DOCSLIB.ORG

Characterization of the Small Molecule Kinase Inhibitor SU11248 (Sunitinib/ SUTENT in Vitro and in Vivo

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Characterization of the Small Molecule Kinase Inhibitor SU11248 (Sunitinib/ SUTENT in Vitro and in Vivo TECHNISCHE UNIVERSITÄT MÜNCHEN Lehrstuhl für Genetik Characterization of the Small Molecule Kinase Inhibitor SU11248 (Sunitinib/ SUTENT in vitro and in vivo - Towards Response Prediction in Cancer Therapy with Kinase Inhibitors Michaela Bairlein Vollständiger Abdruck der von der Fakultät Wissenschaftszentrum Weihenstephan für Ernährung, Landnutzung und Umwelt der Technischen Universität München zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften genehmigten Dissertation. Vorsitzender: Univ. -Prof. Dr. K. Schneitz Prüfer der Dissertation: 1. Univ.-Prof. Dr. A. Gierl 2. Hon.-Prof. Dr. h.c. A. Ullrich (Eberhard-Karls-Universität Tübingen) 3. Univ.-Prof. A. Schnieke, Ph.D. Die Dissertation wurde am 07.01.2010 bei der Technischen Universität München eingereicht und durch die Fakultät Wissenschaftszentrum Weihenstephan für Ernährung, Landnutzung und Umwelt am 19.04.2010 angenommen. FOR MY PARENTS 1 Contents 2 Summary ................................................................................................................................................................... 5 3 Zusammenfassung .................................................................................................................................................... 6 4 Introduction .............................................................................................................................................................. 8 4.1 Cancer ............................................................................................................................................................... 8 4.1.1 The hallmarks of cancer ........................................................................................................................... 8 4.2 Protein kinases and cancer .............................................................................................................................. 11 4.3 Protein kinase inhibitors in targeted cancer therapy ........................................................................................ 18 4.3.1 Classes of small-molecule protein tyrosine kinase inhibitors ................................................................. 22 4.3.2 Multi-targeted small-molecule protein kinase inhibitors ........................................................................ 24 4.4 Sunitinib malate .............................................................................................................................................. 24 4.5 A closer look at targeted cancer therapy and small-molecule kinase inhibitors .............................................. 27 4.5.1 The advantages and drawbacks of targeted cancer therapy with kinase inhibitors ................................. 27 4.5.2 Challenges for multi-targeted kinase inhibitors ...................................................................................... 28 4.5.3 Drug resistance –single versus multi-targeted small-molecule protein kinase inhibitors ....................... 28 4.6 Drug discovery of selective kinase inhibitors.................................................................................................. 30 5 Aims of this PhD thesis .......................................................................................................................................... 32 6 Materials and Methods .......................................................................................................................................... 34 6.1 Materials .......................................................................................................................................................... 34 6.1.1 Laboratory chemicals, biochemicals and inhibitors ............................................................................... 34 6.1.2 Chemicals for SILAC and MS-analysis .................................................................................................. 34 6.1.3 Enzymes .................................................................................................................................................. 35 6.1.4 “Kits“ and other materials ..................................................................................................................... 35 6.1.5 Growth factors and ligands .................................................................................................................... 35 6.2 Media .............................................................................................................................................................. 35 6.2.1 Bacterial media ...................................................................................................................................... 35 6.2.2 Cell culture media .................................................................................................................................. 35 6.3 Stock solutions and commonly used buffers ................................................................................................... 36 6.4 Cells ................................................................................................................................................................ 36 6.4.1 Eukaryotic cell lines ............................................................................................................................... 36 6.5 Antibodies and recombinant proteins .............................................................................................................. 38 6.5.1 Primary antibodies ................................................................................................................................. 38 6.5.2 Secondary antibodies .............................................................................................................................. 38 6.6 Oligonucleotides ............................................................................................................................................. 38 6.6.1 siRNA oligonucleotides .......................................................................................................................... 38 6.7 Methods ........................................................................................................................................................... 