DOCSLIB.ORG

Early During Myelomagenesis Alterations in DNA Methylation That

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Early During Myelomagenesis Alterations in DNA Methylation That Myeloma Is Characterized by Stage-Specific Alterations in DNA Methylation That Occur Early during Myelomagenesis This information is current as Christoph J. Heuck, Jayesh Mehta, Tushar Bhagat, Krishna of September 23, 2021. Gundabolu, Yiting Yu, Shahper Khan, Grigoris Chrysofakis, Carolina Schinke, Joseph Tariman, Eric Vickrey, Natalie Pulliam, Sangeeta Nischal, Li Zhou, Sanchari Bhattacharyya, Richard Meagher, Caroline Hu, Shahina Maqbool, Masako Suzuki, Samir Parekh, Frederic Reu, Ulrich Steidl, John Greally, Amit Verma and Seema B. Downloaded from Singhal J Immunol 2013; 190:2966-2975; Prepublished online 13 February 2013; doi: 10.4049/jimmunol.1202493 http://www.jimmunol.org/content/190/6/2966 http://www.jimmunol.org/ Supplementary http://www.jimmunol.org/content/suppl/2013/02/13/jimmunol.120249 Material 3.DC1 References This article cites 38 articles, 15 of which you can access for free at: http://www.jimmunol.org/content/190/6/2966.full#ref-list-1 by guest on September 23, 2021 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Myeloma Is Characterized by Stage-Specific Alterations in DNA Methylation That Occur Early during Myelomagenesis Christoph J. Heuck,* Jayesh Mehta,† Tushar Bhagat,* Krishna Gundabolu,* Yiting Yu,* Shahper Khan,‡ Grigoris Chrysofakis,* Carolina Schinke,* Joseph Tariman,† Eric Vickrey,† Natalie Pulliam,† Sangeeta Nischal,* Li Zhou,* Sanchari Bhattacharyya,* Richard Meagher,† Caroline Hu,* Shahina Maqbool,* Masako Suzuki,* Samir Parekh,* Frederic Reu,‡ Ulrich Steidl,* John Greally,* Amit Verma,* and Seema B. Singhal† Epigenetic changes play important roles in carcinogenesis and influence initial steps in neoplastic transformation by altering ge- nome stability and regulating gene expression. To characterize epigenomic changes during the transformation of normal plasma cells to myeloma, we modified the HpaII tiny fragment enrichment by ligation–mediated PCR assay to work with small numbers of Downloaded from purified primary marrow plasma cells. The nano-HpaII tiny fragment enrichment by ligation–mediated PCR assay was used to analyze the methylome of CD138+ cells from 56 subjects representing premalignant (monoclonal gammopathy of uncertain significance), early, and advanced stages of myeloma, as well as healthy controls. Plasma cells from premalignant and early stages of myeloma were characterized by striking, widespread hypomethylation. Gene-specific hypermethylation was seen to occur in the advanced stages, and cell lines representative of relapsed cases were found to be sensitive to decitabine. Aberrant demethylation in monoclonal gammopathy of uncertain significance occurred primarily in CpG islands, whereas differentially methylated loci in http://www.jimmunol.org/ cases of myeloma occurred predominantly outside of CpG islands and affected distinct sets of gene pathways, demonstrating qualitative epigenetic differences between premalignant and malignant stages. Examination of the methylation machinery revealed that the methyltransferase, DNMT3A, was aberrantly hypermethylated and underexpressed, but not mutated in mye- loma. DNMT3A underexpression was also associated with adverse overall survival in a large cohort of patients, providing insights into genesis of hypomethylation in myeloma. These results demonstrate widespread, stage-specific epigenetic changes during myelomagenesis and suggest that early demethylation can be a potential contributor to genome instability seen in myeloma. We also identify DNMT3A expression as a novel prognostic biomarker and suggest that relapsed cases can be therapeutically targeted by hypomethylating agents. The Journal of Immunology, 2013, 190: 2966–2975. by guest on September 23, 2021 espite therapeutic advances, multiple myeloma (MM) re- the development of a risk model that remains robust even in the age mains incurable and needs newer insights into the path- of newer therapies (1). The use of gene expression profiling by D ogenic mechanisms that