DOCSLIB.ORG

Comprehensive Cardiovascular

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Comprehensive Cardiovascular ComprehensiveComprehensive Cardiovascular Cardiovascular CardiovascularCardiovascular Diseases Diseases CardiovascularCardiovascular diseases diseases are are a groupa group of of disorders disorders that that may may affect affect the the heart heart and and blood blood vessels. vessels. WhileWhile the the causes causes of of cardiovascularcardiovascular disease disease are are diverse, diverse, proportions proportions are are genetic genetic in inorigin. origin. These These disorders disorders may may occur occur as aspart part of ofa clinicala clinical spectrumspectrum associated associated with with a particulara particular genetic genetic condition condition or or as as an anisolated isolated finding. finding. The The mode mode of of inheritance inheritance is isalso also diverse diverse withwith differing differing clinical clinical variability variability and and expressivity. expressivity. EmoryEmory Genetics Genetics Laboratory Laboratory offers offers the the Comprehensive Comprehensive Cardiovascular Cardiovascular Panel Panel to toaid aid in inthe the diagnosis diagnosis of ofa avariety variety of of cardiovascularcardiovascular conditions. conditions. This This panel panel is isideal ideal if theif the causative causative gene gene is isunknown unknown and and therefore therefore single-gene single-gene analysis analysis will will notnot be be cost-effective. cost-effective. Some Some genes genes on on this this panel panel are are associated associated with with addit additionalional phenotypes. phenotypes. GenesGenes Included Included on on Comprehensive Comprehensive Cardiovascular Cardiovascular Panel* Panel* ABCC9ABCC9 CACNA1C CACNA1C DESDES FKTNFKTN KCNE2 KCNE2 LMNA LMNA MYLK2 MYLK2 PTPN11 PTPN11 SKI SKI TMPO TMPO ACTA2ACTA2 CACNB2CACNB2 DMD DMD FLNA FLNA KCNE3 KCNE3 MAP2K1 MAP2K1 MYOZ2 MYOZ2 RAF1 RAF1 SLC2A10 SLC2A10 TNNC1 TNNC1 ACTC1ACTC1 CASQ2CASQ2 DSC2 DSC2 GAA GAA KCNH2 KCNH2 MAP2K2 MAP2K2 MYPN MYPN RANGRF RANGRF SMAD3 SMAD3 TNNI3 TNNI3 ACTN2ACTN2 CAV1CAV1 DSG2 DSG2 GATAD1 GATAD1 KCNJ2 KCNJ2 MED12 MED12 NEBL NEBL RBM20 RBM20 SNTA1 SNTA1 TNNT2 TNNT2 ACVRL1ACVRL1 CAV3 CAV3 DSP DSP GLA GLA KCNJ5 KCNJ5 MYBPC3 MYBPC3 NEXN NEXN RIT1 RIT1 SOS1 SOS1 TPM1 TPM1 AKAP9AKAP9 CBS CBS DTNADTNA GPD1LGPD1L KCNJ8 KCNJ8 MYH6 MYH6 NKX2-5 NKX2-5 RYR2 RYR2 TAZTAZ TTNTTN ANK2ANK2 COL3A1COL3A1 EMD EMD HCN4 HCN4 KCNQ1 KCNQ1 MYH7 MYH7 NRAS NRAS SCN1B SCN1B TCAP TCAP TTR TTR ANKRD1ANKRD1 COL5A1 COL5A1 ENG ENG HRAS HRAS KRAS KRAS MYH11 MYH11 PDLIM3 PDLIM3 SCN3B SCN3B TGFB2 TGFB2 VCLVCL BAG3BAG3 COL5A2COL5A2 FBN1 FBN1 JPH2 JPH2 LAMA4 LAMA4 MYL2 MYL2 PKP2 PKP2 SCN4B SCN4B TGFBR1 TGFBR1 BMPR2BMPR2 CRYAB CRYAB FBN2 FBN2 JUP JUP LAMP2 LAMP2 MYL3 MYL3 PLN PLN SCN5A SCN5A TGFBR2 TGFBR2 BRAFBRAF CSRP3 CSRP3 FHL2 FHL2 KCNE1 KCNE1 LDB3 LDB3 MYLK MYLK PRKAG2 PRKAG2 SGCD SGCD TMEM43 TMEM43 *Please*Please note note that that deletion/duplication deletion/duplication analysis analysis is notis not completed completed for for all allgenes genes in thein the panel. panel. Some Some genes genes on on this this panel panel are are associated associated with with