Geneseq®: Cardio
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent -
Adrenocortical Tumors Have a Distinct Long Non-Coding RNA Expression Profile and LINC00271 Is Downregulated in Malignancy
Edinburgh Research Explorer Adrenocortical tumors have a distinct long non-coding RNA expression profile and LINC00271 is downregulated in malignancy Citation for published version: Buishand, F, Liu-Chittenden, Y, Fan, Y, Tirosh, A, Gara, S, Patel, D, Meerzaman, D & Kebebew, E 2019, 'Adrenocortical tumors have a distinct long non-coding RNA expression profile and LINC00271 is downregulated in malignancy', Surgery. https://doi.org/10.1016/j.surg.2019.04.067 Digital Object Identifier (DOI): 10.1016/j.surg.2019.04.067 Link: Link to publication record in Edinburgh Research Explorer Document Version: Peer reviewed version Published In: Surgery General rights Copyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorer content complies with UK legislation. If you believe that the public display of this file breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 07. Oct. 2021 Elsevier Editorial System(tm) for Surgery Manuscript Draft Manuscript Number: 19-AAES-22R2 Title: Adrenocortical tumors have a distinct long non-coding RNA expression profile and LINC00271 is downregulated in malignancy Article Type: AAES Society Paper Section/Category: Basic Research Keywords: LINC00271; adrenocortical; long noncoding RNA; microarray; prognostic marker; gene signaling pathway. Corresponding Author: Dr. -
Supplemental Material Table of Contents
Supplemental material Table of Contents Detailed Materials and Methods ......................................................................................................... 2 Perioperative period ........................................................................................................................... 2 Ethical aspects ................................................................................................................................... 4 Evaluation of heart failure ................................................................................................................. 4 Sample preparation for ANP mRNA expression .................................................................................. 5 Sample preparation for validative qRT-PCR (Postn, Myh7, Gpx3, Tgm2) ............................................ 6 Tissue fibrosis .................................................................................................................................... 7 Ventricular remodeling and histological tissue preservation ................................................................ 8 Evaluation of the histological preservation of cardiac tissue ................................................................ 9 Sample preparation and quantitative label-free proteomics analyses .................................................. 10 Statistical methods ........................................................................................................................... 12 References ........................................................................................................................................ -
Atlas Antibodies in Breast Cancer Research Table of Contents
ATLAS ANTIBODIES IN BREAST CANCER RESEARCH TABLE OF CONTENTS The Human Protein Atlas, Triple A Polyclonals and PrecisA Monoclonals (4-5) Clinical markers (6) Antibodies used in breast cancer research (7-13) Antibodies against MammaPrint and other gene expression test proteins (14-16) Antibodies identified in the Human Protein Atlas (17-14) Finding cancer biomarkers, as exemplified by RBM3, granulin and anillin (19-22) Co-Development program (23) Contact (24) Page 2 (24) Page 3 (24) The Human Protein Atlas: a map of the Human Proteome The Human Protein Atlas (HPA) is a The Human Protein Atlas consortium cell types. All the IHC images for Swedish-based program initiated in is mainly funded by the Knut and Alice the normal tissue have undergone 2003 with the aim to map all the human Wallenberg Foundation. pathology-based annotation of proteins in cells, tissues and organs expression levels. using integration of various omics The Human Protein Atlas consists of technologies, including antibody- six separate parts, each focusing on References based imaging, mass spectrometry- a particular aspect of the genome- 1. Sjöstedt E, et al. (2020) An atlas of the based proteomics, transcriptomics wide analysis of the human proteins: protein-coding genes in the human, pig, and and systems biology. mouse brain. Science 367(6482) 2. Thul PJ, et al. (2017) A subcellular map of • The Tissue Atlas shows the the human proteome. Science. 356(6340): All the data in the knowledge resource distribution of proteins across all eaal3321 is open access to allow scientists both major tissues and organs in the 3. -