cause this disease. Gene expres- different groups has also led to the identification of distinct mo- sion profiling has been used extensively in myeloma and has led to lecular subgroups that show defined clinical features (2, 3). How- ever, pathogenic mechanisms driving these differences in gene expression have not been well described, especially for early stages *Albert Einstein College of Medicine, Bronx, NY 10461; †Northwestern University, in myelomagenesis (4). Feinberg School of Medicine, Chicago, IL 60611; and ‡Cleveland Clinic, Cleveland, Recent studies of the epigenome and in particular the methylome OH 44195 have shown that cancer is characterized by widespread epigenetic Received for publication September 7, 2012. Accepted for publication January 9, changes. These changes lead to altered gene expression that can 2013. result in activation of oncogenic pathways. Furthermore, methyl- This work was supported by National Institutes of Health Immunooncology Training ome profiling has shown greater prognostic ability than gene ex- Program Grant T32 CA009173, Gabrielle’s Angel Foundation, the Leukemia and Lymphoma Society, the American Cancer Society, the Department of Defense, and pression profiling in acute myeloid leukemia (AML) and has led to a Partnership for Cures grant. identification of newer molecular subgroups with differences in The methylation data presented in this article have been deposited in the National overall survival (5). We have shown that methylome profiling is Institutes of Health Gene Expression Omnibus (National Center for Biotechnology able to identify changes that occur early during carcinogenesis in Information, http://www.ncbi.nlm.nih.gov/geo/) under accession number GSE 43860. solid tumors such as esophageal cancer (6). These studies have Address correspondence and reprint requests to Dr. Amit Verma, Dr. Christoph J. Heuck, and Dr. Seema B. Singhal, Albert Einstein College of Medicine, Bronx, NY been conducted with the use of the HpaII tiny fragment enrich- 10461 (A.V. and C.J.H.) and Feinberg School of Medicine, Northwestern University, ment by ligation–mediated PCR (HELP) assay, which is a ge- Chicago, IL 60611 (S.B.S.). E-mail addresses: [email protected] (A.V.), nome-wide assay that provides a reproducible analysis of the [email protected] (C.J.H.), and [email protected] (S.B.S.) methylome that is not biased toward CpG islands (7). Analyzing The online version of this article contains supplemental material. the methylome of myeloma can help identify changes that can Abbreviations used in this article: AML, acute myeloid leukemia; HAF, HpaII-amplifi- able fragment; HELP, HpaII tiny fragment enrichment by ligation–mediated PCR; MM, define disease subsets and lead to identification of newer thera- multiple myeloma; MGUS, monoclonal gammopathy of uncertain significance; peutic targets. Recent sequencing studies in myeloma have also NEWMM, newly diagnosed myeloma; NL, normal; REL, relapsed myeloma; REM, revealed mutations in enzymes that are involved in epigenetic complete remission; SMM, smoldering myeloma; TF, transcription factor. machinery, again reinforcing the need to study the epigenetic Copyright Ó 2013 by The American Association of Immunologists, Inc. 0022-1767/13/$16.00 alterations in this disease (8). We have conducted a genome-wide www.jimmunol.org/cgi/doi/10.4049/jimmunol.1202493 The Journal of Immunology 2967 analysis of changes in DNA methylation in monoclonal gamm- tative for methylation and analyzed as a continuous variable. For most loci, opathy of uncertain significance (MGUS), newly diagnosed MM, each fragment was categorized as either methylated, if the centered log , as well as relapsed MM, and compared them with normal plasma HpaII/MspI ratio was generally 0, or hypomethylated, if, in contrast, the log ratio was .0. cell controls. We used a modification of the HELP assay (nano- HELP) that was developed to work with low amounts of DNA to Quantitative DNA methylation analysis by MassArray interrogate the methylome of sorted CD138+ cells from patient Epityping samples. We report that widespread alterations in DNA methyla- Validation of the findings of the HELP assay was carried out by MALDI- tion are seen in myeloma and have the power to discriminate TOF mass spectrometry using EpiTyper by MassArray (Sequenom, CA) on between MGUS and new/relapsed cases. We report that hypo- bisulfite-converted DNA, as previously described (6). Validation was done methylation is the predominant early change during myeloma- on all samples with sufficient available DNA. MassARRAY primers were designed to cover the flanking HpaII sites for a given HAF, as well as for genesis that is gradually transformed to hypermethylation in any other HpaII sites found up to 2000 bp upstream