NeuromuscularComprehensiveNeuromuscularComprehensiveadditionaladditional phenotypes. phenotypes. Cardiovascular Cardiovascular Disorders Disorders AllAll genes genes on on the the next next generation generation sequencing sequencing panel panel may may be beordered ordered separately. separately. Genes Genes included included on onpanels panels are are subject subject to tochange. change. ComprehensiveComprehensive Cardiovascular Cardiovascular AboutAbout EGL EGL Genet Geneticsics EGLEGL Genetics Genetics specializes specializes in ingenetic genetic diagnostic diagnostic testing, testing, with with ne nearlyarly 50 50 years years of of clinical clinical experience experience and and board-certified board-certified labor laboratoryatory directorsdirectors and and genetic genetic counselors counselors reporting reporting out out cases. cases. EGL EGL Genet Geneticsics offers offers a combineda combined 1000 1000 molecular molecular genetics, genetics, biochemical biochemical ������������������ ��� ��� ������������ ������������ ����� ����� ����� ����� ��� ��� ���� ���� ��� ��� ������ ������ ���� ���������� ��� ��� ��� ��� ��������� ��������� �������� �������� ������ ������ ��� ��� �������� �������� with���with��� ������������� differing ������������� differing clinical clinical �������� �������� variability variability and and expressivity. expressivity. EquallyEmoryEquallyEmory Genetics important Genetics important Laboratory toLaboratory to improving improving offers offers patient patient the the careComprehensive careComprehensive through through quality quality Cardiovascular Cardiovascular gen geneticetic testing testing Panel Panel is toisthe toaidthe aidcontribution incontribution inthe the diagnosis diagnosis EGL EGL Geneticsof Genetics ofa avariety variety makes makes of of back back to to thecardiovascularthecardiovascular scientific scientific and conditions.and conditions. medical medical communities. This communities. This panel panel is isideal EGL ideal EGL Geneticsif Geneticstheif the causative causative is isone one ofgene of geneonly only is aisunknown few aunknown few clinical clinical and and diagnostic therefore diagnostic therefore laboratories single-gene laboratories single-gene analysisto analysisto openly openly will sharewill share dat dat a a withnotwithnot be the be thecost-effective. NCBIcost-effective. NCBI freely freely available Some available Some genes genespublic public on ondatabase this database this panel panel ClinVar areClinVar are associated associated(> (>35,000 35,000 with variants with variants addit addit onional on i>onal1700 > phenotypes.1700 phenotypes. genes) genes) and and is isalso also the the only only labo laboratoryratory with with a a freefree online online database database (EmVClass), (EmVClass), featuring featuring a varianta variant classific classificationation search search and and report report request request interface, interface, which which facilitates facilitates rapid rapid interactiveinteractive curation curation and and reporting reporting of of variants. variants. ComprehensiveComprehensive Cardiovascular Cardiovascular GenesGenes Included Included on on Comprehensive Comprehensive Cardiovascular Cardiovascular