39 6.7.1 Cellular Assays ....................................................................................................................................... 39 6.7.2 Affinity chromatography and mass spectrometry ................................................................................... 40 6.7.3 Molecular methods ................................................................................................................................. 42 7 Results ..................................................................................................................................................................... 44 7.1 Profiling of SU11248 activity in cancer cells .................................................................................................. 44 7.1.1 Effect of SU11248 on cancer cell proliferation ...................................................................................... 44 7.1.2 Effect of SU11248 on cancer cell apoptosis and cell cycle distribution ................................................. 52 7.1.3 Effect of SU11248 on cancer cell migration and invasion ..................................................................... 56 7.1.4 Morphological changes of cancer cells after SU11248 treatment .......................................................... 60 7.2 Target-selectivity profiling of SU11248 in cancer cell lines and metastatic renal cell carcinoma (mRCC) tumors ................................................................................................................................................................. 62 7.2.1 Workflow of drug target profiling by affinity chromatography and mass spectrometry ........................ 63 7.2.2 Target identification and functional classification of SU11248 protein interaction partners ................. 65 7.3 Binding-affinity-analysis of SU11248 towards qualitatively identified cellular targets ................................. 72 7.4 Quantification of target-dissociation constants directly from cells ................................................................. 82 7.4.1 Workflow of target affinity measurement based on quantitative mass spectrometry combined with affinity purification experiments ............................................................................................................ 82 7.5 In vitro binding studies and cellular kinase assays .......................................................................................... 87 7.6 Quantification of relative target amount binding to SU11248 in sensitive and insensitive cell lines ................. ......................................................................................................................................................................... 89 7.7 Gene expression analysis of SU11248 sensitive and less responsive cancer cell lines of different cancer types .. ......................................................................................................................................................................... 93 7.8 Phosphoproteomic analysis of cancer cell lines treated with SU11248 .........................................................
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Recombinant MAP2K2 Protein
    Recombinant MAP2K2 protein Catalog No: 81332, 81632 Quantity: 20, 1000 µg Expressed In: Baculovirus Concentration: 0.3 µg/µl Source: Human Buffer Contents: Recombinant MAP2K2 protein is supplied in 25 mM HEPES-NaOH pH 7.5, 300 mM NaCl, 10% glycerol, 0.04% Triton X-100, and 0.5 mM TCEP. Background: MAP2K2 (Mitogen-Activated Protein Kinase Kinase Kinase 2) is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase plays a critical role in mitogen growth factor signal transduction. It phosphorylates and activates MAPK1/ERK2 and MAPK2/ERK3. The activation of this kinase itself is dependent on the Ser/Thr phosphorylation by MAP kinase kinase kinases. Mutations in this gene cause cardiofaciocutaneous syndrome (CFC syndrome), a disease characterized by heart defects, cognitive disability, and distinctive facial features similar to those found in Noonan syndrome. Protein Details: Recombinant MAP2K2 protein was expressed in baculovirus expression system as the full length protein (accession number NP_109587.1) with a N-terminal FLAG Tag. The molecular weight of the protein is 45.7 kDa. Application Notes: This product was manufactured as described in Protein Details. Where possible, Active Motif has developed functional or activity assays for Recombinant MAP2K2 protein gel recombinant proteins. Additional characterization such as enzyme kinetic activity 10% SDS-PAGE with Coomassie blue assays, inhibitor screening or other biological activity assays may not have been staining MW: 45.7 kDa performed for every product. All available data for a given product is shown on the lot- Purity: >90% specific Technical Data Sheet. Storage and Guarantee: Recombinant proteins in solution are temperature sensitive and must be stored at -80°C to prevent degradation.
    [Show full text]
  • Significant Shortest Paths for the Detection of Putative Disease Modules
    bioRxiv preprint doi: https://doi.org/10.1101/2020.04.01.019844; this version posted April 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. SIGNIFICANT SHORTEST PATHS FOR THE DETECTION OF PUTATIVE DISEASE MODULES Daniele Pepe1 1Department of Oncology, KU Leuven, LKI–Leuven Cancer Institute, Leuven, Belgium Email address: DP: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.04.01.019844; this version posted April 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Keywords Structural equation modeling, significant shortest paths, pathway analysis, disease modules. Abstract Background The characterization of diseases in terms of perturbated gene modules was recently introduced for the analysis of gene expression data. Some approaches were proposed in literature, but many times they are inductive approaches. This means that starting directly from data, they try to infer key gene networks potentially associated to the biological phenomenon studied. However they ignore the biological information already available to characterize the gene modules. Here we propose the detection of perturbed gene modules using the combination of data driven and hypothesis-driven approaches relying on biological metabolic pathways and significant shortest paths tested by structural equation modeling.