Load more

Recommended publications
  • Histone Isoform H2A1H Promotes Attainment of Distinct Physiological
    Bhattacharya et al. Epigenetics & Chromatin (2017) 10:48 DOI 10.1186/s13072-017-0155-z Epigenetics & Chromatin RESEARCH Open Access Histone isoform H2A1H promotes attainment of distinct physiological states by altering chromatin dynamics Saikat Bhattacharya1,4,6, Divya Reddy1,4, Vinod Jani5†, Nikhil Gadewal3†, Sanket Shah1,4, Raja Reddy2,4, Kakoli Bose2,4, Uddhavesh Sonavane5, Rajendra Joshi5 and Sanjay Gupta1,4* Abstract Background: The distinct functional efects of the replication-dependent histone H2A isoforms have been dem- onstrated; however, the mechanistic basis of the non-redundancy remains unclear. Here, we have investigated the specifc functional contribution of the histone H2A isoform H2A1H, which difers from another isoform H2A2A3 in the identity of only three amino acids. Results: H2A1H exhibits varied expression levels in diferent normal tissues and human cancer cell lines (H2A1C in humans). It also promotes cell proliferation in a context-dependent manner when exogenously overexpressed. To uncover the molecular basis of the non-redundancy, equilibrium unfolding of recombinant H2A1H-H2B dimer was performed. We found that the M51L alteration at the H2A–H2B dimer interface decreases the temperature of melting of H2A1H-H2B by ~ 3 °C as compared to the H2A2A3-H2B dimer. This diference in the dimer stability is also refected in the chromatin dynamics as H2A1H-containing nucleosomes are more stable owing to M51L and K99R substitu- tions. Molecular dynamic simulations suggest that these substitutions increase the number of hydrogen bonds and hydrophobic interactions of H2A1H, enabling it to form more stable nucleosomes. Conclusion: We show that the M51L and K99R substitutions, besides altering the stability of histone–histone and histone–DNA complexes, have the most prominent efect on cell proliferation, suggesting that the nucleosome sta- bility is intimately linked with the physiological efects observed.
    [Show full text]
  • Deciphering the Functions of Ets2, Pten and P53 in Stromal Fibroblasts in Multiple
    Deciphering the Functions of Ets2, Pten and p53 in Stromal Fibroblasts in Multiple Breast Cancer Models DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Julie Wallace Graduate Program in Molecular, Cellular and Developmental Biology The Ohio State University 2013 Dissertation Committee: Michael C. Ostrowski, PhD, Advisor Gustavo Leone, PhD Denis Guttridge, PhD Dawn Chandler, PhD Copyright by Julie Wallace 2013 Abstract Breast cancer is the second most common cancer in American women, and is also the second leading cause of cancer death in women. It is estimated that nearly a quarter of a million new cases of invasive breast cancer will be diagnosed in women in the United States this year, and approximately 40,000 of these women will die from breast cancer. Although death rates have been on the decline for the past decade, there is still much we need to learn about this disease to improve prevention, detection and treatment strategies. The majority of early studies have focused on the malignant tumor cells themselves, and much has been learned concerning mutations, amplifications and other genetic and epigenetic alterations of these cells. However more recent work has acknowledged the strong influence of tumor stroma on the initiation, progression and recurrence of cancer. Under normal conditions this stroma has been shown to have protective effects against tumorigenesis, however the transformation of tumor cells manipulates this surrounding environment to actually promote malignancy. Fibroblasts in particular make up a significant portion of this stroma, and have been shown to impact various aspects of tumor cell biology.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Targeting and Reprograming Cancer-Associated Fibroblasts and the Tumor Microenvironment in Pancreatic Cancer