Panel* Panel* CardiovascularCardiovascularABCC9ABCC9 CACNA1C CACNA1C Diseases DiseasesDESDES FKTNFKTN KCNE2 KCNE2 LMNA LMNA MYLK2 MYLK2 PTPN11 PTPN11 SKI SKI TMPO TMPO CardiovascularCardiovascularACTA2ACTA2 CACNB2diseases CACNB2diseases are are DMDa DMD groupa group of of FLNAdisorders FLNAdisorders that KCNE3 that KCNE3 may may affect MAP2K1affect MAP2K1 the the heart MYOZ2heart MYOZ2 and and blood blood RAF1 RAF1vessels. vessels. SLC2A10 While SLC2A10While the the causes causes TNNC1 TNNC1 of of cardiovascularcardiovascular disease disease are are diverse, diverse, proportions proportions are are genetic genetic in inorigin. origin. These These disorders disorders may may occur occur as aspart part of ofa clinicala clinical spectrumspectrumACTC1ACTC1 associated associatedCASQ2CASQ2 with with a DSC2 particulara DSC2particular GAAgenetic GAAgenetic condition KCNH2condition KCNH2 or MAP2K2 or as MAP2K2 as an anisolated isolated MYPN MYPN finding. finding. RANGRF RANGRF The The mode mode SMAD3of SMAD3of inheritance inheritance TNNI3 is TNNI3 isalso also diverse diverse withwithACTN2 differingACTN2 differing clinical CAV1clinicalCAV1 variability variability DSG2 DSG2 and and expressivity. GATAD1 expressivity. GATAD1 KCNJ2 KCNJ2 MED12 MED12 NEBL NEBL RBM20 RBM20 SNTA1 SNTA1 TNNT2 TNNT2 ACVRL1ACVRL1 CAV3 CAV3 DSP DSP GLA GLA KCNJ5 KCNJ5 MYBPC3 MYBPC3 NEXN NEXN RIT1 RIT1 SOS1 SOS1 TPM1 TPM1 EGLEGL Genetics Genetics offers offers the the Comprehensive Comprehensive Cardiovascular Cardiovascular Panel Panel to toaid aid in inthe the diagnosis diagnosis of ofa avariety variety of ofcardiovascular cardiovascular AKAP9AKAP9 CBS CBS DTNADTNA GPD1LGPD1L KCNJ8 KCNJ8 MYH6 MYH6 NKX2-5 NKX2-5 RYR2 RYR2 TAZTAZ TTNTTN conditions.conditions. This This panel panel is isideal ideal if theif the causative causative gene gene is isunknow unknown andn and therefore therefore single-gene single-gene analysis analysis will will not not be be cost- cost- effective.effective.ANK2ANK2 Some SomeCOL3A1 genesCOL3A1 genes on on this EMDthis EMDpanel panel are are HCN4 associated HCN4 associated KCNQ1 with KCNQ1 with addit addit MYH7ional MYH7ional phenotypes. phenotypes. NRAS NRAS SCN1B SCN1B TCAP TCAP TTR TTR ANKRD1ANKRD1 COL5A1 COL5A1 ENG ENG HRAS HRAS KRAS KRAS MYH11 MYH11 PDLIM3 PDLIM3 SCN3B SCN3B TGFB2 TGFB2 VCLVCL BAG3BAG3 COL5A2COL5A2 FBN1 FBN1 JPH2 JPH2 LAMA4 LAMA4 MYL2 MYL2 PKP2 PKP2 SCN4B SCN4B TGFBR1 TGFBR1 BMPR2BMPR2 CRYAB CRYAB FBN2 FBN2GenesGenes Included Included JUP JUP on on LAMP2Comprehensive LAMP2Comprehensive MYL3 MYL3 Cardiovascular Cardiovascular PLN PLN Panel* SCN5A Panel* SCN5A TGFBR2 TGFBR2 ABCC9BRAFABCC9BRAF CACNA1C CSRP3 CACNA1C CSRP3 FHL2DES FHL2DES KCNE1FKTN KCNE1FKTN KCNE2 LDB3 KCNE2 LDB3 LMNA MYLK LMNA MYLK PRKAG2 MYLK2 PRKAG2 MYLK2 PTPN11 SGCD PTPN11 SGCD TMEM43 TMEM43 SKI SKI TMPO TMPO *Please*PleaseACTA2ACTA2 note note that CACNB2that deletion/duplicationCACNB2 deletion/duplication DMD DMD analysis analysis FLNA FLNAis notis not completed completed KCNE3 KCNE3 for for all MAP2K1allgenes MAP2K1genes in thein the panel. MYOZ2 panel. MYOZ2 Some Some genes genes RAF1 RAF1 on on this this panel SLC2A10panel SLC2A10 are are associated associated TNNC1 with TNNC1 with additionaladditional phenotypes. phenotypes.
