome (adapted from [70]). function of some mechanosignalling complexes at the Z- The CaM kinase family contains a group of related protein kinases that disk and M-band anchoring planes. includes obscurin kinases 1 and 2 (OBSCN-1 and OBSCN-2), striated Upon development of active force by myosin motors muscle preferentially expressed protein kinases 1 and 2 (SPEG-1 and SPEG-2), titin (TTN), trio and kalirin (KALRN), the myosin light-chain pulling on actin filaments, substantial mechanical stress acts kinases of smooth muscle (MYLK1), skeletal muscle (MYLK2), cardiac on the various structures of the sarcomere, which needs to be muscle (MYLK3) and the more ubiquitously expressed MYLK4. Death- counteracted by the cross-links of the actin and myosin associated protein kinases 1–3(DAPK1–3) and the death-associated filaments themselves. Electron microscopic analysis of protein kinase-related apoptosis-inducing protein kinase 1 and 2 (DRAK1 and DRAK2) form a separate sub-branch. Kinases that are isometrically contracting skeletal muscle fibres revealed that unlikely to be CaM-regulated are shown in red the resistance of Z-disks and M-bands to mechanical strain differ markedly: While Z-disks showed no appreciable deformation along the sarcomere axis, the M-bands buckled giant muscle proteins twitchin (TwK) from Caenorhabditis rapidly [49] up to the point of rupture. This selective elegans [9] and projectin from Drosophila melanogaster buckling of the M-band is likely a result of the shear forces [10]. Generally, MLCK-like kinases are considered to be between adjacent myosin filaments and is on the order of autoinhibited serine/threonine kinases, where the major 10 nm or more [1, 52]. At the same time, the myosin mechanism of activation is the relief of autoinhibition by interfilament spacing does not change significantly under the binding of Ca2+–calmodulin (CaM) to the C-terminal isometric contraction, suggesting that most contraction- autoinhibitory region, thus removing the sterical blockage of induced changes seem to result in axial M-band strain and the active site without requirement of phosphorylation of displacement of myosin [31]. This is contrary to the Z-disk, sites in the activation loop, as in phosphorylation-regulated where active contraction results predominantly in changes in protein kinases. MLCK1 to 3 are expressed in smooth, lattice spacing (reviewed in [36]). skeletal and cardiac muscle, respectively, while MLCK4 The integration of actin and myosin filaments at the M- (MYLK4) seems ubiquitously expressed; its role as a myosin band and Z-disk, and thus also the length of the sarcomere, are light-chain kinase is not experimentally verified. The determined by the giant sarcomeric protein titin [126](also classical MLCKs phosphorylate the N-terminus of myosin known as connectin [75]). Titin is a highly modular, over regulatory light chain to initiate or modulate myosin 1-μm long protein composed mostly of immunoglobulin (Ig) contractility [56]. MLCKs are thus involved in myosin- and fibronectin-like (Fn) domains and elastic linker regions linked processes as diverse as cell migration, cytoskeletal [63]. Titin combines multiple functions: a molecular ruler for remodelling, vessel tone control, peristaltic movement or sarcomere assembly, the main source of passive elasticity in fine-tuning of striated muscle contractility. thesarcomere,andahubforsignaltransduction[35, 69, However, as we shall see, there are crucial differences in 123]. Apart from the hundreds of Ig and Fn domains, many the TK structure and regulation mechanism that may lead to of which interact with sarcomeric ligands (reviewed in [60, new perspectives also on other members of the MLCK 61, 66]), and the elastic regions in the I-band [63], titin branch of the human kinome. contains a single catalytic kinase domain (TK) near its C- terminal, M-band-associated end [64].TheTKdomainis located at the M-band periphery, about 50 nm from the An unusual active site: implications for regulation central M-band line M1 [86] and is superficially similar to and activity of titin kinase the catalytic domains of other kinases of the myosin light- chain kinase (MLCK) branch (Fig. 1) of the human kinome The crystal structure of titin kinase [78] revealed the [37, 64, 70], as well as the kinase domains of the related complex autoinhibited conformation of TK. The C- Pflugers Arch - Eur J Physiol (2011) 462:119–134 121 terminal autoinhibitory tail (AI) is formed from three Twitchin kinase could, however, be activated in vitro by the secondary structure elements, αR1, αR2 and βR1, wrap- dimeric calcium-binding protein S100A1 in the presence of ping around the catalytic domain and tightly occluding the Ca2+ and low concentrations of Zn2+ [45];