    cancers Review Targeting and Reprograming Cancer-Associated Fibroblasts and the Tumor Microenvironment in Pancreatic Cancer Yoshiaki Sunami * , Viktoria Böker and Jörg Kleeff Department of Visceral, Vascular and Endocrine Surgery, Martin-Luther-University Halle-Wittenberg, University Medical Center Halle, 06120 Halle, Germany; [email protected] (V.B.); [email protected] (J.K.) * Correspondence: [email protected]; Tel.: +49-345-557-2794 Simple Summary: The tumor microenvironment plays a major role in the progression and drug resistance of pancreatic cancer. Cancer-associated fibroblasts are the major stromal cells and source of extracellular matrix proteins forming the dense stromal tumor microenvironment. Targeting cancer-associated fibroblasts has been deemed a promising therapeutic strategy. However, deplet- ing cancer-associated fibroblasts may also have tumor-promoting effects due to their functional heterogeneity. It is therefore important to target selectively the tumor-promoting subtype of cancer- associated fibroblasts. Furthermore, deactivating fibroblasts, or reprograming tumor-promoting cancer-associated fibroblasts to tumor-restraining cancer-associated fibroblasts are considered as therapy for pancreatic cancer. Abstract: Pancreatic cancer is the fourth leading cause of cancer deaths in the United States both in female and male, and is projected to become the second deadliest cancer by 2030. The overall five-year survival rate remains at around 10%. Pancreatic cancer exhibits a remarkable resistance to established therapeutic options such as chemotherapy and radiotherapy, due to dense stromal Citation: Sunami, Y.; Böker, V.; tumor microenvironment. Cancer-associated fibroblasts are the major stromal cell type and source of Kleeff, J. Targeting and Reprograming extracellular matrix proteins shaping a physical and metabolic barrier thereby reducing therapeutic Cancer-Associated Fibroblasts and efficacy.
    [Show full text]
  • Genetic Mutations and Mechanisms in Dilated Cardiomyopathy
    Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, … , Jessica R. Golbus, Megan J. Puckelwartz J Clin Invest. 2013;123(1):19-26. https://doi.org/10.1172/JCI62862. Review Series Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of congestive heart failure. In hypertrophic cardiomyopathy (HCM), cardiac output is limited by the thickened myocardium through impaired filling and outflow. Mutations in the genes encoding the thick filament components myosin heavy chain and myosin binding protein C (MYH7 and MYBPC3) together explain 75% of inherited HCMs, leading to the observation that HCM is a disease of the sarcomere. Many mutations are “private” or rare variants, often unique to families. In contrast, dilated cardiomyopathy (DCM) is far more genetically heterogeneous, with mutations in genes encoding cytoskeletal, nucleoskeletal, mitochondrial, and calcium-handling proteins. DCM is characterized by enlarged ventricular dimensions and impaired systolic and diastolic function. Private mutations account for most DCMs, with few hotspots or recurring mutations. More than 50 single genes are linked to inherited DCM, including many genes that also link to HCM. Relatively few clinical clues guide the diagnosis of inherited DCM, but emerging evidence supports the use of genetic testing to identify those patients at risk for faster disease progression, congestive heart failure, and arrhythmia. Find the latest version: https://jci.me/62862/pdf Review series Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, Jessica R. Golbus, and Megan J. Puckelwartz Department of Human Genetics, University of Chicago, Chicago, Illinois, USA. Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of conges- tive heart failure.