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Genetic Mutations and Mechanisms in Dilated Cardiomyopathy
    Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, … , Jessica R. Golbus, Megan J. Puckelwartz J Clin Invest. 2013;123(1):19-26. https://doi.org/10.1172/JCI62862. Review Series Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of congestive heart failure. In hypertrophic cardiomyopathy (HCM), cardiac output is limited by the thickened myocardium through impaired filling and outflow. Mutations in the genes encoding the thick filament components myosin heavy chain and myosin binding protein C (MYH7 and MYBPC3) together explain 75% of inherited HCMs, leading to the observation that HCM is a disease of the sarcomere. Many mutations are “private” or rare variants, often unique to families. In contrast, dilated cardiomyopathy (DCM) is far more genetically heterogeneous, with mutations in genes encoding cytoskeletal, nucleoskeletal, mitochondrial, and calcium-handling proteins. DCM is characterized by enlarged ventricular dimensions and impaired systolic and diastolic function. Private mutations account for most DCMs, with few hotspots or recurring mutations. More than 50 single genes are linked to inherited DCM, including many genes that also link to HCM. Relatively few clinical clues guide the diagnosis of inherited DCM, but emerging evidence supports the use of genetic testing to identify those patients at risk for faster disease progression, congestive heart failure, and arrhythmia. Find the latest version: https://jci.me/62862/pdf Review series Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, Jessica R. Golbus, and Megan J. Puckelwartz Department of Human Genetics, University of Chicago, Chicago, Illinois, USA. Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of conges- tive heart failure.
    [Show full text]
  • Profiling Data
    Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8
    [Show full text]
  • Supplementary Table 1
    SI Table S1. Broad protein kinase selectivity for PF-2771. Kinase, PF-2771 % Inhibition at 10 μM Service Kinase, PF-2771 % Inhibition at 1 μM Service rat RPS6KA1 (RSK1) 39 Dundee AURKA (AURA) 24 Invitrogen IKBKB (IKKb) 26 Dundee CDK2 /CyclinA 21 Invitrogen mouse LCK 25 Dundee rabbit MAP2K1 (MEK1) 19 Dundee AKT1 (AKT) 21 Dundee IKBKB (IKKb) 16 Dundee CAMK1 (CaMK1a) 19 Dundee PKN2 (PRK2) 14 Dundee RPS6KA5 (MSK1) 18 Dundee MAPKAPK5 14 Dundee PRKD1 (PKD1) 13 Dundee PIM3 12 Dundee MKNK2 (MNK2) 12 Dundee PRKD1 (PKD1) 12 Dundee MARK3 10 Dundee NTRK1 (TRKA) 12 Invitrogen SRPK1 9 Dundee MAPK12 (p38g) 11 Dundee MAPKAPK5 9 Dundee MAPK8 (JNK1a) 11 Dundee MAPK13 (p38d) 8 Dundee rat PRKAA2 (AMPKa2) 11 Dundee AURKB (AURB) 5 Dundee NEK2 11 Invitrogen CSK 5 Dundee CHEK2 (CHK2) 11 Invitrogen EEF2K (EEF-2 kinase) 4 Dundee MAPK9 (JNK2) 9 Dundee PRKCA (PKCa) 4 Dundee rat RPS6KA1 (RSK1) 8 Dundee rat PRKAA2 (AMPKa2) 4 Dundee DYRK2 7 Dundee rat CSNK1D (CKId) 3 Dundee AKT1 (AKT) 7 Dundee LYN 3 BioPrint PIM2 7 Invitrogen CSNK2A1 (CKIIa) 3 Dundee MAPK15 (ERK7) 6 Dundee CAMKK2 (CAMKKB) 1 Dundee mouse LCK 5 