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • The Role of Z-Disc Proteins in Myopathy and Cardiomyopathy
    International Journal of Molecular Sciences Review The Role of Z-disc Proteins in Myopathy and Cardiomyopathy Kirsty Wadmore 1,†, Amar J. Azad 1,† and Katja Gehmlich 1,2,* 1 Institute of Cardiovascular Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham B15 2TT, UK; [email protected] (K.W.); [email protected] (A.J.A.) 2 Division of Cardiovascular Medicine, Radcliffe Department of Medicine and British Heart Foundation Centre of Research Excellence Oxford, University of Oxford, Oxford OX3 9DU, UK * Correspondence: [email protected]; Tel.: +44-121-414-8259 † These authors contributed equally. Abstract: The Z-disc acts as a protein-rich structure to tether thin filament in the contractile units, the sarcomeres, of striated muscle cells. Proteins found in the Z-disc are integral for maintaining the architecture of the sarcomere. They also enable it to function as a (bio-mechanical) signalling hub. Numerous proteins interact in the Z-disc to facilitate force transduction and intracellular signalling in both cardiac and skeletal muscle. This review will focus on six key Z-disc proteins: α-actinin 2, filamin C, myopalladin, myotilin, telethonin and Z-disc alternatively spliced PDZ-motif (ZASP), which have all been linked to myopathies and cardiomyopathies. We will summarise pathogenic variants identified in the six genes coding for these proteins and look at their involvement in myopathy and cardiomyopathy. Listing the Minor Allele Frequency (MAF) of these variants in the Genome Aggregation Database (GnomAD) version 3.1 will help to critically re-evaluate pathogenicity based on variant frequency in normal population cohorts.
    [Show full text]
  • Genetic Mutations and Mechanisms in Dilated Cardiomyopathy
    Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, … , Jessica R. Golbus, Megan J. Puckelwartz J Clin Invest. 2013;123(1):19-26. https://doi.org/10.1172/JCI62862. Review Series Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of congestive heart failure. In hypertrophic cardiomyopathy (HCM), cardiac output is limited by the thickened myocardium through impaired filling and outflow. Mutations in the genes encoding the thick filament components myosin heavy chain and myosin binding protein C (MYH7 and MYBPC3) together explain 75% of inherited HCMs, leading to the observation that HCM is a disease of the sarcomere. Many mutations are “private” or rare variants, often unique to families. In contrast, dilated cardiomyopathy (DCM) is far more genetically heterogeneous, with mutations in genes encoding cytoskeletal, nucleoskeletal, mitochondrial, and calcium-handling proteins. DCM is characterized by enlarged ventricular dimensions and impaired systolic and diastolic function. Private mutations account for most DCMs, with few hotspots or recurring mutations. More than 50 single genes are linked to inherited DCM, including many genes that also link to HCM. Relatively few clinical clues guide the diagnosis of inherited DCM, but emerging evidence supports the use of genetic testing to identify those patients at risk for faster disease progression, congestive heart failure, and arrhythmia. Find the latest version: https://jci.me/62862/pdf Review series Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, Jessica R. Golbus, and Megan J. Puckelwartz Department of Human Genetics, University of Chicago, Chicago, Illinois, USA. Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of conges- tive heart failure.