    [Show full text]
  • Genome-Wide Prediction of Small Molecule Binding to Remote
    bioRxiv preprint doi: https://doi.org/10.1101/2020.08.04.236729; this version posted August 5, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Genome-wide Prediction of Small Molecule Binding 2 to Remote Orphan Proteins Using Distilled Sequence 3 Alignment Embedding 1 2 3 4 4 Tian Cai , Hansaim Lim , Kyra Alyssa Abbu , Yue Qiu , 5,6 1,2,3,4,7,* 5 Ruth Nussinov , and Lei Xie 1 6 Ph.D. Program in Computer Science, The Graduate Center, The City University of New York, New York, 10016, USA 2 7 Ph.D. Program in Biochemistry, The Graduate Center, The City University of New York, New York, 10016, USA 3 8 Department of Computer Science, Hunter College, The City University of New York, New York, 10065, USA 4 9 Ph.D. Program in Biology, The Graduate Center, The City University of New York, New York, 10016, USA 5 10 Computational Structural Biology Section, Basic Science Program, Frederick National Laboratory for Cancer Research, 11 Frederick, MD 21702, USA 6 12 Department of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel Aviv University, Tel 13 Aviv, Israel 7 14 Helen and Robert Appel Alzheimer’s Disease Research Institute, Feil Family Brain & Mind Research Institute, Weill 15 Cornell Medicine, Cornell University, New York, 10021, USA * 16 [email protected] 17 July 27, 2020 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.08.04.236729; this version posted August 5, 2020.
    [Show full text]
  • Edinburgh Research Explorer
    Edinburgh Research Explorer International Union of Basic and Clinical Pharmacology. LXXXVIII. G protein-coupled receptor list Citation for published version: Davenport, AP, Alexander, SPH, Sharman, JL, Pawson, AJ, Benson, HE, Monaghan, AE, Liew, WC, Mpamhanga, CP, Bonner, TI, Neubig, RR, Pin, JP, Spedding, M & Harmar, AJ 2013, 'International Union of Basic and Clinical Pharmacology. LXXXVIII. G protein-coupled receptor list: recommendations for new pairings with cognate ligands', Pharmacological reviews, vol. 65, no. 3, pp. 967-86. https://doi.org/10.1124/pr.112.007179 Digital Object Identifier (DOI): 10.1124/pr.112.007179 Link: Link to publication record in Edinburgh Research Explorer Document Version: Publisher's PDF, also known as Version of record Published In: Pharmacological reviews Publisher Rights Statement: U.S. Government work not protected by U.S. copyright General rights Copyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorer content complies with UK legislation. If you believe that the public display of this file breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 02. Oct. 2021 1521-0081/65/3/967–986$25.00 http://dx.doi.org/10.1124/pr.112.007179 PHARMACOLOGICAL REVIEWS Pharmacol Rev 65:967–986, July 2013 U.S.
    [Show full text]
  • Differences for Ectopic Versus Eutopic Cells
    556 RBMO VOLUME 39 ISSUE 4 2019 ARTICLE Chemosensitivity and chemoresistance in endometriosis – differences for ectopic versus eutopic cells BIOGRAPHY Andres Salumets is Professor of Reproductive Medicine at the University of Tartu, and Scientific Head at the Competence Centre on Health Technologies, Tartu, Estonia. He has been involved in assisted reproduction for 20 years, first as an embryologist and later as a researcher. His major interests are endometriosis, endometrial biology and implantation. Darja Lavogina1,2,*, Külli Samuel1, Arina Lavrits1,3, Alvin Meltsov1, Deniss Sõritsa1,4,5, Ülle Kadastik6, Maire Peters1,4, Ago Rinken2, Andres Salumets1,4,7, 8 KEY MESSAGE Akt/PKB inhibitor GSK690693, CK2 inhibitor ARC-775, MAPK pathway inhibitor sorafenib, proteasome inhibitor bortezomib, and microtubule-depolymerizing toxin MMAE showed higher cytotoxicity in eutopic cells. In contrast, 10 µmol/l of the anthracycline toxin doxorubicin caused cellular death in ectopic cells more effectively than in eutopic cells, underlining the potential of doxorubicin in endometriosis research. ABSTRACT Research question: Endometriosis is a common gynaecological disease defined by the presence of endometrium-like tissue outside the uterus. This complex disease, often accompanied by severe pain and infertility, causes a significant medical and socioeconomic burden; hence, novel strategies are being sought for the treatment of endometriosis. Here, we set out to explore the cytotoxic effects of a panel of compounds to find toxins with different efficiency in eutopic versus ectopic cells, thus highlighting alterations in the corresponding molecular pathways. Design: The effect on cellular viability of 14 compounds was established in a cohort of paired eutopic and ectopic endometrial stromal cell samples from 11 patients.