Dundee PIM3 1 Dundee PDPK1 (PDK1) (directed 5 Invitrogen rat DYRK1A (MNB) 1 Dundee RPS6KB1 (p70S6K) 5 Dundee PBK 0 Dundee CSNK2A1 (CKIIa) 4 Dundee PIM1 -1 Dundee CAMKK2 (CAMKKB) 4 Dundee DYRK2 -2 Dundee SRC 4 Invitrogen MAPK12 (p38g) -2 Dundee MYLK2 (MLCK_sk) 3 Invitrogen NEK6 -3 Dundee MKNK2 (MNK2) 2 Dundee RPS6KB1 (p70S6K) -3 Dundee SRPK1 2 Dundee AKT2 -3 Dundee MKNK1 (MNK1) 2 Dundee RPS6KA3 (RSK2) -3 Dundee CHEK1 (CHK1) 2 Invitrogen rabbit MAP2K1 (MEK1) -4 Dundee
    [Show full text]
  • Dilated Cardiomyopathy Caused by Truncating Titin Variants
    BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Med Genet Dilated cardiomyopathy caused by truncating titin variants – Long-term outcomes, arrhythmias, response to treatment and sex differences SUPPLEMENTARY MATERIAL Christoffer Rasmus Vissing1*, MD; Torsten Bloch Rasmussen2, MD, PhD; Anne Mette Dybro2, MD; Morten Salling Olesen3,4, MSc, PhD; Lisbeth Nørum Pedersen5; MSc, PhD; Morten Jensen, MD, PhD2; Henning Bundgaard1, MD, DMSc; Alex Hørby Christensen1,6 MD, PhD 1The Capital Region’s Unit for Inherited Cardiac Diseases, Department of Cardiology, Rigshospitalet, Copenhagen University Hospital, Copenhagen, Denmark 2Department of Cardiology, Aarhus University Hospital, Aarhus, Denmark 3Laboratory for Molecular Cardiology, University of Copenhagen, Copenhagen, Denmark 4Department of Biomedical Sciences, University of Copenhagen, Copenhagen, 2200 N, Denmark 5Department of Molecular Medicine, Aarhus University Hospital, Denmark. 6Department of Cardiology, Herlev-Gentofte Hospital, Copenhagen University Hospital, Copenhagen, Denmark *Corresponding author: Christoffer Rasmus Vissing, MD The Capital Region’s Unit for Inherited Cardiac Diseases, Department of Cardiology, The Heart Center, Rigshospitalet, Copenhagen University Hospital, Blegdamsvej 9, DK-2100 Copenhagen, Denmark, E-mail: [email protected]; Phone +45 3545 5045 1 Vissing CR, et al. J Med Genet 2020;0:1–10.
    [Show full text]
  • Early During Myelomagenesis Alterations in DNA Methylation That
    Myeloma Is Characterized by Stage-Specific Alterations in DNA Methylation That Occur Early during Myelomagenesis This information is current as Christoph J. Heuck, Jayesh Mehta, Tushar Bhagat, Krishna of September 23, 2021. Gundabolu, Yiting Yu, Shahper Khan, Grigoris Chrysofakis, Carolina Schinke, Joseph Tariman, Eric Vickrey, Natalie Pulliam, Sangeeta Nischal, Li Zhou, Sanchari Bhattacharyya, Richard Meagher, Caroline Hu, Shahina Maqbool, Masako Suzuki, Samir Parekh, Frederic Reu, Ulrich Steidl, John Greally, Amit Verma and Seema B. Downloaded from Singhal J Immunol 2013; 190:2966-2975; Prepublished online 13 February 2013; doi: 10.4049/jimmunol.1202493 http://www.jimmunol.org/content/190/6/2966 http://www.jimmunol.org/ Supplementary http://www.jimmunol.org/content/suppl/2013/02/13/jimmunol.120249 Material 3.DC1 References This article cites 38 articles, 15 of which you can access for free at: http://www.jimmunol.org/content/190/6/2966.full#ref-list-1 by guest on September 23, 2021 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc.