    [Show full text]
  • Pak1 Kinase Controls Cell Shape Through Ribonucleoprotein Granules Joseph O Magliozzi, James B Moseley*
    RESEARCH ARTICLE Pak1 kinase controls cell shape through ribonucleoprotein granules Joseph O Magliozzi, James B Moseley* Department of Biochemistry and Cell Biology, The Geisel School of Medicine at Dartmouth, Hanover, United States ABSTRACT Fission yeast cells maintain a rod shape due to conserved signaling pathways that organize the cytoskeleton for polarized growth. We discovered a mechanism linking the conserved protein kinase Pak1 with cell shape through the RNA- binding protein Sts5. Pak1 (also called Shk1 and Orb2) prevents Sts5 association with P bodies by directly phosphorylating its intrinsically disor- dered region (IDR). Pak1 and the cell polarity kinase Orb6 both phosphorylate the Sts5 IDR but at distinct residues. Mutations preventing phosphorylation in the Sts5 IDR cause increased P body formation and defects in cell shape and polarity. Unexpectedly, when cells encounter glucose star- vation, PKA signaling triggers Pak1 recruitment to stress granules with Sts5. Through retargeting experiments, we reveal that Pak1 localizes to stress granules to promote rapid dissolution of Sts5 upon glucose addition. Our work reveals a new role for Pak1 in regulating cell shape through ribonu- cleoprotein granules during normal and stressed growth conditions. Introduction Cell polarity signaling networks determine cell morphology by controlling growth machinery in time and space. Because active growth requires energy, these networks must also respond to changes in the environment such as glucose availability. The p21- activated kinase (PAK) family of protein kinases *For correspondence: are key mediators of cell polarity signaling in many eukaryotes (Hofmann et al., 2004). Following james. b. moseley@ dartmouth. activation by small GTPases like Cdc42, PAKs function in regulating the cytoskeleton and MAPK path- edu ways, and PAK dysregulation is associated with multiple human diseases.
    [Show full text]
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
    [Show full text]
  • Transcriptomic Analysis of Native Versus Cultured Human and Mouse Dorsal Root Ganglia Focused on Pharmacological Targets Short
    bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Transcriptomic analysis of native versus cultured human and mouse dorsal root ganglia focused on pharmacological targets Short title: Comparative transcriptomics of acutely dissected versus cultured DRGs Andi Wangzhou1, Lisa A. McIlvried2, Candler Paige1, Paulino Barragan-Iglesias1, Carolyn A. Guzman1, Gregory Dussor1, Pradipta R. Ray1,#, Robert W. Gereau IV2, # and Theodore J. Price1, # 1The University of Texas at Dallas, School of Behavioral and Brain Sciences and Center for Advanced Pain Studies, 800 W Campbell Rd. Richardson, TX, 75080, USA 2Washington University Pain Center and Department of Anesthesiology, Washington University School of Medicine # corresponding authors [email protected], [email protected] and [email protected] Funding: NIH grants T32DA007261 (LM); NS065926 and NS102161 (TJP); NS106953 and NS042595 (RWG). The authors declare no conflicts of interest Author Contributions Conceived of the Project: PRR, RWG IV and TJP Performed Experiments: AW, LAM, CP, PB-I Supervised Experiments: GD, RWG IV, TJP Analyzed Data: AW, LAM, CP, CAG, PRR Supervised Bioinformatics Analysis: PRR Drew Figures: AW, PRR Wrote and Edited Manuscript: AW, LAM, CP, GD, PRR, RWG IV, TJP All authors approved the final version of the manuscript. 1 bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Prox1regulates the Subtype-Specific Development of Caudal Ganglionic
    The Journal of Neuroscience, September 16, 2015 • 35(37):12869–12889 • 12869 Development/Plasticity/Repair Prox1 Regulates the Subtype-Specific Development of Caudal Ganglionic Eminence-Derived GABAergic Cortical Interneurons X Goichi Miyoshi,1 Allison Young,1 Timothy Petros,1 Theofanis Karayannis,1 Melissa McKenzie Chang,1 Alfonso Lavado,2 Tomohiko Iwano,3 Miho Nakajima,4 Hiroki Taniguchi,5 Z. Josh Huang,5 XNathaniel Heintz,4 Guillermo Oliver,2 Fumio Matsuzaki,3 Robert P. Machold,1 and Gord Fishell1 1Department of Neuroscience and Physiology, NYU Neuroscience Institute, Smilow Research Center, New York University School of Medicine, New York, New York 10016, 2Department of Genetics & Tumor Cell Biology, St. Jude Children’s Research Hospital, Memphis, Tennessee 38105, 3Laboratory for Cell Asymmetry, RIKEN Center for Developmental Biology, Kobe 650-0047, Japan, 4Laboratory of Molecular Biology, Howard Hughes Medical Institute, GENSAT Project, The Rockefeller University, New York, New York 10065, and 5Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724 Neurogliaform (RELNϩ) and bipolar (VIPϩ) GABAergic interneurons of the mammalian cerebral cortex provide critical inhibition locally within the superficial layers. While these subtypes are known to originate from the embryonic caudal ganglionic eminence (CGE), the specific genetic programs that direct their positioning, maturation, and integration into the cortical network have not been eluci- dated. Here, we report that in mice expression of the transcription factor Prox1 is selectively maintained in postmitotic CGE-derived cortical interneuron precursors and that loss of Prox1 impairs the integration of these cells into superficial layers. Moreover, Prox1 differentially regulates the postnatal maturation of each specific subtype originating from the CGE (RELN, Calb2/VIP, and VIP).