    [Show full text]
  • GSK3 Is a Negative Regulator of the Thermogenic Program in Brown Adipocytes
    GSK3 is a negative regulator of the thermogenic program in brown adipocytes Markussen, Lasse K.; Winther, Sally; Wicksteed, Barton; Hansen, Jacob B. Published in: Scientific Reports DOI: 10.1038/s41598-018-21795-y Publication date: 2018 Document version Publisher's PDF, also known as Version of record Document license: CC BY Citation for published version (APA): Markussen, L. K., Winther, S., Wicksteed, B., & Hansen, J. B. (2018). GSK3 is a negative regulator of the thermogenic program in brown adipocytes. Scientific Reports, 8, 1-12. [3469]. https://doi.org/10.1038/s41598- 018-21795-y Download date: 01. okt.. 2021 www.nature.com/scientificreports OPEN GSK3 is a negative regulator of the thermogenic program in brown adipocytes Received: 16 January 2017 Lasse K. Markussen1, Sally Winther1, Barton Wicksteed2 & Jacob B. Hansen 1 Accepted: 9 February 2018 Brown adipose tissue is a promising therapeutic target in metabolic disorders due to its ability to Published: xx xx xxxx dissipate energy and improve systemic insulin sensitivity and glucose homeostasis. β-Adrenergic stimulation of brown adipocytes leads to an increase in oxygen consumption and induction of a thermogenic gene program that includes uncoupling protein 1 (Ucp1) and fbroblast growth factor 21 (Fgf21). In kinase inhibitor screens, we have identifed glycogen synthase kinase 3 (GSK3) as a negative regulator of basal and β-adrenergically stimulated Fgf21 expression in cultured brown adipocytes. In addition, inhibition of GSK3 also caused increased Ucp1 expression and oxygen consumption. β-Adrenergic stimulation triggered an inhibitory phosphorylation of GSK3 in a protein kinase A (PKA)- dependent manner. Mechanistically, inhibition of GSK3 activated the mitogen activated protein kinase (MAPK) kinase 3/6-p38 MAPK-activating transcription factor 2 signaling module.
    [Show full text]
  • Discovery of the Novel Autophagy Inhibitor Aumitin That Targets Mitochondrial Complex I
    Electronic Supplementary Material (ESI) for Chemical Science. This journal is © The Royal Society of Chemistry 2018 Discovery of the novel autophagy inhibitor Aumitin that targets mitochondrial complex I Lucas Robkea,b,c, Yushi Futamurad, Georgios Konstantinidise, Julian Wilkea,b, Harumi Aonod, Zhwan Mahmoudb, Nobumoto Watanabec,f, Yao-Wen Wue, Hiroyuki Osadac,d, Luca Laraiaa,g *, Herbert Waldmanna,b * a: Max-Planck-Institute of Molecular Physiology, department of Chemical Biology, Otto-Hahn-Str. 11, 44227 Dortmund (Germany); b: Faculty of Chemistry and Chemical Biology, TU Dortmund University, Otto-Hahn-Str. 4a, 44227 Dortmund (Germany); c: RIKEN-Max Planck Joint Research Division for Systems Chemical Biology, RIKEN CSRS, 2-1, Hirosawa, Wako, Saitama 351-0198 (Japan); d: Chemical Biology Research Group, RIKEN CSRS, 2-1, Hirosawa, Wako, Saitama 351-0198 (Japan); e: Chemical Genomics Centre of the Max-Planck-Society, Otto- Hahn-Str. 15, 44227 Dortmund (Germany); f: Bio-Active Compounds Discovery Research Unit, RIKEN CSRS, 2-1, Hirosawa, Wako, Saitama 351-0198 (Japan). g: present address: Department of Chemistry, Technical University of Denmark, Kemitorvet Building 207, Room 124, 2800 Kgs. Lyngby, Denmark. * [email protected], [email protected] SI-Table 1: Structure activity relationship of the di-aminopyrimidines. Starvation = starvation induced autophagy assay; Rapamycin = Rapamycin induced autophagy assay; Viability = survival assessed by means of an ADP-glow assay. > 10 = no inhibition at a test concentration of 10
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Map2k1 and Map2k2 Genes Contribute to the Normal Development of Syncytiotrophoblasts During Placentation