    [Show full text]
  • Geneseq®: Cardio
    LabCorp GeneSeq®: Cardio Helping you provide better patient care Testing for more than 100 genetic causes of familial cardiac disease. Treatment That May Help Clinical Utility Familial cardiac diseases are associated with up to 80% • Establish/confirm a diagnosis of familial cardiac disease. of cases of sudden cardiac death in young patients.1 • Identify the need for regular cardiac screening, lifestyle Identification of individuals with pathogenic mutations in changes, or pharmacological or surgical intervention to genes associated with cardiac disease may allow timely prevent the progression of cardiac disease and secondary initiation of screening and treatment that may help prevent complications. myocardial infarction, stroke, and sudden cardiac death. • Identify first-degree relatives of the proband who have inherited a disease-causing genetic variant and may be GeneSeq: Cardio at risk for myocardial infarction, stroke, or sudden cardiac death. can be a useful prognostic tool in the presence of a positive • Facilitate appropriate genetic counseling for probands family history and symptoms of cardiomyopathy, arrhythmia, and their first-degree relatives. aortopathy, Noonan syndrome, RASopathies, congenital heart disease, early-onset coronary artery disease, or familial hypercholesterolemia. Sample Requirements • 10 mL whole blood or 30 mL if ordering multiple tests. Six indications for testing, available separately or in combination Test No. Test Name Genes Included In the Profile 451422 GeneSeq®: Cardio - Familial Cardiomyopathy Profile
    [Show full text]
  • MYLK2, Active MYLK2, Active
    Catalogue # Aliquot Size M63-10H-05 5 µg M63-10H-10 10 µg M63-10H-20 20 µg MYLK2, Active Full-length recombinant protein expressed in Sf9 cells Catalog # M63-10H Lot # E1 65-4 Product Description Specific Activity Recombinant full-length human MYLK2 was expressed by baculovirus in Sf9 insect cells using an N-terminal His tag. 84,000 The gene accession number is NM_033118 . 63,000 Gene Aliases 42,000 skMLCK, KMLC, MLCK, MLCK2 21,000 (cpm) Activity Formulation 0 0 10 20 30 40 Protein (ng) Recombinant protein stored in 50mM sodium phosphate, pH 7.0, 300mM NaCl, 150mM imidazole, 0.1mM PMSF, The specific activity of MYLK2 was determined to be 238 0.25mM DTT, 25% glycerol. nmol/min/mg as per activity assay protocol. Storage and Stability Purity Store product at –70 oC. For optimal storage, aliquot target into smaller quantities after centrifugation and store at recommended temperature. For most favorable performance, avoid repeated handling and multiple The purity of MYLK2 was freeze/thaw cycles. determined to be >85% by densitometry. Scientific Background Approx. MW 74kDa . MYLK2 is a member of the myosin light chain kinase family and is a calcium/calmodulin dependent enzyme that is exclusively expressed in adult skeletal muscle (1). MYLK2 has been proposed to participate in signaling pathways (calcium signaling pathway, focal adhesion, regulation of actin cytoskeleton) and cellular processes MYLK2, Active (neuromuscular synaptic transmission, protein/amino acid Full-length recombinant human protein expressed in Sf9 cells phosphorylation). MYLK2 is involved in multiple molecular functions as a result of various subdomains that Catalog Number M63-10H participate in ATP binding, calmodulin binding, Specific Activity 238 nmol/min/mg nucleotide binding, protein serine/threonine kinase Specific Lot Number E165-4 activity and transferase activity) (2).