    [Show full text]
  • Evaluation of Mutations in Kras and Braf Genes in Iranian Population with Diffuse Gastric Cancer
    WCRJ 2019; 6: e1352 EVALUATION OF MUTATIONS IN KRAS AND BRAF GENES IN IRANIAN POPULATION WITH DIFFUSE GASTRIC CANCER M. SANEIPOUR1,2, A. MORIDNIA3 1Department of Medical Biochemistry, School of Medicine, Shoushtar University of Medical Sciences, Shoushtar, Iran 2Department of Medical Biochemistry, School of Medicine, Dezful University of Medical Sciences, Dezful, Iran 3Department of Genetics and Molecular Biology, School of Medicine, Dezful University of Medical Sciences, Dezful, Iran Abstract – Objective: RAS proteins control signaling pathways which are the main regulators of the normal cell growth and malignant transformation cells. The point mutations in the KRAS gene are current event in numerous human cancers including pancreatic, lung, colon, and breast cancer. BRAF protein is located in the downstream of KRAS and it is revealed to be somatically mutated in various human cancers. KRAS and BRAF mutated genes have a vital role in the estab- lishment and development of tumors. Since there is a little information about BRAF and KRAS mutations in gastric cancer, the present study has been designed. Materials and Methods: We assessed 31 cases that experienced gastrectomy for diffuse gas- tric cancer, according to the histopathological criteria confirmed by pathologist. The patients were hospitalized in the Al-Zahra hospital in the Isfahan province (central Iran) and in the Alaa Cancer Control Center from 2011 to 2016. The DNA sequencing was completed by amplification exon 2 of KRAS and exon 15 of BRAF genes. Results: According to the electropherogram of DNA sequencing we did not find any alterations in the codon 12 and 13 of KRAS and codon 600 of BRAF genes.