Computational Genome-Wide Identification of Heat Shock Protein Genes in the Bovine Genome [Version 1; Peer Review: 2 Approved, 1 Approved with Reservations]
F1000Research 2018, 7:1504 Last updated: 08 AUG 2021 RESEARCH ARTICLE Computational genome-wide identification of heat shock protein genes in the bovine genome [version 1; peer review: 2 approved, 1 approved with reservations] Oyeyemi O. Ajayi1,2, Sunday O. Peters3, Marcos De Donato2,4, Sunday O. Sowande5, Fidalis D.N. Mujibi6, Olanrewaju B. Morenikeji2,7, Bolaji N. Thomas 8, Matthew A. Adeleke 9, Ikhide G. Imumorin2,10,11 1Department of Animal Breeding and Genetics, Federal University of Agriculture, Abeokuta, Nigeria 2International Programs, College of Agriculture and Life Sciences, Cornell University, Ithaca, NY, 14853, USA 3Department of Animal Science, Berry College, Mount Berry, GA, 30149, USA 4Departamento Regional de Bioingenierias, Tecnologico de Monterrey, Escuela de Ingenieria y Ciencias, Queretaro, Mexico 5Department of Animal Production and Health, Federal University of Agriculture, Abeokuta, Nigeria 6Usomi Limited, Nairobi, Kenya 7Department of Animal Production and Health, Federal University of Technology, Akure, Nigeria 8Department of Biomedical Sciences, Rochester Institute of Technology, Rochester, NY, 14623, USA 9School of Life Sciences, University of KwaZulu-Natal, Durban, 4000, South Africa 10School of Biological Sciences, Georgia Institute of Technology, Atlanta, GA, 30032, USA 11African Institute of Bioscience Research and Training, Ibadan, Nigeria v1 First published: 20 Sep 2018, 7:1504 Open Peer Review https://doi.org/10.12688/f1000research.16058.1 Latest published: 20 Sep 2018, 7:1504 https://doi.org/10.12688/f1000research.16058.1 Reviewer Status Invited Reviewers Abstract Background: Heat shock proteins (HSPs) are molecular chaperones 1 2 3 known to bind and sequester client proteins under stress. Methods: To identify and better understand some of these proteins, version 1 we carried out a computational genome-wide survey of the bovine 20 Sep 2018 report report report genome. -
Genome Editing with CRISPR/Cas9 in Postnatal Mice Corrects PRKAG2 Cardiac Syndrome
Cell Research (2016) 26:1099-1111. © 2016 IBCB, SIBS, CAS All rights reserved 1001-0602/16 $ 32.00 ORIGINAL ARTICLE www.nature.com/cr Genome editing with CRISPR/Cas9 in postnatal mice corrects PRKAG2 cardiac syndrome Chang Xie1, 2, *, Ya-Ping Zhang3, *, Lu Song2, *, Jie Luo1, Wei Qi2, Jialu Hu3, Danbo Lu3, Zhen Yang3, Jian Zhang2, Jian Xiao1, Bin Zhou4, Jiu-Lin Du5, Naihe Jing2, Yong Liu1, Yan Wang1, Bo-Liang Li2, Bao-Liang Song1, Yan Yan3 1Hubei Key Laboratory of Cell Homeostasis, College of Life Sciences, Wuhan University, Wuhan 430072, China; 2The State Key Laboratory of Molecular Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, 320 Yue-Yang Road, Shanghai 200031, China; 3Shanghai Institute of Cardiovascular Diseases, Zhongshan Hospital, Fudan University, Shanghai 200032, China; 4Key Laboratory of Nutrition and Metabolism, Institute for Nutritional Sci- ences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, 320 Yue-Yang Road, Shanghai 200031, China; 5Institute of Neuroscience and State Key Laboratory of Neuroscience, Shanghai Institutes for Biological Sciences, Chinese Acade- my of Sciences, 320 Yue-Yang Road, Shanghai 200031, China PRKAG2 cardiac syndrome is an autosomal dominant inherited disease resulted from mutations in the PRK- AG2 gene that encodes γ2 regulatory subunit of AMP-activated protein kinase. Affected patients usually develop ventricular tachyarrhythmia and experience progressive heart failure that is refractory to medical treatment and requires cardiac transplantation. In this study, we identify a H530R mutation in PRKAG2 from patients with famil- ial Wolff-Parkinson-White syndrome. By generating H530R PRKAG2 transgenic and knock-in mice, we show that both models recapitulate human symptoms including cardiac hypertrophy and glycogen storage, confirming that the H530R mutation is causally related to PRKAG2 cardiac syndrome. -