    [Show full text]
  • The Role of Genetics in Cardiomyopaties: a Review Luis Vernengo and Haluk Topaloglu
    Chapter The Role of Genetics in Cardiomyopaties: A Review Luis Vernengo and Haluk Topaloglu Abstract Cardiomyopathies are defined as disorders of the myocardium which are always associated with cardiac dysfunction and are aggravated by arrhythmias, heart failure and sudden death. There are different ways of classifying them. The American Heart Association has classified them in either primary or secondary cardiomyopathies depending on whether the heart is the only organ involved or whether they are due to a systemic disorder. On the other hand, the European Society of Cardiology has classified them according to the different morphological and functional phenotypes associated with their pathophysiology. In 2013 the MOGE(S) classification started to be published and clinicians have started to adopt it. The purpose of this review is to update it. Keywords: cardiomyopathy, primary and secondary cardiomyopathies, sarcomeric genes 1. Introduction Cardiomyopathies can be defined as disorders of the myocardium associated with cardiac dysfunction and which are aggravated by arrhythmias, heart failure and sudden death [1]. The aim of this chapter is focused on updating and reviewing cardiomyopathies. In 1957, Bridgen coined the word “cardiomyopathy” for the first time and in 1958, the British pathologist Teare reported nine cases of septum hypertrophy [2]. Genetics has played a key role in the understanding of these disorders. In general, the overall prevalence of cardiomyopathies in the world population is 3%. The genetic forms of cardiomyopathies are characterized by both locus and allelic heterogeneity. The mutations of the genes which encode for a variety of proteins of the sarcomere, cytoskeleton, nuclear envelope, sarcolemma, ion channels and intercellular junctions alter many pathways and cellular structures affecting in a negative form the mechanism of muscle contraction and its function, and the sensi- tivity of ion channels to electrolytes, calcium homeostasis and how mechanic force in the myocardium is generated and transmitted [3, 4].
    [Show full text]
  • MYLK2 Kinase
    MYLK2 Kinase Store at -80°C n3 5 µg Orders n 877-616-CELL (2355) [email protected] Support n 877-678-TECH (8324) [email protected] Web n www.cellsignal.com New 11/06 #7498 This product is for in vitro research use only and is not intended for use in humans or animals. Description: Purified recombinant full length human Source/Purification: The GST-Kinase fusion protein was Storage: Enzyme is supplied in 50 mM Tris-HCl, pH 7.5; MYLK2 (Met1-Val596) kinase, supplied as a GST fusion produced using a baculovirus expression system with a 150 mM NaCl, 0.25 mM DTT, 0.1 mM EGTA, 0.1 mM EDTA, protein. construct expressing full length human MYLK2 (Met1- 0.1 mM PMSF, 25% glycerol, 7 mM glutathione. Val596) (GenBank Accession No. NM_033118.2) with an Store at –80°C. Background: Myosin light chain kinases (MYLKs) are amino-terminal GST tag. The protein was purified by one- Ca2+/calmodulin-dependent protein kinases that regulate Keep on ice during use. step affinity chromatography using GSH-agarose. myosin motor activities through phosphorylation of myosin Avoid repeated freeze-thaw cycles. regulatory light chain (RLC). This phosphorylation increases Quality Control: The theoretical molecular weight of the the actin-activated myosin ATPase activity and is thought GST-MYLK2 fusion protein is 95 kDa. The purified kinase Companion Products: to play major roles in a number of biological processes, was quality controlled for purity using SDS-PAGE followed Serine/Threonine Kinase Substrate Screening Kit #7400 including cell spreading and migration, transepithelial by Coomassie stain [Fig.1].