    [Show full text]
  • Profiling Data
    Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8
    [Show full text]
  • Supplementary Table 1
    SI Table S1. Broad protein kinase selectivity for PF-2771. Kinase, PF-2771 % Inhibition at 10 μM Service Kinase, PF-2771 % Inhibition at 1 μM Service rat RPS6KA1 (RSK1) 39 Dundee AURKA (AURA) 24 Invitrogen IKBKB (IKKb) 26 Dundee CDK2 /CyclinA 21 Invitrogen mouse LCK 25 Dundee rabbit MAP2K1 (MEK1) 19 Dundee AKT1 (AKT) 21 Dundee IKBKB (IKKb) 16 Dundee CAMK1 (CaMK1a) 19 Dundee PKN2 (PRK2) 14 Dundee RPS6KA5 (MSK1) 18 Dundee MAPKAPK5 14 Dundee PRKD1 (PKD1) 13 Dundee PIM3 12 Dundee MKNK2 (MNK2) 12 Dundee PRKD1 (PKD1) 12 Dundee MARK3 10 Dundee NTRK1 (TRKA) 12 Invitrogen SRPK1 9 Dundee MAPK12 (p38g) 11 Dundee MAPKAPK5 9 Dundee MAPK8 (JNK1a) 11 Dundee MAPK13 (p38d) 8 Dundee rat PRKAA2 (AMPKa2) 11 Dundee AURKB (AURB) 5 Dundee NEK2 11 Invitrogen CSK 5 Dundee CHEK2 (CHK2) 11 Invitrogen EEF2K (EEF-2 kinase) 4 Dundee MAPK9 (JNK2) 9 Dundee PRKCA (PKCa) 4 Dundee rat RPS6KA1 (RSK1) 8 Dundee rat PRKAA2 (AMPKa2) 4 Dundee DYRK2 7 Dundee rat CSNK1D (CKId) 3 Dundee AKT1 (AKT) 7 Dundee LYN 3 BioPrint PIM2 7 Invitrogen CSNK2A1 (CKIIa) 3 Dundee MAPK15 (ERK7) 6 Dundee CAMKK2 (CAMKKB) 1 Dundee mouse LCK 5 Dundee PIM3 1 Dundee PDPK1 (PDK1) (directed 5 Invitrogen rat DYRK1A (MNB) 1 Dundee RPS6KB1 (p70S6K) 5 Dundee PBK 0 Dundee CSNK2A1 (CKIIa) 4 Dundee PIM1 -1 Dundee CAMKK2 (CAMKKB) 4 Dundee DYRK2 -2 Dundee SRC 4 Invitrogen MAPK12 (p38g) -2 Dundee MYLK2 (MLCK_sk) 3 Invitrogen NEK6 -3 Dundee MKNK2 (MNK2) 2 Dundee RPS6KB1 (p70S6K) -3 Dundee SRPK1 2 Dundee AKT2 -3 Dundee MKNK1 (MNK1) 2 Dundee RPS6KA3 (RSK2) -3 Dundee CHEK1 (CHK1) 2 Invitrogen rabbit MAP2K1 (MEK1) -4 Dundee
    [Show full text]
  • The TRAX, DISC1, and GSK3 Complex in Mental Disorders and Therapeutic Interventions Yu-Ting Weng1,2, Ting Chien1, I-I Kuan1 and Yijuang Chern1,2*
    Weng et al. Journal of Biomedical Science (2018) 25:71 https://doi.org/10.1186/s12929-018-0473-x REVIEW Open Access The TRAX, DISC1, and GSK3 complex in mental disorders and therapeutic interventions Yu-Ting Weng1,2, Ting Chien1, I-I Kuan1 and Yijuang Chern1,2* Abstract Psychiatric disorders (such as bipolar disorder, depression, and schizophrenia) affect the lives of millions of individuals worldwide. Despite the tremendous efforts devoted to various types of psychiatric studies and rapidly accumulating genetic information, the molecular mechanisms underlying psychiatric disorder development remain elusive. Among the genes that have been implicated in schizophrenia and other mental disorders, disrupted in schizophrenia 1 (DISC1) and glycogen synthase kinase 3 (GSK3) have been intensively investigated. DISC1 binds directly to GSK3 and modulates many cellular functions by negatively inhibiting GSK3 activity. The human DISC1 gene is located on chromosome 1 and is highly associated with schizophrenia and other mental disorders. A recent study demonstrated that a neighboring gene of DISC1, translin-associated factor X (TRAX), binds to the DISC1/GSK3β complex and at least partly mediates the actions of the DISC1/GSK3β complex. Previous studies also demonstrate that TRAX and most of its interacting proteins that have been identified so far are risk genes and/or markers of mental disorders. In the present review, we will focus on the emerging roles of TRAX and its interacting proteins (including DISC1 and GSK3β) in psychiatric disorders and the potential implications for developing therapeutic interventions. Keywords: TRAX, DISC1, GSK3β, Mental disorders, DNA damage, DNA repair, Oxidative stress, A2AR, PKA Background DNA repair) by interacting with various proteins [4–12].
    [Show full text]