Genetic Variation Screening of TNNT2 Gene in a Cohort of Patients with Hypertrophic and Dilated Cardiomyopathy
Physiol. Res. 61: 169-175, 2012 https://doi.org/10.33549/physiolres.932157 Genetic Variation Screening of TNNT2 Gene in a Cohort of Patients With Hypertrophic and Dilated Cardiomyopathy M. JÁCHYMOVÁ1, A. MURAVSKÁ1, T. PALEČEK2, P. KUCHYNKA2, H. ŘEHÁKOVÁ1, S. MAGAGE2, A. KRÁL2, T. ZIMA1, K. HORKÝ2, A. LINHART2 1Institute of Clinical Chemistry and Laboratory Diagnostics, First Faculty of Medicine and General University Hospital, Charles University, Prague, Czech Republic, 2Second Department of Internal Medicine – Clinical Department of Cardiology and Angiology, First Faculty of Medicine and General University Hospital, Charles University, Prague, Czech Republic Received February 1, 2011 Accepted October 17, 2011 On-line January 31, 2012 Summary Introduction Mutations in troponin T (TNNT2) gene represent the important part of currently identified disease-causing mutations in Cardiomyopathies are generally defined as hypertrophic (HCM) and dilated (DCM) cardiomyopathy. The aim myocardial disorders in which the heart muscle is of this study was to analyze TNNT2 gene exons in patients with structurally and functionally abnormal, in the absence of HCM and DCM diagnosis to improve diagnostic and genetic coronary artery disease, hypertension, valvular disease consultancy in affected families. All 15 exons and their flanking and congenital heart disease sufficient to cause the regions of the TNNT2 gene were analyzed by DNA sequence observed myocardial abnormality (Elliott et al. 2008). analysis in 174 patients with HCM and DCM diagnosis. We According to the morphological and functional phenotype identified genetic variations in TNNT2 exon regions in 56 patients the diagnosis of hypertrophic and dilated cardiomyopathy and genetic variations in TNNT2 intron regions in 164 patients. -
Genetic Mutations and Mechanisms in Dilated Cardiomyopathy
Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, … , Jessica R. Golbus, Megan J. Puckelwartz J Clin Invest. 2013;123(1):19-26. https://doi.org/10.1172/JCI62862. Review Series Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of congestive heart failure. In hypertrophic cardiomyopathy (HCM), cardiac output is limited by the thickened myocardium through impaired filling and outflow. Mutations in the genes encoding the thick filament components myosin heavy chain and myosin binding protein C (MYH7 and MYBPC3) together explain 75% of inherited HCMs, leading to the observation that HCM is a disease of the sarcomere. Many mutations are “private” or rare variants, often unique to families. In contrast, dilated cardiomyopathy (DCM) is far more genetically heterogeneous, with mutations in genes encoding cytoskeletal, nucleoskeletal, mitochondrial, and calcium-handling proteins. DCM is characterized by enlarged ventricular dimensions and impaired systolic and diastolic function. Private mutations account for most DCMs, with few hotspots or recurring mutations. More than 50 single genes are linked to inherited DCM, including many genes that also link to HCM. Relatively few clinical clues guide the diagnosis of inherited DCM, but emerging evidence supports the use of genetic testing to identify those patients at risk for faster disease progression, congestive heart failure, and arrhythmia. Find the latest version: https://jci.me/62862/pdf Review series Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, Jessica R. Golbus, and Megan J. Puckelwartz Department of Human Genetics, University of Chicago, Chicago, Illinois, USA. Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of conges- tive heart failure. -
Defining Functional Interactions During Biogenesis of Epithelial Junctions