    [Show full text]
  • Skeletal Muscle Gene Expression in Long-Term Endurance and Resistance Trained Elderly
    International Journal of Molecular Sciences Article Skeletal Muscle Gene Expression in Long-Term Endurance and Resistance Trained Elderly 1,2, 3, 1,2, Alessandra Bolotta y, Giuseppe Filardo y, Provvidenza Maria Abruzzo *, Annalisa Astolfi 4,5 , Paola De Sanctis 1, Alessandro Di Martino 6, Christian Hofer 7, Valentina Indio 4 , Helmut Kern 7, Stefan Löfler 7 , Maurilio Marcacci 8, Sandra Zampieri 9,10, 1,2, 1, Marina Marini z and Cinzia Zucchini z 1 Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna School of Medicine, 40138 Bologna, Italy; [email protected] (A.B.); [email protected] (P.D.S.); [email protected] (M.M.); [email protected] (C.Z.) 2 IRCCS Fondazione Don Carlo Gnocchi, 20148 Milan, Italy 3 Applied and Translational Research Center, IRCCS Istituto Ortopedico Rizzoli, 40136 Bologna, Italy; g.fi[email protected] 4 Giorgio Prodi Interdepartimental Center for Cancer Research, S.Orsola-Malpighi Hospital, 40138 Bologna, Italy; annalisa.astolfi@unibo.it (A.A.); [email protected] (V.I.) 5 Department of Morphology, Surgery and Experimental Medicine, University of Ferrara, 44121 Ferrara, Italy 6 Second Orthopaedic and Traumatologic Clinic, IRCCS Istituto Ortopedico Rizzoli, 40136 Bologna, Italy; [email protected] 7 Ludwig Boltzmann Institute for Rehabilitation Research, 1160 Wien, Austria; [email protected] (C.H.); [email protected] (H.K.); stefan.loefl[email protected] (S.L.) 8 Department of Biomedical Sciences, Knee Joint Reconstruction Center, 3rd Orthopaedic Division, Humanitas Clinical Institute, Humanitas University, 20089 Milan, Italy; [email protected] 9 Department of Surgery, Oncology and Gastroenterology, University of Padua, 35122 Padua, Italy; [email protected] 10 Department of Biomedical Sciences, University of Padua, 35131 Padua, Italy * Correspondence: [email protected]; Tel.: +39-051-2094122 These authors contributed equally to this work.
    [Show full text]
  • Cardiovascular Diseases Genetic Testing Program Information
    Cardiovascular Diseases Genetic Testing Program Description: Congenital Heart Disease Panels We offer comprehensive gene panels designed to • Congenital Heart Disease Panel (187 genes) diagnose the most common genetic causes of hereditary • Heterotaxy Panel (114 genes) cardiovascular diseases. Testing is available for congenital • RASopathy/Noonan Spectrum Disorders Panel heart malformation, cardiomyopathy, arrythmia, thoracic (31 genes) aortic aneurysm, pulmonary arterial hypertension, Marfan Other Panels syndrome, and RASopathy/Noonan spectrum disorders. • Pulmonary Arterial Hypertension (PAH) Panel Hereditary cardiovascular disease is caused by variants in (20 genes) many different genes, and may be inherited in an autosomal dominant, autosomal recessive, or X-linked manner. Other Indications: than condition-specific panels, we also offer single gene Panels: sequencing for any gene on the panels, targeted variant • Confirmation of genetic diagnosis in a patient with analysis, and targeted deletion/duplication analysis. a clinical diagnosis of cardiovascular disease Tests Offered: • Carrier or pre-symptomatic diagnosis identification Arrythmia Panels in individuals with a family history of cardiovascular • Comprehensive Arrhythmia Panel (81 genes) disease of unknown genetic basis • Atrial Fibrillation (A Fib) Panel (28 genes) Gene Specific Sequencing: • Atrioventricular Block (AV Block) Panel (7 genes) • Confirmation of genetic diagnosis in a patient with • Brugada Syndrome Panel (21 genes) cardiovascular disease and in whom a specific
    [Show full text]