    RESEARCH ARTICLE 1363 Development 136, 1363-1374 (2009) doi:10.1242/dev.031872 Map2k1 and Map2k2 genes contribute to the normal development of syncytiotrophoblasts during placentation Valérie Nadeau*, Stéphanie Guillemette*, Louis-François Bélanger, Olivier Jacob, Sophie Roy and Jean Charron† The mammalian genome contains two ERK/MAP kinase kinase genes, Map2k1 and Map2k2, which encode dual-specificity kinases responsible for ERK/MAP kinase activation. In the mouse, loss of Map2k1 function causes embryonic lethality, whereas Map2k2 mutants survive with a normal lifespan, suggesting that Map2k1 masks the phenotype due to the Map2k2 mutation. To uncover the specific function of MAP2K2 and the threshold requirement of MAP2K proteins during embryo formation, we have successively ablated the Map2k gene functions. We report here that Map2k2 haploinsufficiency affects the normal development of placenta in the absence of one Map2k1 allele. Most Map2k1+/–Map2k2+/– embryos die during gestation because of placenta defects restricted to extra-embryonic tissues. The impaired viability of Map2k1+/–Map2k2+/– embryos can be rescued when the Map2k1 deletion is restricted to the embryonic tissues. The severity of the placenta phenotype is dependent on the number of Map2k mutant alleles, the deletion of the Map2k1 allele being more deleterious. Moreover, the deletion of one or both Map2k2 alleles in the context of one null Map2k1 allele leads to the formation of multinucleated trophoblast giant (MTG) cells. Genetic experiments indicate that these structures are derived from Gcm1-expressing syncytiotrophoblasts (SynT), which are affected in their ability to form the uniform SynT layer II lining the maternal sinuses. Thus, even though Map2k1 plays a predominant role, these results enlighten the function of Map2k2 in placenta development.
    [Show full text]
  • And Cisplatin-Resistant Ovarian Cancer
    Vol. 2, 607–610, July 2003 Molecular Cancer Therapeutics 607 Alchemix: A Novel Alkylating Anthraquinone with Potent Activity against Anthracycline- and Cisplatin-resistant Ovarian Cancer Klaus Pors, Zennia Paniwnyk, mediated stabilization of the topo II-DNA-cleavable complex Paul Teesdale-Spittle,1 Jane A. Plumb, and resulting in inhibition of poststrand passage DNA religa- Elaine Willmore, Caroline A. Austin, and tion (1). This event is not lethal per se but initiates a cascade 2 Laurence H. Patterson of events leading to cell death (2). Anthraquinones, as ex- Department of Pharmaceutical and Biological Chemistry, The School of emplified by mitoxantrone, are topo II inhibitors with proven Pharmacy, University of London, London WC1N 1AX, United Kingdom [K. P., L. H. P.]; Department of Pharmacy, De Montfort University, success for the treatment of advanced breast cancer, non- Leicester LE1 9BH, United Kingdom [Z. P., P. T. S.]; Cancer Research Hodgkin’s lymphoma, and acute leukemia (3). Intercalation is UK Department of Medical Oncology, University of Glasgow, Glasgow a crucial part of topo II inhibition by cytotoxic anthraquinones G61 1BD, United Kingdom [J. A. P.]; and School of Cell and Molecular Biosciences, The Medical School, University of Newcastle upon Tyne, with high affinity for DNA (4). It is likely that the potent Newcastle upon Tyne NE2 4HH, United Kingdom [E. W., C. A. A.] cytotoxicity of anthraquinones is related to their slow rate of dissociation from DNA, the kinetics of which favors long- term trapping of the topo-DNA complexes (5). However, Abstract currently available DNA intercalators at best promote a tran- Chloroethylaminoanthraquinones are described with sient inhibition of topo II, because the topo-drug-DNA ter- intercalating and alkylating capacity that potentially nary complex is reversed by removal of the intracellular drug covalently cross-link topoisomerase II (topo II) to DNA.