ARTICLE Received 11 Dec 2015 | Accepted 13 Oct 2016 | Published 6 Dec 2016 | Updated 5 Jan 2017 DOI: 10.1038/ncomms13542 OPEN Defining functional interactions during biogenesis of epithelial junctions J.C. Erasmus1,*, S. Bruche1,*,w, L. Pizarro1,2,*, N. Maimari1,3,*, T. Poggioli1,w, C. Tomlinson4,J.Lees5, I. Zalivina1,w, A. Wheeler1,w, A. Alberts6, A. Russo2 & V.M.M. Braga1 In spite of extensive recent progress, a comprehensive understanding of how actin cytoskeleton remodelling supports stable junctions remains to be established. Here we design a platform that integrates actin functions with optimized phenotypic clustering and identify new cytoskeletal proteins, their functional hierarchy and pathways that modulate E-cadherin adhesion. Depletion of EEF1A, an actin bundling protein, increases E-cadherin levels at junctions without a corresponding reinforcement of cell–cell contacts. This unexpected result reflects a more dynamic and mobile junctional actin in EEF1A-depleted cells. A partner for EEF1A in cadherin contact maintenance is the formin DIAPH2, which interacts with EEF1A. In contrast, depletion of either the endocytic regulator TRIP10 or the Rho GTPase activator VAV2 reduces E-cadherin levels at junctions. TRIP10 binds to and requires VAV2 function for its junctional localization. Overall, we present new conceptual insights on junction stabilization, which integrate known and novel pathways with impact for epithelial morphogenesis, homeostasis and diseases. 1 National Heart and Lung Institute, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. 2 Computing Department, Imperial College London, London SW7 2AZ, UK. 3 Bioengineering Department, Faculty of Engineering, Imperial College London, London SW7 2AZ, UK. 4 Department of Surgery & Cancer, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. -
University of Groningen the Human HSP70/HSP40 Chaperone Family
University of Groningen The human HSP70/HSP40 chaperone family Hageman, Jurre IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below. Document Version Publisher's PDF, also known as Version of record Publication date: 2008 Link to publication in University of Groningen/UMCG research database Citation for published version (APA): Hageman, J. (2008). The human HSP70/HSP40 chaperone family: a study on its capacity to combat proteotoxic stress. s.n. Copyright Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons). The publication may also be distributed here under the terms of Article 25fa of the Dutch Copyright Act, indicated by the “Taverne” license. More information can be found on the University of Groningen website: https://www.rug.nl/library/open-access/self-archiving-pure/taverne- amendment. Take-down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum. Download date: 30-09-2021 CHAPTER 1 Introduction - Structural and functional diversities between members of the human HSPH, HSPA and DNAJ chaperone families Jurre Hageman and Harm H. -
Clinical and Prognostic Significance of MYH11 in Lung Cancer
ONCOLOGY LETTERS 19: 3899-3906, 2020 Clinical and prognostic significance ofMYH11 in lung cancer MENG-JUN NIE1,2, XIAO-TING PAN1,2, HE-YUN TAO1,2, MENG-JUN XU1,2, SHEN-LIN LIU1, WEI SUN1, JIAN WU1 and XI ZOU1 1Oncology Department, The Affiliated Hospital of Nanjing University of Chinese Medicine, Jiangsu Province Hospital of Chinese Medicine, Nanjing, Jiangsu 210029; 2No.1 Clinical Medical College, Nanjing University of Chinese Medicine, Nanjing, Jiangsu 210023, P.R. China Received May 14, 2019; Accepted February 21, 2020 DOI: 10.3892/ol.2020.11478 Abstract. Myosin heavy chain 11 (MYH11), encoded by 5-year survival rate is estimated to approximately 18% (2). the MYH11 gene, is a protein that participates in muscle Therefore, novel targets for drug treatment and prognosis of contraction through the hydrolysis of adenosine triphosphate. lung cancer are needed. Although previous studies have demonstrated that MYH11 Myosin heavy chain 11 (MYH11), which is encoded by gene expression levels are downregulated in several types of the MYH11 gene, is a smooth muscle myosin belonging to the cancer, its expression levels have rarely been investigated in myosin heavy chain family (3). MYH11 is a contractile protein lung cancer. The present study aimed to explore the clinical that slides past actin filaments to induce muscle contraction significance and prognostic value of MYH11 expression levels via adenosine triphosphate hydrolysis (4,5). Previous findings in lung cancer and to further study the underlying molecular have shown that in aortic tissue, destruction of MYH11 can mechanisms of the function of this gene. The Oncomine lead to vascular smooth muscle cell loss, disorganization database showed that the MYH11 expression levels were and hyperplasia, which is one of the mechanisms leading to decreased in lung cancer compared with those noted in the thoracic aortic aneurysms and dissections (6,7).