    [Show full text]
  • Profound Treg Perturbations Correlate with COVID-19 Severity
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.11.416180; this version posted December 15, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Profound Treg perturbations correlate with COVID-19 severity Silvia Galván-Peña1*, Juliette Leon1,2*, Kaitavjeet Chowdhary1, Daniel A. Michelson1, Brinda Vijaykumar1, Liang Yang1, Angela Magnuson1, Zachary Manickas-Hill3,4, Alicja Piechocka- Trocha3,4, Daniel P. Worrall3,4, Kathryn E. Hall3,5, Musie Ghebremichael3,4, Bruce D. Walker3,4,6, Jonathan Z. Li3,7, Xu G. Yu3,4, MGH COVID-19 Collection & Processing Team, Diane Mathis1 and Christophe Benoist1,8,+ 1Department of Immunology, Harvard Medical School, Boston, MA, USA 2 INSERM UMR 1163, University of Paris, Imagine Institute, Paris, France 3Massachusetts Consortium on Pathogen Readiness, Boston, MA, USA 4Ragon Institute of MGH, MIT and Harvard, Cambridge, MA, USA 5Department of Medicine, Massachusetts General Hospital, Boston, MA, USA 6Howard Hughes Medical Institute, Center for the AIDS Programme of Research in South Africa. 7Brigham and Women’s Hospital, Harvard Medical School, Boston, MA, USA 8Lead contact * Equal contribution +Address correspondence to: Christophe Benoist Department of Immunology Harvard Medical School 77 Avenue Louis Pasteur, Boston, MA 02115 e-mail: [email protected] Phone: (617) 432-7741 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.11.416180; this version posted December 15, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
    [Show full text]
  • Profiling Data
    Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8
    [Show full text]
  • Reconstructing Cell Cycle Pseudo Time-Series Via Single-Cell Transcriptome Data—Supplement
    School of Natural Sciences and Mathematics Reconstructing Cell Cycle Pseudo Time-Series Via Single-Cell Transcriptome Data—Supplement UT Dallas Author(s): Michael Q. Zhang Rights: CC BY 4.0 (Attribution) ©2017 The Authors Citation: Liu, Zehua, Huazhe Lou, Kaikun Xie, Hao Wang, et al. 2017. "Reconstructing cell cycle pseudo time-series via single-cell transcriptome data." Nature Communications 8, doi:10.1038/s41467-017-00039-z This document is being made freely available by the Eugene McDermott Library of the University of Texas at Dallas with permission of the copyright owner. All rights are reserved under United States copyright law unless specified otherwise. File name: Supplementary Information Description: Supplementary figures, supplementary tables, supplementary notes, supplementary methods and supplementary references. CCNE1 CCNE1 CCNE1 CCNE1 36 40 32 34 32 35 30 32 28 30 30 28 28 26 24 25 Normalized Expression Normalized Expression Normalized Expression Normalized Expression 26 G1 S G2/M G1 S G2/M G1 S G2/M G1 S G2/M Cell Cycle Stage Cell Cycle Stage Cell Cycle Stage Cell Cycle Stage CCNE1 CCNE1 CCNE1 CCNE1 40 32 40 40 35 30 38 30 30 28 36 25 26 20 20 34 Normalized Expression Normalized Expression Normalized Expression 24 Normalized Expression G1 S G2/M G1 S G2/M G1 S G2/M G1 S G2/M Cell Cycle Stage Cell Cycle Stage Cell Cycle Stage Cell Cycle Stage Supplementary Figure 1 | High stochasticity of single-cell gene expression means, as demonstrated by relative expression levels of gene Ccne1 using the mESC-SMARTer data. For every panel, 20 sample cells were randomly selected for each of the three stages, followed by plotting the mean expression levels at each stage.
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]