    [Show full text]
  • Coupling of Autism Genes to Tissue-Wide Expression and Dysfunction of Synapse, Calcium Signalling and Transcriptional Regulation
    PLOS ONE RESEARCH ARTICLE Coupling of autism genes to tissue-wide expression and dysfunction of synapse, calcium signalling and transcriptional regulation 1 2,3 4 1,5 Jamie ReillyID *, Louise Gallagher , Geraldine Leader , Sanbing Shen * 1 Regenerative Medicine Institute, School of Medicine, Biomedical Science Building, National University of a1111111111 Ireland (NUI) Galway, Galway, Ireland, 2 Discipline of Psychiatry, School of Medicine, Trinity College Dublin, Dublin, Ireland, 3 Trinity Translational Medicine Institute, Trinity Centre for Health SciencesÐTrinity College a1111111111 Dublin, St. James's Hospital, Dublin, Ireland, 4 Irish Centre for Autism and Neurodevelopmental Research a1111111111 (ICAN), Department of Psychology, National University of Ireland (NUI) Galway, Galway, Ireland, a1111111111 5 FutureNeuro Research Centre, Royal College of Surgeons in Ireland (RCSI), Dublin, Ireland a1111111111 * [email protected] (JR); [email protected] (SS) Abstract OPEN ACCESS Citation: Reilly J, Gallagher L, Leader G, Shen S Autism Spectrum Disorder (ASD) is a heterogeneous disorder that is often accompanied (2020) Coupling of autism genes to tissue-wide with many co-morbidities. Recent genetic studies have identified various pathways from expression and dysfunction of synapse, calcium hundreds of candidate risk genes with varying levels of association to ASD. However, it is signalling and transcriptional regulation. PLoS ONE unknown which pathways are specific to the core symptoms or which are shared by the co- 15(12): e0242773. https://doi.org/10.1371/journal. pone.0242773 morbidities. We hypothesised that critical ASD candidates should appear widely across dif- ferent scoring systems, and that comorbidity pathways should be constituted by genes Editor: Nirakar Sahoo, The University of Texas Rio Grande Valley, UNITED STATES expressed in the relevant tissues.
    [Show full text]
  • The Genetic Landscape of Clinical Resistance to RAF Inhibition in Metastatic Melanoma
    CD-13-0617_PAP.indd Page OF1 19/11/13 9:36 PM user-f028 /Books-Arts/JOURNAL-Cancer%20Discovery/01-JAN-Issue-2014/PAP Published OnlineFirst November 21, 2013; DOI: 10.1158/2159-8290.CD-13-0617 RESEARCH ARTICLE The Genetic Landscape of Clinical Resistance to RAF Inhibition in Metastatic Melanoma Eliezer M. Van Allen 1 , 3 , Nikhil Wagle 1 , 3 , Antje Sucker 5 , 6 , Daniel J. Treacy 1 , Cory M. Johannessen 3 , Eva M. Goetz 1 , Chelsea S. Place 1 , 3 , Amaro Taylor-Weiner 3 , Steven Whittaker 3 , Gregory V. Kryukov 3 , Eran Hodis 1 , 3,4 , Mara Rosenberg 3 , Aaron McKenna 3 , 15 , Kristian Cibulskis 3 , Deborah Farlow 3 , Lisa Zimmer 5 , 6 , Uwe Hillen 5 , 6 , Ralf Gutzmer 8 , Simone M. Goldinger 16 , Selma Ugurel 9 , Helen J. Gogas 17 , Friederike Egberts 10 , Carola Berking 6 , 11 , Uwe Trefzer 6 , 12 , Carmen Loquai 6 , 13 , Benjamin Weide 6 , 14 , Jessica C. Hassel 6 , 7 , Stacey B. Gabriel 3 , Scott L. Carter 3 , Gad Getz 2 , 3 , Levi A. Garraway 1 , 3 , and Dirk Schadendorf 5 , 6 on behalf of the Dermatologic Cooperative Oncology Group of Germany (DeCOG) Downloaded from cancerdiscovery.aacrjournals.org on September 25, 2021. © 2013 American Association for Cancer Research. CD-13-0617_PAP.indd Page OF2 19/11/13 9:36 PM user-f028 /Books-Arts/JOURNAL-Cancer%20Discovery/01-JAN-Issue-2014/PAP Published OnlineFirst November 21, 2013; DOI: 10.1158/2159-8290.CD-13-0617 ABSTRACT Most patients with BRAF V600 -mutant metastatic melanoma develop resistance to selective RAF kinase inhibitors. The spectrum of clinical genetic resistance mechanisms to RAF inhibitors and options for salvage therapy are incompletely understood.
    [Show full text]
  • Profiling Data
    Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8
    [Show full text]